Searching for a Salamander: Distribution and Habitat of the Common Mudpuppy
(Necturus maculosus) in Southeast Ohio Using Environmental DNA
A thesis presented to
the faculty of
the Voinovich School of Leadership and Public Affairs of Ohio University
In partial fulfillment
of the requirements for the degree
Master of Science
Merri K. Collins
August 2017
© 2017 Merri K. Collins. All Rights Reserved. 2
This thesis titled
Searching for a Salamander: Distribution and Habitat of the Common Mudpuppy
(Necturus maculosus) in Southeast Ohio Using Environmental DNA
by
MERRI K. COLLINS
has been approved for
the Program of Environmental Studies
and the Voinovich School of Leadership and Public Affairs by
Shawn R. Kuchta
Associate Professor of Biological Sciences
Mark Weinberg
Dean, Voinovich School of Leadership and Public Affairs
3
ABSTRACT
COLLINS MERRI K., M.S., August 2017, Environmental Studies
Searching for a Salamander: Distribution and Habitat of the Common Mudpuppy
(Necturus maculosus) in Southeast Ohio Using Environmental DNA
Director of Thesis: Shawn R. Kuchta
Habitat destruction and anthropogenic drivers have led to a decline of amphibian populations worldwide, but the conservation status of many species remains in question.
Environmental DNA is a new monitoring methodology that non-invasively detects the presence of imperiled, rare, and secretive species. Although the use of environmental
DNA (eDNA) to detect species presence is increasing, it is not often paired with habitat data. This study focuses on the declining Common Mudpuppy salamander, Necturus maculosus. I conducted both traditional and eDNA field surveys at 10 stream sites located in Southeastern Ohio. I detected the presence of Mudpuppies at 6 of 10 streams using eDNA. In contrast, I only observed individuals at one site using stream surveys
Presence was detected in fourhistoric streams, and established at two new locations.
I quantified physical and chemical habitat characteristics over six months for each stream using water quality surveys. I recorded measurements of heavy metals, nutrients physical stream habitat, conductivity, pH, temperature, total dissolved solids, and oxygen.
Logistic regression analysis determined that QHEI (Qualitative Habitat Evaluation Index) scores for riparian zone was the best predictor of mudpuppy presence. This sampling methodology could be broadly applied to study other aquatic species. 4
DEDICATION
This thesis is dedicated to my late grandparents, Russell and Betty Wilkinson, who instilled empathy and compassion in my heart for all wild things, and to my mother,
Beverly, for her support and strength that knows no bounds. You are my inspiration.
This one’s for you.
5
ACKNOWLEDGMENTS
I would first like to thank Crane Hollow for their generous support that made this research possible, for continuing to support the research goals of Ohio University students, and for protecting the beautiful and unique habitat within the preserve. It is truly a remarkable place. A huge thanks to Stephen Spear for his incredible advice and guidance, without you this thesis would be incomplete. To Shawn, for your kindness in taking on a student with little experience, your positivity along the way, and for the blind faith you put in me. To Denim, for her warm and welcoming friendship. To my MSES cohort, I could not have imagined a better group of friends, cheers to you. To my mother, for always believing in me. To my brother for exploring the woods with me as a child and being my partner in adventure, that sense of adventure never died. To my lab mates for your encouragement. To Bill Broach for being a great lab teacher, and Erin Murphy for allowing me to use her equipment. To my field help, those who taught me protocol in the lab, and who edited my work with heart and patience. To the countless friends that I have made on this journey who kept me laughing. To my committee members Natalie and
Nancy who pointed me in a direction I never thought I would (or could) go. To everyone who believed in me, thank you all, I would have never succeeded without you.
6
TABLE OF CONTENTS
Page
Abstract ...... 3 Dedication ...... 4 Acknowledgments...... 5 List of Tables ...... 7 List of Figures ...... 8 Chapter 1: Introduction ...... 9 Chapter 2: Materials ad Methods ...... 15 Chapter 3: Results ...... 49 Chapter 4: Discussion ...... 61 Literature Cited ...... 69 Appendix A: Myron Results ...... 76
7
LIST OF TABLES
Page
Table 1 Crane Creek eDNA ...... 24 Table 2 Pine Creek eDNA ...... 27 Table 3 Clear Creek eDNA ...... 30 Table 4 East Fork Queer Creek eDNA ...... 32 Table 5 Raccoon Creek eDNA ...... 34 Table 6 Heweet-Fork eDNA ...... 36 Table 7 Leading Creek EPA 1993 ...... 39 Table 8 Leading Creek eDNA ...... 39 Table 9 Forked-Run eDNA ...... 42 Table 10 Hocking eDNA ...... 44 Table 11 Primer and Probe ...... 47 Table 12 QHEI Scores ...... 50 Table 13 Contaminants ...... 51 Table 14 Nutrients...... 53 Table 15 Mudpuppy Measurements...... 53 Table 16 DNA Quantity ...... 55 Table 17 Logistic Regression...... 58
8
LIST OF FIGURES
Page
Figure 1. eDNA Sites in southeast Ohio...... 21 Figure 2. Crane Creek eDNA...... 23 Figure 3. Pine Creek eDNA...... 26 Figure 4. Clear Creek eDNA ...... 29 Figure 5. East Fork Queer Creek eDNA...... 31 Figure 6. Raccoon Creek eDNA ...... 33 Figure 7. Hewett-Fork eDNA...... 35 Figure 8. Leading Creek eDNA ...... 38 Figure 9. Forked-Run eDNA...... 41 Figure 10. Hocking eDNA ...... 43 Figure 11. Mudpuppy Egg Nest ...... 55 Figure 12. Riparin Zone Score Spline...... 59 Figure 13. Pearson’s 1...... 59 Figure 14. Pearson’s 2...... 60 Figure 15. Pearson’s 3...... 60
9
CHAPTER 1: INTRODUCTION
Globally, even in protected areas amphibian populations have declined dramatically with worsening declines over the past twenty-five years (Davic and Welsh
2004). Recent research on extinction has shown that amphibians are now more threatened than both mammals and birds, with the IUCN estimating that over one-third of known populations have undergone severe and rapid decline or extinction, with 41 percent currently threatened (IUCN 2014, Beebee et al. 2005). Species associated with stream and freshwater habitats are especially imperiled due to rapid habitat loss and habitat degradation (Blaustein et al. 2011). Further, freshwater species and habitats are affected by a variety of interacting, multi-faceted issues including modification of ecosystems through water contamination and destruction of riparian zones (WWF 2016). Habitat destruction in aquatic ecosystems results in altered thermal regimes, disrupted flow patterns, and altered biochemistry, which can imperil native species (Collen et al. 2014).
Declines of native species are often difficult to monitor without long term population studies and studies of habitat data use, and studies focused on secretive species, or those with low densities, face an even larger challenge (Wheeler et al 2003). However, advances in technology have led to the development of monitoring methods that these conservation challenges.
Environmental DNA (eDNA) is a cost effective and time saving approach that allows for rapid species monitoring at a large spatial scale without disturbing the study species (Thomsen et al. 2015). In aquatic systems, eDNA is collected through water sampling and is detected in samples using quantitative PCR (qPCR). DNA detected in 10 water samples comes from sloughed cells released from skin, saliva, fecal matter, or during reproduction (Jerde et al. 2011). Studies report remarkable success when using eDNA to detect species that are otherwise difficult to observe with traditional survey methods (Jerde et al. 2011). Methods for eDNA amplification and analysis are advancing rapidly and are being used to detect low-density, secretive, and at-risk species (Pilliod et al. 2013, Voros et al. 2017). Amphibians have been detected in multiple studies using eDNA (Spear et al. 2015, Pilliod et al. 2013, Thomsen et al. 2012, Olson et al. 2012,
Pierson et al. 2016, Voros, et al. 2017). The Common Mudpuppy (Necturus maculosus) is a secretive salamander species that is difficult to detect using any traditional field surveys
(Price et al. 2016). Occurrence data suggests that mudpuppy is in decline throughout much of its range (Matson 2005), but studies currently lack important habitat and distribution data to accurately quantify the extent of this decline.
Study Species
Necturus maculosus is in the amphibian order Caudata, and the family Proteidae.
All proteids are paedeomorphic, and retain a fully aquatic lifestyle (Holman 2006).
Reports estimate that the mudpuppy can live upwards of thirty years, not attaining sexual maturity until after year six (Matson 2005). Mudpuppies retain large reddish external gills in post-embryonic life. Coloration ranges from shades of brown to gray, with a pattern of black spots (Matson 2013). Mudpuppies use chemical secretions to mark and identify substrate, relying heavily on olfactory cues for hunting and avoiding predation.
Olfactory cues also allow individuals to return to nests after nocturnal foraging, as well as to relocate nesting areas during the breeding season. At times, multiple mudpuppies 11 might be found nesting in the same location, using chemical secretions as social cues
(Parzefall et al. 1980). Mudpuppies are nocturnal feeders that seek refuge under rock slabs or logs and plant debris during the day. They prey upon crayfish, worms, macroinvertebrate nymphs, and fish at night (Christie 2000). As stream carnivores, mudpuppies play an important role in regulating macroinvertebrate assemblages. In addition, mudpuppies prey upon several invasive species, including rusty crayfish
(Orconectes rusticus), round gobies (Neogobius melanostomus), and zebra/quagga mussels (Dreissena spp.) (Beattie et al. 2016).
Observation and ecological data suggest that adult mudpuppies prefer cool aerated water around 15 cm in depth downstream from riffle areas (Matson 2013, Bishop 1941).
They occupy shallow waters with low water temperatures from late fall to early spring in accordance (Craig et al. 2015). Breeding occurs in autumn when water temperatures are cooler. Females store sperm throughout winter, and lay fertilized eggs under rock slabs and other large surfaces during spring and early summer (April-June). Nests are located on the downstream side of the cover object, and females brood the nests until the young hatch (Matson 2005).
Necturus maculosus occurs in a variety of lotic and lentic habitats such as lakes, rivers, streams and creeks (Matson et al. 2013). Populations persist where adequate cover objects remain, as Mudpuppies depend on them for several aspects of their life history.
Mudpuppies also require sand or silt substrate under their cover object for burrowing in well aerated water for increased oxygen (Mattson 2005). Crayfish burrows and undercut banks also provide suitable habitat for Mudpuppies (Pfingsten and White 1989). 12
While the fossil record for the Family Proteidae is sparse, the earliest fossil
Proteid was discovered in the Ravenscrag sandstone and shale formation in Eastern
Saskatchewan, Canada from the late Paleocene. The paleo-environment during this epoch was likely heavily aquatic and many of the salamander fossils found there are thought to be fully aquatic (Naylor 1978). Necturus maculosus is restricted to North America, while the genus Proteus is restricted to Europe. Thus, mudpuppies contribute phylogenic diversity to North America.
Current Distribution
Historically, studies reported Mudpuppies as common across the mid-western and southern United States. In Ohio, mudpuppies were once highly abundant across the Great
Lakes region, but have declined due to habitat destruction, lampricide use, and other anthropogenic drivers (Matson 2005). There are few documented museum specimens of
Mudpuppies in Ohio after 1989. Prior to 1952 populations were documented in 27 of
Ohio’s 88 counties, with no specimen records in Hocking County, and only limited records in southeastern Ohio. Only 14 counties have museum specimens collected after
1989, and with just four from southern Ohio. Most specimen records from southern Ohio fall between 1952 and 1989 (Matson 2013). The Ohio Department of Natural Resources lists Mudpuppies as number 14 out of 39 Ohio amphibian species of conservation concern, and mudpuppies have been designated as “in decline” in Ohio (Ohio
Department of Natural Resources 2007). This determination is based on based on funding for conservation, population status, habitat health, and threats to continued persistence
(Millsap et al. 1990). 13
Freshwater ecosystems occupy less than one percent of Earth’s biomes, yet support one-third of all known vertebrate species (WWF 2016). North American freshwater streams and rivers contain rich biodiversity. For instance, the Mississippi
River drainage basins alone is thought to contain as many, if not more, species than are found in all of Europe (Allan and Flecker 1993). Freshwater ecosystems in Southeast
Ohio are supplied by three major underground aquifers types: sand and gravel, interbedded shale, and sandstone (Ohio EPA 2012 Section M). Contamination of underground aquifers occurs through land use change, natural resource extraction, and organic enrichment. In Southeast Ohio coal mining has contributed to contamination of ground and surface waters by lowering pH, increasing heavy metal and dissolved solid loads, and elevating rates of conductivity (Ohio EPA 2012 Section A). Land use changes in Southeast Ohio, such as deforestation for farming, construction of roadways and urban areas, and an increase in timber harvesting have resulted in a reduction of biological health scores in many streams in Southern Ohio (Ohio EPA 2012). Despite negative effects from land use changes, remediation and monitoring efforts by the EPA and local interest groups continue to increase the ecological health of many habitats.
The objectives of this study are to: 1) evaluate the effectiveness of eDNA as a monitoring tool for the Common Mudpuppy; 2) update distribution records for the
Common Mudpuppy in southeast Ohio; and 3) provide data on the habitat features associated with mudpuppy presence. To attain these objectives, I identified and conducted surveys at 10 stream sites located in southeast Ohio. Eight of these contained populations of Mudpuppies sometime between 1952 and 1989. To determine current 14 presence or absence, I first surveyed each stream using traditional field methods for this species (i.e. flipping large rocks, dip netting in woody debris). Next, I conducted eDNA surveys of the same streams. I also measured aspects of water quality and conducted physical habitat surveys at each locality. Finally, I tested for correlations between mudpuppy presence and habitat variables.
15
CHAPTER 2: MATERIALS AND METHODS
Water and Habitat Quality Surveys
QHEI
The Qualitative Habitat Evaluation Index (QHEI) is an index used by the Ohio
EPA to quantify the health of physical macrohabitats in lotic waters. The QHEI is composed of six evaluation metrics and a site can attain a maximum score of 100 points.
All metrics are measured individually and then summed to provide the overall score.
Categories in QHEI evaluation include: substrate type and percent, instream cover type, extent of channel morphology, extent of riparian zones and bank erosion, pool and riffle quality, and landscape gradient (OHIO EPA 2006, Assessing Habitat in Flowing
Waters,Assessing Habitat in Flowing Waters). I used the QHEI method to rate the habitat of each study location, excluding Crane Creek due to its small size and the East Fork of
Queer Creek due to its intermittent flow. Crane Creek and the East Fork of Queer Creek were evaluated using the Primary Headwaters Habitat Index (PHWHI), an index like the
QHEI, but adapted for headwater streams (OHIO EPA 2006, Assessing Habitat in
Flowing Waters). For this study, stream stretches of 700 m were used in larger streams, and 300 m in smaller streams (Crane and the East Fork of Queer Creek). The entirety of these stream stretches was evaluated using visual surveys.
Contaminants and Nutrients
Water samples were collected directly from stream sites in sterile 250 mL sample bottles and transported the same day to the Ohio University Biochemistry Research Lab and Facility during the summer and fall of 2016. All samples were stored on ice in a 16 cooler during transport. All readings were in parts per million (ppm). The Biochemistry lab tested water samples for copper, lead, and iron, which are contaminants associated with acid mine drainage, an issue throughout southern Ohio. For nitrates, 10 mL of stream water was taken, then a NitraVer 5 Nitrate Reagent (Hach, Loveland Colorado) powder packet was added to the sample and left to dissolve for one minute. The sample was then shaken, and left to react for five minutes. During this time, a 10-mL blank was created in a separate cylinder using distilled water, and placed into the cell holder of the spectrometer. The spectrometer was synced to zero using the blank, and when the five- minute timer was up, the stream sample replaced the blank in the cell holder, and the spectrophotometer was read for nitrogen levels.
Phosphorus was measured using a 25-mL cylinder filled with stream water. One mL of molybdate reagent and 1mL of amino acid reagent was added using a calibrated dropper. The sample was then inverted several times to mix the solution thoroughly. The time on the spectrometer was set for ten minutes. During this time, a blank was created using 25 mL of distilled water in a separate sterile cylinder. The blank was inserted into the cell holder of the spectrometer, and the spectrometer was set to zero. When the ten- minute reaction period ended, the prepared sample was placed into the cell holder, and the phosphorus levels were recorded.
Field Water Chemistry
The following field parameters were measured during summer and fall 2016 using a Myron L Ultrameter II 6P (Myron L Company, Carlsbad California).
17 pH pH is a measurement of water acidity and alkalinity. pH readings were taken throughout the summer and fall seasons of 2016. Several natural factors can affect water acidity, including decaying plant matter and soil acidity levels. However, many anthropogenic factors can affect water acidity as well, including heavy metal contamination and acid rain pollution. A neutral pH reading supportive of ecological health in freshwater is between 6-8 (EPA 2016).
Conductivity
Conductivity reads the potential of water to hold an electric current. Conductivity is usually much higher when contaminants such as salts or metals are present in water.
Due to this, healthy stream habitats generally have low conductivity. For instance, streams impacted by acid mine drainage usually have very high conductivity readings, while streams with negligible impact from pollutants have low conductivity readings.
Most streams have a conductivity reading around 50-1500 µS/cm, with 150-500 µS/cm being ideal for healthy ecosystems (Behar, S. 1997).
Total Dissolved Solids (TDS)
Total dissolved solids (TDS) is a measure of all organic and inorganic substances in a water sample. These can be ionized or in suspended form, such as silts. TDS is related to conductivity and a high TDS reading corresponds with a high conductivity reading. Measurements for TDS are in parts per million (ppm). Common pollutants leading to high TDS levels are agricultural or urban wastewater runoff.
18
Oxidation Reduction Potential (ORP)
Oxidation Reduction Potential (ORP) quantifies whether an aquatic system gains or loses electrons in chemical reactions. High ORP measurements indicate that a stream promotes oxidation, and low values indicate the stream promotes reduction. ORP values between 300 and 340 millivolts are considered healthy, while measurements higher than
400 millivolts can be lethal for some freshwater species (Fenner 2008). ORP is correlated with pH, as the higher the pH the more oxidation potential, and the lower the pH the more reduction potential. Many natural processes, such as decomposition of organic matter in streams, depends on oxidation by microorganisms (Baird and Cann 2005).
Temperature
Temperature was recorded in degrees Celsius and taken from both shaded and unshaded portions of each stream.
19
Site Selection
Western Alleghany Plateau Ecoregion
I selected 10 research sites in southeastern Ohio based on either historic presence of Mudpuppies or good habitat quality. Sampling locations included: two sites in the
Hocking River in Athens County; Clear Creek, Pine Creek, and Crane Creek in Hocking
County; Hewett -Fork, East Fork of Queer Creek, and Raccoon Creek in Vinton County; and Leading Creek and Forked Run in Meigs County (Figure 1). At each site, I identified several specific points to conduct eDNA surveys. Survey points were selected based on stream length, historic data, and habitat quality from QHEI assessments.
All study sites lie within the Western Alleghany Plateau ecoregion of Ohio
(WAP). Soils in the WAP consist of colluvium, lake deposits, outwash, and moraine, with bedrock outcroppings (Birkhimer 2013). Broad outwash valleys characterize the
Hocking River and Scioto River drainage areas, and thick sediment deposits are typical in the WAP (Birkhimer 2013). The WAP receives an average of 39-43 inches of precipitation a year and experiences temperatures ranging from below 0º C in winter to over 28º C in summer (Armitage 2013). The Western Alleghany Plateau ecoregion was deforested during settlement, but has returned to a heavily forested state in the last century. It is comprised of patches of agricultural terrain within a matrix of bottomland hardwood forest comprised predominately of mixed oak and beech (Armitage and Lipps
2013). 20
Figure 1. Environmental DNA sampling sites denoted by red dots for Common Mudpuppies at nine stream sites in southeastern Ohio.
21
Crane Creek, Crane Hollow, Hocking County
Crane Hollow is a 1,960-acre nature preserve located within Laurel Township in
Hocking County. The preserve is located within the Pine Creek sub-watershed, with an outparcel in the Queer Creek sub-watershed. Approximately 45 percent of the land around Crane Hollow Preserve is dedicated as state park, forest, or natural areas. Five percent is pasture or farmland, and 3 percent is conservation easements. While a high percentage of the land surrounding Crane Hollow is protected, Columbia Gas still utilizes areas within Crane Hollow for underground pipeline upkeep.
Unlike many other natural preserve systems, Crane Hollow is a restricted access preserve, open only to dedicated scientific research as a special effort to protect its ecological health. Crane Creek runs the length of Crane Hollow, and empties into Pine
Creek just south of the preserve boundary. Biological surveys have documented 9,604 species in Crane Hollow, including 11 salamander species (H. Stehle, Personal
Communication, 3-10-2016). As of 2016, mudpuppy presence had not been confirmed in
Crane Creek, but suitable habitat does exist. I surveyed the 2.95 km stretch of Crane
Creek at 16 locations using eDNA, taking samples every 200m (Figure 2, Table 1). 22
Figure 2. Environmental DNA sampling locations for Common Mudpuppies along a 2.95 km stretch of Crane Creek located in Hocking County, OH. White circles denote a positive eDNA result. Site 1 (CH-1) is located at the confluence of Pine and Crane Creeks, with site 16 (CH-16) positioned at the headwaters.
23
Table 1. Necturus maculosus environmental DNA sites; Crane Creek 2016
Site Number Latitude Longitude Sampling Date
CH-1 39.455429 -82.568051 10-2-2016
CH-2 39.456999 -82.568372 10-2-2016
CH-3 39.458586 -82.568998 10-2-2016
CH-4 39.460336 -82.569349 10-2-2016
CH-5 39.462398 -82.569582 10-2-2016
CH-6 39.464207 -82.568975 10-2-2016
CH-7 39.465853 -82.569822 10-2-2016
CH-8 39.467624 -82.570648 10-2-2016
CH-9 39.469137 -82.570666 10-2-2016
CH-10 39.470848 -82.570808 10-2-2016
CH-11 39.472419 -82.570804 10-2-2016
CH-12 39.474295 -82.57119 10-2-2016
CH-13 39.475951 -82.572103 10-2-2016
CH-14 39.477641 -82.571721 10-2-2016
CH-15 39.479137 -82.57289 10-2-2016
CH-16 39.481089 -82.573097 10-2-2016
24
Pine Creek, Hocking County:
Pine Creek runs 323.48 km southeast through Laurel Township in Hocking
County, Ohio. Pine Creek is located on private land and Hocking State Forest. It flows through several state nature preserves including Conkle’s Hollow and Crane Hollow. Per an Ohio EPA (2015) assessment of Pine Creek, no area scored lower than 68.5 on a
QHEI assessment test (of river km 9.33, 18.67, and 27.52), indicating superior physical habitat. I selected Pine Creek as a research site due to much of the watershed being heavily forested with a history of healthy habitat. Furthermore, it was reported by Al
Marietta (Personal Communication), a counselor at Camp Ot’y Okwa, in May 2015 that a female Common Mudpuppy had been discovered in Pine Creek during a kick net survey.
I collected eDNA samples every 180-240 m upstream (10 points), and downstream (10 points) from a documented mudpuppy nest site (Figure 3, Table 2). 25
Figure 3. eDNA survey sites in Pine Creek. Both upstream and downstream surveys begin at a documented mudpuppy nest site. Sites upstream of the nest area are PU1-10. Sites downstream from the nest are PD 1-10. White dots denote positive eDNA results.
26
Table 2. Necturus maculosus environmental DNA sites; Pine Creek 2016
Site Number Latitude Longitude Date
PD-1 39.442222 -82.5852 10-9-2016
PD-2 39.440561 -82.584907 10-9-2016
PD-3 39.439173 -82.585801 10-9-2016
PD-4 39.439216 -82.587762 10-9-2016
PD-5 39.438676 -82.588611 10-9-2016
PD-6 39.438706 -82.591023 10-9-2016
PD-7 39.4386 -82.59308 10-9-2016
PD-8 39.438576 -82.595036 10-9-2016
PD-9 39.439595 -82.5966 10-9-2016
PD-10 39.43953 -82.597255 10-9-2016
PU-1 39.441714 -82.585183 10-10-2016
PU-2 39.443294 -82.58485 10-10-2016
PU-3 39.444147 -82.584737 10-10-2016
PU-4 39.445546 -82.584819 10-10-2016
PU-5 39.446956 -82.584353 10-10-2016
PU-6 39.446625 -82.582991 10-10-2016
PU-7 39.448093 -82.582797 10-10-2016
PU-8 39.449902 -82.583574 10-10-2016
PU-9 39.449371 -82.581604 10-10-2016
PU-10 39.449025 -82.580134 10-10-2016
27
Clear Creek, Hocking County
Clear Creek, located within Clear Creek Metro Park, flows eastward through
5,000 heavily forested acres, and empties into the Hocking River. This site was selected based on historic presence and water quality. In a 2009 report, Clear Creek was rated as
“Superior High Quality Water” in all tested areas (Ohio EPA 2009). A mudpuppy specimen was recorded between 1952 and 1989 in Clear Creek (Pfingsten et al. 2013).
Four sample sites were chosen in Clear Creek (Figure 4). Site one is at the west end of the creek at County Road 69, which borders the Western tip of Fairfield County. Total site distance from sites one to four spans 17.7km (Table 3).
28
Figure 4. eDNA sample sites in Clear Creek located in Clear Creek Metro Park for the Common mudpuppy. Site CC-1 is at the most western end of the creek, and site CC-4 is at the most eastern end of the creek near its confluence with the Hocking River. White dots denote presence of mudpuppy eDNA.
29
Table 3. Necturus maculosus environmental DNA sites; Clear Creek, 2016
Site Number Latitude Longitude Date
CC-1 39.592383 -82.623904 10-26-2016
CC-2 39.590600 -82.610517 10-26-2016
CC-3 39.588938 -82.577721 10-26-2016
CC-4 39.595849 -82.550833 10-26-2016
East Fork Queer Creek
Queer Creek is a tributary of Salt Creek and splits into two branches: the main stem, which begins and ends in Hocking State Forest, and the Eastern Branch, which flows southeast along route 56 on the border of Vinton County eventually ending near
Ash Cave in the Hocking Hills. I selected the East Fork of Queer Creek due to its superior water quality and protected habitat. The East Fork of Queer Creek flows southward, with headwaters in the Bison Hollow Preserve near Ash Cave. Queer Creek, including East Fork, was listed as a “special high quality water ecosystem” in 2014 (Ohio
EPA 2014). I identified four eDNA sample locations along a 11.27 km stretch of Queer
Creek extending from Bison Hollow upstream to the preserve border near Amerine Road
(Figure 5, Table 4). 30
Figure 5. eDNA sample sites in the East Fork of Queer Creek at Bison Hollow Preserve for the Common mudpuppy. Site QC-1 is located at the border of Hocking and Vinton Counties, and site QC-4 is located near the end of the East Fork where it joins the main branch of Queer Creek. No presence of mudpuppy eDNA was detected.
31
Table 4. Necturus maculosus environmental DNA sites; East Fork of Queer Creek (Bison Hollow), 2016
Site Number Latitude Longitude Date
QC-1 39.22.032 -82.33.091 10-15-2016
QC-2 39.22.442 -82.32.994 10-15-2016
QC-3 39.23.129 -82.33.042 10-15-2016
QC-4 39.395134 -82.550629 10-15-2016
Raccoon Creek, Vinton County
Raccoon Creek is one of Ohio’s longest streams, flowing over 180.25 km through six counties in Southern Ohio. The headwaters of Raccoon Creek are in Vinton County, and the creek flows southward until it empties into the Ohio River in Gallia County.
Seventy-five percent of the watershed is forested, and the remainder is primarily agricultural land (Raccoon Creek Partnership, Personal Communication May 2016).
Based on historic records, Mudpuppies likely occurred in Vinton County near or within
Zaleski State Forest (Pfingsten et al. 2013). Raccoon Creek flows southward through
Zaleski before its confluence with Little Raccoon Creek at the Vinton County border. I identified four eDNA sample locations along a 38.62 km stretch of Raccoon Creek extending from Zaleski State Forest on Old Crow Road, upstream to the Moonville
Tunnel (Figure 6, Table 5). 32
Figure 5. eDNA sample sites in Raccoon Creek in Zaleski Sate Forest for the Common mudpuppy. Site RC-1 is located on Old Crow Road, and site RC-4 is located at the Moonville tunnel near Lake Hope. No DNA was located at any site.
33
Table 5. Necturus maculosus environmental DNA sites; Raccoon Creek, 2016
Site Number Latitude Longitude Date
RC-1 39.26946 -82.29751 11-1-2016
RC-2 39.317222 -82.351205 11-1-2016
RC-3 39.315741 -82.333351 11-1-2016
RC-4 39.307803 -82.323565 11-1-2016
Hewett-Fork, Vinton County
Headwaters of Hewett-Fork are in the Waterloo Township of Athens County.
Hewett-Fork is part of a coal mining reclamation project led by the Raccoon Creek
Partnership. It is likely that Hewett-Fork within Athens County had a mudpuppy population before 1952 (Mattson et al. 2013). However, stream water has been highly acidic and polluted by heavy metal runoff for decades from a mine seep. The construction of a lime doser in Carbondale has since increased the health of the stream and promoted ecosystem recovery for 11 miles downstream. Given the recent and successful recovery of this area (Figure 7, Table 6) I choose eDNA sample locations beginning at the confluence area with Raccoon Creek, and extending northward upstream 10 km into the
Waterloo Wildlife area. 34
Figure 7. Hewett-Fork eDNA sample sites for the Common Mudpuppy. Site HF-1 is nearest to Carbondale, an area of Hewett -Fork that is heavily impacted by acid mine drainage. Site HF-4 is near the acid mine drainage recovery zone. No DNA was located at any site.
35
Table 6. Necturus maculosus environmental DNA sites; Hewett-Fork, 2016
Site Number Latitude Longitude Date
HF-1 39.31926 -82.2835 10-22-2016
HF-2 39.329597 -82.268824 10-22-2016
HF-3 39.343138 -82.258518 10-22-2016
HF-4 39.347315 -82.253161 10-22-2016
Leading Creek, Meigs County
Leading Creek is 48.3 km long, flowing from Athens County southward through
Meigs County and emptying into the Ohio River at Middleport, Ohio. Seventy percent of
Leading Creek’s 241.4 km Watershed is forested, with the remainder a mixed matrix of farm, urban, and mining land. In 1993, Southern Ohio Coal Company’s Mine #31 ruptured and flooded Leading Creek with over 1 million gallons of toxic mine wastewater, decimating biological life downstream. Currently, 2,000 acres of the watershed is un-reclaimed strip mines (Leading Creek Partners Group, 2015). Acid mine drainage effects 20 stream miles in the watershed.
During a 1993 Ohio Department of Natural Resources (ODNR) survey of fish kills, deceased mudpuppies were discovered washed up on shore in six different areas
(Table 7). Collections of deceased animals were carried out during high flow, with high turbidity, so total mortality was estimated to be much higher. Since this time, significant efforts to clean up Leading Creek have been made, and a clean-up plan designated the 36 mudpuppy as an amphibian indicator species of stream health, in hopes populations could be restored (Ohio EPA 1994).
Due to records of historic presence, and areas of seemingly good habitat, Leading
Creek was chosen as a stream site. Four sampling points throughout Leading Creek were chosen based on historic data of mudpuppy specimens recorded during the 1993 survey
(OHIO EPA 1994, Mine 31 Report) (Figure 8, Table 8). Points at Insinger Road Bridge,
State Route 124, Leading Creek Road, and ST RT 7 were as selected sample sites, spanning 24.1 km in the mainstream.
37
Figure 8. Leading Creek eDNA sample sites for the Common Mudpuppy. Downstream from sites 1 and 2, at the tributary with Thomas Fork, is where acid mine drainage still heavily impacts Leading Creek. All four sites are places where dead Mudpuppies were found during EPA surveys after the Mine #31 rupture in 1993.
38
Table 7. Locations of deceased individuals of Necturus maculosus found following the Mine #31 spill; Leading Creek, 1993
Location No. of Mudpuppies
Malloons Rd Bridge 2
Insinger Rd Bridge 3
ST.RT.124 1
Parkinson Run Rd 1
Leading Creek Rd. 1
ST.RT.7 Bridge 4 Data Provided in ODNR 1993 Report (Ecological Recovery Endpoints for Streams Affected by the Meigs #31 Mine Discharges during July - September 1993).
Table 8. Necturus maculosus environmental DNA sites; Leading Creek, 2016
Site Number Latitude Longitude Date
LC-1 39.055929 -82.194602 11-11-2016
LC-2 39.045986 -82.184466 11-11-2016
LC-3 39.012903 -82.137338 11-11-2016
LC-4 38.993352 -82.076687 11-11-2016
39
Forked Run, Meigs County
Forked Run is part of the Upper Shade-Ohio River Watershed in Meigs County,
Ohio. It flows south through the Southeastern portion of the county and empties into the
Ohio River in Portland, Ohio. Per EPA assessments from 2006 and 2008, the human health use for aquatic organism consumption was rated as “good,” but no other information on water quality is available. Based on historic records it is likely that mudpuppies occupied a section of the Forked Run stream system in Forked Run State
Park. Data was collected at the Ohio River confluence with Forked Run northward to the dam spillway area where the lake drains back into Forked Run stream (Figure 9, Table 9).
The total area sampled was 4.7 km. 40
Figure 9. eDNA sample sites for the Common Mudpuppy in Forked-Run State Park downstram of Forked-Run Reservoir. Forked Run empties into the Ohio River. No DNA was found at any sample point.
41
Table 9. Necturus maculosus environmental DNA sites; Forked Run State Park, 2016
Site Number Latitude Longitude Date
FR-1 39.085450 -81.764200 10-23-2016
FR-2 39.087694 -81.765889 10-23-2016
FR-3 39.089383 -81.767250 10-23-2016
FR-4 39.090917 -81.767533 10-23-2016
Hocking River, Athens County
The Hocking River watershed is 164.2 km long, extending from Lancaster southward into the Ohio River. In 1971, a flood protection project was completed that rerouted the Hocking River near White’s Mill in Athens County, reducing the river length by 1,400 feet and significantly changing the channel structure (Hocking Conservancy,
Personal Communication, May 2016). In 8 of 18 tested areas near the city of Athens, a warm water habitat status of ecological health was not attained due to pollutants. Nutrient enrichment was also cited as a significant impairment in these areas. Further, flow alteration is listed as an impairment in about 50 percent of tested areas. While 60 percent of the Hocking River watershed is estimated to be forested, in Athens, the river is impacted by erosion and sedimentation, and much of the river runs through residential areas (Ohio EPA 2009). It is difficult to ascertain the precise water body historic mudpuppy specimen records are from in Athens County, but maps suggest multiple locations within the Hocking River. I initiated sampling near the Stimson Avenue bridge and continued upstream through four sites in the altered area of the river, then four sites 42 in the unaltered area of river, ending along the Hocking-Adena bike path on the west side of Athens (Figure 10, Table 10).
Figure 10. Hocking River eDNA sample sites for the Common Mudpuppy. Altered Channel Sites1-4 are around Athens City. Unaltered Channel Sites 1-4 are to the North near Columbus Road. Presence of DNA is denoted by white dots.
43
Table 10. Necturus maculosus environmental DNA sites; Hocking River, 2016
Site Number Latitude Longitude Date
HR-(A)1 39.330487 -82.088109 10-7-2016
HR-(A)2 39.320395 -82.105032 10-7-2016
HR-(A)3 39.325472 -82.11337 10-7-2016
HR-(A)4 39.330746 -82.125428 10-7-2016
HR-(U)1 39.332688 -82.126108 10-6-2016
HR-(U)2 39.340672 -82.10937 10-6-2016
HR-(U)3 39.342932 -82.101748 10-6-2016
HR-(U)4 39.346702 -82.100137 10-6-2016
(A)=Altered (U)=Unaltered river area.
Mudpuppy Surveys
All ten research streams were searched for the presence of Mudpuppies twice.
During surveys, locations within the stream site that had large stones or heavy leaf packs were identified, averaging 3.5 search sites per stream. Search areas were chosen based on physical stream characteristics associated with good mudpuppy habitat (large rocks, instream cover, riffle areas). Large stones were lifted and searched underneath, and leaf packs were searched using a D-ring dip net. Searches took two to four hours to complete and were completed by a field team of at least two people.
44
Environmental DNA
For the collection of eDNA, I followed United States Geological Service (USGS) environmental DNA collection protocol 1 (Laramie et al. 2015). A manual, hand-driven, air-brake vacuum pump with a 1 liter flask was used for water filtration. A 250-mL disposable filter funnel, with 47 mm cellulose nitrate (0.45 microliter pore diameter) filter membrane (Thermo Fisher Scientific, Waltham, MA) was attached to the top of the flask using plastic hose, with the other end of the hose running through a rubber stopper with a
1.6 cm hole drilled in the center and attached to the hand pump.
A filter cup was submerged directly into the stream, either at streamside or from an access point in the middle of the stream if one was available. Four cups of water taken per sample. After pumping, I carefully removed the filter cup and used sterilized forceps to extract the filter paper. Filters were folded into fourths and placed in a 2mL sterile tube filled with 95% ethanol for preservation, and were labeled with site name and sample number. Tubes were stored in a -80° C freezer until processing. A Garmin eTrex GPS unit was used to record coordinates of each sampling site. Sterile gloves were changed after each filtration.
At each sample site, three one liter stream samples and one filter blank were collected. Blank samples consisted of distilled water filtered in the field as a control to detect contamination. Eight streams included four sampling sites. Exceptions included
Crane Creek, where I collected a stream sample every 182m (n=20 sample sites), with one blank every five samples, and Pine Creek, where one sample was taken every 182m upstream and downstream from the known mudpuppy nest site (10 upstream, 10 45 downstream, 5 blanks). This resulted in one-hundred and sixty-four samples from ten streams.
DNA Extraction and qPCR
Filters were torn in half using sterile forceps, with one half of each filter stored in a 2-mL tube in ethanol as a backup. The other half of each filter was shredded into four pieces, and DNA was extracted from filters using the protocol described in Spear et al.
(2015) modified to repeat the DNA isolation step twice to increase potential DNA yields from the sample.
I used primers and a probe that were specifically designed to amplify the mitochondrial cytochrome b locus in N. maculosus (Table 11; S.F. Spear, unpublished data). Primers were confirmed effective at a 99 percent match with Necturus maculosus on GenBank, and these primers were used to amplify and sequence DNA from mudpuppy tail tips collected from individuals in Pine Creek using Sanger sequencing. To establish the specificity of the primers, positive controls were tested against DNA from the Two- lined Salamander (Eurycea bislineata) and Spring Salamander (Gyrinophilus porphiriticus). Neither species amplified. Both are equally related to N. maculosus, and no other species of salamander in North America is more closely related to the mudpuppy. These results indicate that the primer/probe combination we used is specific to the N. maculosus.
For qPCR, a 15 ml PCR solution was created with a FAM probe (Integrated DNA
Technologies, Coralville IA), VIC PCR internal positive control detection kit (Thermo
Fisher Waltham, MA), and IDT qPCR master mix. A standard curve for detection of 46 mudpuppy DNA was created using a Nanodrop spectrometer, with a 40ng/uL DNA tail clip sample diluted at five concentrations from 10-1 to 10-5. These dilutions were used to set a standard curve of DNA detection with Bio-rad CFX software, which allows us to estimate the DNA quantity per sample.
I ran all samples in triplicate in a Bio-Rad CFX qPCR machine. Each plate included a series of standards and negative controls consisting of DNase/RNase free distilled water. Every well included an internal positive control (TaqMan Exogenous
Internal Positive Control; ThermoFisher Scientific, Waltham, MA) to detect internal PCR error. Quantitative PCR conditions were as follows: initial denaturation at 95° for 15 minutes, followed by 50 cycles at 94° C and 60° C for 60 s (S.F. Spear, unpublished data). None of the negative controls show amplification.
Table 11. Necturus maculosus primer and probe sequences
Name Sequence
NemaForward AGCAACAGCCTTTGTAGGGTA
NemaReverse TCGCCTTATCGACGGAGAATC
NemaProbe CGTACTACCATGAGGCCAAATATCCTTC
Quantitative PCR results were analyzed using BioRad CFX software. If any samples fell along above the CT threshold on the standard curve, this was considered a positive for DNA. At each sampling locality, if two out of three wells amplified for that filtration this was scored as a positive result. If one of three wells amplified this was 47 scored as a negative. Any wells that showed amplification, but did not exceed the CT threshold, were re-run. The BioRad CFX software derives mean DNA density from a sample, and densities were averaged across samples in each stream to provide a grand estimate of DNA density.
Environmental Correlates
Following the estimation of mudpuppy presence/absence, I used a binomial regression model to determine if water quality data predicts occurrence. Water quality covariates included conductivity, max water temperature, QHEI substrate score, QHEI cover score, and QHEI riparian zone score. Response variables included number of stream sites presence/absence of DNA at each site. I did not include stream chemistry data as no site had contamination levels above toxicity thresholds. TDS is correlated with conductivity, so only conductivity was included in the model. ORP did not have observed outliers, and pH was neutral throughout all tested stream sites. I used Pearson’s correlation coefficients to test for correlated environmental variables. After correlations were established I then evaluated the relative influence of each covariate on mudpuppy presence using logistic regression (Pitt et al. 2017).
48
CHAPTER 3: RESULTS
Water and Habitat Quality Surveys
QHEI
In the QHEI, a score above 70 is considered excellent (OHIO EPA 2006,
Assessing Habitat in Flowing Waters). Clear Creek received an excellent score. All other streams fell into the “good” category (range of scores considered good goes here), except the first Hocking River site, which ranked as “fair” (50). Hocking site 1 received the lowest score due to channelization, lack of riparian habitat, and levels of bank erosion.
Clear Creek had the highest score due to its superior riffle quality, good instream cover and riparian habitat, and the quality of its rocky substrate (Table 12). As a small primary headwater stream, Crane Creek was ranked as a Class III stream, indicating excellent conditions. The East Fork of Queer Creek had a high score in water quality (score here), but due to its ephemeral flow, it was designated as a Class 1 stream under PHWH criteria.
49
Table 12. QHEI scores
Stream Substrate Cover Channel Riparian Pools Riffles Gradient Total
Crane 22 - - 25 20 - - 67
Clear 15 16 15 9.5 9 7 6 77.5
Forked 8 13 12 6 9 2 4 55
Hewett 6 16 13 8.5 9 3 4 59.5
Hock 1 9 11 8 5 11 4 2 50
Hock 2 10 12 11 8 11 2 4 58.5
Leading 10 15 12 7 12 5 6 59
Pine 10.5 16 17 9 10 5 4 69.5
Queer 25 - - 21 20 - - 65
Raccoon 11 14 14 9 10 6 6 69
HHEI Maximum Scores: Sub=20, Cover=20, Channel=20, Rip=10, Pool=12, Riffle=8, Gradient=10
Contaminants
No stream had any contaminant levels above toxicity thresholds. The confluence of Crane and Pine Creek had the highest iron reading at 498.2 ug/L (Table 13). All streams fell below 64 ug/L for copper. Lead readings also fell below toxicity thresholds in all streams.
50
Table 13. Heavy metal contaminants (ppm) Stream/Site Cu²+(Copper) Fe²+ (Iron) Pb²+ (Lead) Date Crane Hollow CH-16 0.0028 0.1244 0.0052 7-18-2016 CH-1 0.0129 0.4982 0.0075 9-1-2016
Clear Creek CC-1 0.00210 0.0120 0.0238 6-17-2016 0.0206 0.0027 0.0075 7-31-2016 Forked-Run FR-4 0.0018 0.01 0.0132 6-18-2016
Hewett HF-4 0.0018 0.038 0.0045 6-22-2016
Hock 1 HR-(A)4 0.0026 0.018 0.0135 7-27-2016
Hock 2 HR-(U)3 0.0037 0.0008 0 .0068 7-27-2016
Leading LC-2 0.0024 0.0006 0.0041 6-14-2016
Pine PU-1 0.0015 0.2420 0.0024 5-30-2016 PD-8 0.0129 0.4982 0.0075 5-30-2016
Queer QC-1 0.0013 0.046 0.0057 7-25-2016 QC-4 0.0009 0.0146 0.0063 7-25-2016
Raccoon RC-4 0.0022 0.216 0.0108 6-22-2016 RC-2 0.0016 0.152 0.0046 6-22-2016
51
Nutrients
The EPA (1999) found that the median concentration of nitrate levels in warm water habitat streams (comparable to cold water) should be near 1.0 mg/L. Four sample sites exceed this limit (Table 14). Both Hocking River sites have about three times this limit.
Forked Run had high nitrogen readings, exceeding three times the expected 1.0 mg/L median. Pine Creek exceeds the recommended median, but only downstream from agricultural land. Hewett-Fork and Raccoon Creek also exceed the median, but minimally.
As of January 2017, no phosphorous limit for biological water quality as been determined, but research to establish a threshold began in 2016 (EPA 2016). However, exceedingly elevated levels of phosphorous can cause algal growth and decreased oxygen in lentic and lotic environments. Hocking site one had high phosphorous readings at 5.8 and 6.5 mg/L, but no other site exceeded 3 mg/L. 52
Table 14. Nutrient Sampling Stream Nitrogen Phosphorous Date Crane Hollow CH-16 0.9 mg/L 1.4 mg/L 6/9/16 CH-8 0.7 mg/L 1.2 mg/L 6/9/16 CH-1 0.6 mg/L 1.2 mg/L 6/9/16 CH-16 0.8 mg/L 1.1 mg/L 10/2/16 CH-8 0.9 mg/L 1.3 mg/L 10/2/16 CH-1 0.9mg/L 1.4 mg/L 10/2/16 Clear Creek CC-1 0.8mg/L 1.1mg/L 7/6/16 CC-3 0.2mg/L 1.4mg/L 7/6/16 CC-4 0.5mg/L 0.9mg/L 7/6/16 Forked Run FR-4 3.3mg/L 2.7mg/L 8/10/16 FR-2 2.1mg/L 1.8mg/L 8/10/16 Hocking Site 1 HR-(A)4 3.0mg/L 6.5mg/L 7/27/16 HR-(A)2 2.8mg/L 5.8mg/L 7/27/16 Hocking Site 2 HR-(U)2 2.8mg/L 2.4mg/L 7/27/16 HR-(U)3 2.4mg/L 1.6mg/L 7/27/16 E. Fork Queer QC-1 0.6mg/L 0.0mg/L 7/25/16 QC-4 0.1mg/L 0.2mg/L 7/25/16 Pine Creek PU-1 0.3mg/L 1.8mg/L 8/9/16 PD-4 0.9mg/L 1.2mg/L 10/9/16 PU-9 1.1mg/L 1.8mg/L 10/9/16 Raccoon Creek RC-4 1.1mg/L 1.0mg/L 8/25/16 RC-2 1.2mg/L 0.4mg/L 8/25/16 Hewett-Fork HF-1 1.4mg/L 0.4mg/L 7/10/16 HF-4 1.1mg/L 0.6mg/L 7/10/16 Leading Creek LC-2 0.1mg/L 0.5mg/L 8/17/16 LC-3 1.0/mg/L 0.8mg/L 8/17/16 LC-4 0.8mg/L 0.4mg/L 8/17/16
53
Field Water Chemistry Parameters
All pH readings of streams, including streams with acid mine drainage impairment, were within neutral limits. Crane Creek and Queer Creek averaged the lowest conductivity scores, and maintained the lowest total dissolved solid scores (Table 16, Appendix).
Conductivity and TDS are correlated, and high conductivity readings are often caused by pollutants (Ohio EPA 2016). Leading Creek and Hocking Site 1 had the highest conductivity readings, with Leading Creek’s average conductivity 1116.4µS/cm which is likely linked to acid mine drainage. Hocking Site 1 had an average conductivity of 961.7
µS/cm. This high score could be caused by urban runoff from residential and business areas
(storm drains, use of weather resistant minerals on highways). Streams with the coolest temperature averages between May and November 2016 were Crane Creek, Queer Creek, and Clear Creek, all with averages under 20° Celsius.
Mudpuppy Surveys
I detected four adult individuals in Pine Creek, Hocking County while conducting traditional field surveys. Three individuals were females with nests consisting of 76-110 eggs (Figure 11). Female Mudpuppies brood their eggs (Matson 2005), so during rock flip surveys, when I observed nests, females were also present. All females and nests were found during the May 2016 survey (Table 17), and all nest sites were within a 91 m stretch of stream. Rocks used for nesting were an average of 108.5 cm long and 45.4 cm wide.
Water depth in areas with individuals was between 16.5 and 25 cm. All individuals were found in run areas of the stream. All three individuals were measured, tail clipped and released back into the stream. The fourth adult was found during the October 2016 survey, 54
550 m upstream of the nest site. In addition, I observed a deceased juvenile in this same area.
Table 15. Mudpuppy survey results Sex Total Length Capture Date
Female 31.75 cm 5-7-16
Female 33.2 cm 5-27-16
Female 30.7 cm 5-27-17
Undetermined 31.2 cm 10-8-16
Figure 11. Mudpuppy egg nest in Pine Creek, Hocking County, Ohio. May, 2016.
55
Environmental DNA Results
All qPCR runs were within 100-120 in plate efficiency, and had a standard curve with an r2. ≥ 0.90. Using eDNA, I detected the presence of Mudpuppy DNA in 6 of the
10 streams surveyed. Presence/absence maps are shown in (Figures 2-10). Clear Creek had Mudpuppy DNA amplifications in sites CC-1-CC-3. Crane Creek had amplifications in 9 out of 16 sites. The Hocking River had no amplifications at site 1, but amplifications in sites HR(U)-3 and HR(U)-4 of site 2. Forked-Run, Raccoon Creek, and the East Fork of Queer Creek had no DNA amplification. Leading Creek had amplification in sites LC-
1 and LC-2. Hewett-Fork had one site amplification in site HF-4 and Pine Creek had amplifications in 11 of 20 tested areas.
The amount of DNA recovered varied widely between streams. The lowest amount of DNA was observed at Hewett -Fork, with an average of 1.06 x10-4 ng, while the most DNA was found in Pine Creek, with an average of 8.9 x 10-2 ng.
56
Table 16. DNA quantity Site Name Presence Sites per Stream Mean DNA (Ng) Pine Creek X 11 0.089 Crane Creek X 9 0.097 Hocking 2 X 2 0.00416 Leading Creek X 2 0.00238 Clear Creek X 3 0.000491 Hewett Fork X 1 0.000106 Hocking 1 - 0 0 EF Queer Creek - 0 0 Forked-Run - 0 0 Racoon Creek - 0 0
DNA quantity in nanogram averaged per sample site to derive an overall DNA density average per stream.
Environmental Correlates
Pearson’s correlation coefficients revealed relationships between three environmental variables. A negative correlation between QHEI riparian zone score and maximum water temperature (r² = -0.65; Figure 13). A positive correlation was detected between QHEI riparian zone score and QHEI cover score (r² = 0.82; Figure 14). Finally, a strong negative correlation was detected between maximum water temperature and
QHEI cover score (r² = -0.82; Figure 15).
In the binomial logistic regression, QHEI riparian zone was the only variable predicted mudpuppy presence and was the best-fit model (Table 19; Figure 12). The sample size is this analysis is small (n=10), and other variables may predict presence/absence with larger samples. AIC score was adjusted to account for small 57 sample size and is reported as AICc. Riparian zone score also had the lowest AICc score of any variable.
Table 17. eDNA occupancy logistic regression Model AICc Delta Cum.Wt β SE z Pr(>|z|) Riparian 29.66 0.00 0.51 0.611 0.305 2.002 .045*
Water T 32.07 2.41 0.66 -0.158 0.097 -1.627 0.10
Cover 32.77 3.11 0.82 0.343 0.233 1.468 0.35
Substrate 34.49 4.83 0.96 0.113 0.121 0.930 0.35
Conduct 34.85 5.19 0.04 -0.0005 0.0007 -0.698 0.48
* Statistical significance = ≤ 0.05
58
Figure 12. A cubic spline illustrating the relationship between QHEI riparian zone score and mudpuppy presence determined using eDNA.
Riparian Zone Riparian
Max Water Temp
Figure 13. Relationship between QHEI riparian zone score and maximum water temperature at field sites surveyed for mudpuppies in southeastern OH. Pearson’s correlation coefficient r² = -0.65.
59
Riparian Zone Riparian
Cover
Figure 14. Relationship between QHEI riparian zone score and QHEI cover score at field sites surveyed for mudpuppy in southeastern OH. Pearson’s correlation coefficient r² = 0.82.
Max Water Temp Water Max
Cover
Figure 15. Relationship between maximum water temperature and QHEI cover score at field sites surveyed for mudpuppy in southeastern OH. Pearson’s correlation coefficient r²= -0.82.
60
CHAPTER 4: DISCUSSION
Environmental DNA has proven to be an innovative biological monitoring tool in comparison to traditional field surveys due its capacity to detect rare or secretive species
(Bohmann et al. 2014). I conducted an eDNA study that established the presence of the
Common Mudpuppy in 6 out of 10 southeastern Ohio streams. In contrast, traditional surveys only detected presence at one of these sites. Establishing species presence using eDNA, when traditional surveys failed to detect occurrence, is a common result in eDNA studies. For instance, a study on the Eastern Hellbender located 9 individuals out of 23 sample sites using field surveys, but 33 of 61 sites included hellbenders using eDNA, including 6 new sites (Spear et a1.2015). In a survey comparing traditional leaflitter surveys versus eDNA in Patch-Nosed Salamanders (Urspelerpes brucei), the probability of detecting presence through eDNA sampling was 0.788/sample, while field surveys only
0.048/site visit (Pierson et al. 2016). A study on mudpuppy trapping methods concluded there is no single effective field method for locating mudpuppies (Price et al. 2016). The secretive nature of this species has resulted in sporadic trapping success.
Studies have attempted to correlate DNA density derived from qPCR protocols with animal biomass (Spear et al. 2015, Ficetola et al. 2008, Goldberg et al 2011). Thus far, data correlating eDNA mass with population size in natural populations has been inconclusive (references here). Greater success has been achieved using controlled laboratory methods (Takahara et al. 2012). We calculated mudpuppy DNA density was calculated for each study site. Two sites, Pine Creek, and Crane Creek, had the highest amounts of DNA. During eDNA surveys an individual was found in Pine Creek, (Site PU- 61
6) (Table 18). This site had a particularly high amount of DNA (0.04 ng), indicating that sample distance from live individual could influence eDNA density. High-density measurements could also result from sampling during the mudpuppy breeding season, or near breeding sites. For example, Spear and colleagues (2015) reported eDNA levels 2 to
10 times higher during the breeding season compared to non-breeding months for Eastern
Hellbenders. Furthermore, a study on Eastern Hellbender distribution obtained a high eDNA density results during the mating season, and reported high eDNA levels in areas where presence was established (Pitt et al. 2017)
There is no evidence of mudpuppies in either Pine or Crane Creek. Therefore, this
study identified two new locations for mudpuppy presence to be added to the distribution
map created by Matson (2013). In addition, presence was confirmed in historic sites in
the Hocking River in Athens County (unaltered channel), Clear Creek in Hocking
County, Leading Creek in Meigs County, and Hewett-Fork in Vinton County.
Environmental DNA surveys failed to detect Mudpuppies at four historic sites: Raccoon
Creek in Vinton County, Forked-Run in Meigs County, the Hocking River (with the
altered channel area) in Athens County, and the East Fork of Queer Creek in Vinton
County. Thus, based on these surveys, are no longer present at 50% of historic sites in
southeastern Ohio. However, as persistence of eDNA in lotic systems is dependent on the
organism, flow regime, and water temperature (Thomsen et al 2012, Strickler et al. 2015,
Pilliod et al. 2013), it is possible that I failed to detect mudpuppy eDNA despite their
occurrence at some sites. This is likely not the case because I sampled for eDNA during
the mating season. This is a time during their lifecycle likely correlated with elevated 62 eDNA densities as in Eastern Hellbenders (Spear et al. 2015). However, given that DNA detection is dependent on several environmental factors, as well as the species, it is possible that adding more sampling points in each stream would render more site positives pending on mudpuppy distribution in the stream.
Estimates of heavy metal levels in this study did not exceed the known limits to biological health. Criteria for copper toxicity have not been determined, but studies have shown that amphibians cannot live with copper levels in water reaching 64 µg/L (Besser,
J. Leib, K. 2007). Similarly, with lead the limit for aquatic organism toxicity is 65 µg/L.
The current aquatic life criteria for iron toxicity is 1,000 µg/L (EPA 2016). The confluence area of Crane and Pine creek had the highest iron reading, but at 498.2 µg/L it fell below toxicity thresholds. All streams fell below 64 µg/L for copper, with Clear
Creek having the closest copper reading, at 20.6 µg/L. Lead levels also fell below toxicity thresholds. Streams with acid mine drainage pollutants were not associated with elevated levels of any metals, and this may be due to reclamation efforts upstream of testing sites.
Further, dip samples have limited ability to detect long-term metal contamination, as natural events (e.g. heavy rainfall events) can influence metal concentrations in lotic systems (Sarmiento et al. 2009).
To thoroughly document contamination, ongoing data collection of chemical levels throughout the length of the stream system and chemical contaminants from tributary streams should be accessed using a long-term study. Nitrogen and phosphorous levels in some study sites were higher than what is healthy for maintaining ecological integrity. However, no correlation with nitrogen levels and presence/absence was found. 63
Long term studies on levels of nitrogen and phosphorous and stream health should be implemented. Streams once impaired by acid mine drainage could now have acceptable water quality, but due to mortality during initial contamination, mudpuppies may not have recolonized yet, or may not have the means to disperse to these now suitable areas to recolonize.
Not much is known about mudpuppy dispersal habits. In one mark-recapture study, individuals were found in the same vicinity after five years with dispersal distance between 100 and 200 meters (Shoop and Gunning 1967). In a more recent study by
Matson (1998), individuals were re-captured after three years in the same area with an average dispersal range of 136 m2. Thomas Fork, a tributary significantly impaired with acid mine drainage, flows into Leading Creek upstream of Site LC-4 (absence site) and subsequent pollution is potentially a contributor to Mudpuppies not being detected in this area. Site LC-1 in Leading Creek, near Insinger Road bridge, had significant mortality of mudpuppies during a 1993 EPA survey. It is possible that a portion of the population persisted here (site 1) and these individuals later recolonized the area. Reclamation efforts Leading Creek, along with strong riparian habitat in sites LC-1 and LC-2, could have sustained populations long term. Populations in sites LC-1 and LC-2 are about 2.4 km from one another. A presence site (HF-4) in Hewett-Fork is furthest from acid mine drainage impacted areas near Carbondale, and populations could have persisted in this area due to their distance from AMD impacts. Ongoing reclamation efforts near Waterloo
Wildlife Areas (sites HF-1 and HF-2) could result in populations recolonizing that area in the future, given feasible dispersal. 64
Although the East Fork of Queer Creek has superior physical habitat and water quality, its intermittent flow likely renders it inadequate to sustain mudpuppy populations. During spring and fall, depending on precipitation, the East Fork experiences significant flow. In the summer months, although the water temperature stays cool enough to sustain individuals, much of the creek bed dries up, leaving a matrix of dry gravel and deep water pools. I hypothesized prior to sampling that due to the quality of the habitat and water, Mudpuppies might be able to sustain populations in deep pools.
During the summer months, Mudpuppies utilize deep water retreats. However, based on eDNA testing this prediction was incorrect, as not mudpuppies were detected. The cause of this absence is not clear. Although remaining pools have cool water during summer, the lack of flow between pools may lower oxygen levels enough to render survival difficult. As with the East Fork of Clear Creek, no mudpuppies were detected in Raccoon
Creek using eDNA or traditional surveys. However, this is a relatively long stream and my sampling was widely spaced. There are several points between testing sites where mudpuppies could exist, and more sampling is needed to confirm that absence of mudpuppies in Raccoon Creek.
Environmental DNA has been shown to be an effective conservation tool in locating Eastern Hellbenders and identifying the habitat features on which they depend
(Spear et al. 2015, Santas et al. 2013). Eastern Hellbenders share similar microhabitats and natural history traits with the Common Mudpuppy, and therefore eDNA could contribute significantly to tracking mudpuppy presence and absence over time.
Mudpuppy populations have declined throughout its native range, including Ohio, 65
Illinois, Wisconsin, and Minnesota (Hoffman et al. 2014). The mudpuppy is considered endangered and possibly locally extinct in Maryland, of special conservation need in
Vermont (Chellman et al. 2012), threatened in Iowa, and is a species of concern in both
North Carolina and Indiana. Population status remains unknown in many other localities
(Mattson 2013). Despite documented declines, detailed information on mudpuppy populations and habitat associations remains generally unavailable (McDaniel 2008).
However, like other amphibians (e.g. Eastern Hellbender), anthropogenic habitat degradation resulting in habitat loss is thought to be a major contributor to declines
(Mattson 2005). Habitat loss via alteration of aquatic ecosystems, resulting in altered flow, sedimentation, altered thermal regimes, and chemical impairment are contributors to loss of mudpuppy habitat (Matson 2005).
In this study, correlations between maximum water temperature, QHEI instream cover score, and QHEI riparian zone score were detected, but the QHEI riparian zone score was the best predictor of mudpuppy presence. Despite the small sample size (n=10 streams), the association between QHEI riparian zone score and mudpuppy presence could help locate potential habitat and identify areas for conservation and restoration efforts. Categories for scoring riparian zone include the extent of bank erosion (little, moderate, severe), riparian width (>5 meters to <50 meters), and flood plain quality
(predominant land use of the flood plain: farming, conservation, urban, field, mining, or pasture (OHIO EPA 2006, Assessing Habitat in Flowing Waters). No presence site scored below a 7 in riparian zone assessment. 66
Riparian habitat act as a mechanistic driver underlying other beneficial habitat characteristics. Riparian zones act as buffer systems that filter sediment and contaminants through roots before reaching streams, and increase the availability of woody debris, which provides habitat to a wide range of species (Anbumozhi et al. 2005, Naiman et al.
1997, Swanson et al. 1982). Riparian zones also regulate water temperatures by providing a canopy cover that filters sunlight. The maximum water temperature for mudpuppy survival cannot exceed 30° C (Hutchison 1975), and this temperature was exceeded in
Forked-Run and the Hocking River site 1 (QHEI instream cover and QHEI riparian zone scores were also low). At Forked-Run, the mean temperature across a six-month period was 27.8° C, and while there are several deep pools that could be used as cool water retreats, these temperatures likely do not coincide with the needs of the Mudpuppies cutaneous respiratory system. All sites with mudpuppy detection had mean temperature values below 27° C. Several field studies have concluded that higher trapping rates are correlated with low water temperatures due to increased activity (Beattie et al. 2016,
Craig et al. 2015).
Strong riparian habitat results in less erosion and therefore less sedimentation due to root systems stabilizing and holding streambanks in place (Anbumozhi et al. 2005,
Naiman et al. 1997, Swanson et al. 1982). Sedimentation is a threat to mudpuppy persistence and survival. Sedimentation can suffocate juveniles and eggs, as well as cover important nesting habitat and remove crucial instream cover (Minton 2001, Casper 1998).
Being a long-lived species unable to reproduce until 5-6 years of age, recruitment of juveniles to adulthood is a central conservation concern. A study on juvenile recruitment 67 of Eastern Hellbenders (Wheeler et al. 2003) found that adults survived 20+ years in degraded habitats, but a 77% decrease in juvenile recruitment ultimately extirpating the population.
It is crucial to continue compiling data on distribution, habitat, and decline of the mudpuppy. Lack of this research could result in the Common Mudpuppy reaching threatened or endangered status. While it is apparent that the Common Mudpuppy is in decline, data are not available to measure the rate of decline or assess details of that decline. Characterization of habitat characteristics will be necessary not only to identify habitat associations, but to implement restoration or protection of critical habitat. Despite the small sample of streams surveyed during this study, I detected a correlation between mudpuppy presence and QHEI riparian zone. These data can potentially be used to identify other populations, and monitor for habitat changes. Riparian zone is a QHEI metric that can be easily measured using satellite imagery or mapping systems.
Incorporating more study sites combining eDNA and habitat measurements would allow for further evaluation of the conservation status of the Common Mudpuppy. 68
LITERATURE CITED
Allan, J. D., Flecker, A. S. (1993) Biodiversity Conservation in Running Waters.
BioScience, 43(1), 32–43.
Anbumozhi, V., Radhakrishnan, J., & Yamaji, E. (2005) Impact of riparian buffer zones
on water quality and associated management considerations. Ecological
Engineering, 24(5), 517-523.
Armitage, B. (2013) Section II- III Subsections 3- 4 Soils and Climate. Amphibians of
Ohio. Ohio Biological Society Bulletin New series. Volume 17. Number 1.
Armitage, B., Lipps, R, Jr. (2013) Section III Subsection 5. Habitats. Amphibians of Ohio
Ohio Biological Society Bulletin New series. Volume 17. Number 1.
Baird, C, Cann, M. (2004) The chemistry of natural waters. Pp. 425-462. Environmental
Chemistry. 3rd ed. New York: W.H. Freeman and Company 2004.
Beattie, A. (2016) Seasonality, demographics, and feeding ecology of mudpuppies
(Necturus maculosus) in an urban lake. PhD.Diss. Southern Illinois University at
Carbondale.
Behar, S. (1997) Testing the waters: chemical and physical vital signs of a river. River
Watch Network Newsletter, Montpelier, VT.
Birkhimer, John. (2013) Section III Subsection 1. Amphibians of Ohio. Ohio Biological
Society Bulletin New series. Volume 17. Number 1.
Blaustein, A. R. (2011) The complexity of amphibian population declines: understanding
the role of cofactors in driving amphibian losses. Annals of the New York
Academy of Sciences 1223(1):108-119. 69
Bohmann, K., Evans, A., Gilbert, M. T. P., Carvalho, G. R., Creer, S., Knapp, M., Bruyn,
M. (2014). Environmental DNA for wildlife biology and biodiversity monitoring.
Trends in Ecology & Evolution 29(6): 358–367.
Casper, G.S. (1998) Review of the status of Wisconsin amphibians. Pp. 199-205. Status
and Conservation of Midwestern Amphibians (M.J. Lannoo, Ed.). University of
Iowa Press, Iowa City, Iowa.
Chellman, I.C., D.L. Parrish. (2010) Developing methods for sampling mudpuppies in
Vermont tributaries of Lake Champlain. Final Report. State Wildlife Grants
Program, Vermont Fish and Wildlife, Waterbury.
Christie, G. (2000) Protecting Mudpuppies, Protecting Stream Ecosystems. Great Lakes
Fishery Commission Forum, Volume 7. Fall 2000.
Collen, B., Whitton, F., Dyer, E. E., Baillie, J. E. M., Cumberlidge, N., Darwall, W. R.
T., (2014) Global patterns of freshwater species diversity, threat and endemism.
Global Ecology and Biogeography 23: 40–51.
Craig, J. M., Mifsud, D. A., Briggs, A. S., Boase, J.,and Kennedy, G. (2012) Mudpuppy
(Necturus maculosus maculosus) spatial distribution, breeding water depth, and
use of artificial spawning habitat in the Detroit River. Herpetological
Conservation and Biology 10(3): 926–934.
Eycleshymer, A. C. (1906) The habits of Necturus maculosus. The American Naturalist,
40(470), 123–136.
Hoffman, A. S., Robb, J. R., Fisher, B. E. (2014) Recent records for mudpuppies
(Necturus maculosus) in Indiana with notes on presumed declines throughout the
Midwest. Proceedings of the Indiana academy of science 123(1): 1–6. 70
Holman, J. A. (2006). Fossil salamanders of North America. Indiana University Press.
Hutchison, V. H, L. G. Hill. (1976) Thermal selection in the hellbender, Cryptobranchus
alleganiensis, and the mudpuppy, Necturus maculosus. Herpetological
Monographs:327-331.
Jane, S. F., Wilcox, T. M., Mckelvey, K. S., Young, M. K., Schwartz, M. K., Lowe, W.
H., Whiteley, A. R. (2015) Distance, flow and PCR inhibition: eDNA dynamics in
two headwater streams. Molecular Ecology Resources, 15(1), 216–227.
Jerde, C. L., Mahon, A. R., Chadderton, W. L., Lodge, D. M. (2011) “Sight-unseen”
detection of rare aquatic species using environmental DNA: eDNA surveillance of
rare aquatic species. Conservation Letters, 4(2), 150–157.
Laramie, M. B., Pilliod, D. S.,Goldberg, C. S. (2015) Characterizing the distribution of an
endangered salmonid using environmental DNA analysis. Biological
Conservation, 183, 29-37.
Matson, T.O. (2013) Necturus Maculosus Chapter 23. Pp. 407-424. Amphibians of Ohio.
Ohio Biological Society Bulletin New series. Volume 17. Number 1.
Matson, T. O. (2005) Amphibian Declines: The Conservation Status of United States
Species (M. Lannoo, Ed.) Berkely, CA: University of California Press.
Matson, Timothy O. (1998): Evidence for home ranges in mudpuppies and implications
for impacts due to episodic applications of the lampricide TFM. Pp. 278–287.
Status and Conservation of Midwestern Amphibians. University of Iowa Press,
Iowa City, IA 278-287.
McDaniel, T. V., Martin, P. A., Barrett, G. C., Hughes, K., Gendron, A. D., Shirose, L.,
Bishop, C. A. (2009) Relative abundance, age structure, and body size in 71
mudpuppy populations in southwestern Ontario. Journal of Great Lakes
Research, 35(2), 182–189.
Minton, S.A. (1998) Observations on Indiana amphibian populations: a forty-five-year
overview. Pp. 217-220. Status and Conservation of Midwestern Amphibians (M.J.
Lannoo, Ed.) University of Iowa Press, Iowa City, Iowa.
Naiman and, R. J., Decamps, H. (1997). The ecology of interfaces: riparian zones.
Annual review of Ecology and Systematics, 28(1), 621-658.
Naylor, B. G. (1978) The earliest known Necturus (Amphibia, Urodela), from the
paleocene Ravenscrag Formation of Saskatchewan. Journal of Herpetology,
12(4), 565.
Parzefall, J., Durand, J. P., & Richard, B. (1980) Chemical communication in Necturus
maculosus and his cave-living relative Proteus anguinus (Proteidae, Urodela)
Zeitschrift Für Tierpsychologie, 53(2), 133–138.
Pfingsten, R.A., J.G. Davis, T.O. Matson, G.L. Lipps, Jr, D. Wynn,B.J. Armitage
(Editors) 2013. Amphibians of Ohio. Ohio Biological Survey Bulletin New Series.
OHIO, EPA. (2012) Biological and Water Quality Study of Southeast Ohio Tributaries
2010 and 201, Jackson, Scioto, and Lawerence Counties (pp. 1-72, Publication)
OHIO EPA: Ohio Division of Surface Water.
OHIO, EPA (2012) An Overview of Groundwater Quality. Integrated Report Section A.
OHIO, EPA (2012) An Overview of Groundwater Quality. Integrated Report Section M.
OHIO, EPA. (2009) Total Maximum Daily Load for the Salt Creek Watershed (pp. 1-60,
Rep.) OH: OHIO EPA: Ohio Division of Surface Water.
72
OHIO, EPA (2006) Methods for Assessing Habitat in Flowing Waters: Using the
Qualitative Habitat Evaluation Index (QHEI). OHIO EPA Technical Bulletin
EAS/2006-06-1.
OHIO, EPA. 31, Dec. 1997 Report. Biological and Water Quality Study of the Upper
Hocking River and Selected Tributaries Fairfield and Hocking Counties,Ohio.
OHIO, EPA. March 1994 Report. “Ecological Recovery Endpoints for Streams Affected
by the Meigs #31 Mine Discharges during July - September 1993.”
Olson, Zachary H., Jeffrey T. Briggler, Williams, RN. "An eDNA approach to detect
Eastern Hellbenders (Cryptobranchus a. alleganiensis) using samples of water."
Wildlife Research 39.7 (2012): 629-636.
Pfingsten, R.A., White, A.M., (1989) Necturus maculosus (Rafinesque), mudpuppy. Ohio
Biological Survey, Columbus, Ohio pp. 72-78. Salamanders of Ohio vol. 7.
Pilliod, D. S., Goldberg, C. S., Arkle, R. S., Waits, L. P., Richardson, J. (2013)
Estimating occupancy and abundance of stream amphibians using environmental
DNA from filtered water samples. Canadian Journal of Fisheries and Aquatic
Sciences, 70(8), 1123–1130.
Pitt, A. L., Shinskie, J. L., Tavano, J. J., Hartzell, S. M., Delahunty, T., & Spear, S. F.
(2017) Decline of a giant salamander assessed with historical records,
environmental DNA and multi-scale habitat data. Journal of Freshwater Biology.
R Core Team (2016) R: A language and environment for statistical computing. R
Foundation for Statistical Computing, Vienna, Austria. 73
Sajdak, R. A. (1982) Seasonal activity patterns, habitat selection, and population structure
of the Mudpuppy, Necturus maculosus, in a Wisonsin Stream Master's Diss. The
University of Wisconsin-Milwaukee.
Santas, A. J., Persaud, T., Wolfe, B. A., Bauman, J. M., Santas, A. J., Persaud, T.,
Bauman, J. M. (2013) Noninvasive method for a statewide survey of Eastern
Hellbenders Cryptobranchus alleganiensis using environmental DNA.
International Journal of Zoology, 2013, 1–6.
Shoop, C. Robert, Gunning, Gerald (1967): Seasonal activity and movements of Necturus
in Louisiana. Copeia VOLUME 732-737.
Sodhi, N. S., Bickford, D., Diesmos, A. C., Lee, T. M., Koh, L. P., Brook, B. W.
Bradshaw, C. J. (2008). Measuring the meltdown: drivers of global amphibian
extinction and decline. PloS one, 3(2), e1636.
Spear, S. F., Groves, J. D., Williams, L. A.,Waits, L. P. (2015) Using environmental
DNA methods to improve detectability in a hellbender (Cryptobranchus
alleganiensis) monitoring program. Biological Conservation, 183, 38–45.
Strickland, T., Fisher, G. L.,Governor, L. (2006) Field Evaluation Manual for Ohio’s
Primary Headwater Habitat Streams. Publisher OHIO EPA.
Strickler, K. M., Fremier, A. K., Goldberg, C. S. (2015) Quantifying effects of UV-B,
temperature, and pH on eDNA degradation in aquatic microcosms. Biological
Conservation, 183.85–92.
Swanson, F. J., S. V. Gregory, J. R. Sedell, and A. G. Campbell. "Land-water
interactions: the riparian zone." (1982): 267-29. 74
Thomsen, P. F. Willerslev, E. (2015) Environmental DNA–an emerging tool in
conservation for monitoring past and present biodiversity. Biological
Conservation, 183, 4–18.
Voros J, Marton O, Schmidt BR, Gal JT, Jelić D (2017) Surveying Europe’s only cave
dwelling cordate species (Proteus anguinus) using environmental DNA. PLoS
ONE 12(1)
Wheeler, B. Prosen, E. Mathis, A. Wilkinson, R. (2003) Population declines of a long-
lived salamander: a 20+-year study of hellbenders, Cryptobranchus alleganiensis.
Biological Conservation 109(1): 151-156.
WWF. (2016) Living Planet Report 2016. Risk and resilience in a new era. Gland,
Switzerland: WWW International 75
APPENDIX A: MYRON MEASUREMENTS
Date Crane Hollow pH Conductivity TDS ORP Temperature 5/30/16 Head 6.5 86.1 70 73 19 Midpoint 6.7 88.9 78 87 19.4 6/17/16 Head 6.6 88.1 71.2 90 19.1 7/5/16 Head 6.9 90.6 58.2 76 19 Mid-Point 7.2 97.7 62.7 116 19.7 7/10/16 Head 6.5 86.4 55.6 131 18.8 Confluence 7.3 141.5 90.7 100 22 8/9/16 Head 6.7 87.7 55.9 123 20.2 Confluence 7.5 144.3 90.8 102 21.5 8/22/16 Head 6.3 82 76.3 120 21.2 Mid-Point 7.0 90.1 78 98 22 8/23/16 Confluence 7.6 144.3 91.8 88 23.1 9/24/16 Head 7.2 101.2 88 78 20.7 Confluence 7.6 130.6 91.7 101 22.1 10/2/16 Head 6.4 78.9 70.5 98 16.5 Mid-Point 6.7 80.3 66.7 100 16.9 Confluence 7.4 120.1 96.6 102 18.8 11/11/16 Head 6.5 88 70.5 90 15.1 Mid-Point 7.1 102.1 81 101 16 Confluence 7.5 122 102.5 121 17.1 AVERAGE 6.96 102.5 77.3 99.75 19.4 Date Clear Creek pH Conductivity TDS ORP Temperature 5/19/16 Pt1 8.57 464.3 314.3 138 17.6 Midpt 8.01 400.9 312.3 166 16.9 Endpt 8.50 417.2 300 158 17.2 6/1/16 Pt1 8.36 456.1 335 145 18.4 Midpt 8.20 412.3 312.8 171 17.6 Endpt 8.45 410.3 301.2 156 18.1 6/30/16 Pt1 8.41 492.3 332.1 170 19.8 Midpt 8.12 420.1 315.6 165 18.8 Endpt 8.2 405 300.4 165 19.1 7/6/16 Pt1 8.34 490.1 338.1 152 20.1 Midpt 8.11 430.6 317.8 170 19.5 Endpt 8.0 400 310.4 169 19.4 7/15/16 Pt1 7.79 328.7 256.1 102 21.2 Midpt 8.10 398.4 289.1 141 20.8 Endpt 7.78 345 244 160 20.7 8/8/16 Pt1 8.31 428.7 287.7 106 22.5 Midpt 8.4 406.6 304.5 188 21.4 Endpt 8.1 400 302.1 165 21.6 9/22/16 Pt1 8.23 445.1 234.7 100 23.4 76
Midpt 8.0 399.1 300.7 176 22.1 Endpt 7.78 405 330 170 22.8 10/16/16 Pt1 8.1 409 304.6 130 20.7 Midpt 8.1 401.2 308.8 181 20.0 Endpt 7.67 399 400 176 19.6 11/25/16 Pt1 7.79 328.8 256.1 109 16.3 Midpt 8.2 304 330 199 15.9 Endpt 8.0 300 277 180 15.4 AVERAGE 8.1 403.6 304.2 155.8 19.5 Date Forked Run pH Conductivity TDS ORP Temperature 5/27/16 Spill 7.98 161.3 102 104 28.1 MdPt 7.61 160.3 100 109 27.4 End 7.65 130 122 105 27.8 6/18/16 Spill 7.89 158.2 101.6 169 28.1 MdPt 7.77 161 102 109 27.5 End 7.4 123 124 110 27.9 7/9/16 Spill 7.28 123 78.9 125 27.7 MdPt 7.78 104 89.5 110 27.9 End 7.56 128 67.5 102 28.9 7/21/16 Spill 8.2 125 103 100 29.4 MdPt 7.98 130 90.1 100 29.0 End 8.4 144 105 110 29.0 8/10/16 Spill 8.33 124.6 79.8 90 30.1 MdPt 8.1 133 87 91 29.7 End 7.79 150 100 100 30.2 9/26/16 Spill 7.98 128.3 82.6 102 28.1 MdPt 8.0 129 90.3 99 27.7 End 7.98 130 102 111 27.5 10/22/16 Spill 7.6 140 101 99 26.1 MdPt 7.89 135.6 102 120 26.0 End 7.78 140 110 140 26.3 11/28/16 Spill 7.89 189 99.8 123 25.7 MdPt 7.78 130 113 128 25.5 End 7.23 144 100 112 25.6 AVERAGE 7.8 138.3 98.0 111.1 27.8 Date Hocking Site 1 pH Conductivity TDS ORP Temperature 5/25/16 Whites 8.8 716 556.1 122 26.6 Rich Bridge 8.7 800 450.7 102 26.8 Stim Bridge 8.4 778 400.3 120 27.1 6/21/16 Whites 8.2 751 514.4 158 26.0 Rich Bridge 8.4 776 409.7 115 26.6 Stim Bridge 8.2 700 412.5 117 27.2 7/13/16 Whites 8.2 711.5 453 66 27.7 Rich Bridge 8.5 750 404 89 27.8 77
Stim Bridge 8.4 698 399 90 27.9 8/26/16 Whites 7.7 1146 796.3 121 31.3 Rich Bridge 8.2 1181 864.8 108 30.7 Stim Bridge 7.7 1189 788.9 104 31.2 9/9/16 Whites 7.9 1123 897.9 114 32.1 Rich Bridge 8.0 1132 900.6 112 32.0 Stim Bridge 8.2 1145 854 109 31.9 10/24/16 Whites 8.1 1143 867.3 112 28.2 Rich Bridge 8.2 1212 845.6 119 28.0 Stim Bridge 7.9 1289 833.4 104 27.8 11/17/16 Whites 8.0 988 677 103 26.6 Rich Bridge 8.3 967 701 100 26.8 Stim Bridge 7.9 1001 804 155 26.1 AVERAGE 8.1 961.7 658.5 111.4 28.4 Date Hocking Site 2 pH Conductivity TDS ORP Temperature 5/25/16 Boat Ramp 8.0 506.7 388.1 173 26.2 Bike Path 8.2 667.4 461.4 188 26.4 Good WF 8.1 589.9 403.2 181 26.5 6/21/16 Boat Ramp 8.2 615.8 420.8 170 26.4 Bike Path 8.4 688.7 445.7 200 26.5 Good WF 8.1 599.7 428.9 167 26.8 7/13/16 Boat Ramp 8.1 609.7 432.2 194 27.1 Bike Path 8.3 685.6 468.2 202 27.1 Good WF 8.0 598.9 417.9 173 27.2 8/26/16 Boat Ramp 8.1 694.4 458.3 100 27.3 Bike Path 8.03 691.4 472.2 94 27.3 Good WF 8.0 689.1 443.3 89 27.1 9/9/16 Boat Ramp 8.2 718.3 445.6 112 27.0 Bike Path 8.1 726.1 496.6 170 27.2 Good WF 8.0 700.8 405.9 116 27.1 10/24/16 Boat Ramp 8.2 677.8 443.8 98 26.3 Bike Path 8.0 598.0 412.8 99 26.3 Good WF 8.1 564.8 401.6 97 26.2 11/17/16 Boat Ramp 8.1 555.1 337.8 102 25.9 Bike Path 8.1 517.1 300.6 108 25.7 Good WF 8.0 506.8 276.8 105 25.6 AVERAGE 8.1 628.6 417.2 139.9 26.6 Date Queer Creek pH Conductivity TDS ORP Temperature 5/30/16 Falls 8.1 108.7 69.8 223 16.8 Md.Pt. 7.7 98.7 54.6 220 16.6 Amerine 7.5 96.4 67.9 215 16.9 6/28/16 Falls 7.7 109.7 70.9 221 17.2 Md.Pt. 7.8 100.4 63.9 215 17.0 Amerine 7.7 102 64 210 17.3 78
7/11/16 Falls 7.0 130.8 83.8 145 19.8 Md.Pt. 7.1 113.2 72.7 98 23.9 Amerine 7.3 109 70.8 109 21.9 8/25/16 Falls 7.2 170.5 66 78 25.1 Md.Pt. 7.8 126 81.1 99 23.4 Amerine 7.3 134 97.0 112 22.8 9/16/16 Falls 7.6 112 68 142 20.1 Md.Pt. 7.3 127.1 70 134.7 21.1 Amerine 7.1 130 72 135.1 21.0 10/30/16 Falls 7.4 101 82.1 206 19.9 Md.Pt. 7.2 114 80.9 200 20.0 Amerine 7.1 118 80.7 200 20.1 11/14/16 Falls 7.3 160 67.7 259 15.2 Md.Pt. 7.1 123 70.1 251 15.6 Amerine 7.2 134 71.3 252 15.7 AVERAGE 7.4 119.9 72.6 177.3 19.4 Date Pine Creek pH Conductivity TDS ORP Temperature 5/27/16 Nest 7.2 330.8 213.4 193 20.8 Upstream Farm 7.5 340.9 245.8 104 21.2 DownstreamFarm 7.4 346.6 252.4 101 21.3 6/30/16 Nest 7.3 227.0 117.9 200 20.9 Upstream Farm 7.4 328.9 240.1 106 21.1 DownstreamFarm 7.3 356.7 245.6 100 21.6 7/19/16 Nest 7.1 189.1 121.1 198 20.7 Upstream Farm 7.5 317.4 228.3 104 21.6 DownstreamFarm 7.3 342.1 234.5 100 21.6 8/9/16 Nest 7.4 214.3 140.1 104 25.1 Upstream Farm 6.9 248.6 236 102 25.3 DownstreamFarm 7.1 179.2 211 102 25.2 9/30/16 Nest 7.7 235.7 154.3 86 21.2 Upstream Farm 7.6 189.9 123.4 97 21.7 DownstreamFarm 7.3 190.2 123.6 111 21.6 10/10/16 Nest 7.5 206.8 132.5 206 20.6 Upstream Farm 7.6 190.1 143.4 167 20.7 DownstreamFarm 7.4 214.5 198.8 137 20.8 11/14/16 Nest 7.3 230.1 121.4 215 19.5 Upstream Farm 7.4 261.1 200.1 181 19.5 DownstreamFarm 7.3 278.8 156 189 19.6 AVERAGE 7.3 258.0 182.8 138.2 21.5 Date Raccoon Creek pH Conductivity TDS ORP Temperature 5/20/16 Moonville 7.1 445 251.1 223 22.1 Path Bridge 6.9 678 261.5 201 22.2 Forest 6.7 598 243.1 199 22.3 6/22/16 Moonville 7.3 449 287.1 224 23.1 79
Path Bridge 7.0 659 247.3 198 22.8 Forest 7.4 617 221 205 23.1 7/24/16 Moonville 7.3 408.5 272.8 81 27.3 Path Bridge 7.4 601.8 256.7 99 27.1 Forest 7.1 512.3 198.6 111 26.9 8/25/16 Moonville 7.2 516.1 233 90 27.2 Path Bridge 7.0 671.1 267.8 114 26.9 Forest 7.2 599.1 237.7 98 27.3 9/6/16 Moonville 7.2 475 242 210 26.8 Path Bridge 7.3 618.9 255 101 27.2 Forest 7.0 500.8 221 101 27.0 10/1/16 Moonville 7.1 360 240.4 230 25.1 Path Bridge 7.3 498 211 103 25.5 Forest 7.1 401 234.6 177 24.9 11/22/16 Moonville 7.2 701 302.5 215 23.1 Path Bridge 7.1 596.7 234.1 201 23.5 Forest 7.2 601.3 215.6 200 23.4 AVERAGE 7.1 547.9 244.4 161 24.9 Date Hewett-Fork pH Conductivity TDS ORP Temperature 5/22/16 Kings Hollow 7.1 436.9 289.9 91 21.1 Mid Pt 6.7 522.2 448.9 49 21.3 Waterloo 6.1 889.7 386.8 4 21.8 6/15/16 Kings Hollow 6.9 456.1 245.2 101 21.2 Mid Pt 6.5 607.9 303.9 65 21.3 Waterloo 6.4 726.4 401 10 20.5 7/10/16 Kings Hollow 7.3 344 201 98 21.5 Mid Pt 7.1 571 215.9 80 21.6 Waterloo 6.9 600.1 588.7 10 21.4 8/23/16 Kings Hollow 7.2 477 289 88 24.5 Mid Pt 7.0 649 382 40 24.6 Waterloo 6.8 900.2 445.1 23 24.3 9/1/16 Kings Hollow 7.1 798 376.3 57 24.1 Mid Pt 6.9 873 401.3 15 23.8 Waterloo 6.5 1122 446.7 5 24.1 10/24/16 Kings Hollow 7.1 701 388 58 21.6 Mid Pt 7.1 899 402.9 28 22.0 Waterloo 6.9 900.1 445.1 23 21.9 11/13/16 Kings Hollow 7.1 799.9 349 40 20.6 Mid Pt 6.9 801.4 421 34 20.8 Waterloo 6.7 899.9 457.7 19 20.7 AVERAGE 6.8 713 375.4 44.6 22.1 Date Leading Creek pH Conductivity TDS ORP Temperature 5/21/16 Insinger 7.6 1100 598.3 176 20.7 Rt 124 7.7 989 600.1 170 20.9 80
Middleport 7.5 904 577 140 21.3 6/14/16 Insinger 7.7 863.8 596.5 173 22.7 Rt 124 7.8 979.1 500.9 201 23.1 Middleport 7.6 854.9 488 167 23.9 7/22/16 Insinger 7.7 862.1 595.7 92 26 Rt 124 7.7 2517 1889 152 23.5 Middleport 7.4 1089 980 145 23.9 8/17/16 Insinger 7.8 2557 1921 118 24.9 Rt 124 7.6 1984 1002 177 24.4 Middleport 7.7 945 1357 139 24.5 9/8/16 Insinger 7.8 1327 978 170 23.8 Rt 124 7.6 1045 873.4 189 23.6 Middleport 7.7 908 653 144 23.9 10/7/16 Insinger 7.7 1033 921 201 22.8 Rt 124 7.6 1001 873 111 22.6 Middleport 7.7 990 901 120 22.9 11/28/16 Insinger 7.6 760 405 220 21.8 Rt 124 7.7 800 340 189 21.2 Middleport 7.7 567 230 140 21.5 AVERAGE 7.6 1146.4 822.8 158.7 23.0
! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !
Thesis and Dissertation Services ! !