Mapping and Characterization of the Interaction Network of ALK Receptor Tyrosine Kinase Using the Mammalian Membrane Two-Hybrid (Mamth) Assay

Mapping and Characterization of the Interaction Network of ALK Receptor Tyrosine Kinase using the Mammalian Membrane Two-Hybrid (MaMTH) Assay

Farzaneh Aboualizadeh

A thesis submitted in conformity with the requirements for the degree of Master of Science

Graduate Department of Biochemistry University of Toronto

Farzaneh Aboualizadeh Master of Science Graduate Department of Biochemistry University of Toronto 2018

Abstract

Anaplastic Lymphoma Kinase (ALK) which belongs to the Receptor Tyrosine Kinases

(RTKs) play a critical role in development and progression of many type of cancers. To design new treatments for ALK associated human diseases, it is essential to study the interactions of the protein to better understand the biological significance of its protein-protein interactions (PPIs) and how they contribute to ALK regulation and function. Novel high-throughput technology, the

Mammalian Membrane Two-Hybrid (MaMTH), was used in this study to generate a targeted protein-protein interaction map (interactome) of full length ALK.

Biased screening of 150 predicted and previously known ALK interactors were performed and 34 identified as novel ALK interactors. The active mutant cells stably expressing

ALK F1245C, F1245I and L1196M have been generated which showed more phosphorylation of

ALK (pALK1604) as compared to wild type. Moreover, these active mutants exhibited more phosphorylation of downstream signaling ERK1/2 as compared to wild type.

ii Acknowledgments

I would like to express my sincere gratitude to my supervisor, Dr. Igor Stagljar, for the useful advices, remarks and engagement through the learning process of this master thesis. His guidance helped me in all the time of research and writing of this thesis. I would like to thank him for his moral and emotional support during my study. Additionally, I would like to thank my committee members, Dr. Liliana Attisano, Dr. Daniela Rotin and Dr. Vuk Stambolic for their support on the way.

A very special gratitude goes out to Dr. Jamie Snider who supported me in any way possible. I would like to thank him for helping me with my project and research and answering countless questions.

I would like to thank all members of Stagljar lab for their never-ending support. They provided a friendly and cooperative atmosphere at work and useful feedback and insightful comments on my work.

I wish to thank Dr. Tania Christova for her willingness to help whenever needed. I really appreciate it.

Finally, I would like to express my profound gratitude to my spouse for providing me with unfailing support and continuous encouragement throughout my years of study and through the process of researching and writing this thesis. This accomplishment would not have been possible without him.

My eternal gratitude goes to my parents and my brothers for their understanding, never-ending love, moral support, endless patience and encouragement as and when required.

iii Table of Contents

Acknowledgments…………………………………………………………………………….....iii Table of Contents………...…………………………………………………………………...... iv Abbreviations…………………………………………………………………………………....ix List of Tables……..………………………………………………………………………………x List of Figures………...…………………………………………………………………...... xi List of Appendices…………………………………………………………………………...... xiii 1 Chapter 1: Introduction…………………………………………………………………1 1.1 Protein Kinases…………………………………………………………………...1 1.2 Protein tyrosine kinases……………………………………………………….....2 1.2.1 Receptor Tyrosine Kinases (RTKs)…………………………………...…..3 1.2.1.1 Classification and structure of RTKs……………………………...4 1.2.1.2 Mechanism of action of RTKs………………………...... 6 1.2.1.3 Regulation of RTKs…………….………………………………....8 1.2.1.4 RTKs and signaling pathways………………….………….……...8 1.2.1.5 RTKs in human diseases………………………….………...... 9 1.3 Anaplastic Lymphoma Kinase (ALK) …………………………………….…...9 1.3.1 ALK function and structure…………………...... 10 1.3.1.1 Structure of ALK kinase domain…….……………………….….12 1.3.2 ALK activation and downstream signaling…………………………...... 13 1.3.2.1 ALK phosphorylation and activation………...... 13 1.3.2.2 ALK downstream signaling….……………………………….….15 1.3.3 ALK in disease……………………………………………...……………...17 1.3.4 Inhibition of ALK activity…………..……………….………………….….21

1.3.5 Identification of human ALK interactors………………………….…….….23 Research objective……………………………………………………………………………...27 2 Chapter 2: Materials and methods…………………...…………………………….….28 2.1 General experimental methods……………….…………………………….….28 2.1.1 PCR amplification……………………………………………………...... 28 2.1.2 Agarose gel electrophoresis……...………….……………………………...28

iv 2.1.3 Sequencing DNA from TCAG (The Center for Applied Genomics)………29 2.1.4 Competent E. coli preparation using Inoue method……………….….……29 2.1.5 E. coli transformation using heat shock method…………………...………29 2.1.6 Glycerol stock preparation…………………………………………………30 2.1.7 DNA isolation from bacteria……………………………………………….30 2.1.8 Co-Immunoprecipitation (Co-IP) ………………………………………….30 2.2 Gateway cloning…………………………...………………………………...….31 2.2.1 Purification of entry clones…………………………….……...…………...31 2.2.2 Gateway LR cloning……….………….…………………….…………...... 31 2.3 Site-directed mutagenesis……….………………………………..………….…31 2.3.1 Primer design guidelines……….…………….…………………………….31 2.3.2 PCR amplification using site-directed mutagenesis primers………………32 2.3.3 DpnI digestion and transformation of mutagenized PCR product…………32 2.4 Tissue culture protocols…………………………………………..…………….33 2.4.1 Growing up cells from liquid nitrogen storage.…………………….…...…33

2.4.2 Freezing cells…….…………….…………………………...……….……...33 2.4.3 Cell splitting…….….…………….……………………………...... 33

2.4.4 Counting cells …….….…………….………………………………….…...34

2.4.5 Seeding cells in plate……….…………….……………….………………..34

2.4.6 Transient transfection of cells using standard CaCl2 method……………....35

2.4.7 Transfection of stable cells using standard CaCl2 method…………………35 2.4.8 Transfection of cells using FLP-In TREx system………………………….36 2.4.9 Transfection of cells using lipofectamine 3000……………………………36 2.4.10 Picking foci………….……………………………………………………37 2.4.11 Luciferase assay…….…………………………………………………….37 2.4.12 Cell viability assay….…………………………………………………….37 2.5 Western immunoblotting protocols…………………………………..………..38 2.5.1 Protein extraction…………………………………………………………..38 2.5.2 Measuring protein concentration using Bradford assay……………………38

v 2.5.3 Preparation of stacking and resolving SDS polyacrylamide gel for western immunoblotting…………………………….……………….……………………38 2.5.4 Gel electrophoresis of protein samples, transfer and western immunoblotting…………………………………………………...……………...39 2.6 ALK Bait generation…………………..………………..…………………..…..40 2.6.1 Gateway cloning of ALK gene into MaMTH bait vector………………….40 2.6.2 Transfection of C-tagged ALK bait into reporter cell line………………....40 2.6.3 Testing the expression of ALK-Cub-TF in the presence and absence of tetracycline……………………………………………………………………….40 2.7 Prey generation…………………………………...……………………………..41

2.7.1 Gateway cloning of preys into MaMTH prey vectors……………………...41 2.7.2 Testing the expression of MaMTH prey constructs………………………..41 2.8 Testing the interaction of bait and prey using MaMTH………………..…….41

2.9 Testing the interaction of bait and prey in serum starvation media………....42 2.10 Testing the interaction of bait and prey in the presence of drug using MaMTH………………………………………………………………………….42 2.11 Preparation of FAM150A and FAM150B ALK ligands……………...……...42 3 Chapter 3: Results……………………………………………………………………...44

3.1 Generation of stably integrated ALK-Cub-TF………………………..….…...44 3.2 Generation of N- and C-terminally tagged preys…………………..…….…...45 3.3 Targeted screening for ALK interactors using MaMTH in media +/- tetracycline…………………....…………………………………………………47 3.4 MaMTH experiment in serum starvation media…………………….……….49 3.5 Targeted screening for ALK interactors using MaMTH………………..…...50 3.6 Targeted screening for SH2/PTB domain containing prey library using MaMTH………………………………………………………………………….53 3.7 Summary of preliminary targeted screening of ALK wild type using MaMTH………………………………………………………………………….56 3.8 Validation of novel ALK interactors using Co-IP……………………..……...58 3.9 Active and kinase-dead forms of ALK……………………..………..………...59 3.9.1 Generation of ALK active and kinase-dead mutants………………...... …..59

vi 3.9.2 Expression and phosphorylation status of mutant ALK baits……………...60 3.9.3 Interaction of active and kinase-dead ALK mutants with ALK known interactors…………………………………………………………………...……61 3.9.4 Characterization of downstream signaling of ALK wild type and mutants using Western immunoblotting…...………………………………………..…….62 3.9.5 Characterization of tyrosine phosphorylation of ALK wild type and mutants in the presence of Brigatinib……………………………………..………………64 3.10 Investigating phosphorylation-dependent interactions of ALK wild type using MaMTH…………………………………………………………………..66 3.11 Assessment of cell viability in the presence of brigatinib……………...... ….67 3.12 Testing phosphorylation-dependent interactions of ALK wild type at different concentrations of brigatinib, using MaMTH……………………….68 3.13 Characterization of ALK bait expression and downstream signaling in the presence of Brigatinib……………………………………..……………………69 3.14 Testing phosphorylation-dependence of ALK wild type interactions at 25nM concentration of brigatinib……………………...……………………………...70 3.15 Functional characterization of ALK interactors……………………………...72 3.16 Investigating the effect of FAM150A and FAM150B ALK ligands………….70 4 Chapter 4: Discussion…………………………………………………………………..74 4.1 Generation of bait and prey constructs and optimization of MaMTH……...74

4.2 MaMTH could detect condition-dependent PPIs of ALK bait...... ……..…76 4.3 Analysis of targeted MaMTH screening with ALK bait……..…………...... 76 4.4 Validation of ALK interactors……………………..…………………………..78 4.5 Investigating the ALK active mutants………………………...……………….78 4.6 Monitoring phosphorylation-dependent interactions………………...………80 4.7 Analysis of functional characterization of ALK interactors………...…….....81 5 Chapter 5: Conclusion and future directions……………………………………….83 5.1 Targeted screening of HEK293 cell line stably expressing ALK wild type resulted in detection of 34 novel ALK interactors…………………………….83 5.2 MaMTH detected constitutive activation of ALK……………….…………...83 5.3 MaMTH identified phosphorylation-dependent interactions……..…………84

vii 5.4 Study the functional effects of PPIs to understand ALK function……..……84 References……………………………………………………………………………………….86

viii Abbreviations

RTK Receptor Tyrosine Kinase ALK Anaplastic Lymphoma Kinase EGFR Epidermal Growth Factor Receptor AML Acute Myeloid Leukemia NPM Nucleophosmin ALCL Anaplastic Large Cell Lymphoma LTK Leukocyte Tyrosine Kinase Tyr Tyrosine LDLa Low Density Lipoprotein class A MAM Meprin, A-5 protein, receptor protein tyrosine phosphatase Mu PTN Pleiotrophin MDK Midkine EML4 Echinoderm Microtubule-associated protein Like 4 NSCLC Non-Small Cell Lung Cancer PPI Protein-Protein Interaction Co-IP Co-Immunoprecipitation LUMIER Luminescence-based Mammalian Interactome FRET Fluorescence Resonance Energy Transfer HTS High-Throughput Screening MaMTH Mammalian Membrane Two-Hybrid DUB Deubiquitinating Enzymes Cub C-terminal half of ubiquitin Nub N-terminal half of ubiquitin TF Transcription Factor UAS Upstream Activating Sequence Tet Tetracycline HA Hemaglutinine

ix List of Tables

Table 1. List of ALK mutations known to be oncogenic………………………………………...20

Table 2. Plate sizes and volumes……………………….………………………………………...34

Table 3. Number of cells seeded in different plates……………………………………………...35

x List of Figures

Figure 1. Protein tyrosine kinase family tree……………………………………………………...3

Figure 2. Classification of human Receptor Tyrosine Kinase (RTKs)……………………………5

Figure 3. Crystal structure of active (green) and inactive (grey) forms of EGFR………………...7

Figure 4. Structure of ALK………………………………………………………………………11

Figure 5. Ribbon diagram of the ALK kinase domain……………………...……………………13

Figure 6. Downstream signaling of the ALK receptor tyrosine kinase………………………….17

Figure 7. Summary of different ALK-positive diseases…………………………………………21

Figure 8. Outline of the MaMTH System………………………………………………………..27

Figure 9. Western blot analysis of HEK293 stable cell line expressing ALK bait………………45

Figure 10. Prey expression in HEK293 cell line stably expressing ALK-Cub-TF………..……..47

Figure 11. MaMTH biased screening of HEK293T-ALK with N- and C-tagged preys .…….…48

Figure 12. HEK293-ALK MaMTH in full media and serum starved conditions …………...…..50

Figure 13. MaMTH biased screening of HEK293-ALK with N- and C-tagged preys……...... 53

Figure 14. MaMTH targeted screening of HEK293-ALK bait with N-tagged SH2 and PTB domain-containing proteins …………………………………………...... 56

Figure 15. Summary of targeted MaMTH assays performed with ALK.……………..………....57

Figure 16. Validation of novel identified ALK interactors in MaMTH using Co-IP……………59

Figure 17. Expression and phosphorylation status of mutant and wild type ALK baits………...61

Figure 18. Interactions of Active and Kinase-dead mutants in MaMTH …………………….....62

Figure 19. Downstream signaling of ALK wild type and mutants………………………………64

Figure 20. Tyrosine phosphorylation of ALK wild type and mutants (F1245C, L1196M and I1250T) in the presence of Brigatinib…………………………………………………………....65

xi Figure 21. MaMTH for screening phosphorylation-dependent protein-protein interactions……67

Figure 22. Cell viability assay of HEK293-ALK in the presence of brigatinib………...……….68

Figure 23. Phosphorylation-dependent interactions of ALK wild type at different concentrations of brigatinib using MaMTH……………………………………………………………………...69

Figure 24. Expression and downstream signaling of ALK wild type bait in the presence of 25nM brigatinib…………………………………………………………………………………………70

Figure 25. MaMTH screening for phosphorylation-dependent protein-protein interactions……71

Figure 26. Functional characterization of novel ALK interactors identified in MaMTH……….72

Figure 27. Ligand stimulation of HEK293-ALK……………………………………………...…74

xii List of Appendices

Appendix1……………………………………………………………………………….………96 A1.1: Media………………………………………………………………………96 A1.2: Antibiotics…………………………………………………………………96 A1.3: Chemical solutions…………...……………………………………………97 A1.4: Molecular biological kits………………………………………………...101 A1.5: Antibodies………………………………………………………………..101 A1.6: Plasmids……………………………………………………………….....102 A1.7: Mammalian cell line……………………………………………….……..102 A1.8: Oligonucleotides……………………………………………….………....102

Appendix2……………………………………………………………………………………...104 A2.1: Supplementary tables…………………………………………………….104 A2.2: Supplementary figures……………………………………………….…...107

xiii 1

Chapter 1 Introduction

1.1: Protein Kinases

Protein kinases are one of the largest families of human proteins, representing 2% of human genes (Manning, 2002). They transfer a phosphate group from adenosine triphosphate (ATP) to the free hydroxyl group of tyrosine or serine/threonine via a process called phosphorylation (Manning, 2002). Protein kinases phosphorylate more than 30% of cellular proteins (Ubersax & Ferrell, 2007) and phosphorylation is one of the most common post-translational modifications resulting in the functional change of a protein (Manning, 2002). Conformational changes induced by phosphorylation are highly dependent on the structural context of the phosphorylated protein. Upon phosphorylation, the phosphate group regulates the activity of the protein by creating a network of hydrogen bonds among specific amino acid residues nearby. This network of hydrogen bonds is governed by the three-dimensional structure of the phosphorylated protein and therefore is unique to each protein (Johnson, 2009).

Protein kinases play critical roles in regulation of different cellular pathways involved in signal transduction. Protein kinases are highly regulated because of their profound effect on the cell (Johnson, 2009), and dysfunction of protein kinases is associated with a wide range of human diseases such as cancer and autoimmune disorders, making them important therapeutic targets (Roskoski, 2012). They are classified as serine/threonine kinases, tyrosine kinases and tyrosine kinase-like proteins, based on the nature of the -OH group they target for phosphorylation. Serine/threonine kinases phosphorylate the -OH group of serine or threonine while tyrosine kinases phosphorylate tyrosine amino acid residues. Both types of kinase are used in signal transduction. Furthermore, there is another group of kinases which phosphorylate both tyrosine and serine/threonine residues and are classified as dual-specificity kinases (Roskoski, 2012). There are also protein kinases that phosphorylate other amino acids such as histidine kinases that phosphorylate histidine residues. Most histidine protein kinases are transmembrane proteins that are presumed to be receptors for extracellular signals and play role in signal transduction (Wolanin, Thomason, & Stock, 2002).

1.2: Protein tyrosine kinases

Protein tyrosine kinases are a large and diverse multigene family involved in cell growth, differentiation, adhesion, motility, and death. In humans, tyrosine kinases have been demonstrated to play important roles in the development of many diseases including cancers. Historically, tyrosine kinases are defined as a class of oncogenes involved in most forms of human malignancies, and have also been linked to different types of genetic disorders (Robertson, Tynan, & Donoghue, 2000) (Robinson, Wu, & Lin, 2000). Tyrosine kinases contain highly conserved catalytic domains, like those in protein serine/threonine and dual-specificity kinases, but with unique subdomain motifs that classify them as tyrosine kinases (Hanks & Quinn, 1991). They can be divided into two major groups; Receptor Tyrosine Kinases (RTKs) and non-receptor kinases (Roskoski, 2012) (Manning, 2002) (Figure 1). Among 90 tyrosine kinases in humans, 58 are RTK proteins and 32 are non-receptor tyrosine kinases, which fall into different subfamilies based on their kinase domain sequences (Lemmon & Schlessinger, 2010) (Robinson et al., 2000).

Figure 1. Protein tyrosine kinase family tree. Tyrosine kinases are divided into Receptor Tyrosine Kinases (RTKs) and non-receptor or cytoplasmic tyrosine kinases (Reproduced with permission from Manning, 2002).

1.2.1: Receptor Tyrosine Kinases (RTKs)

Membrane proteins encompass nearly 30% of the proteome (Stevens & Arkin, 2000) and play critical roles in different cellular processes. Determination of membrane protein structure and function has remained a challenge compared to other classes of proteins, due to the difficulty of studying full-length membrane proteins in their native environment with current experimental approaches (Doerr, 2009).

RTKs, the cell surface receptors, are characterized by intrinsic kinase activity and consequently by their ability for auto-phosphorylation (Ségaliny, Tellez-Gabriel, Heymann, & Heymann, 2015). RTKs transfer the  phosphate of ATP to hydroxyl groups of tyrosine residues on target proteins (Hunter, 1998). RTKs transmit signals from the cell surface into the cell through a process called signal transduction, and have been identified as essential regulators of fundamental cellular functions, such as cell proliferation, differentiation, survival, metabolism, migration, cytoskeletal rearrangement and cell cycle control (Lemmon & Schlessinger, 2010).

1.2.1.1: Classification and structure of RTKs

58 RTK proteins in humans are classified into 20 subfamilies based on their kinase domain sequences (Figure 2) (Lemmon & Schlessinger, 2010) (Robinson et al., 2000).

All RTKs have a similar molecular architecture consisting of an extracellular hydrophilic region which recognizes the ligand, a hydrophobic transmembrane region that makes embedding possible within the lipid bilayer of the plasma membrane and plays a role in the formation and stabilization of the dimer of the receptor, and an intracellular region dedicated to signal transduction within the cell. The extracellular region is involved in ligand binding and dimerization of the receptor. The composition of this region depends on the class of RTK and defines the specificity of the ligand. The intracellular region contains a tyrosine kinase domain, which transfers phosphate groups from ATP to tyrosine residues (a process called phosphorylation), as well as carboxy terminal and juxtamembrane regions (Lemmon & Schlessinger, 2010) (Ségaliny et al., 2015). The tyrosine kinase domain contains an activation loop which determines the active or inactive state of the enzyme (Ségaliny et al., 2015). The kinase domain of RTKs is composed of 12 subdomains organized into two lobes (small lobe/N lobe and large lobe/C lobe). The small lobe consists of ß-sheets and one α-helix and is involved in binding, stabilizing and orienting ATP which is in complex with Mg2+ ions. The large lobe predominantly consists of α-helices and plays a role in chelation of ATP and transfer of the phosphate group from ATP to the receptor chains (Hubbard & Till, 2000). The size of the tyrosine kinase domain is relatively constant between different RTKs. However, the size and content of the carboxy terminal and juxtamembrane regions differ between different RTKs

(Ségaliny et al., 2015). Additionally, the number of tyrosine residues (phosphorylatable or not) and their contributions are different between RTKs (Bradshaw, Chalkley, Biarc, & Burlingame, 2013).

It has been found that a pair of tyrosine residues in the activation loop get phosphorylated after activation of RTKs, which is required for the functionality of the receptor. The phosphorylation of these tyrosine residues stabilizes the open conformation of the activation loop and allows the ATP to bind (Hubbard & Till, 2000). The structure of RTKs is highly conserved from Caenorhabditis elegans to humans (Lemmon & Schlessinger, 2010).

Figure 2. Classification of human Receptor Tyrosine Kinases (RTKs). RTKs are categorized into 20 subfamilies (Lemmon & Schlessinger, 2010).

1.2.1.2: Mechanism of action of RTKs

In general, RTKs get activated by ligand-binding and dimerization. Ligands are growth factors, hormones, cytokines, neutrophilic factors and other extracellular signaling molecules (Regad, 2015). When a dimeric ligand associates with the receptor, it stabilizes the relationship between two receptors in a dimer. This non-covalent dimerization is associated with conformational changes that lead to activation of the cytoplasmic tyrosine kinase domain of RTKs. One receptor then phosphorylates specific tyrosine residues in the tyrosine kinase domain of the neighboring RTKs (a process called trans-phosphorylation) which causes activation of the RTKs. Some ligands such as EGF are monomeric, whose binding to their receptor induces conformational change that exposes a binding domain in the receptor and results in its dimerization (Ullrich J., 1990) (Lemmon & Schlessinger, 2010) (Ségaliny et al., 2015). However, some RTKs are present at the cell surface as oligomers (mostly dimers) even in the absence of the ligand, such as the insulin receptor and IGF1 receptor (Ward, Lawrence, Streltsov, Adams, & McKern, 2007). In such cases, binding of the ligand induces conformational changes within the receptor and releases auto-inhibition, which results in activation of the dimeric receptor (Lemmon & Schlessinger, 2010). Some RTKs such as Ret and MuSK require co-receptors or other proteins for activation through their ligands because they do not bind their ligands directly (Hubbard & Miller, 2007).

In the absence of the ligand, the activation loop adopts the closed conformation, which inhibits catalytic activity of RTKs (cis-inhibition). However, in the presence of ligand trans- phosphorylation of key tyrosine residues in the activation loop of RTKs stabilizes the open conformation which results in activation of kinase activity of RTKs (Ségaliny et al., 2015) (Hubbard, 2002). The crystal structure of active and inactive forms of epidermal growth factor receptor (EGFR) have been shown in Figure 3 as an example.

Figure 3. Crystal structure of active (green) and inactive (grey) forms of EGFR. In inactive EGFR structure, key auto-inhibitory interactions between the crucial αC helix and a short α helix at the beginning of the activation loop (magenta) displace the αC helix from the position it must adopt in the active kinase (S. C. Bresler et al., 2011).

Furthermore, phosphorylation of tyrosine residues in non-catalytic domains occurs mostly in juxtamembrane and C-terminal domains. These and other tyrosine residues in a phosphorylated state serve as docking sites for several cytoplasmic proteins involved in intracellular signal transduction (Ségaliny et al. 2015). These proteins can be enzymes, regulatory, or adaptor proteins, and will activate the downstream signaling cascades (Yao et al., 2017). They contain SH2 (Src Homology 2) and/or PTB (Phosphotyrosine-binding) domains which recognize phosphorylated tyrosine residues. The SH2 domain is a conserved protein structure, which is found in Src oncoprotein and many other intracellular signal-transducing proteins. SH2 domain- containing proteins bind to phosphotyrosine (Schlessinger & Lemmon, 2003). These proteins are often adaptor proteins for receptor-tyrosine pathways, and a subset of these proteins have an intrinsic enzymatic activity (Fantauzzo & Soriano, 2015). Proteins which are recruited to the phosphorylated tyrosine residues through their SH2 domain are named adaptor proteins and

8 proteins which bind directly to the receptor or through adaptor proteins are termed anchoring proteins (Ségaliny et al., 2015) (Pawson, Gish, & Nash, 2001).

PTB domains bind to a specific motif (Asn-Pro-Xaa-Tyr(P)) found in many tyrosine- phosphorylated proteins. Proteins can include several of these domains, for example SHC has both an SH2 and a PTB domain (Schlessinger & Lemmon, 2003) (Wagner, Stacey, Liu, & Pawson, 2013).

1.2.1.3: Regulation of RTKs

RTK activities must be tightly controlled by different regulatory mechanisms. There are some negative feedbacks which attenuate the activity of RTKs. One such feedbacks is activation of protein phosphatases which are recruited to activated RTKs and promote their dephosphorylation (Freeman, 2000) (Lemmon & Schlessinger, 2010). Protein phosphatases play an important role in controlling RTK activity and related downstream signaling pathways (Schlessinger, 2000) (Yao et al., 2017). Moreover, another general response in the activation of RTKs is receptor down-regulation. Down-regulation of RTKs involves internalization and endocytosis of the receptor in clathrin coated-pits following by intracellular degradation of the receptor by lysosomal enzymes (Sorkin & Goh, 2009) (von Zastrow & Sorkin, 2007) (Zwang & Yarden, 2009).

1.2.1.4: RTKs and signaling pathways

As mentioned above, RTKs are fundamental components of cellular signaling pathways and are important in many cellular processes such as cell growth and proliferation or differentiation (Hubbard & Miller, 2007). Activated RTKs recruit many different signaling proteins, therefore they can be thought as crucial points in a signaling network that transmit signals from the cell surface into cells (Lemmon & Schlessinger, 2010).

MAPK (Mitogen-Activated Protein Kinases), PI3K (Phosphoinositide 3 Kinase) and Src (proto- oncogene tyrosine kinase Src) pathways as well as other signaling pathways involving PLC-γ

(Phospholipase C γ) and JAK/STAT (Janus Kinase/ Signal Transducer and Activator of Transcription) are the main RTK downstream signaling pathways (Ségaliny et al., 2015).

1.2.1.5: RTKs in human diseases

Abnormal expression or dysfunction of RTKs is responsible for several diseases and developmental disorders (Schlessinger, 2000). RTK activation which is deregulated in human cancers is mediated by different mechanisms such as autocrine activation, chromosomal rearrangements, overexpression and gain-of-function mutations (Lemmon & Schlessinger, 2010). About 30% of RTKs are mutated or overexpressed in different types of human cancers which results in constitutive activation of these receptors in the absence of their ligands (Ségaliny et al., 2015). For example, overexpression of EGFR and ErbB2 have been reported in lung (Lynch et al., 2004), breast (Bose et al., 2013) (Nakajima et al., 2014) and prostate cancer (Peraldo-Neia et al., 2011) (Fu et al., 2014). Moreover, mutations such as L858R and T790M which occur in the kinase domain of EGFR have been found in non-small-cell lung cancer (NSCLC) (Ladanyi & Pao, 2008) (Pao et al., 2005). In addition to EGFR kinase domain mutations, a deletion mutant found in gliomas, named EGFRvIV, lacks either two or three exons in its carboxyl tail (Frederick, Wang, Eley, & James, 2000) (Ekstrand, Sugawa, James, & Collins, 1992). Gain-of-function mutations in KIT have been found in various types of cancers such as Acute Myeloid Leukemia (AML) (Corless & Heinrich, 2008). In addition, FMS-like tyrosine kinase 3 (FLT3) mutation has been shown to occur frequently in AML (Levis & Small, 2003). Therefore, as RTKs are involved in numerous human disorders, development of RTK inhibitors has been strengthened in the last decades (Ségaliny et al., 2015).

1.3: Anaplastic Lymphoma Kinase (ALK)

Anaplastic Lymphoma Kinase (ALK) was first discovered in 1994 as the NPM-ALK fusion protein in Anaplastic Large Cell Lymphoma (ALCL) (Morris et al., 1994) (Shiota et al., 1994). The NPM-ALK fusion protein is created by chromosomal rearrangement between chromosomes (2;5) (p23; q35) and results in constitutively activated ALK kinase domain. The N-terminal portion of the nucleophosmin (NPM) gene is fused to the 3’ portion of the ALK gene in the NPM-ALK fusion protein (Morris et al., 1994). ALK belongs to the insulin receptor superfamily

10 of protein tyrosine kinases due to its high homology with other members of this family such as Leukocyte Tyrosine Kinase (LTK) (Lemmon & Schlessinger, 2010). The ALK gene is located at chromosome 2p23 in humans (Mathew et al., 1995) and encodes the 177 kDa ALK protein which undergoes post-translational modifications such as N-glycosylation to generate a mature protein of 220 kDa (Iwahara et al., 1997) (Pulford et al., 1997). Two isoforms of the ALK protein exists, the 220-kDa full-length receptor and the truncated 140-kDa protein which is a result of cleavage of the extracellular domain. The mechanism of such cleavage has not been clarified yet but it has been shown that this cleavage can be inhibited by an unidentified factor secreted by Schwann cells (Degoutin, Brunet-De Carvalho, Cifuentes-Diaz, & Vigny, 2009). Hallberg and Palmer suggested that cleaved ALK may be more stable or active than intact ALK, therefore cleavage of ALK may play a role in ALK activation (B. Hallberg & Palmer, 2016). The term anaplastic refers to the cells that have become differentiated (Roskoski, 2013).

1.3.1: ALK function and structure

ALK is thought to act early in development to help regulate the proliferation of nerve cells. Expression of ALK mRNA occurs in the nervous system through embryogenesis and its expression decreases after birth (Morris et al., 1997) (Iwahara et al., 1997) (Vernersson et al., 2006). The level of ALK mRNA and protein expression in mice reduces after birth and reaches a minimum after three weeks of age and is sustained at low levels in adult animals. Therefore; designing experiments that address the mechanism of function of ALK is difficult. Consequently, the normal function of the full length ALK receptor is not clear yet and there is not much known about the mechanism of function of ALK (Iwahara et al., 1997).

ALK is a single-chain 1620 amino acid (aa) transmembrane protein consisting of a 1030-aa extracellular ligand binding region, a 28-aa transmembrane-spanning region and a 276-aa intracellular tyrosine kinase domain (Figure 4) (Iwahara et al., 1997) (Morris et al., 1997) (Azarova, Gautam, & George, 2011).

The extracellular domain of ALK is unique among RTKs and consists of a 26-aa N-terminal signal peptide sequence, two MAM (meprin, A-5 protein, receptor protein tyrosine phosphatase mu) domains, one LDLa (low density lipoprotein class A) domain and a glycine-rich region. The

MAM domains consist of about 170 amino acid residues containing four cysteines that form two disulfide bridges. These domains are thought to have adhesive function and participate in cell- cell communication. The LDLa domain also contains two or more disulfide bridges and a cluster of negatively charged residues. The LDLa domain forms a binding site for LDL and calcium (Palmer, Vernersson, Grabbe, & Hallberg, 2009) (Li & Morris, 2008) (Roskoski, 2013). The glycine-rich domain consists of one stretch of eight consecutive glycine residues and two stretches of six consecutive glycine residues, however its function is not yet clear (Roskoski, 2013). The extracellular domain contains the ligand binding domain (Stoica et al., 2002) (Stoica et al., 2001).

The extracellular and intracellular regions are connected by a single pass transmembrane region.

The intracellular region contains a 64-aa juxtamembrane region and a tyrosine kinase catalytic domain. The tyrosine kinase catalytic domain contains three key tyrosine residues at the positions 1278, 1282 and 1283 within an activation loop which get phosphorylated upon ALK activation (Figure 4) (Roskoski, 2013).

Figure 4. Structure of ALK. ALK consists of an N-terminal extracellular region (aa 1-1030), a single-pass transmembrane region (aa 1030-1058) and a C-terminal intracellular region (aa 1122- 1620) (Azarova et al., 2011).

1.3.1.1: Structure of ALK kinase domain

The ALK kinase domain consists of a small amino-terminal lobe (N-lobe) and a large carboxyterminal lobe (C-lobe) (Knighton et al., 1991). The small lobe contains five antiparallel β-strands (β1- β5) (Taylor & Kornev, 2011), one regulatory αC-helix that appears in an active or inactive position and a conserved glycine-rich ATP-phosphate-binding loop or P-loop which occurs between the β1 and β2 strands. The glycine-rich loop helps position the β and γ phosphates of ATP for catalysis. The adenine part of ATP is situated between the β1 and β2 strands. There is a conserved lysine residue in the β3 strand which forms a salt bridge with a conserved glutamate residue in the αC-helix. This salt bridge is a prerequisite for the formation of the active form of the ALK receptor and corresponds to the αC-helix-in conformation. The absence of this αC-in conformation indicates that ALK receptor is in an inactive form (Figure 5) (Roskoski, 2013).

The large carboxy-terminal lobe is more α-helical and contains six conserved α helices (αD- αI) (Kornev & Taylor, 2010) and two β strands (β7- β8). The C-lobe consists of a catalytic loop defined by three amino acid residues (Lys, Asp, Asp) and an activation segment. The activation segment, which is the most important regulatory element in protein kinases, starts with DFG (Asp-Phe-Gly) and ends with PPE (Pro-Pro-Glu) in ALK (Roskoski, 2013) (Kornev & Taylor, 2010). The middle of the activation segment is called the activation loop which is the most varied part of the segment regarding length and sequence among protein kinases. This activation loop contains three key tyrosine residues which get phosphorylated upon ALK receptor activation as mentioned above (Roskoski, 2013).

The two main regulatory elements of the ALK kinase domain are the αC-helix within the small lobe and the activation segment within the large lobe (Figure 5) (Roskoski, 2013).

Figure 5. Ribbon diagram of the ALK kinase domain. The numbers from 1-5 represent the 5 β strands of the N-lobe of the ALK kinase domain. The αC-helix is viewed from its N-terminus (Roskoski, 2013).

1.3.2: ALK activation and downstream signaling

1.3.2.1: ALK phosphorylation and activation

Generally, activation of receptor tyrosine kinases occurs through ligand-induced dimerization of the receptor and trans-phosphorylation of specific tyrosine residues. The ALK activating ligands in Drosophila melanogaster and C.elegans are well-characterized and called Jeb (jelly belly) (Englund et al., 2003) (Lee, Norris, Weiss, & Frasch, 2003) (Stute, Schimmelpfeng, Renkawitz- Pohl, Palmer, & Holz, 2004) and Hen-1 (hesitation 1) (Ishihara et al., 2002), respectively. Dimerization and phosphorylation of mammalian ALK was shown in the presence of two secreted growth factors, pleiotrophin (PTN) and midkine (MDK), leading to activation of

PI3K/AKT downstream signaling (Powers, Aigner, Stoica, McDonnell, & Wellstein, 2002). Moreover, ligand activation of ALK has been shown to induce neuronal cell differentiation through the MAPK pathway (Degoutin et al., 2009) (Souttou, Carvalho, Raulais, & Vigny, 2001) (Motegi, Fujimoto, Kotani, Sakuraba, & Yamamoto, 2004). Although some researchers believe that PTN and MDK bind and activate ALK (Stoica et al., 2001) (Stoica et al., 2002) (Lu et al., 2005), others showed no activation of ALK and downstream signaling in the presence of PTN and MDK (Moog-Lutz et al., 2005) (Mathivet, Mazot, & Vigny, 2007). Therefore, mammalian ALK remained as an orphan receptor for a long time as the identity of its activating ligand was unclear. The knowledge of ALK activation comes from the ALK fusion proteins as well as activating point mutations and ALK overexpression in neuroblastoma (Maris, Hogarty, Bagatell, & Cohn, 2007) (Carén, Abel, Kogner, & Martinsson, 2008) (Chen et al., 2008) (George et al., 2008) (Bengt Hallberg & Palmer, 2013) (Janoueix-Lerosey et al., 2008) (Yaël P Mossé et al., 2008).

Recent studies of Zhang et al. demonstrated two novel secreted proteins as ligands for LTK family, FAM150A and FAM150B. Both proteins bind to the extracellular domain of LTK resulting in activation of downstream signaling in cell culture experiments (H. Zhang et al., 2014). Interestingly, Guan et al. reported that the two LTK ligands (FAM150A and FAM150B) are potent ALK ligands as well (Guan et al., 2015). ALK and LTK show kinase domain similarities as well as glycine-rich domain similarity in the membrane proximal portion of their extracellular domains (Iwahara et al., 1997) (Morris et al., 1997). Strong activation of downstream ALK signaling was observed in PC12 cells in the presence of the FAM150A and FAM150B proteins. Moreover, FAM150A and FAM150B could activate endogenous ALK signaling in neuroblastoma cells as well (Guan et al., 2015).

Like other RTKs, activation of ALK occurs through ligand-induced dimerization following by phosphorylation of those three key tyrosine residues in the activation loop of the kinase domain of ALK. It has been reported that for the NPM-ALK fusion protein, the tyrosine residue at position 1278 is phosphorylated first and then phosphorylation of Tyr1282 and Tyr1283 occurs later (Tartari et al., 2008). Whether this order of tyrosine phosphorylation occurs in native ALK remains unknown. Further studies are required to define the order of tyrosine phosphorylation of

15 the ALK activation loop as well as tyrosine residues in the juxtamembrane domain (Roskoski, 2013). Consequently; there is still much unknown about the mechanism of activation and function of native ALK (Roskoski, 2013).

1.3.2.2: ALK downstream signaling

Most studies of mammalian ALK signal transduction were performed with oncogenic ALK and little is known about physiological ALK signal transduction in mammals (Roskoski, 2013). To identify the ALK downstream signaling components, the focus of research has been on oncogenic ALK fusion proteins such as NPM-ALK and EML4-ALK. (B. Hallberg & Palmer, 2016). Differences in ALK fusion partners as well as the differences in tumor cell type and genetic background of the tumor cells result in differences in ALK signaling pathways (B. Hallberg & Palmer, 2016).

In general, ALK activates multiple signaling pathways such as PI3K (phosphatidylinositol 3- kinase)-AKT (PKB), Ras/Raf/MEK/ERK1/2, PLC-γ (Phospholipase C-γ), JAK/STAT (Janus Kinase/ Signal Transducer and Activator of Transcription) and CRKL–C3G (also known as RAPGEF1) which affect cell growth, transformation and anti-apoptotic signaling (Palmer et al., 2009) (Yael P Mossé, Wood, & Maris, 2009) (Chiarle, Voena, Ambrogio, Piva, & Inghirami, 2008). The JAK/STAT3 and PI3K/AKT pathways mediate cell survival and the PLC-γ and Ras/Raf/MEK/ERK1/2 pathways are involved in cell proliferation (Roskoski, 2013).

There are some adaptor proteins downstream of the ALK receptor which get activated upon activation of ALK. These proteins include fibroblast growth factor receptor substrate 2 (FRS2), insulin receptor substrate 1 (IRS1), SRC proto-oncogene, SHC and growth factor receptor-bound protein 2 (GRB2). ALK activation results in phosphorylation of specific tyrosine residues in the carboxyterminal tail and tyrosine kinase domain of ALK which then serves as a docking site for these adaptor proteins (Palmer et al., 2009). Studies with the NPM-ALK fusion protein revealed that the SHC adaptor protein binds to phosphorylated tyrosine residue at position 1507 and pTyr1604 is the binding site for PLC-γ (Palmer et al., 2009). Moreover, GRB2 interacts with the protein tyrosine kinase SRC which binds to pTyr1358. GRB2 also binds to SHC. SHC, PLC-γ, GRB2 and SRC are upstream of the Ras/Raf/MEK/ERK1/2 pathway (Chiarle et al., 2008).

The JAK/STAT3 pathway is one of the important pathways downstream of the ALK receptor (Palmer et al., 2009). Zhang et al. demonstrated that the NPM-ALK fusion protein induces activation of STAT3 (Q. Zhang et al., 2002) however, whether ALK phosphorylates STAT3 directly or through JAK3 remained unclear (Roskoski, 2013). Activation of STAT3 requires tyrosine phosphorylation which is catalyzed by the JAK tyrosine kinase. On the other hand, STAT3 phosphorylation is inhibited in the presence of the ALK inhibitor TEA-684 in murine Ba/F3 cells expressing the NPM-ALK fusion protein (Galkin et al., 2007). Moreover, Zhang et al. demonstrated that STAT3 is phosphorylated and activated in Karpus-299 cells by immunoprecipitation of NPM-ALK and STAT3 (Q. Zhang et al., 2002). Therefore, STAT3 is activated by ALK directly or indirectly through JAK3 (Chiarle et al., 2008).

Furthermore the PLC-γ pathway is identified as a downstream signaling pathway of the NPM- ALK fusion protein which plays a role in activation of the MAPK pathway leading to cell proliferation (Roskoski, 2013) (Roskoski, 2012). The characterization of ALK downstream signaling has focused on the oncogenic ALK fusion proteins and ALK signal transduction in mammals necessitates further studies (B. Hallberg & Palmer, 2016). ALK downstream signaling is shown in Figure 6.

Figure 6. Downstream signaling of the ALK receptor tyrosine kinase. ALK mediates signaling via the RAS–MAPK, PI3K–mTOR, phospholipase Cγ (PLCγ), RAP1, Janus kinase (JAK)–signal transducer and activator of transcription (STAT) and JUN pathways (Bengt Hallberg & Palmer, 2013).

1.3.3: ALK in disease

The ALK gene has been found to be rearranged, mutated or amplified in a series of tumors including Anaplastic Large-Cell Lymphoma (ALCL), neuroblastoma (a childhood tumor arising from precursor cells of neural cells) and Non-Small-Cell Lung Cancer (NSCLC). ALK can be oncogenic by gaining additional gene copies which has been shown in 15-20% of neuroblastoma cases. Moreover ALK form a fusion gene with other genes such as EML4-ALK which is responsible for approximately 3-5% of NSCLC (Chia, Dobrovic, Dobrovic, & John, 2014) (Jemal et al., 2004) (Shaw & Engelman, 2013) and NPM-ALK which is associated with ALCL

(Morris et al., 1994). ALK could be oncogenic also with mutations within the gene itself which have been reported in 8% of neuroblastomas (Yaël P Mossé et al., 2008).

The ALK locus seems to be a hotspot for chromosomal rearrangement for reasons that are not well characterized and almost always these translocations occur at exon 20 of the ALK locus resulting in production of the ALK fusion protein. Production of ALK fusion proteins leads to dimerization and constitutive activation of ALK which then plays an important role in driving tumorigenesis. However, the oncogenic outcome of ALK fusion proteins differ due to the differences in expression level and signaling characteristics of the fusion proteins as well as the tissue where the ALK translocations occur. In all ALK fusion proteins characterized to date, the entire kinase domain of ALK is fused to the amino terminal portion of partner proteins (Bengt Hallberg & Palmer, 2013) (B. Hallberg & Palmer, 2016). Almost 30 different ALK fusion proteins have been identified such as NPM-ALK in ALCL (Morris et al., 1994), EML4-ALK in NSCLC (Soda et al., 2007) and TPM4-ALK and TPM3-ALK in inflammatory myofibroblastic tumors (IMT) (Lawrence et al., 2000). A few of these fusion proteins have been well studied such as NPM-ALK in ALCL and EML4-ALK in NSCLC (B. Hallberg & Palmer, 2016). The EML4-ALK fusion protein occurs in only 5% of NSCLC cases, however the large number of NSCLC patients makes EML4-ALK the most dominant ALK gene translocation which accounts for approximately 40,000 new incidences per year worldwide (Chia et al., 2014) (Jemal et al., 2004) (Shaw & Engelman, 2013). Particular fusion proteins occur more regularly in a specific subtype of tumor cells such as EML4-ALK in NSCLC although other fusion proteins of ALK have been reported in NSCLC as well (B. Hallberg & Palmer, 2016).

Moreover, mutations in the ALK receptor tyrosine kinase have exhibited transforming potential in vivo (Chen et al., 2008). Activating or gain-of-function ALK mutations occur predominantly in the kinase domain of ALK resulting in constitutive ligand-independent activation of ALK. These activating mutations cause single amino acid substitutions and have been reported in neuroblastoma (Yaël P Mossé et al., 2008) and anaplastic thyroid cancer (Murugan & Xing, 2011). Germline as well as somatic activating mutations of ALK have been reported as major causes of neuroblastoma (Chen et al., 2008) (George et al., 2008) (Bengt Hallberg & Palmer, 2013) (Janoueix-Lerosey et al., 2008) (Yaël P Mossé et al., 2008). More than 35 ALK mutations

(mostly point mutations) have been reported (B. Hallberg & Palmer, 2016). There are three hotspot residues in the ALK kinase domain which account for 85% of mutations; F1174 (30%), R1275 (43%) and F1245 (12%). Bresler et al. found that R1275 is substituted with glutamine or leucine, F1174 is changed to leucine, isoleucine, valine, cysteine or serine and F1245 is altered to leucine, isoleucine, valine and cysteine (Scott C. Bresler et al., 2014). F1174L, R1275Q and F1245C mutations are gain-of-function ligand-independent mutations which have been reported in neuroblastoma patients (Chen et al., 2008) (George et al., 2008) (Schönherr, Ruuth, Yamazaki, et al., 2011) (Infarinato et al., 2016). It has been reported that F1174L and R1275Q mutations activate the ERK, JAK/STAT3 and PI3K/AKT downstream signaling pathways (Chen et al., 2008) (George et al., 2008) (Janoueix-Lerosey et al., 2008) (Yaël P Mossé et al., 2008). Moreover, the L1196M mutation occurs in the kinase domain of ALK and allows continued ALK activation in the presence of crizotinib, a tyrosine kinase inhibitor. L1196M interferes with crizotinib binding through steric hindrance (Choi et al., 2010).

In general, most of the ALK residues that get mutated in neuroblastoma occur in the activation loop and the αC-helix. These residues play roles in the auto-inhibition of ALK and when mutated result in activation of ALK. One possible reason would be that these mutations release the autoinhibitory effect and the αC-helix can rotate more freely (Azarova et al., 2011) (Bengt Hallberg & Palmer, 2013). There are two more groups of ALK mutations: ligand-dependent mutations which are not constitutively active and require ligand stimulation for activation, and kinase-dead mutations such as I1250T which are unable to phosphorylate tyrosine residues and activate downstream signaling (Bengt Hallberg & Palmer, 2013) (Schönherr, Ruuth, Eriksson, et al., 2011). A list of some known oncogenic ALK mutations is shown in Table 1.

Mutation Location Functional significance Tumor type References H694R Extracellular Increased phosphorylation, (Wang et al., 2011) promotes tumors in mice K1062M Juxtamembrane Transform cells, promotes Neuroblastoma (Chen et al., 2008) tumors in mice (Murugan & Xing, 2011) G1128A Kinase domain, Increased phosphorylation Neuroblastoma (Yaël P Mossé et al., glycine-rich region 2008) (Bossi et al., 2010) (Schönherr, Ruuth, Yamazaki, et al., 2011) M1166R Kinase domain Increased phosphorylation Neuroblastoma (Yaël P Mossé et al., 2008) (Chand et al., 2013) F1174I Kinase domain Increased phosphorylation Neuroblastoma (Chand et al., 2013) (Mologni et al., 2015) F1174L Kinase domain Disrupts autoinhibitory Neuroblastoma (Chen et al., 2008) function (George et al., 2008)

(Infarinato et al., 2016) F1174S Kinase domain Ligand-independent Neuroblastoma (Martinsson et al., 2011) activity L1198F Kinase domain Increased phosphorylation Thyroid (Murugan & Xing, 2011)

G1201E Kinase domain Increased phosphorylation Thyroid, Skin (Murugan & Xing, 2011)

F1245C Kinase domain Increased phosphorylation Neuroblastoma (Schönherr, Ruuth, Yamazaki, et al., 2011) (Infarinato et al., 2016) R1275Q Kinase domain Disrupts auto-inhibitory Neuroblastoma (Chen et al., 2008) function (George et al., 2008) E1384K Kinase domain Increased phosphorylation Cervix (Wang et al., 2011) L1196M Kinase domain Gateway mutation NSCLC (Choi et al., 2010)

Table 1. List of ALK mutations known to be oncogenic.

Furthermore, ALK overexpression has been reported in different types of human cancers such as neuroblastoma, NSCLC, melanoma, breast cancer and glioblastoma. However, there is little known about the role of ALK overexpression in the initiation or progression of tumors (Bengt

Hallberg & Palmer, 2013). ALK gene amplification has been reported in 9.4% of primary neuroblastoma tissues (Osajima-Hakomori et al., 2005). Moreover, Grosso et al. found that AKT, ERK1/2 and STAT3 downstream signaling get activated by ALK amplification in neuroblastoma (Del Grosso et al., 2011).

Different types of human diseases that arise from ALK fusion proteins, ALK overexpression and point mutations are summarized in Figure 7.

Figure 7. Summary of different ALK-positive diseases. The kinase domain of ALK is fused to the N-terminal portion of other proteins to generate ALK fusion proteins which are involved in progression or development of different cancers (shown in beige). ALK overexpression (shown in pink) and point mutations (shown in blue) have been observed in different types of cancers as well (Bengt Hallberg & Palmer, 2013).

1.3.4: Inhibition of ALK activity

Tyrosine kinases are critical components of signaling pathways which when disrupted result in the development and progression of different types of human diseases. Therefore, the use of

22 antitumor inhibitors directed toward tyrosine kinases is of great importance (Schlessinger, 2000) (Blume-Jensen & Hunter, 2001).

As the ALK receptor tyrosine kinase is involved in different types of human diseases, it has been considered a great therapeutic target. ALK inhibitors have been generated using insulin receptor kinase as a homology model and most of these inhibitors target the ATP-binding site of the catalytic region of ALK (Azarova et al., 2011). The first ALK inhibitor that entered clinical trials was crizotinib which is the 2,4-pyrimidinediamine derivative, ATP-competitive, dual inhibitor of the ALK and MET receptor tyrosine kinases (Zou et al., 2007). Crizotinib was the first ALK inhibitor which was approved by the FDA and first tested in EML4-ALK positive NSCLC patients with a response rate of 57% in 82 patients (Kwak et al., 2010). This compound was also tested in neuroblastoma cell lines with ALK amplification and F1174 and R1275Q mutations and it has been shown that crizotinib is more effective toward neuroblastoma cell lines bearing ALK amplification or R1275Q mutation as compared to cells with the F1174 mutation (Azarova et al., 2011).

TAE (5-chloro-2,4 diaminophenylpyrimidine) (George et al., 2008) and CRL151104A, a pyridine (Webb et al., 2009) are other ATP-competitive inhibitors which are potent against neuroblastoma cell lines bearing the F1174L mutation.

Moreover, CH5424802 (benzo carbazole derivative) has displayed antitumor activity against EML4-ALK positive NSCLC and NPM-ALK positive ALCL. It has been reported that the ALK L1196M mutation which shows resistance to kinase inhibitors is inhibited by CH5424802. However, the inhibitory effect of this compound on neuroblastoma cells bearing ALK mutations in vivo is not yet clear (Sakamoto et al., 2011b) (Azarova et al., 2011).

Other examples of FDA approved ALK tyrosine kinase inhibitors are ceritinib (Seto et al., 2013), brigatinib (Siaw et al., 2016) and alectinib (Kodama, Tsukaguchi, Yoshida, Kondoh, & Sakamoto, 2014) (Sakamoto et al., 2011a). All these inhibitors bind to the ATP-binding pocket of the ALK kinase domain in a slightly different manner (B. Hallberg & Palmer, 2016).

It is now clear that continuing treatment with tyrosine kinase inhibitors is not effective due to the development of drug resistance (Choi et al., 2010) (Gainor & Shaw, 2013). This drug resistance is due to mutations within the ALK fusion gene, ALK gene amplification and activation of pathways which bypass inhibitory pathways (R. C. Doebele, 2014).

1.3.5: Identification of human ALK interactors

ALK is an integral membrane protein and target of great therapeutic interest; therefore, it is important to design new treatments for ALK associated human diseases. To this end, it is essential to study the interactions of the ALK protein to better understand the biological significance of its protein-protein interactions (PPIs) and how they contribute to ALK regulation and function. Identifying novel interacting partners of human ALK increases our understanding of the molecular events occurring during signal transduction, and allows for a more thorough investigation of signaling pathways.

Signaling pathways are one of the key processes in the cells which are mediated by several interactions between membrane proteins and their downstream signaling partners. Studying the physical interactions of membrane proteins (which are the target of approximately 60% of drugs currently available on the market) can lead to an understanding of the mechanism of action and the function of these proteins and help in the development of new targeted therapies to treat human diseases (Petschnigg et al., 2014) (Overington, Al-Lazikani, & Hopkins, 2006).

Various classical biochemical methods as well as genetic approaches are available to study the PPIs of membrane proteins and each has its own advantages and disadvantages (Snider et al., 2015). One such methods is yeast two-hybrid approach, a genetic-based assay in which one candidate protein is tagged with DNA-binding domain (BD) and another protein of interest is tagged with transcriptional activation domain (AD). If the two proteins interact with each other BD and AD act as a transcription factor resulting in activation of a reporter system (Fields & Song, 1989). Suc1-associated neurotrophic factor-induced tyrosine-phosphorylated target (SNT)- 2 was identified as the ALK partner which interact with cytoplasmic domain of ALK in the NPM-ALK fusion protein using yeast two-hybrid approach. Chikamori et al. found that tyrosine residues at positions 156 and 567 as well as a 19-amino-acid sequence (aa 631-649) of NPM-

ALK were essential for this interaction and mutation of these three binding sites results in reducing the transforming activity of NPM-ALK (Chikamori, Fujimoto, Tokai-Nishizumi, & Yamamoto, 2007). Although this method is simple, low cost and effective for high throughput screening studies, it is limited to a yeast host and PPIs from other organisms cannot always be detected due to the lack of key post translational modifications such as phosphorylation. Moreover, yeast two-hybrid approach requires that both bait and prey proteins access to nucleus (Snider et al., 2015).

Affinity purification-mass spectrometry (AP-MS) is another popular technology to study PPIs. It involves immobilization of protein of interest (bait) on a solid support which could be agarose or magnetic beads. Afterwards this coupled bait is used to capture target proteins from soluble phase which then be digested using proteases to generate peptides. Subsequently, these peptides are fractionated using high-pressure liquid chromatography (HPLC), ionized and then detected using mass spectrometer. AP-MS can be performed with either endogenous protein baits or with protein baits which are tagged with standardized epitope tag. Immunoprecipitation following mass spectrometry studies have demonstrated the interaction of the NPM-ALK with PLCγ (Chikamori et al., 2007) as well as SOCS, MEK kinase 1 and PKC (Crockett, Lin, Elenitoba- Johnson, & Lim, 2004). Furthermore, the interaction of heat shock protein 90kDa alpha family class A member 1 (HSP90AA1), lymphoid-restricted membrane protein (LRMP) and tubulin beta class I (TUBB) were identified in H3122 and STE1 cells harboring the EML4-ALK fusion protein using AP-MS. Zhang et al. also showed that phosphorylation of STAT3 and FRS2 are reduced by crizotinib in H3122 cells indicating that these proteins are common components of EML4-ALK signaling (Zhang et al., 2017). The main advantage of affinity purification with endogenous baits using native antibodies is that the proteins are purified in their natural form from cell or tissue lysates. In other hand, the main advantage of epitope tagging is that it allows the study of proteins for which native antibodies are not available. However, cell lysis step in AP-MS results in disruption of weak or transient interactions. Another limitation of this method is that low expression levels of proteins of interest may also prevent detection with endogenous proteins. Moreover, data analysis of AP-MS experiments is more difficult as compared to other methods as it requires expertise with MS and specific bioinformatics tools.

Moreover, proximity-dependent biotin identification coupled to mass spectrometry (BioID-MS) is another method to study PPIs in which the bait protein is fused to prokaryotic biotin ligase molecule (BirA). Following expression of bait protein in cells, proteins in proximity to the BioID fusion protein are biotinylated by BirA. Avidin/streptavidin-based biotin affinity capture approach is then used to isolate the interacting proteins. These purified, biotinylated proteins are then identified using mass spectrometry. A major advantage of BioID-MS is that PPIs are detected in their natural environment. This technique is also able to detect weak or transient interactions however, BioID-MS requires tagging of bait protein with BirA which can affect protein function due to the large size of BirA. Moreover, low expression level of PPIs partners may lead to false negatives and like AP-MS data analysis is complex as it requires expertise with MS and specific bioinformatics tools.

Luminescence-based mammalian interactome (LUMIER) is another method to study PPIs of mammalian proteins in which one protein is fused to Renilla luciferase and another protein of interest is linked to an affinity tag such as FLAG or HA. Both protein constructs are transfected into an appropriate cell line and the second tagged protein is immunoprecipitated using appropriate antibody against the affinity tag. Interaction of two proteins is assessed by measuring luciferase activity. LUMIER has its own merits and demerits as well. LUMIER is easy to perform and can be used in a high-throughput format. It also can detect indirect interactions however weak or transient interactions cannot be detected using LUMIER as it requires cell lysis prior to immunoprecipitation and it may result in disruption of such interactions. (Barrios- Rodiles et al., 2005) (Blasche & Koegl, 2013) (Snider et al., 2015).

Fluorescence resonance energy transfer (FRET), in which the two proteins of interest (donor and acceptor) are labelled with fluorescent tags, and when an interaction occurs, there is a non- radiative transfer of energy between the nearby fluorophores through a dipole-dipole coupling mechanism. In this method, free fluorophores can mask energy transfer, which can develop as a problem (Sun, Rombola, Jyothikumar, & Periasamy, 2013). An additional weakness is that for a strong readout, spatial proximity of the fluorophores is very important. The other fluorescence- based approaches like BiFC (Bimoleculare fluorescence complementation) or BRET

(Bioluminescence resonance energy transfer) have increased sensitivity compared to FRET (Snider et al., 2015) (Kerppola, 2008) (Ciruela, 2008).

The methods mentioned above have limits with respect to studying full-length integral membrane proteins. Moreover, BioID-MS, LUMIER, FRET, BRET and BiFC methods have not yet been applied to ALK.

It is therefore of paramount importance to identify and screen the interactions of human integral membrane proteins in their native environment and in a high-throughput screening (HTS) format.

The recent development in our lab of a novel high-throughput protein interaction technology called Mammalian Membrane Two-Hybrid (MaMTH) allows researchers to study the interactions of full length human integral membrane proteins in their native mammalian cell environment, and has the potential to allow for rapid and significant advances in our understanding of membrane protein biology. The MaMTH assay is a split ubiquitin-based method wherein the bait is a membrane protein of interest tagged with the C-terminal half of ubiquitin (Cub) followed by a chimeric transcription factor (TF) (Petschnigg et al., 2014) (Snider et al., 2015). The prey protein can be membrane-bound or cytosolic and is tagged with the N- terminal half of ubiquitin (Nub). The bait and prey proteins can be C- or N-terminally tagged depending on their orientation and the nature of the protein. Once bait and prey interact, ubiquitin reconstitution occurs leading to proteolytic cleavage by deubiquitinating enzymes (DUBs) and release of TF. Then TF enters the nucleus, binds to upstream activating sequence (UAS) or operator and causes reporter gene activation. Expression of the reporter gene can be detected by measuring fluorescence (for GFP) or bioluminescence (for luciferase) (Petschnigg et al., 2014). The principles of MaMTH are shown in Figure 8. One of the key advantages of MaMTH is its high sensitivity that makes it suitable for detecting weak or transient interactions. MaMTH could also detect condition-dependent interactions. Other important features of MaMTH are its compatibility with gateway cloning technology, amenability to high-throughput screening and high transferability which allows it to be performed in different cell lines. The assay is also low cost, highly scalable and requires no specialized equipment.

Figure 8. Outline of the MaMTH System. The MaMTH assay detects transcriptional activation of a reporter gene, such as luciferase, located downstream of multiple GAL4 DNA-binding sites. The protein of interest (bait) is fused to the C-terminal half of ubiquitin (Cub) and an artificial chimeric transcription factor (TF). The putative interacting proteins (preys) are fused to the N- terminal half of ubiquitin (Nub). If bait and prey proteins interact with each other, the two halves of the ubiquitin reconstitute to form a full-length pseudo-ubiquitin molecule, which is recognized by cytosolic ubiquitin-specific proteases (DUBs). DUBs then cleave the transcription factor from the bait, allowing it to travel to the nucleus and activate the expression of reporters (Petschnigg et al., 2014).

Research objective

The purpose of my research was to identify the interaction network (interactome) of human wild type ALK using the Mammalian Membrane Two-Hybrid (MaMTH) assay to better understand the mechanism of function of the human ALK protein. Moreover, I studied the effect of ALK mutations on ALK phosphorylation and downstream signaling in mammalian cells as well as the phosphorylation-dependence of ALK interactions using the ALK inhibitor, brigatinib.

Chapter 2 Materials and Methods

A list of all plasmids, antibiotics, antibodies, cell lines, media, oligonucleotides and chemical solutions can be found in Appendix 1.

2.1: General experimental methods

2.1.1: PCR amplification

PCR amplification was done with KAPA high fidelity PCR master mix from Thermo Scientific. For a single 50 l reaction, 25 l of HiFi KAPA mix, 19 l of sterile double-distilled water, 3 l of ethylene glycol, 1 l of 50nM forward and 1 l of 50nM reverse primers and 1 l of DNA template were mixed. The PCR program included initial heating at 95 C for 5 minutes followed by 35 cycles of denaturation (95 C for 1 minute), annealing (60 C for 30 seconds) and extension (72 C for 3 minutes). After 35 cycles, the final extension was done at 72 C for 5 minutes.

Extension time of 1 minute per 1 kb is suitable for most templates although some amplicons can be successfully amplified even at lower extension time.

2.1.2: Agarose gel electrophoresis

1% agarose gel was prepared by adding 0.5 g of agarose powder in 50 ml of 1X TAE solution (see A1.3.17) and heating in the microwave till agarose dissolved. 2.5 l of SYBR safe DNA gel stain was added to the 50 ml of agarose solution to visualize the DNA. The solution was then poured into the electrophoresis tray to get solidified. 5 l of amplified DNA was mixed with 1 l of 6X loading dye and run on agarose gel in 1X TAE solution for 40 minutes at 100 V. 5 l of Thermo Scientific GeneRuler DNA ladder mix was loaded with samples. Afterwards, the gel was visualized under a UV source provided by Bio-Rad gel Doc.

2.1.3: Sequencing DNA from TCAG (The Center for Applied Genomics)

Sequencing was carried out at The Centre for Applied Genomics (TCAG), Hospital for Sick Children, Toronto. For TCAG, 200-300 ng/l of DNA and 0.7 l of 50 M sequencing primers were mixed in a microfuge tube and the final volume was adjusted to 7 l by adding sterile double-distilled water. The sequencing data was analyzed using the freeware ApE and NCBI blast tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.1.4: Competent E. coli preparation using Inoue method

Competent E. coli were prepared using Inoue method. DH5 E. coli strain was streaked onto LB medium plate from glycerol stock and grown at 37 C overnight. The following day, a single colony was inoculated into 25 ml of LB medium and grown at 37 C for 6 hours. Then the OD600 of cell culture was measured using spectrophotometer. Cells were then diluted to OD600: 0.03 in a 250 ml of LB medium and grown overnight at 18 C until OD600: 0.35 to 0.4. The cells were chilled on ice for 10 minutes and then centrifuged at 3500 x g for 10 minutes at 4 C. The supernatant was removed and the pellet was resuspended in 80 ml of cold Inoue buffer (see A1.3.1) and placed on ice for 5 minutes. Cells were centrifuged at 3500 x g for 10 minutes. The supernatant was removed and the pellet was gently resuspended in 20 ml of cold Inoue buffer. DMSO was added to the final concentration of 7% (1.5 ml in 20 ml cell mixture) while gently swirling the cells. The cells were placed on ice for 10 minutes. Afterwards, cells were aliquoted in 1.5 ml microfuge tube, flash freeze with liquid nitrogen and stored at -80 C.

2.1.5: E. coli transformation using heat shock method

1 l of DNA was added to 100 l of competent E. coli cells in a sterile 1.5 ml microfuge tube. The cells were placed on ice for 30 minutes. Afterwards, cells were heat shocked in the 42 C water bath for 2 minutes. Cells were then placed on ice for additional 1 minute. 900 l of LB medium was added to the cells and cells were placed in 37 C incubator with shaking for 1hour. Cells were centrifuged at 10,000 x g for 1 minute and 900 l of supernatant was removed. The pellet was resuspended in the remaining medium and plated onto the appropriate agar selection plate. The cells were plated in the 37 C incubator for 1 day till colonies appeared.

2.1.6: Glycerol stock preparation

Culture of the strain of interest was grown in the appropriate medium at 37 C overnight. 800 l of overnight culture and 200 l of 80% glycerol was added to 1 ml of sterile tube. The final concentration of glycerol was 16%. The glycerol mixture was mixed by vortex and stored at -80 C.

2.1.7: DNA isolation from bacteria

A single colony of strain of interest was grown in 3 ml of the appropriate selective medium in 37 C incubator with shaking overnight. 1.5 ml of overnight culture was centrifuged at 120,000 x g for 1 minute and the supernatant was discarded. The cell pellet was resuspended in an appropriate volume of resuspension buffer (as detailed in the manufacturer's protocol corresponding to the miniprep kit being used). The resuspended cells were then transferred the to the 1.5 mL microfuge tube and proceeded with the standard miniprep protocol as per the protocol corresponding to the Presto Mini Plasmid kit from Geneaid.

2.1.8: Co-Immunoprecipitation (Co-IP)

10 cm cell culture plate of cells transfected with 20 µg DNA of interest was washed with 4 ml of ice-cold PBS. PBS was removed and 1 ml of ice-cold lysis buffer (see appendix1.3.23) was added to the cells. The plate of cells was incubated at 4 °C for 30 minutes with shaking at maximum speed. Afterwards, the cells were collected by scraping and transfered to 1.5 ml microfuge tube. 150 µl of these lysed cells was transferred to another sterile 1.5 ml microfuge tube as input. 50 µl of 4X sample buffer (see appendix 1.3.7) was added to the input, boiled for 5 minutes and stored at -20 °C till running on the gel. The rest of the lysed cells was centrifuged at 14000 rpm for 10 minutes at 4 °C and the supernatant was transferred to the new 1.5 ml microfuge tube. Recommended amount of antibody was added to the cells and incubated for 2 hours at 4 °C while rotating gently. After 2 hours, 50 µl of protein G sepharose beads which is called 50% slurry was added to the same tube and incubated for 2 more hours at 4 °C while rotating gently. The tube was centrifuged at 3000 rpm for 1 minute, the supernatant was discarded and 1 ml of wash buffer (see appendix 1.3.24) was added to the beads containing the protein of interest. The tube was then centrifuged at 3000 rpm for 1 minute and again the

31 supernatant was discarded. This washing step was repeated for 3 times. Finally, 50 µl of 2X sample buffer (see appendix 1.3.7) was added to the beads, boiled for 5 minutes and stored at -20 °C till running on the gel. 4X sample buffer was diluted in wash buffer (see appendix 1.3.24) to make 2X sample buffer.

2.2: Gateway cloning

2.2.1: Purification of entry clones

Gateway entry clones of interest were picked from the human ORFeome collection V8.1 and grown on LB+ spectinomycin agar plate at 37 °C for 16 hours. A single colony was picked and incubated in 3 ml of LB + spectinomycin broth at 37 °C for 16 hours. For the purification of the plasmids, the Presto Mini Plasmid Kit from Geneaid was used, according to the manufacturer’s instructions. The concentrations of the entry clone plasmids were determined by NanoDrop spectrophotometry.

2.2.2: Gateway LR cloning

The gene of interest was transferred from a gateway entry clone to destination vector using LR clonase ™ II enzyme mix (Thermo Scientific). 2 l of 50 ng/µl entry clone, 1 l of 100 ng/µl destination vector, 0.5 l of TekNova TE buffer pH: 8.0, 0.5 l of sterile double-distilled water and 1 l of LR clonase ™ II enzyme mix were mixed and incubated at 25 C for 16 hours. 1 l of proteinase K was added to the reaction, mixed and placed at 37 C for 10 minutes. 3 l of LR reaction was then transformed into DH5 alpha competent cells or could be stored at -20 C to be transformed later. The transformed cells were plated onto the LB plates containing appropriate selection marker suited to the destination vector (typically 100 µg/ml ampicillin).

2.3: Site-directed mutagenesis

2.3.1: Primer design guidelines

For site-directed mutagenesis, primers should be between 25 and 45 bases in length with a melting temperature (Tm) of more than 78 ºC. Primers longer than 45 bases may be used but longer primers increase the likelihood of secondary structure formation which may affect the

32 efficiency of the mutagenesis reaction. Both mutagenesis primers must contain the desired mutation and anneal to the same sequence on opposite strands of the plasmid. The desired mutation should be in the middle of the primer with 18 bases of correct sequence on both sides. The primers should optimally have a minimum GC content of 40% and should terminate in one or more G or C bases. Site-directed mutagenesis primers were generated using the protocol described above.

2.3.2: PCR amplification using site-directed mutagenesis primers

Amplification was carried out using KAPA high fidelity PCR master mix from Thermo Scientific. 25 l of HiFi KAPA mix, 19 l of sterile water, 3 l of ethylene glycol, 1 l of 50nM forward, 1 l of 50nM reverse primers and 1 l of DNA template were mixed. The PCR program included initial heating at 95 C for 3 minutes followed by 20 cycles of denaturation (95 C for 30 seconds), annealing (68 C for 30 seconds) and extension (72 C for 5 minutes). After 20 cycles, the final extension was done at 72 C for 5 minutes.

Extension time of 1 minute per 1 kb is suitable for most templates although some amplicons can be successfully amplified even at lower extension time.

2.3.3: DpnI digestion and transformation of mutagenized PCR product

1 l of 10 units/l DpnI restriction enzyme was added to the mutagenized PCR product and incubated at 37 C for 1 hour. DpnI selectively degrades methylated DNA and will therefore destroy the original template while leaving the newly synthesized and therefore mutagenized strands intact. Note that for this to work it is important that the template plasmid DNA used in the procedure has been isolated from a strain of E. coli that is not dam methylation deficient (most standard lab strains meet this criteria). 5 l of the reaction was then transformed into 100 l of chemically competent E. coli and plated onto appropriate selective media (described in section 2.2.5).

2.4: Tissue culture protocols

2.4.1: Growing up cells from liquid nitrogen storage

1 ml aliquot of cells was removed from liquid nitrogen storage and thawed in hand. 9 ml of pre- warmed DMEM ((+)4.5 g/L D-Glucose, (+) L-Glutamine, (+) 110 mg/L Sodium pyruvate) media containing 10% FBS and 1% of 100X penicillin/streptomycin was added to the thawed cells, mixed by inverting the tube and centrifuged at 3000 rpm for 3 minutes. The supernatant was removed and the cells was dissolved in 10 ml of fresh pre-warmed DMEM media containing 10% FBS and 1% of 100X penicillin/streptomycin. The cells were then grown in 37 C incubator under an atmosphere of 5% CO2.

2.4.2: Freezing cells

Media from 10 cm plate of cells at 80-100% confluency was removed. 1 ml of Versene (from Life Technologies) was added to the cells (only needed for Grip-tite cells) and incubated at room temperature for 5 minutes. Versene was removed and 1 ml of TrypLE Express (from Life Technologies) was added to the plate of cells and incubated at room temperature for 5 minutes. The cells were then resuspended with 1 ml pipette. 4 ml of fresh pre-warmed DMEM media containing 10% FBS and 1% of 100X penicillin/streptomycin was added to the plate of cells and the whole amount was then transferred to 15 mL centrifuge tube. The cells were centrifuged at 3000 rpm for 3 minutes and the supernatant was removed. The pellet of cells was dissolved in 2 ml of freezing media (DMEM with 10% FBS, 1% PS and 10% DMSO). 2 ml of cells were divided into 2 sterile cryovials, stored at -80 °C overnight and transferred to liquid nitrogen storage after.

2.4.3: Cell splitting

The cells which grown at 37 °C under an atmosphere of 5% CO2 in 10 cm culture dishes and in DMEM with 10% FBS and 1% penicillin/streptomycin media were passaged two times per week. Culture dishes were rinsed once with 4 ml of pre-warmed PBS to remove leftover media and incubated for 5 min at room temperature with 1 ml of versene to weaken the attachment of the Grip-tite cells. The versene was removed and 1 ml of TrypLE was added and plates were incubated for 5 min at room temperature to detach viable cells. Afterwards, 4 ml of pre-warmed

34 culture medium was added, and trypsin was inactivated by FBS. The cell suspension was transferred to a new culture dish and diluted with culture medium to a final volume of 10 ml.

2.4.4: Counting cells

Cell count was performed using the Coulter Z Series cell counter (particle count and size analysers). After trypsinization and resuspension of the cells, 500 µl of cell suspension was added to 9.5 ml of IsoFlow Sheath Fluid in a CasyCup. The CasyCup was then placed in cell counter and waited to count. The count was multiplied by 40 to get the total number of cells/ml. The cell counter was flushed with IsoFlow Sheath Fluid after all samples were measured to rinse the machine and it was repeated until cell count dropped to lower than 100.

2.4.5: Seeding cells in plate

The cells were grown to 80-100% confluency and then trypsinized as described in cell splitting protocol (section 2.5.3). Afterwards, 4 ml of pre-warmed DMEM media with 10% FBS and 1% penicillin/streptomycin was added and counted with the Coulter Z Series cell counter as described in cell counting (section 2.5.4). Cells were diluted in pre-warmed DMEM with 10% FBS and 1% penicillin/streptomycin media to a concentration appropriate for the size of plate/application being performed (e.g.100 µl of 1.5 x 105 cells/ml suspension were added to each well of 96-well plate). Cells were then incubated at 37 °C under an atmosphere of 5% CO2 for 24 hours. The volumes for plates with different sizes are summarized in table 2 and the number of cells seeded in different plates are shown in table 3.

Plate Diameter of Wells Surface Area of Wells Recommended Media (mm2) Volume Standard Petri (10 cm) 83 mm 5411 10 ml

6 Well Plate 34 mm 908 2 ml 12 Well Plate 22 mm 380 1 ml

24 Well Plate 15 mm 177 500 µl

48 Well Plate 10 mm 79 250 µl 96 Well Plate 6 mm 28 100 µl

Table 2. Plate sizes and volumes.

Wells Total Cells/Well DNA/Well ddH2O/Well 2x BES/Well 2.5M CaCl2/Well

6 200 000 1 µg 130 µl 150 µl 15 µl

12 80 000 500 ng 65 µl 75 µl 7.5 µl

24 40 000 200 ng 32.5 µl 37.5 µl 3.75 µl

48 20 000 100 ng 16.3 µl 18.8 µl 1.9 µl

96 15 000 50 ng 8.1 µl 9.4 µl 0.9 µl

Table 3. Number of cells seeded in different plates.

2.4.6: Transient transfection of cells using standard CaCl2 method

The cells were seeded in DMEM with 10% FBS and 1% penicillin/streptomycin media into 96- well plate (see seeding cells at 2.4.5 section). 7.1 µl of sterile double-distilled water, 9.4 µl 2x BES (see A1.3.20), 1 µl of 50 ng/µl bait and 1 µl of 50 ng/µl prey were mixed in 1.5 ml microfuge tube. 0.9 µl of 2.5M CaCl2 was added, vortexed for 10 seconds and incubated at room temperature for 15 minutes. The whole amount of mixture (19.4 µl) was then added to cells in each well of 96-well plate dropwise using multichannel pipette. The plate of cells was swirled gently and incubated at 37 °C under an atmosphere of 5% CO2 for 5 hours. The media was removed after 5 hours and 100 µl of the fresh pre-warmed DMEM with 10% FBS and 1% penicillin/streptomycin media was added to the cells. The cells were grown at 37 °C under an atmosphere of 5% CO2 for a further 24-48 hours depending on the experiment.

Note that cells should have some space between them to help maximize transfection efficiency (e.g. 60-70% confluency at the time of transfection).

2.4.7: Transfection of stable cells using standard CaCl2 method

The cell line stably expressing the gene of interest was seeded in DMEM with 10% FBS and 1% penicillin/streptomycin media in appropriate plate (see seeding cells at 2.4.5 section). 8.1 µl of sterile double-distilled water, 9.4 µl 2x BES (see A1.3.20), and 1 µl of 50 ng/µl prey were mixed

in 1.5 ml microfuge tube. 0.9 µl of 2.5M CaCl2 was added, vortexed for 10 seconds and incubated at room temperature for 15 minutes. The whole amount of mixture (19.4 µl) was then added to cells in each well of 96-well plate dropwise using multichannel pipette. The plate of cells was swirled gently and incubated at 37 °C under an atmosphere of 5% CO2 for 5 hours. The media was removed after 5 hours and 100 µl of the fresh pre-warmed DMEM with 10% FBS and 1% penicillin/streptomycin media was added to the cells. The cells were grown at 37 °C under an atmosphere of 5% CO2 for a further 24-48 hours depending on the experiment. Note that cells should have some space between them to help maximize transfection efficiency (e.g. 60-70% confluency at the time of transfection).

2.4.8: Transfection of cells using FLP-In TREx system

400,000 cells per well were seeded in DMEM with 10% FBS and 1% penicillin/streptomycin media into 6-well plate (see seeding cells at 2.5.5 section). 97 µl of optimum media (no serum and no antibiotics were added), 3 µl of X-treme Gene 9 transfection reagent (from Roche), 100 ng of bait and 900 ng of pOG44 (FLP recombinase expression plasmid) were added to 1.5 ml microfuge tube. The mixture was vortexed briefly and incubated at room temperature for 15 minutes. The mixture was then added to the wells of 6-well plate dropwise while swirling. The plate of cells was placed at 37 °C under an atmosphere of 5% CO2 for 5 hours. The media was removed after 5 hours and 2 ml of fresh pre-warmed DMEM with 10% FBS and 1% penicillin/streptomycin media was added to each well of cells. The cells were grown at 37 °C under an atmosphere of 5% CO2 for 48 hours. The cells were splitted into the new 6-well plate after 48 hours in selective media (see cell splitting protocol at section 2.5.3) and grown until the foci appeared. FLP-In TREx allows the rapid generation of isogenic cell lines stably expressing genes of interest via Flp recombinase-mediated DNA recombination into a FRT site in the target cell genome.

2.4.9: Transfection of cells using lipofectamine 3000

The cells were seeded as outlined in section 2.4.5 in 10 cm plate to be 70-90% confluent at the time of transfection. 18.75 µl of lipofectamine 3000 reagent was diluted with 625 µl of optimum media in 1.5 ml microfuge tube. In another 1.5 ml microfuge tube, 12.5 µg of DNA, 625 µl of optimum media and 25 µl of p3000 reagent were mixed. 2 microfuge tubes were mixed together and incubated at room temperature for 10-15 minutes. Afterwards, the DNA mixture was added

to the plate of cells dropwise and incubated at 37 °C under an atmosphere of 5% CO2 for 6 hours. After 6 hours, the media was removed and fresh pre-warmed DMEM with 10% FBS and 1% penicillin/streptomycin media was added and incubated for 24-48 hours. The transfected cells were then analyzed based on the experiment performed.

2.4.10: Picking foci when the foci were relatively large, the media was removed and a sterile plastic cylinder was placed around the foci (If the foci are too small it will be difficult for the cells to recover when transferred to new media). 50 µl of TrypLE was added into the cylinder and let the cells sit for 1- 2 minutes. The cells were dissolved in TrypLE by pipetting up and down gently. The cells were then transferred into the wells of a 12-well plate containing 950 µl of appropriate media each and grown at 37 °C under an atmosphere of 5% CO2 until they became confluent to be splitted into 10 cm plate.

2.4.11: Luciferase assay

5X lysis buffer (from Promega) was diluted to 1X in sterile double-distilled water. The media was aspired off from the plate of cells. 70 µl of the diluted lysis buffer was added to each well of 96-well plate containing cells. The plate of cells was then incubated at room temperature while shaking for 10 minutes to detach the cells. 50 µl of lysed cells was transferred into the opaque white plate suitable for use in luminometer. The opaque white plate was placed in luminometer for the luciferase activity to be measured using luciferase substrate (Firefly luciferin). Samples were tested and read in three biological triplicates.

2.4.12: Cell viability assay

The 96-well plate transfected with DNAs of interest using CaCl2 transfection method (see section 2.4.7) was set up. 5 hours after transfection the media of the cells was removed and 100 µl of fresh pre-warmed DMEM with 10% FBS and 1% penicillin/streptomycin media containing desired amount of drug was added and incubated at 37 °C under an atmosphere of 5% CO2 for almost 18 hours. Afterwards, 10 µl/well of CellTiter-Blue Reagent (from Promega) was added to the plate of cells and incubated at 37 °C under an atmosphere of 5% CO2 for 4 hours. The fluorescence was then measured at 560nm using the spectrophotometer.

2.5: Western immunoblotting protocols

2.5.1: Protein extraction

Transfected cells with gene of interest in 12-well tissue culture plates were lysed by adding 100 l of buffer H (see A1.3.6). The plate of cells was then incubated at 4 C with shaking for 30 minutes. The lysed cells were then collected in 1.5 ml microfuge tube and centrifuged at 14000 rpm for 10 minutes at 4 C. The supernatant containing protein was then transferred into the clean 1.5 ml microfuge tube. 15 l of 4X sample buffer was added to 45 l of lysate and boiled at 95 C for 3-5 minutes. Samples were then stored at -20 or -80 C until ready to run on SDS- PAGE.

2.5.2: Measuring protein concentration using Bradford assay

2 mg/ml bovine serum albumin from Thermo Scientific was diluted in sterile double-distilled water to make 7 standards of 12.5, 25, 50, 75, 100, 150 and 200 µg/ml. Protein samples with no sample buffer were diluted 1:30 in sterile double-distilled water. Bio-Rad Bradford reagent was diluted 1:5 in sterile double-distilled water. 10 µl of standards and protein samples were added to 96-well plate in triplicate and 190 µl of diluted Bio-Rad Bradford reagent was added to each well containing standards and protein samples. After 5 minutes shaking at room temperature, the absorbance was measured at 595nm using the spectrophotometer. Absorbance from standards was used to draw the standard curve using Microsoft Excel. The equation of line of best fit and absorbance of protein samples was used to calculate the approximate protein concentration.

2.5.3: Preparation of stacking and resolving SDS polyacrylamide gel for Western immunoblotting Glass plates (1.0 mm spacing) from Bio-Rad were washed, dried and assembled together in the Bio-Rad gel cassette. 4 ml of sterile double-distilled water, 3.3 ml of 30% acrylamide mix, 2.5 ml of 1.5M Tris pH: 8.8, 100 µl of 10% SDS, 100 µl of 10% ammonium persulfate and 4 µl of TEMED were mixed together to make 10% resolving gel. Approximately 4 ml of gel solution was poured per gel between the glass plate until approximately 1cm from the top. Immediately, 500 µl of sterile double-distilled water was added at the top of the gel to remove bubbles and

39 ensure the flat interface between the resolving and stacking gels. After 20 minutes, sterile double-distilled water was discarded and left-over double-distilled water was removed using a filter paper.

2.7 ml of sterile double-distilled water, 670 µl of 30% acrylamide mix, 500 µl of 1.0M Tris pH: 6.8, 40 µl of 10% SDS, 40 µl of 10% ammonium persulfate and 4 µl of TEMED were mixed together to make 5% stacking gel. Approximately 1.5 ml of stacking gel solution was poured on top of the resolving gel and 1 mm 15-well Bio-Rad combs were placed into stacking gel. The gel allowed to solidify for 30 minutes.

2.5.4: Gel electrophoresis of protein samples, transfer and Western immunoblotting

25 to 50 µg of protein samples was loaded per well of SDS polyacrylamide gel. 5 µl of PageRuler Plus Prestained protein ladder (from Thermo Scientific) was loaded alongside the protein samples and all were run at constant 150 V until the samples and protein ladder reached the end of the gel (approximately 70 minutes) in 1X SDS running buffer. Afterwards, protein samples were transferred to nitrocellulose membrane using the wet Bio-Rad transfer setup in 1X transfer buffer at constant 300 mA for 90 minutes. Membrane was stained with 1% ponceau S to check if the transfer worked properly and ensure equal loading between lanes. Ponceau S stain was removed by washing the membrane in approximately 15 ml of 1X TBST for 10 minutes. Membranes were blocked with 20 ml of blocking solution (2% Bovine Serum Albumin in 1X TBST) for 1 hour. Membranes were washed with 1X TBST for 5 minutes and incubated overnight at 4 C with primary antibody diluted in 10 ml of 1X TBST. The following day, membranes were washed 3 times with 15 ml of 1X TBST for 15 minutes each. Afterwards, membranes were incubated with secondary antibody diluted in 10 ml of 1X TBST for 1 hour at room temperature. After secondary incubation membranes were washed 3 times with with 15 ml of 1X TBST for 15 minutes each. 1 ml of SuperSignal West Pico PLUS chemiluminescent substrate (from Thermo Scientific) was added to the membranes and incubated at room temperature for 1 minute. Signal was developed using the high performance chemiluminescent film (from Mandel). Different dilutions of primary and secondary antibodies were prepared according to manufacturer’s protocols.

2.6: ALK Bait generation

2.6.1: Gateway cloning of ALK gene into MaMTH bait vector

MaMTH bait vector expressing the C- terminal half of ubiquitin (Cub) fused to 5X GAL4 transcription factor and tetracycline-inducible promoter was generated by Stagljar lab (see SF.1). The transcription factor comprises amino acids 1-147 of GAL4 fused to amino acids 364-550 of mouse NF-κB (GAL4 (1-147)-mNF-κB (364-550)) (Petschnigg et al., 2014). MaMTH bait construct is shown in SF.2.

ALK entry clone (taken from Zhong Yao, Stagljar lab) was LR cloned into MaMTH bait vector (see A1.6) using gateway LR cloning protocol as described in section 2.2.2 to generate C- terminally tagged of ALK bait (ALK-Cub-TF) which is compatible with the FLP-In TREx system. C-tagged ALK bait (miniprep DNA) was then isolated from bacteria using protocol as outlined in section 2.1.7.

2.6.2: Transfection of C-tagged ALK bait into reporter cell line

HEK293 cell line stably expressing firefly luciferase reporter gene, established by the Stagljar Lab, were used to generate the stably integrated ALK bait construct using FLP-In TREx system as described in section 2.4.8. 5 hours after transfection, the media of cells was changed with fresh pre-warmed DMEM with 10% FBS and 1% penicillin/streptomycin media containing 0.5 µg/ml of tetracycline as ALK bait was expressed under the control of the tetracycline-inducible promoter.

HEK293 cell line stably expressing luciferase reporter gene contains five GAL4 upstream activating sequence repeats followed by the luciferase gene (5xGAL4-UAS-luciferase reporter).

2.6.3: Testing the expression of ALK-Cub-TF in the presence and absence of tetracycline

HEK293 cell line stably expressing ALK-Cub-TF was seeded into 12-well plate according to protocol explained in section 2.4.5. The plate of cells was incubated at 37 °C under an atmosphere of 5% CO2 overnight. The day after, the media of the cells was removed and 1 ml of

41 fresh pre-warmed DMEM media with 10% FBS and 1% penicillin/streptomycin containing different concentration of tetracycline from 0 to 1.0 µg/ml was added and cells were grown at 37

°C under an atmosphere of 5% CO2 overnight. The day after, the media of the cells was removed and cell lysates were collected and subjected to Western immunoblotting as outlined in section 2.5.

2.7: Prey generation

2.7.1: Gateway cloning of preys into MaMTH prey vectors

Entry clones containing proteins of interest (preys) were obtained from human ORFeome collection V8.1 provided by Dr. Marc Vidal from Center for Cancer Systems Biology (CCSB), Boston, U.S. Both N- (Nub-Prey) and C- (Prey-Nub) terminally tagged of MaMTH preys were generated in MaMTH prey vectors (see A1.6) using gateway LR cloning (see section 2.2.2). N- and C-terminally tagged of preys were then isolated from bacteria using DNA isolation method as outlined in section 2.1.7.

2.7.2: Testing the expression of MaMTH prey constructs

HEK293 cell line stably expressing ALK-Cub-TF was seeded into 96-well plate according to protocol explained in section 2.4.5. The plate of cells was incubated at 37 °C under an atmosphere of 5% CO2 overnight. MaMTH prey constructs were transfected into the seeded cells using CaCl2 transfection method (see section 2.4.7). The next day, cells were lysed and subjected to Western immunoblotting (see section 2.5) to check the expression of MaMTH prey constructs.

2.8: Testing the interaction of bait and prey using MaMTH

2.9: Testing the interaction of bait and prey in serum starvation media

HEK293 cell line stably expressing ALK-Cub-TF was seeded in 96-well plate according to seeding protocol described in section 2.4.5. N- and C-terminally tagged of preys were transfected into HEK293 cell line stably expressing ALK-Cub-TF using CaCl2 transfection method as described in section 2.4.7. each prey was transfected into 6 wells to be tested in full media as well as serum starvation media (see A.1.1.2) side by side. 5 hours after transfection, the media was removed and 100 µl of pre-warmed full media as well as serum starvation media was added to the corresponding wells. After 24 hours, interaction of ALK-Cub-TF and preys were tested using luciferase assay as outlined in section 2.4.11. Samples were tested in three biological replicates.

2.10: Testing the interaction of bait and prey in the presence of drug using MaMTH

HEK293 cell line stably expressing ALK-Cub-TF was seeded in 96-well plate according to seeding protocol described in section 2.4.5. N-terminally tagged of selected preys were transfected into HEK293 cell line stably expressing ALK-Cub-TF using CaCl2 transfection method as outlined in section 2.4.7. 5 hours after transfection (CaCl2 method), the media of cells was removed and DMEM media with 10% FBS and 1% penicillin/streptomycin containing 0.5 µg/ml of tetracycline and 250 nM of drug (brigatinib and erlotinib) was added to the cells. The day after, luciferase activity was measured using luciferase assay (see section 2.4.11).

2.11: Preparation of FAM150A and FAM150B ALK ligands

HEK293 cell line was seeded in 10 cm plate in a way that 1 ml of 100% confluent HEK293 cells was added to 10 ml of DMEM with 10% FBS and 1% penicillin/streptomycin media in 10 cm plate to have 80% confluency the next day (time of transfection). The plate of HEK293 cells was grown at 37 °C under an atmosphere of 5% CO2 overnight. The next day, 8 µg of FAM150A-HA and FAM150B-HA constructs kindly provided by Dr. Ruth Palmer, Gothenburg University, Sweden, were transfected into the HEK293 cells using lipofectamine 3000 reagent (see transfection protocol at section 2.4.9). six hours after transfection, the media was changed to serum-free media and further cultured for another 24-48 hours. After approximately 40 hours,

43 the media containing ALK ligands (FAM150A-HA and FAM150B-HA) was collected and transferred to 15 ml falcon tube. The ligands were aliquoted and kept at -80 °C.

Chapter 3 Results

3.1: Generation of stably integrated ALK-Cub-TF

ALK in pDONR223 entry clone was cloned using Gateway LR enzyme II mix (ThermoFisher Scientific) into MaMTH bait vector (SF.1) to generate C-terminally tagged ALK bait (ALK- Cub-TF) compatible with the FLP-In TREx system. The MaMTH bait construct is shown in SF.2.

The HEK293 cell line stably expressing ALK-Cub-TF was successfully generated under the control of a tetracycline-inducible promoter using the FLP-In TREx system, by introducing ALK-Cub-TF into a HEK293 cell line stably expressing firefly luciferase reporter, previously generated in the Stagljar lab. To determine the expression of stably-expressed ALK-Cub-TF at different concentrations of tetracycline from 0 to 1 µg/ml, Western immunoblotting was performed, using -V5 antibody (Figure 9). Bradford assay was done prior to Western immunoblotting to determine the protein concentration. There was no expression of ALK bait in no-tetracycline media or in the presence of a very low concentration of tetracycline (0.002 µg/ml). However, ALK-Cub-TF was expressed at different concentrations of tetracycline from 0.005 to 1 µg/ml as shown in Figure 9.

kDa

250 ⍺-V5

130

55 ⍺-GAPDH 35

Tetracycline concentration (µg/ml)

Figure 9. Western blot analysis of HEK293 stable cell line expressing ALK bait. The expression of C-tagged ALK bait was tested at different concentrations of tetracycline using anti- V5 antibody. GAPDH was used as loading control and 20 ng of total protein were loaded per well.

3.2: Generation of N- and C-terminally tagged preys

MaMTH prey vectors expressing the N-terminal half of ubiquitin (Nub) and FLAG tag were previously generated by the Stagljar lab (SF.3, SF.4) (Petschnigg et al., 2014). N- and C- terminally tagged of MaMTH prey constructs are shown in SF.5 and SF.6 respectively.

Thirty-seven predicted and known ALK interactors were selected using FpClass, which is a data mining-based method for proteome-wide PPI prediction (Kotlyar et al., 2015), and Biological General Repository for Interaction Datasets (BioGRID), respectively. The list of selected known and predicted ALK interactors is shown in Supplementary Table 1 (see A2.1.1). Entry clones containing the selected interactors were obtained from the human ORFeome collection V8.1

46 provided by Dr. Marc Vidal from the Center for Cancer Systems Biology (CCSB), Boston, U.S. Both N- (Nub-Prey) and C- (Prey-Nub) terminally tagged MaMTH preys were then generated using Gateway cloning (ThermoFisher Scientific). All preys were sequence verified using common primers and their expression tested with Western immunoblotting (Figure 10) using - FLAG antibody. Bradford assay was performed prior to Western immunoblotting to determine the protein concentration.

b b

u L u

N N

- -

B N

B u

C R

B -

3 1

- I

R N

T O

H Y

S K

S L

G I

G P

1 C

- -

- - -

B C

b b

b b b

u I

u u

H u

K N V

S N kDa N S N N kDa

N P

P N G

N I

N G N N

130 130 100 * * 100 * * * * 70 * * 70 * 55 ⍺-FLAG 55 ⍺-FLAG * * * * * * 35 35 * * 25 25

2 3

1 B

K K

N b

B u

P u

b N

R R

P u

R R

- C

T T

A N

N 3

K - L

1 -

K B

- 1

N N

1 I

- K

2 2

A C 2

- -

N R

b R

b b

K b

b 2

u D

u T u

R T

u P

u R u

K kDa

N F I

N D

F N N N

N N

N I

N A kDa N M 130 100 * * 130 * * 70 100 * * ⍺-FLAG 55 ⍺-FLAG 70 * * * * * * * * 55 * * * 35 * 35 25

K A

T u

C D S

E L 1

H H H

E F A

- - -

- - 1 -

K A

b b b

C D

u N

u u u

u u u C

N D

N H N H N

N N F N A

N kDa kDa T

130 130 * * 100 100 * * 70 * ⍺-FLAG 70 ⍺-FLAG * * * 55 55 *

35 35

b M

S 2

O N 1

S A

I T

- - M

- -

S 2

b b

b b G

u u P

u u

O kDa R

N S I N A

N N T 130 * 100 * * ⍺-FLAG 70 *

Figure 10. Prey expression in HEK293 cell line stably expressing ALK-Cub-TF. Anti-FLAG antibody was used to test prey expression using Western immunoblotting; 15 ng of total protein were loaded per well. The asterisks represent the expected molecular weight of preys.

3.3: Targeted screening for ALK interactors using MaMTH in media +/-tetracycline

As mentioned above, cells stably expressing ALK-Cub-TF under the control of the tetracycline- inducible promoter were generated (HEK293-ALK). Therefore, to show that tagging of ALK bait with Cub does not interfere with normal association of the receptor, the interactions of some

48 known ALK interactors (GRB2, PDLIM3, GNB2L1 and CORO1C) were tested in media containing 0.5 µg/ml of tetracycline as well as media lacking tetracycline. The selected preys were transfected into HEK293-ALK cells and the activity of firefly luciferase reporter was measured 24 hours after tetracycline induction. Nub-PEX7 prey was used as negative control. Pex7 is a peroxisomal membrane protein (Braverman et al., 1997) that doesn’t localize near the plasma membrane, hence it should have a very low likelihood of interacting and being near plasma membrane proteins such as ALK. The two-tailed unpaired t-test was used to calculate P- values comparing known interactions to this negative control. The MaMTH assay showed significantly higher luciferase signals (P <0.05 – P<0.001) with all four known ALK interactors (GRB2, PDLIM3, GNB2L1 and CORO1C) in comparison with Nub-PEX7 and no interaction with PEX7 was observed at tetracycline concentration of 0.5 µg/ml (Figure 11). No luminescence values were detectable without bait expression (0 µg/ml tetracycline) (Figure 11). Assays were carried out in triplicate. These results indicate that tagging ALK with the C- terminal half of ubiquitin does not interfere with ALK associations, suggesting that the receptor is properly folded.

ALK-Cub-TF 7.00E+04 ** 6.00E+04

v 5.00E+04

i t **

a *

4.00E+04

e s *** a 3.00E+04

f i * + tetracycline

c 2.00E+04 u - tetracycline L 1.00E+04 0.00E+00

* P< 0.05 ** P< 0.01 *** P< 0.001

Figure 11. MaMTH biased screening of HEK293-ALK bait with N- and C-tagged preys. Cells culture in media with 0.5 µg/ml of tetracycline (blue bars) as well as media lacking tetracycline (red bars). *** P < 0.001, ** P < 0.01, * P < 0.05; two-tailed unpaired t-test calculations compared to negative control (Nub-PEX7). The plotted values represent raw luciferase signals.

3.4: MaMTH experiment in serum starvation media

MaMTH was previously shown to detect serum-dependent protein-protein interactions (Petschnigg et al., 2014). In order to see the effect of serum starvation media on the interaction of ALK interactors with ALK-Cub-TF, some MaMTH prey-tagged known ALK interactors such as SHC1-Nub, Nub-PDLIM3 and Nub-GNB2L1 were transfected into HEK293-ALK. Nub-PEX7 was used as the negative control. The luciferase activity of selected preys was measured 16 hours after growing cells in full media or in serum starvation media, in triplicate. The two-tailed unpaired t-test was used to determine significance of differences. Figure 12a illustrates decreased luciferase activity of all selected preys in serum starvation media as compared to those grown in full media (P<0.01), indicative of activated ALK in full media. The expression of ALK bait and selected preys in serum starvation media as well as full media were tested using Western immunoblotting, using -V5 (bait) and -FLAG (prey) antibodies. Expression of GAPDH was used as a loading control (Figure 12b). This experiment shows that ALK is activated in full media containing serum as compared to serum starvation media. All prey proteins as well as ALK bait were expressed similarly in both full media and serum starvation media, showing that the decreased luciferase signals are not due to lower expression of the proteins.

ALK-Cub-TF

y 4.00E+05 t ** a i

v 3.50E+05

i t 3.00E+05 **

c **

a 2.50E+05 Full media

e 2.00E+05 s 1.50E+05 a Serum starvation media

r 1.00E+05

i 5.00E+04 c 0.00E+00

L ** P< 0.01

F S

- -

b b

u u

L b L

N N

- -

1 1

b K

C C

H H

S S N kDa

A kDa A 250 70 ⍺-FLAG ⍺-V5 55 130 35 55 55 ⍺-GAPDH ⍺-GAPDH 35 35

Figure 12. HEK293-ALK MaMTH in full media and serum starved conditions. (a) MaMTH screening of HEK293-ALK bait with known interactors SHC1, PDLIM3 and GNB2L1 in full media (blue) and serum starvation media (red). Nub-PEX7 was used as negative control. The plotted values represent raw luciferase signals. ** P < 0.01; two-tailed unpaired t-test calculations compared to serum starvation media. (b) ALK bait and prey expression was tested with Western immunoblotting using anti-V5 and anti-FLAG antibodies, respectively. GAPDH was used as a loading control and 20 ng of total protein were loaded per well. F: full media, S: serum starvation media.

3.5: Targeted screening for ALK interactors using MaMTH

Previous ALK interactors were identified by traditional biochemical or genetic approaches, such as affinity capture-MS, two-hybrid and affinity capture-western and there has not yet been a comprehensive interactome study performed using the full-length ALK in its native membrane environment. Development of MaMTH provides a great opportunity to study the PPIs of

51 membrane proteins in their native environment. Therefore, MaMTH assays (three individual assays) were applied to study the interactions of 23 known ALK interactors (selected from BioGRID) as well as 46 predicted interactors of ALK (selected from FpClass). The list of all preys is shown in Supplementary Table 1 (see A2.1.1). HEK293-ALK was transfected with N- and C-terminally tagged GRB2, SHC1, STAT3, IKBKG, PDLIM3, GNB2L1, KRT18, VIM, FRS2, TNK2, IRS1 and N-tagged CORO1C preys as positive controls and N-tagged PEX7 prey as negative control. The firefly luciferase activation upon interaction of selected preys with ALK-Cub-TF was then measured. The interaction of the prey proteins selected from both FpClass and BioGRID (see A2.1.1) with ALK-Cub-TF were tested using MaMTH and the replicates shown as MaMTH (1), (2) and (3) in Figure 13. The two-tailed unpaired t-test was used to calculate P-values comparing interactions to the negative control (Nub-PEX7). The MaMTH assay showed significantly higher luciferase signals (P <0.05 – P<0.001) for novel ALK interactors as compared to Nub-PEX7.

These MaMTH assays confirmed previously reported ALK interacting proteins such as GRB2 (Growth Factor Receptor Bound Protein 2), SHC1 (Src Homology 2 Domain-Containing), CORO1C (Coronin-1C), PDLIM3 (PDZ And LIM Domain 3), RACK1/GNB2L1 (Receptor for Activated C Kinase 1), KRT18 (Keratin 18) and FRS2 (Fibroblast Growth Factor Receptor Substrate 2) proteins, and discovered novel interacting partners such as LYN (Proto-Oncogene, Src Family Tyrosine Kinase), HCK (Proto-Oncogene, Src Family Tyrosine Kinase), EEF1A2 (Eukaryotic Translation Elongation Factor 1 Alpha 2) and FLT1 (Fms Related Tyrosine Kinase 1), (Figure 13). Prey expression was assessed by Western blotting using -FLAG antibody (Figure 10). This MaMTH targeted screening could confirm the interaction of 8 out of 16 (50%) expressed known ALK interactors and some of the previously known ALK interactors that were not detected in this biased screening, such as IKBKG, VIM, TNK2 and IRS1, were not expressed.

Screening for ALK interactors using MaMTH (1)

ALK-Cub-TF a

i 6.00E+04

v i 5.00E+04

a 4.00E+04

s 3.00E+04

r 2.00E+04

i 1.00E+04

u 0.00E+00

) ALK-Cub-TF b y 7

v 14

E ***

c P 12

- a *

e 10 ** u *

a N 8

o e *

t f 6 i *

u e 4

l * * z *

l e 2

m 0 * P< 0.05

o e ** P< 0.01

R ( *** P< 0.001

Screening for ALK interactors using MaMTH (2) a ALK-Cub-TF

y 1.00E+06

i 8.00E+05

6.00E+05

a 4.00E+05

i 2.00E+05

u 0.00E+00

b ALK-Cub-TF

)

y 7 8

i **

v 7

c P 6

b 5

u s *

a 4

e o 3

f t

d 2

z 1

i e l * P< 0.05

v a

i 0

a ** P< 0.01

e o

R N

(

Screening for ALK interactors using MaMTH (3) a ALK-Cub-TF

y 3.50E+05

v 3.00E+05

c 2.50E+05

2.00E+05

s 1.50E+05

r 1.00E+05

f i 5.00E+04

u 0.00E+00

b ) ALK-Cub-TF

y 7

i X 4 *

E t 3.5 *

c P

- a 3

e *

s 2.5

a N

r 2

i 1.5

c d 1

u e

l 0.5

a * P< 0.05

i 0

r ** P< 0.01

(

Figure 13. MaMTH biased screening of HEK293-ALK with N- and C-tagged preys. The orange bars represent ALK novel interactors which have been identified in MaMTH. *** P < 0.001, ** P < 0.01, * P < 0.05; two-tailed unpaired t-test calculations compared to negative control (Nub-PEX7). (a) Raw luminescence signal. (b) The plotted values represent relative luciferase signals calculated as fold change increase above negative control prey Nub-PEX7.

3.6: Targeted screening for SH2/PTB domain-containing prey library using MaMTH

As mentioned before, upon activation of RTKs, specific tyrosine residues in the kinase domain get phosphorylated which then serve as a docking site for SH2/PTB domain-containing proteins (Schlessinger & Lemmon, 2003). Therefore, the interaction of ALK-Cub-TF with a library of proteins containing SH2 and PTB domains were tested using MaMTH. A prey library containing 87 (of a total of 122) SH2/PTB domain-containing preys was generated by Luka Drecun, a graduate student in the Stagljar lab. The preys were sequence verified, and their expression was tested using Western immunoblotting, by Luka Drecun. These SH2 and PTB domain-containing proteins were N- terminally tagged. HEK293-ALK was transfected with these 87 SH2 and PTB domain-containing full-length preys (Nub-preys). After 24 hours, the interactions of prey proteins with ALK bait were tested using the luciferase assay. In this assay, Nub-GRB2 and

Nub-PEX7 were used as positive and negative controls, respectively. Figure 14 shows the luciferase activity of these SH2 and PTB domain-containing proteins across three individual MaMTH assays. The plotted values represent both raw luciferase signals as well as relative luciferase signals calculated as fold change increase above negative control prey Nub-PEX7. In these MaMTH assays, the prey proteins which showed significantly higher luciferase signals as compared to the negative control, based on two-tailed unpaired t-test calculations, were considered as ALK interactors. Thirty more novel ALK interactors among the SH2/PTB domain- containing proteins were identified.

Screening for SH2/PTB domain-containing prey library (1) a ALK-Cub-TF 1.40E+06

i 1.20E+06

t 1.00E+06

8.00E+05

e s 6.00E+05

e 4.00E+05

c 2.00E+05

L 0.00E+00

b ALK-Cub-TF

)

X 16 *

t 14

c P

- a 12

s 10

r 8

f ** *

i 6 * * ***

c d * **

e * u 4 ** *

l z

i * * *

e 2

i 0 * P< 0.05

e ** P< 0.01

R ( *** P< 0.001

Screening for SH2/PTB domain containing prey library (2) a ALK-Cub-TF

t 1.00E+06

t 8.00E+05

6.00E+05

a 4.00E+05

f 2.00E+05

u 0.00E+00

ALK-Cub-TF

)

b t

X 7

v **

c 6 *

b 5 **

a * N 4 *

r * *

e o

f t 3 * *

e 2

i e l 1

v a

m 0 * P< 0.05

e o ** P< 0.01

R N

(

Screening for SH2/PTB domain containing prey library (3)

a ALK-Cub-TF

y 1.20E+06

v 1.00E+06

c 8.00E+05

e 6.00E+05

r 4.00E+05

i 2.00E+05

u 0.00E+00

ALK-Cub-TF

b )

X 12 v *

c P 10

- a *

b 8

a N 6 * * r *

o e ** *

t *

4 * i * * c d * * * *

u 2

l z

l e 0

a r * P< 0.05

N R ** P< 0.01

(

Figure 14. MaMTH targeted screening of HEK293-ALK bait with N-tagged SH2 and PTB domain-containing proteins. The orange bars represent ALK novel interactors which have been identified in MaMTH. *** P < 0.001, ** P < 0.01, * P < 0.05; two-tailed unpaired t-test calculations compared to negative control (Nub-PEX7). (a) The plotted values represent raw luciferase signals. (b) The plotted values represent relative luciferase signals calculated as fold change increase above negative control prey Nub-PEX7.

3.7: Summary of preliminary targeted screening of ALK wild type using MaMTH

Successful completion of targeted screening with MaMTH identified several new potential ALK partners. In total, interaction of 150 prey proteins with ALK-Cub-TF was tested using MaMTH, and 45 ALK interactors were detected. Out of these 45, 11 were known and 34 were novel. Of the 150 tested preys, 29 were previously known ALK interactors (N- and C-terminally tagged GRB2, SHC1, PDLIM3, GNB2L1, KRT18, FRS2, STAT3, VIM, TNK2, IRS1, IKBKG and N- terminally tagged CORO1C, CRKL, PIK3R1, SHC3, SRC, SOCS5 and SOCS1). All known ALK interactors were expressed, shown using Western immunoblotting, except for Nub-SHC1, Nub-VIM, VIM-Nub, Nub-TNK2, TNK2-Nub, FRS2-Nub and Nub-IRS1 as shown in Figure 10. Therefore, interaction of 11 out of 22 (50%) expressed known ALK interactors was confirmed with MaMTH. All novel ALK interactors identified in this study using MaMTH are summarized in Supplementary Table A2.1.2. The summary of targeted screening performed with ALK using MaMTH is shown in Figure 15a. The preliminary wild type ALK interactome mapped by MaMTH was generated using NAViGaTOR 2.3.0 program (Figure 15b).

Figure 15. Summary of targeted MaMTH assays performed with ALK. (a) Interaction of 150 prey proteins with ALK-Cub-TF were tested using MaMTH. (b) Preliminary network of the wild type ALK interactome as mapped by MaMTH.

3.8: Validation of novel ALK interactors using Co-IP

To provide an additional confirmation of novel ALK interactors detected using MaMTH, co- Immunoprecipitation (Co-IP) assays were performed for a subset of the potential ALK partners, such as NCK2, SRMS, CRKI, LYN, EEF1A2 and HSH2D. These novel ALK interactors were selected based on whether they show higher luciferase signal as compared to other interactors or co-localize with ALK in brain and nervous system. For the Co-IP assays, ALK bait construct fused to FLAG tag at its C-terminus was generated. Moreover, the potential interactors mentioned above were tagged with HA at their N-terminus. The FLAG-tagged ALK bait and HA-tagged preys were then co-transfected into HEK293 cells and their interactions were tested by Co-IP. The FLAG-tagged ALK bait was pulled down using anti-FLAG antibody, and Western immunoblotting was then performed using anti-HA antibody to check the interaction of HA-tagged preys with FLAG-tagged ALK bait. FLAG-tagged ALK and pCMV5 vector (vector for expressing an N-terminally HA-tagged protein in mammalian cells) as well as pCMV5 vector only were transfected into HEK293 cell line as negative controls. Known ALK interactors, HA- tagged GNB2L1 and CRKL, were used as positive controls in this experiment. As an additional control, PIK3R2 (Phosphoinositide-3-Kinase Regulatory Subunit 2) was used which showed no interaction with ALK bait in MaMTH (see MaMTH (1), Figure 13), but was a predicted ALK interactor in FpClass. As shown in Figure 16, all the selected ALK interactors were validated with Co-IP except for LYN, which was not expressed with the HA tag. PIK3R2 demonstrated no interaction with ALK bait in Co-IP which is consistent with the MaMTH results.

kDa kDa

250 250 ⍺-FLAG ⍺-FLAG 130 130

F - 70

⍺

: 70

P ⍺-HA I ⍺-HA 35 35

Figure 16. Validation of novel identified ALK interactors in MaMTH using Co-IP. ALK bait and the ALK interactors were probed with -FLAG and -HA, respectively. ALK+vector and ALK only were used as negative controls.

3.9: Active and kinase-dead forms of ALK

It has been shown that MaMTH can detect PPIs correlated with oncogenic nature of the EGFR and ErbB4 receptors (Petschnigg et al., 2014). As mentioned before, ALK has been shown to be mutated in neuroblastoma (Yaël P Mossé et al., 2008) and anaplastic thyroid cancer (Murugan & Xing, 2011). These activating or gain-of-function ALK mutations occur predominantly in the kinase domain of ALK, resulting in constitutive ligand-independent activation of ALK. In order to model constitutively ‘active’ ALK mutants in our system and test the effect of previously identified ALK mutations on ALK interactions using MaMTH, ‘active’ ALK mutants were generated. Moreover, a kinase-dead form of ALK was generated to test the phosphorylation- dependency of ALK interactions in MaMTH.

3.9.1: Generation of ALK active and kinase-dead mutants

Amino acid substitution of phenylalanine to cysteine, isoleucine, leucine and valine at position 1245 (F1245C, F1245I, F1245L, F1245V) and substitution of leucine to methionine at position 1196 (L1196M) were created using site-directed mutagenesis to generate active forms of ALK. In addition, isoleucine was substituted with threonine at position 1250 (I1250T) to generate

60 kinase-dead ALK bait. ALK wild type was used as the DNA template. The active and kinase- dead ALK baits were then transfected into HEK293 cell line stably expressing firefly luciferase reporter gene, established by the Stagljar Lab (see appendix 1.7), to generate the stably integrated mutant ALK baits using FLP-In TREx system.

3.9.2: Expression and phosphorylation status of mutant ALK baits

The expression and phosphorylation status of ALK active (F1245C, F1245I, F1245L, F1245V and L1196M) and kinase-dead (I1250T) mutants as well as wild type were tested by immunoprecipitation, using anti-V5 antibody to pull down the ALK bait proteins. Western immunoblotting was performed using anti-phospho-ALK antibody (pTyr1604), to check the phosphorylation of tyrosine residue 1604 of ALK mutants and wild type (Figure 17). Tyr1604 is one of the important residues, located at the C-terminal tail of the receptor, to indicate activation of ALK. Studies with NPM-ALK fusion protein have shown that Tyr1604 is important for transformation activity of NPM-ALK. Moreover, it serves as docking site for downstream protein PLCγ (Bai, Dieter, Peschel, Morris, & Duyster, 1998).

As shown in Figure 17, ALK active and kinase-dead mutants as well as wild type were expressed correctly. Furthermore, much more phosphorylation of ALK at Tyr1604 was observed in cells expressing F1245C, F1245I, F1245V and L1196M active mutants as compared to wild type and kinase-dead, as expected. The pattern of Tyr1604 phosphorylation in cells expressing the F1245L active mutant was almost the same as that of wild type ALK, which suggests that F1245L does not behave like the other active mutants. Phosphorylation of Tyr1604 could not be detected in the IP input sample.

kDa kDa

250 t 250

5 ⍺-V5 ⍺-V5 n

⍺

250 ⍺-pALK (pTyr1604)

Figure 17. Expression and phosphorylation status of mutant and wild type ALK baits. The expression of ALK active (F1245C, F1245I, F1245L, F1245V and L1196M), kinase-dead (I1250T) and wild type were measured using anti-V5 antibody. Phosphorylation of tyrosine residue 1604 was tested in the cells expressing ALK active and kinase-dead mutants as well as wild type using anti-phospho-ALK (pTyr1604) antibody.

3.9.3: Interaction of active and kinase-dead ALK mutants with ALK known interactors

In order to test the effect of ALK mutations on PPIs of ALK, the MaMTH assay was performed with ALK active and kinase-dead mutants as well as wild type. Two known ALK interactors (Nub-GRB2 and Nub-PDLIM3) were transfected into HEK293 cell line stably expressing ALK mutants and wild type and luciferase signals were calculated after 24 hours. Nub-PEX7 was transfected into HEK293 cell line stably expressing ALK mutants and wild type as negative control. The assays were done in triplicate and the two-tailed unpaired t-test was used to calculate P-values. The MaMTH assay showed significantly higher luciferase signals (P <0.05 – P<0.01) for active ALK mutants as compared to ALK wild type.

As illustrated in Figure 18, F1245C, F1245V and L1196M mutants showed significantly more luciferase signal with Nub-GRB2 (almost 2-fold increase) as compared to wild type and F1245I, F1245V and L1196M mutants demonstrated significantly more luciferase signal with Nub- PDLIM3, while the kinase-dead mutant did not show luciferase signal due to no interaction. Therefore, the MaMTH results confirm the previously known ALK active mutants that showed more phosphorylation of Tyr1604 in the immunoprecipitation assay (Figure 17). MaMTH was also able to detect the changes in PPIs of ALK conferred by mutation. Luciferase signals of ALK

62 bait alone of both wild type and mutants were subtracted from that of each prey tested in this experiment to eliminate the effect of different bait expressions.

F1245L mutant was excluded from further studies as it didn’t behave as an active mutant in both the MaMTH assay and immunoblotting with pALK (pTyr1604) antibody.

2.50E+06

)

i * *

n 2.00E+06 i *

c ALK-wt

a t

e a

s 1.50E+06 F1245C

B *

r *

e t

f * F1245I

e 1.00E+06

u z

l i F1245L

t 5.00E+05 F1245V

l o

N L1196M

( R 0.00E+00 Nub-PEX7 Nub-GRB2 Nub-PDLIM3 -5.00E+05

1.20E+07 *

)

t y 1.00E+07 *

c 8.00E+06

a t

i ALK-wt

e a

B a 6.00E+06

r o F1245C

e t

c e L1196M

u z 4.00E+06

l i *

a *

v * I1250T * P< 0.05

t 2.00E+06

a l o ** ** P< 0.01

( R 0.00E+00 Nub-PEX7 Nub-GRB2 Nub-PDLIM3 -2.00E+06

Figure 18. Interactions of Active and Kinase-dead mutants in MaMTH. *** P < 0.001, ** P < 0.01, * P < 0.05; two-tailed unpaired t-test calculations compared to ALK wild type (dark blue). Nub-PEX7 was the negative control.

3.9.4: Characterization of downstream signaling of ALK wild type and mutants using Western immunoblotting To see the effect of ALK mutations on downstream signaling, Western immunoblotting (pERK1/2) was used with the F1245C, F1245I and L1196M active mutants which showed

63 significantly higher luciferase signals in MaMTH (Figure 18), and for the I1250T inactive ALK mutant. HEK293 cell lines stably expressing active and kinase-dead forms of ALK and ALK wild type were induced with 0.5 µg/ml of tetracycline when they reached 70-80% confluency. Cells were then lysed and cell lysates were run in polyacrylamide gel to see how downstream signaling of ALK (pERK1/2) changes in the presence of wild type, active and kinase-dead forms of ALK (Figure 19). There is less phosphorylation of downstream protein ERK1/2 in ALK wild type expressing cells as compared to cells expressing constitutively active mutants (F1245C, F1245I and L1196M). Moreover, there is no phosphorylation of downstream protein ERK1/2 in the cell line expressing ALK kinase-dead mutants, as expected (Figure 19). Consequently, this signaling study showed that active forms of ALK could activate ALK downstream signaling due to constitutively activation and phosphorylation of ALK. However, kinase-dead ALK mutant is unable to activate ALK downstream signaling. This experiment confirmed the MaMTH result which showed increase in luciferase signal in the presence of active mutants as compared to wild type (Figure 18).

kDa

250 ⍺-V5 130

⍺-ERK1/2 35

55 ⍺-pERK1/2 35

55 ⍺-Tubulin 35

Figure 19. Downstream signaling of ALK wild type and mutants. Expression of ALK wild type and mutants were tested using anti-V5 antibody. Phosphorylation of downstream signaling was tested using anti-pERK1/2. Tubulin was used as a loading control and 20 ng of total protein was loaded per well.

3.9.5: Characterization of tyrosine phosphorylation of ALK wild type and mutants in the presence of Brigatinib Efficient inhibition of ALK activity in neuroblastoma cell line has been shown in the presence of brigatinib, a second-generation ALK inhibitor. Brigatinib, which is the tyrosine kinase inhibitor

65 that binds to ATP-binding pocket of the ALK kinase domain, inhibits the phosphorylation and activation of ALK. Brigatinib was also shown to abrogate the activity of constitutively active ALK variants in in vitro assays (Siaw et al., 2016). Therefore, the phosphorylation status of tyrosine residue 1604 was tested for ALK wild type and mutants (F1245C, L1196M and I1250T) in the presence of brigatinib to test the effect of brigatinib on phosphorylation and activation of ALK wild type and mutants. HEK293 cell lines stably expressing ALK wild type and mutants were treated with 500nM of brigatinib and immunoprecipitated using anti-V5 antibody to pull down the ALK bait proteins. Western immunoblotting was performed using anti-phospho-ALK antibody (pTyr1604) to check the phosphorylation of Tyr1604 of ALK wild type and mutants. As shown in Figure 20, ALK wild type and mutants were expressed properly in the presence and absence of brigatinib. However, kinase activity of ALK wild type and active mutants was abolished in the presence of 500nM of brigatinib. This effective inhibition of the activity of ALK wild type and active mutants is consistent with Siaw et al. studies (Siaw et al., 2016), and showed that both ALK wild type and mutants in our system respond to the previously known ALK inhibitor, brigatinib. Phosphorylation of Tyr1604 could not be detected in the input sample.

kDa kDa

250 t u 250

⍺-V5 n

I 5 ⍺-V5

⍺

250 ⍺-pALK (pTyr1604) Brigatinib - + - + - + - + - + (500nM)

Figure 20. Tyrosine phosphorylation of ALK wild type and mutants (F1245C, L1196M and I1250T) in the presence of Brigatinib. Anti-V5 and anti-pALK (pTyr1604) antibodies were used to check the expression and phosphorylation of Tyr1604 of ALK wild type and mutants, respectively.

3.10: Investigating phosphorylation-dependent interactions of ALK wild type using MaMTH MaMTH was previously shown to detect phosphorylation-dependent protein-protein interactions (Petschnigg et al., 2014). As described in section 3.9, a kinase-dead ALK mutant was generated to test the phosphorylation-dependent PPIs of ALK. Furthermore, MaMTH screening was performed with brigatinib to determine any changes in PPIs between selected preys and ALK bait upon introduction of drug, and determine phosphorylation-dependent PPIs of ALK. HEK293-ALK was transfected with two known ALK interactors (Nub-HSP90 and Nub-FRS2) and a novel ALK partner identified in MaMTH, Nub-NCK2. Five hours after transfection, 0.5 µg/ml of tetracycline and 500 nM of drug (brigatinib) were added. The luciferase activity of selected preys was measured after 18 hours of drug treatment. Nub-PEX7 was used as negative control and the assays were performed in triplicate. The two-tailed unpaired t-test was used to calculate P-values comparing interactions in the presence of brigatinib to DMSO control. The MaMTH assay showed significantly lower luciferase signals (P <0.05 – P<0.001) in the presence of brigatinib. Luciferase activity upon interaction of ALK bait and selected preys decreased significantly in the presence of brigatinib as compared to DMSO control (500 nM), which suggests that the interactions were phosphorylation-dependent. The EGFR-inhibitor erlotinib (500 nM) has been used as a negative control as it does not have any effect on the ALK kinase activity and showed almost the same luciferase signal as DMSO control (Figure 21).

ALK-Cub-TF 3.00E+05 ** **

) ***

y 2.50E+05

v n

t 2.00E+05

t 1.50E+05

u z

l i

l 1.00E+05

e a

e 5.00E+04

(

0.00E+00 Nub-PEX7 Nub-HSP90 Nub-FRS2 Nub-NCK2 * P< 0.05 DMSO Erlotinib Brigatinib ** P< 0.01 *** P< 0.001

Figure 21. MaMTH for screening phosphorylation-dependent protein-protein interactions. *** P < 0.001, ** P < 0.01, * P < 0.05; two-tailed unpaired t-test calculations compared brigatinib (dark blue) to DMSO control (light blue). The plotted values represent relative luciferase signals normalized to bait expression.

3.11: Assessment of cell viability in the presence of brigatinib

As shown in Figure 21, the luciferase signals due to the interaction of ALK-Cub-TF and selected preys decreased significantly in the presence of brigatinib. To examine whether this decrease in luciferase signals was due to the phosphorylation status of ALK and not because of cell death, cell viability assays were performed in triplicate using HEK293-ALK. The cells were transfected with the selected preys (Nub-HSP90, Nub-FRS2 and Nub-NCK2), treated with 500nM of brigatinib, erlotinib or DMSO for 18 hours and assessed for viability using a CellTiter-Blue cell viability assay (Promega). As shown in Figure 22, no cell death was observed in the presence of 500nM of brigatinib.

ALK-Cub-TF 400

350

t i 300

e 250

n a 200

o s 150

A 100

0 Bait Only Nub-PEX7 Nub-HSP90 Nub-FRS2 Nub-NCK2 DMSO Erlotinib Brigatinib

Figure 22. Cell viability assay of HEK293-ALK in the presence of brigatinib. The plotted values represent fluorescence measured at 560 nm.

3.12: Testing phosphorylation-dependent interactions of ALK wild type at different concentrations of brigatinib, using MaMTH To optimize MaMTH screening with brigatinib, dose response curves were generated to find the minimum concentration of drug which could inhibit ALK kinase activity. Nub-HSP90, Nub- FRS2 and Nub-NCK2 were transfected into HEK293-ALK to check their interaction with ALK bait at different concentrations of brigatinib from 0 to 500nM. It was found that brigatinib inhibits ALK activity even at the very low concentration of 3nM (Figure 23).

ALK-Cub-TF 1.4

) 1.2

M v 1

a o

e 0.8

a e

r z

i a

c 0.6

( 0.4

0.2

0 0nM 3nM 5nM 10nM 25nM 50nM 75nM 100nM 250nM 500nM Nub-PEX7 Nub-HSP90 Nub-FRS2 Nub-NCK2

Figure 23. Phosphorylation-dependent interactions of ALK wild type at different concentrations of brigatinib using MaMTH. The plotted values represent relative luciferase signals normalized to DMSO control. Nub-PEX7 was used as negative control.

3.13: Characterization of ALK bait expression and downstream signaling in the presence of Brigatinib Based on previous studies (Siaw et al., 2016), brigatinib blocks the activity of ALK wild type at 25nM concentration in PC12 cells. Therefore, the effect of brigatinib on ALK downstream signaling was examined. Phosphorylation of downstream protein ERK1/2 in HEK293-ALK was tested in the presence of 25nM of brigatinib. The expression of ALK bait was examined in the same conditions to ensure the same bait expression in the presence of drug as compared to no drug. Western immunoblotting was performed after 18 hours of drug treatment. Anti-V5 antibody was used to check ALK bait expression and anti-pERK1/2 antibody was used to check phosphorylation of downstream protein ERK1/2. It was shown that phosphorylation of downstream protein ERK1/2 decreased in the presence of the inhibitor (brigatinib) whilst the bait expression remained the same (Figure 24). It is worth noting that there was no phosphorylation of ERK1/2 in no tetracycline conditions as there was no ALK bait expression.

kDa +DMSO +Erlotinib +Brigatinib

250 ⍺-V5

55 ⍺-ERK1/2 35

55 ⍺-pERK1/2 35

55 ⍺-GAPDH 35

Tetracycline (0.5 µg/ml) - + + + - + + + - + + +

Figure 24. Expression and downstream signaling of ALK wild type bait in the presence of 25nM brigatinib. Erlotinib was used at concentration of 25nM in this assay. GAPDH was loading control; 20 ng of total protein were loaded per well.

3.14: Testing phosphorylation-dependence of ALK wild type interactions at 25nM concentration of brigatinib Based on the MaMTH assays performed in the presence of different concentrations of brigatinib (Figure 23) and previous studies which showed ALK activity was blocked in the presence of 25nM of brigatinib (Siaw et al., 2016), the interaction of the subset of novel ALK interactors (SH2/PTB domain-containing proteins) identified in MaMTH were tested in the presence of 25nM of brigatinib, to see any changes in PPIs between selected preys and ALK bait. N- terminally tagged of selected preys were transfected into HEK293-ALK and the luciferase activity of selected preys was measured after 18 hours of drug treatment. Luciferase activity upon interaction of ALK bait and selected preys decreased significantly for most ALK

71 interactors in the presence of 25nM of brigatinib, as compared with the no brigatinib condition (Figure 25). N-tagged HSP90, GRB2, FRS2, SHC1 and CRKL preys were used as positive controls and Nub-PEX7 was used as negative control. The assay was performed in triplicate and the two-tailed unpaired t-test was used to calculate P-values comparing known interactions to this negative control. The MaMTH assay showed significantly lower luciferase signals (P <0.05 – P<0.01) in the presence of brigatinib for approximately half of the preys including Nub-NCK2, Nub-SLA2 and Nub-SRMS indicating that these prey proteins interact with ALK in phosphorylation-dependent manner.

ALK-Cub-TF 3.50E+05

3.00E+05 *

y 2.50E+05

c 2.00E+05

a **

e s * a 1.50E+05 * r -Brigatinib

f * i +Brigatinib

u 1.00E+05 * * **

L ** * * * * 5.00E+04 *

0.00E+00

* P< 0.05 ** P< 0.01

Figure 25. MaMTH screening for phosphorylation-dependent protein-protein interactions. The plotted values represent raw luciferase signals. ** P < 0.01, * P < 0.05; two-tailed unpaired t-test calculations compared luciferase signals in media containing brigatinib to media lacking brigatinib. luciferase signals in the presence of brigatinib were shown in orange bars as compared to blue bars which represent luciferase signals in no brigatinib conditions.

3.15: Functional characterization of ALK interactors

In order to investigate the functional effect of novel ALK interactors, Dr. Tania Christova, a research associate in the lab of Dr. Attisano at the University of Toronto, transfected HA-tagged NCK2, SLA, ABL1, FLT1 and EEF1A2, MaMTH-identified novel ALK interactors, into mouse neuronal cells expressing ALK wild type. She took mouse neuronal cells at day 15-16 and fixed the cells after 33 hours of transfection. Additionally, she quantified the number of neurons with no axons and with multiple axons using the program Velocity. She found that there is about a 40% increase in the number of neurons with no axons in the presence of NCK2 and SLA which is the same result as found in ALK/LTK overexpression (about 40%) (Figure 26a). Therefore, NCK2 and SLA may affect the activity or expression level of ALK. No axon in the presence of NCK2 was illustrated in Figure 26b as compared to normal axon in the presence of EGFP only.

a b Normal axon

EGFP FEAGMFP15+0NACK2

No axon

Figure 26. Functional characterization of novel ALK interactors identified in MaMTH. (a) The plotted values represent percentage of all neurons with no axon or single and multiple axons. Unpublished data from Attisano lab showed an increase in the number of neurons with no axon when ALK is activated or overexpressed. SLA and NCK2, as novel binding partners of ALK identified in MaMTH, seem to affect the activity or expression level of ALK. (b) fluorescence images of normal and short axon. EGFP was used as a control.

3.16: Investigating the effect of FAM150A and FAM150B ALK ligands

Generally, activation of ALK occurs through ligand-induced dimerization. However, mammalian ALK remained as an orphan receptor for a long time as the identity of its activating ligand was unclear (Bengt Hallberg & Palmer, 2013). In 2015, Guan et al. reported two small secreted proteins (FAM150A and FAM150B) as potent ALK ligands, which showed strong activation of ALK downstream signaling in PC12 cells (Guan et al., 2015).

ALK ligands, FAM150A and FAM150B constructs, were kindly provided by Dr. Palmer, Gothenburg University, Sweden, and used to stimulate ALK-Cub-TF expressing cells. The ligands were expressed in HEK293 cells and added to HEK393-ALK cells. Phosphorylation of downstream protein ERK1/2 was checked for ALK-Cub-TF expressing cells in the presence of ligand using Western immunoblotting. As shown in Figure 27a, there is slightly more phosphorylation of ERK1/2 in the presence of ligand. Phosphorylation of Tyr1604 of ALK-Cub- TF was tested in the presence of ligand at different time intervals from 0 to 20 minutes of stimulation, using Western immunoblotting. As illustrated in Figure 27b, phosphorylation of Tyr1604 increased after 5-minute ligand stimulation, which is consistent with Guan et al. studies (Guan et al., 2015).

In addition, MaMTH was performed with ligand stimulation of HEK293-ALK cells to assess the protein-protein interactions of ALK bait in the presence of ligand. However, there was no change in luciferase signals in the presence of ligand as compared to no ligand condition, which may be due to overexpression of ALK in our system. Overexpression of ALK bait in HEK293 cells results in increasing the expression of the ALK receptor at the membrane which leads to increasing the chance of dimerization and activation of ALK even in the absence of the ligand. Therefore, further ligand experiments were excluded from this study.

a b ALK-wt kDa kDa 250 ⍺ 250 -V5 ⍺-V5

55 ⍺-ERK1/2 250 35 ⍺-pALK (pTyr1604)

55 ⍺-pERK1/2 35 55 ⍺-Tubulin

55 ⍺-Tubulin Ligand stimulation (min) 0 0 5 10 20 35 Tetracycline (0.5 µg/ml) - + + + +

Figure 27. Ligand stimulation of HEK293-ALK. (a) Testing phosphorylation of downstream protein ERK1/2 using anti-pERK1/2 antibody. Anti-V5 antibody was used to check ALK bait expression and tubulin was used as loading control. (b) Testing phosphorylation of Tyr1604 of ALK-Cub-TF in the presence of ligand at different time intervals from 0 to 20 minutes using anti-pALK (pTyr1604) antibody. Tubulin was used as loading control.

Chapter 4 Discussion

4.1: Generation of bait and prey constructs and optimization of MaMTH

In order to perform MaMTH, C-terminally tagged ALK bait and N- and C- terminally tagged prey proteins were required. Prey proteins were either known or predicted ALK-interactors selected by BioGRID database and FpClass protein-protein interaction prediction method.

HEK293 cell line stably expressing ALK-Cub-TF was successfully generated under the control of a tetracycline-inducible promoter using the Flp-In-TREX system. ALK bait showed detectable expression at different concentration of tetracycline from 0.005 to 1 µg/ml. All MaMTH experiments were performed at tetracycline concentration of 0.5 µg/ml as ALK bait expression appeared to reach its maximum at that concentration. Moreover, concentration of 0.5 µg/ml of tetracycline is the most common concentration which was used in Stagljar lab for the expression of different baits. Furthermore, there was no ALK bait expression in the media with no tetracycline as expected indicating that Tet-off/on system is suitable for the inducible expression of ALK “bait” protein in MaMTH.

Petschnigg et al. tested different variants of Nub and determined that human wild-type NubI and Cub displayed the best affinity; therefore, in all MaMTH experiments performed, prey proteins were tagged with the NubI (or wild-type) variant (Petschnigg et al., 2014). Forty-six predicted ALK interactors which showed the interaction score of more than 0.5 were selected from FpClass in this study. FpClass is a data-mining based method for proteome-wide protein-protein interaction prediction. FpClass categorizes series of protein features (for example, domains, co- expressions or post-translational modifications (PTMs)) and uses such sets as analytical features. It also searches for incompatible features that may reduce the chances of protein-protein interactions (Kotlyar et al., 2015). N- and C-terminally tagged preys of 46 predicted ALK interactors (selected from FpClass) were successfully generated. N- and C-terminally tagged preys of 23 previously known ALK interactors selected from BioGRID were also generated. The expression of the prey proteins was tested using western immunoblotting (Figure 10). However,

76 some were not expressed and the reason may be that for such proteins the conditions used for Western immunoblotting were not optimal, e.g. the lysis buffer or the loading buffer. Another possibility which results in lack of prey expression could be loss of stability of some proteins upon tagging with NubI.

As mentioned before, ALK bait is expressed under the control of the tetracycline-inducible promoter for the bait expression to be controlled. To further validate the tetracycline concentration of 0.5 µg/ml for use in MaMTH, an assay was performed with some known ALK interactors in the presence of 0.5 µg/ml of tetracycline as well as in no tetracycline conditions. By considering the results from the Western immunoblotting and MaMTH data of ALK bait (Figures 9 and 11), a concentration of 0.5 µg/ml of tetracycline was suitable for induction of bait expression and detectable MaMTH activity. Therefore, further MaMTH experiments with ALK bait were performed with the tetracycline concentration of 0.5 µg/ml. Moreover, no luciferase signals were detected for tested preys in no tetracycline condition as there was no ALK bait expression, consistent with the results of Western immunoblotting of ALK bait expression.

4.2: MaMTH could detect condition-dependent PPIs of ALK bait

MaMTH could detect serum-dependent protein-protein interactions in HEK293-ALK cells, which were transfected with some known ALK interactors such as SHC1, PDLIM3 and GNB2L1. This MaMTH assay demonstrated increased luciferase activity in full media as compared to cells grown in serum starvation media, indicative of activated ALK. This increased luciferase signals in full media as compared to serum starvation media could be because of endogenous ligand in full media which results in activation and phosphorylation of ALK which is missing in serum starvation media. Therefore, MaMTH can be used as a technology to map interaction network of membrane proteins under desired conditions.

4.3: Analysis of targeted MaMTH screening with ALK bait

Although different approaches exist for studying PPIs of membrane proteins, a comprehensive study of ALK interactors has not yet been performed using full length ALK because traditional

77 proteomics technologies do not use full length ALK in its native environment. Previous ALK interactors have been identified using co-immunoprecipitation, affinity capture-MS and two- hybrid approaches however, they could not study the full length ALK. My work created a preliminary network of the wild type ALK interactome mapped by MaMTH, which is necessary for assessing and understanding complex signaling pathways. Overall, the analysis of the ALK interactome can provide critical and focused research directions for ALK signaling and function.

Initially, biased screening for ALK interactors was performed using MaMTH with 46 predicted ALK interactors (selected from FpClass) as well as 23 Known ALK interactors (selected from BioGRID). This targeted screening confirmed 8 previously known ALK interactors (N- and C- terminally tagged of GRB2, C-terminally tagged of SHC1 and N-terminally tagged of CORO1C, PDLIM3, GNB2L1, KRT18 and FRS2) and identified 4 novel ALK interactors (N-terminally tagged of LYN, HCK, EEF1A2 and FLT1). Moreover, MaMTH was performed to test the interaction of a library of SH2/PTB domain-containing proteins (generated by Luka Drecun) with ALK bait. This biased screening provided 30 more novel ALK interactors as well as confirmed three previously known ALK interactors, specifically CRKL, PIK3R1 and SRC.

In total, MaMTH could confirm the interaction of 11 out of 22 (50%) expressed known ALK interactors as well as detect 34 novel ALK interactors. All novel ALK interactors identified in this study using MaMTH are summarized in Supplementary Table A2.1.2.

Most of the previously known ALK interactors which could not be confirmed in MaMTH had been identified with NPM-ALK fusion protein using Mass Spectrometry (MS). This fusion protein, consisting of first 117 amino acids of the NPM protein and the C-terminal residues 1058-1620 of ALK (Morris et al., 1994), was shown to interact with STAT3 and IRS (Crockett, Lin, Elenitoba-Johnson, & Lim, 2004). Furthermore, TNK2 which was identified by affinity- capture-western immunoblotting requires GRB2 for efficient binding to some RTKs such as ALK (Pao-Chun, Chan, Chan, & Manser, 2009). Generally, previously known ALK interactors which were not detected in MaMTH could be due to tagging with Nub. Tagging prey proteins with Nub in MaMTH may affect the protein stability and folding and as a result protein-protein interactions. Moreover, MaMTH could not detect indirect interactions.

Two known ALK interactors, STAT3 and IRS1, which interact with NPM-ALK fusion protein, were not detected in MaMTH which may be due to different structure of NPM- ALK fusion protein as compared to full length wild type ALK in MaMTH. In addition, the NPM-ALK fusion protein is cytoplasmic which may increase the chance of interaction with other cytoplasmic proteins such as STAT3 and IRS1 as compared to wild type ALK in MaMTH which is membrane-bound receptor protein.

4.4: Validation of ALK interactors

As a secondary validation, co-immunoprecipitation was performed with a subset of novel ALK interactors identified in MaMTH. Nine prey proteins were selected to be tested in co- immunoprecipitation. Six out of nine were novel ALK interactors identified in targeted MaMTH screenings (NCK2, CRKI, HSH2D, EEF1A2, LYN and SRMS), which show significantly (as determined by two-tailed unpaired t-test with a P-value cutoff < 0.05) higher luciferase signal as compared to negative control (Nub-PEX7), or co-localize with ALK in brain and nervous system, two were known ALK interactors (CRKL and GNB2L1) and one was a non-ALK interactor (PIK3R2). LYN (the novel ALK interactor identified in MaMTH) could not be expressed with HA-tag in this experiment. Therefore, the lack of interaction of LYN with ALK in co-immunoprecipitation was due to lack of its expression. Five out of five (100%) of novel ALK interactors which expressed and were identified in MaMTH were also positive interactors of ALK in co-immunoprecipitation. PIK3R2 has been predicted as ALK interactor based on FpClass prediction system however, it is worth noting that consistent with MaMTH results, PIK3R2 did not show any interaction with ALK bait in co-immunoprecipitation. It seems that PIK3R2 is not a real ALK interactor and may instead be a false-positive interactor of ALK predicted by the FpClass system which has shown false discovery rate of 60%. At an estimated false discovery rate of 60%, FpClass achieved better agreement with experimentally detected PPIs compared to previous PPI prediction methods (Kotlyar et al., 2015).

4.5: Investigating the ALK active mutants

F1245 is one of the three hotspot residues accounting for 12% of ALK mutations. F1245 was substituted to cysteine, leucine, isoleucine and valine which have been observed in 0.9% of tumors. These mutations occurred in ALK tyrosine kinase domain and play roles in auto

79 inhibition of ALK which then mutated results in activation of ALK (Chen et al., 2008) (George et al., 2008) (Bengt Hallberg & Palmer, 2013) (Janoueix-Lerosey et al., 2008) (Yaël P Mossé et al., 2008). F1245C results in constitutive, ligand-independent activation of ALK and has been observed in neuroblastoma. However, the effect of F1245I, F1245L and F1245V mutations on ALK has remained unknown (Bengt Hallberg & Palmer, 2013). L1196M is a gatekeeper mutation which has been classified as a gain-of-function, ligand-independent mutation and showed more transforming ability in NIH 3T3 cells (Scott C. Bresler et al., 2014) (Katayama et al., 2012) (R. Doebele, Pilling, ...., & Camidge, 2012). MaMTH was performed to monitor the interactions of active forms of ALK that display constitutive kinase activity. Phenylalanine substitution to cysteine, leucine, isoleucine and valine at position of 1245 and leucine to methionine at position of 1196 were introduced to generate constitutive active forms of ALK. Consistent with previous studies discussed above, a significant increase was detected in luciferase signals related to interaction of F1245C, F1245I, F1245V and L1196M active ALK mutants with two known ALK interactors (GRB2 and PDLIM3) as compared to ALK wild type. Increased luciferase signal was correlated to constitutive activation of ALK mutants by introduction of mutations in the kinase domain of ALK. Taken together, MaMTH could detect any changes in PPIs conferred by mutations and these mutations could be disease-related such as F1245C which has been observed in neuroblastoma (Bengt Hallberg & Palmer, 2013).

Therefore, MaMTH could be used to monitor and identify unique interactors of ALK active mutants. For further study, MaMTH could identify the interactors that interact with ALK active mutants but not wild type or vice-versa, which would represent possible targets for therapeutic approaches.

The effect of F1245L mutation on ALK has not been cleared yet and it has been observed in neuroblastoma in a synergy with MYCN amplification. It has been assumed that F1245L mutation, which did not show any increase in luciferase signal in MaMTH assay, might have effect on ALK activation in a synergy with MYCN amplification (Bengt Hallberg & Palmer, 2013).

As the tyrosine residue at position 1604 is present in human but not mouse and it has been implicated in tumor progression (Bai et al., 1998), its phosphorylation in ALK kinase domain was tested in HEK293 cells stably expressing ALK wild type as well as active mutants. HEK293 cells stably expressing ALK active mutants (F1245C, F1245I, F1245V and L1196M) showed significantly more phosphorylation of Tyr1604 as compared with cells expressing wild type ALK, which was expected. Additionally, much more phosphorylation of downstream protein ERK1/2 in cells stably expressing active mutants as compared to wild type was a consequence of constitutive activation of ALK.

These results demonstrated that the mentioned activating point mutations occurring in the kinase domain of ALK are ligand-independent mutations associated with constitutive phosphorylation of tyrosine in the kinase domain of ALK and overall activation of ALK, as well as constitutive phosphorylation and activation of downstream protein ERK1/2. Therefore, MaMTH could confirm the activation of downstream protein pERK1/2 in the presence of previously known ALK active mutants.

4.6: Monitoring phosphorylation-dependent interactions

Receptor tyrosine kinase signaling pathways are mediated by numerous phosphorylation- dependent protein-protein interactions. The phosphorylation patterns of signaling proteins are often different in signaling pathways which leads to increased association with downstream proteins and proliferation of malignant cells (Petschnigg et al., 2014).

To ensure that the ALK interactors identified in MaMTH were associated with the phosphorylated state of ALK, a kinase-dead form of ALK was generated by substitution of isoleucine to threonine at position of 1250. The kinase-dead form of ALK (I1250T) bait did not bind to PDLIM3 and displayed significantly decreased luciferase signal with GRB2 which correlated to receptor phosphorylation patterns. Moreover, the kinase-dead form of ALK was unable to activate downstream protein ERK1/2.

Based on Bresler et al. studying (Scott C. Bresler et al., 2014) no activating effect was observed experimentally with I1250T. Consistent with Bresler et al., no activation of ALK and

81 downstream signaling were observed in cells stably expressing kinase-dead of ALK (I1250T) using MaMTH and Western immunoblotting. Consequently, PPIs which are not phosphorylation-dependent interact with ALK through other domains, which could be omitted for further drug screening assays as tyrosine kinase inhibitors block ATP-binding site of the receptor and inhibit the phosphorylation-dependent PPIs. Therefore, MaMTH can be used to monitor PPIs that are dependent on the activity and phosphorylation state of a given receptor.

As a secondary confirmation of phosphorylation-dependence of ALK interactors identified using MaMTH, MaMTH was applied to detect drug-inhibited protein-protein interactions in the presence and absence of brigatinib. Brigatinib has been shown to inhibit ALK activity in NSCLC cell lines carrying the EML4-ALK fusion protein (Katayama et al., 2011) (Ceccon et al., 2015) and inhibits ALK activity and proliferation of ALK addicted neuroblastoma cell lines (Siaw et al., 2016). Consistent with these studying, brigatinib inhibited kinase activity of ALK wild type as well as constitutively active mutants but did not exert effect on ALK kinase-dead mutant in my study. MaMTH could efficiently detect brigatinib-mediated inhibition of ALK-Cub-TF interaction with both known (Nub-HSP90, Nub-GRB2, Nub-FRS2 and Nub-SHC1) as well as novel ALK interactors.

Moreover, downstream targets of ALK such as ERK5 (Umapathy et al., 2014), AKT and ERK1/2 were less phosphorylated upon treatment with brigatinib (Schönherr, Ruuth, Yamazaki, et al., 2011). Phosphorylation of downstream protein ERK1/2 was clearly decreased upon treatment of HEK293 cell line stably expressing ALK wild type with brigatinib in this project as well.

4.7: Analysis of functional characterization of ALK interactors

To the best of our knowledge, the interaction between ALK and NCK2 as well as ALK and SLA have not been reported to date. However, in the present study these interactions were found and validated using MaMTH and Co-IP.

NCK2 is a member of the NCK family of adaptor proteins that contains three SH3 domains and one SH2 domain. The protein has been shown to bind and recruit various proteins involved in the regulation of receptor tyrosine kinases. NCK2 is involved in signaling pathways mediating cell proliferation and cytoskeleton organization. Labelle-Côté et al. demonstrated the involvement of NCK2 in proliferation, migration and invasion in human melanoma cells (Labelle-Côté et al., 2011). Moreover, other studies demonstrated that phosphorylation of WASp (NCK2 downstream protein) and numerous proteins involved in actin polymerization are regulated by NPM-ALK which play a critical role in contributing to the invasive properties and tumor growth of ALCL (Murga-Zamalloa et al., 2016). In addition, SLA is highly and selectively expressed in neurons and seems to be essential for neuronal functions. It has not yet been cleared whether SLA plays a role in axon guidance during development.

In collaboration with Dr. Attisano, Dr. Tania Christova found a 40% increase in the number of neuronal cells with no axon in the presence of NCK2 and SLA (two novel ALK interactors identified in MaMTH) as compared to EGFP control which is same as ALK/LTK overexpression. Unpublished data from Attisano lab showed that when ALK is activated or overexpressed, there is increase in the number of neurons with no axon. Therefore, NCK2 and SLA, as ALK partners, may affect ALK activity or expression levels. This preliminary data could shed light on the mechanism of action of ALK and its role in development of diseases, however, more research needs to be done to confirm this hypothesis.

Chapter 5 Conclusion and future directions

5.1: Targeted screening of HEK293 cell line stably expressing ALK wild type resulted in detection of 34 novel ALK interactors Targeted screening of HEK293 cell line stably expressing ALK wild type was performed using MaMTH. In total 150 known and predicted ALK interactors were screened via MaMTH. Using MaMTH as a screening assay, 34 novel ALK interactors were identified and 50% of previously known ALK interactors were confirmed. Moreover, five out of five (100%) novel ALK interactors (NCK2, CRKI, HSH2D, EEF1A2 and SRMS) identified in MaMTH were validated using co-immunoprecipitation. The final, overall aim of future work will be a global, unbiased screen of the entire human protein-encoding open reading frame collection (hORFeome collection V8.1) by using two distinct MaMTH reporter systems (GFP and luciferase) in tandem to help maximize screening fidelity and reduce the number of false-positives. First, a lentiviral Nub-tagged prey library consisting of over 18,000 human ORFs will be transduced into ALK- Cub-TF expressing GFP reporter cell lines in a pooled format. Fluorescence-activated cell sorting (FACS) and deep sequencing will identify genes enriched in GFP-positive pools. Then the second round of screening with luciferase reporter will be performed with the top potential interactors from the initial GFP screening to validate the results.

5.2: MaMTH detected constitutive activation of ALK

Constitutively active ALK mutants were generated which were tested in MaMTH and showed significantly more luciferase signals with known ALK interactors as compared to wild type ALK due to their constitutive phosphorylation of tyrosine residue in the kinase domain and overall activation. Furthermore, active mutants of ALK clearly illustrated more phosphorylation of downstream protein ERK1/2 as compared to wild type ALK. It would be interesting to do high- throughput human ORFeome screening with cells expressing active mutants to find any novel interactors which interact with ALK mutant but not wild type or vice versa. By this approach, it may be possible to identify important interactions relevant to disease states, identifying potential

84 therapeutic targets.

5.3: MaMTH identified phosphorylation-dependent interactions

Phosphorylation-dependent interactions of ALK were tested using MaMTH in the presence of brigatinib and it has been identified that the luciferase signals decreased due to inhibition of kinase activity of ALK in the presence of brigatinib. For more long-term goals, it would be interesting to further investigate the effect of brigatinib on all protein-protein interactions of ALK (identified using global unbiased MaMTH screening). Finding any ALK interactor which is not affected by treatment with drug would be attractive target for studying the biology of the receptor.

Moreover, generation of kinase-dead ALK which was unable to interact with known ALK interactors was another confirmation of phosphorylation-dependent interactions of ALK. ALK kinase-dead was unable to get phosphorylated and activate downstream protein ERK1/2 as well. It would be noteworthy to perform unbiased MaMTH screening using kinase-dead form of ALK to identify novel ALK substrates which interact with ALK independence of phosphorylation status of ALK.

5.4: Study the functional effects of PPIs to understand ALK function

In addition to global, unbiased screen of the entire hORFeome collection V8.1, functional characterization of the most promising interaction partners such as NCK2, EEF1A2, SRMS, CRKI and HSH2D will be an important future goal of this project. Further functional characterization of novel PPIs of ALK that were identified by MaMTH would be useful to identify disease-associated interactors. Investigating interactions related to potential disease states would provide better understanding of associated cellular mechanisms and determine how they can potentially be controlled.

The association between ALK and the validated ALK partners (NCK2, SRMS, CRKI, EEF1A2 and HSH2D) and their effects on cell proliferation, differentiation and the related molecular mechanisms remain largely unknown. To evaluate the role of validated ALK interactors, it is worth to examine how their overexpression and knockouts influence cell signaling such as

Ras/mitogen-activated protein kinase (MAPK) and PI3K-Akt pathways in neuroblastoma cell line SH-SY-5Y (bone marrow biopsy taken from a four-year-old female with neuroblastoma) as well as IMR-32 (human cholinergic neuroblastoma cell line). ALK is mutated in SH-SY5Y cell line while IMR-32 express ALK wild type. Identification and characterization of these novel ALK PPIs might shed light on the mechanism of action of ALK and its role in neuronal development.

To generate stable knockout and overexpression cell lines expressing NCK2, SRMS, CRKI, EEF1A2 and HSH2D, CRISPR or siRNA technologies can be applied. Knockout and overexpression can be verified by Western blot. Once stable cell lines have been generated, overexpression or knockout of the candidate proteins can be tested to see if it improves or reduces the viability of the cells. To see whether these ALK interactions could be involved, proliferation, apoptosis and cell migration assays can be performed with knockout cells. ALK downstream signaling can be assessed by measuring expression of downstream effectors such as phospho-ERK and phospho-Akt using IMR-32 and SH-SY5Y cells expressing ALK wild type and ALK active mutants respectively.

Mechanisms by which ALK and its downstream interactors regulate cell proliferation, migration, invasion and contribute to the oncogenesis of different tumors are not completely understood. Functional characterization of the most promising interaction partners such as NCK2, EEF1A2, SRMS, CRKI and HSH2D contributes to better understanding their role in ALK function and its contribution to cancer as well as ALK-mediated signaling pathways.

References

Azarova, A. M., Gautam, G., & George, R. E. (2011). Emerging importance of ALK in neuroblastoma. Seminars in Cancer Biology. https://doi.org/10.1016/j.semcancer.2011.09.005 Bai, R. Y., Dieter, P., Peschel, C., Morris, S. W., & Duyster, J. (1998). Nucleophosmin- anaplastic lymphoma kinase of large-cell anaplastic lymphoma is a constitutively active tyrosine kinase that utilizes phospholipase C-gamma to mediate its mitogenicity. Molecular and Cellular Biology, 18(12), 6951–61. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9819383 Barrios-Rodiles, M., Brown, K. R., Ozdamar, B., Bose, R., Liu, Z., Donovan, R. S., … Wrana, J. L. (2005). High-throughput mapping of a dynamic signaling network in mammalian cells. Science (New York, N.Y.), 307(5715), 1621–5. https://doi.org/10.1126/science.1105776 Blasche, S., & Koegl, M. (2013). Analysis of protein-protein interactions using LUMIER assays. Methods in Molecular Biology (Clifton, N.J.), 1064, 17–27. https://doi.org/10.1007/978-1- 62703-601-6_2 Blume-Jensen, P., & Hunter, T. (2001). Oncogenic kinase signalling. Nature, 411(6835), 355– 65. https://doi.org/10.1038/35077225 Bose, R., Kavuri, S. M., Searleman, A. C., Shen, W., Shen, D., Koboldt, D. C., … Ellis, M. J. (2013). Activating HER2 mutations in HER2 gene amplification negative breast cancer. Cancer Discovery, 3(2), 224–37. https://doi.org/10.1158/2159-8290.CD-12-0349 Bossi, R. T., Saccardo, M. B., Ardini, E., Menichincheri, M., Rusconi, L., Magnaghi, P., … Bertrand, J. A. (2010). Crystal structures of anaplastic lymphoma kinase in complex with ATP competitive inhibitors. Biochemistry, 49(32), 6813–25. https://doi.org/10.1021/bi1005514 Bradshaw, R. A., Chalkley, R. J., Biarc, J., & Burlingame, A. L. (2013). Receptor tyrosine kinase signaling mechanisms: Devolving TrkA responses with phosphoproteomics. Advances in Biological Regulation. https://doi.org/10.1016/j.jbior.2012.10.006 Braverman, N., Steel, G., Obie, C., Moser, A., Moser, H., Gould, S. J., & Valle, D. (1997). Human PEX7 encodes the peroxisomal PTS2 receptor and is responsible for rhizomelic chondrodysplasia punctata. Nature Genetics, 15(4), 369–76. https://doi.org/10.1038/ng0497-369 Bresler, S. C., Weiser, D. A., Huwe, P. J., Park, J. H., Krytska, K., Ryles, H., … Mossé, Y. P. (2014). ALK Mutations Confer Differential Oncogenic Activation and Sensitivity to ALK Inhibition Therapy in Neuroblastoma. Cancer Cell, 26(5), 682–694. https://doi.org/10.1016/j.ccell.2014.09.019 Bresler, S. C., Wood, A. C., Haglund, E. A., Courtright, J., Belcastro, L. T., Plegaria, J. S., … Mosse, Y. P. (2011). Differential Inhibitor Sensitivity of Anaplastic Lymphoma Kinase Variants Found in Neuroblastoma. Science Translational Medicine, 3(108), 108ra114- 108ra114. https://doi.org/10.1126/scitranslmed.3002950 Carén, H., Abel, F., Kogner, P., & Martinsson, T. (2008). High incidence of DNA mutations and gene amplifications of the ALK gene in advanced sporadic neuroblastoma tumours. Biochem J, 416(2), 153–159. https://doi.org/10.1042/BJ20081834 Ceccon, M., Mologni, L., Giudici, G., Piazza, R., Pirola, A., Fontana, D., & Gambacorti- Passerini, C. (2015). Treatment Efficacy and Resistance Mechanisms Using the Second- Generation ALK Inhibitor AP26113 in Human NPM-ALK-Positive Anaplastic Large Cell

Lymphoma. Molecular Cancer Research : MCR, 13(4), 775–83. https://doi.org/10.1158/1541-7786.MCR-14-0157 Chand, D., Yamazaki, Y., Ruuth, K., Schonherr, C., Martinsson, T., Kogner, P., … Hallberg, B. (2013). Cell culture and Drosophila model systems define three classes of anaplastic lymphoma kinase mutations in neuroblastoma. Dis Model Mech, 6(2), 373–382. https://doi.org/10.1242/dmm.010348 Chen, Y., Takita, J., Choi, Y. L., Kato, M., Ohira, M., Sanada, M., … Ogawa, S. (2008). Oncogenic mutations of ALK kinase in neuroblastoma. Nature, 455(7215), 971–4. https://doi.org/10.1038/nature07399 Chia, P. L., Dobrovic, A., Dobrovic, A., & John, T. (2014). Prevalence and natural history of ALK positive non-small-cell lung cancer and the clinical impact of targeted therapy with ALK inhibitors. Clinical Epidemiology, 6, 423–432. https://doi.org/10.2147/CLEP.S69718 Chiarle, R., Voena, C., Ambrogio, C., Piva, R., & Inghirami, G. (2008). The anaplastic lymphoma kinase in the pathogenesis of cancer. Nat Rev Cancer, 8(1), 11–23. https://doi.org/10.1038/nrc2291 Choi, Y. L., Soda, M., Yamashita, Y., Ueno, T., Takashima, J., Nakajima, T., … ALK Lung Cancer Study Group. (2010). EML4-ALK mutations in lung cancer that confer resistance to ALK inhibitors. The New England Journal of Medicine, 363(18), 1734–9. https://doi.org/10.1056/NEJMoa1007478 Corless, C. L., & Heinrich, M. C. (2008). Molecular pathobiology of gastrointestinal stromal sarcomas. Annual Review of Pathology, 3, 557–86. https://doi.org/10.1146/annurev.pathmechdis.3.121806.151538 Crockett, D. K., Lin, Z., Elenitoba-Johnson, K. S., & Lim, M. S. (2004). Identification of NPM- ALK interacting proteins by tandem mass spectrometry. Oncogene, 23(15), 2617–2629. https://doi.org/10.1038/sj.onc.1207398 Degoutin, J., Brunet-De Carvalho, N., Cifuentes-Diaz, C., & Vigny, M. (2009). ALK (Anaplastic Lymphoma Kinase) expression in DRG neurons and its involvement in neuron-Schwann cells interaction. European Journal of Neuroscience, 29(2), 275–286. https://doi.org/10.1111/j.1460-9568.2008.06593.x Del Grosso, F., De Mariano, M., Passoni, L., Luksch, R., Tonini, G., & Longo, L. (2011). Inhibition of N-linked glycosylation impairs ALK phosphorylation and disrupts pro- survival signaling in neuroblastoma cell lines. BMC Cancer, 11(1), 525. https://doi.org/10.1186/1471-2407-11-525 Doebele, R. C. (2014). A nice problem to have: when ALK inhibitor therapy works better than expected. Journal of Thoracic Oncology : Official Publication of the International Association for the Study of Lung Cancer, 9(4), 433–5. https://doi.org/10.1097/JTO.0000000000000124 Doebele, R., Pilling, A., ...., & Camidge, R. (2012). Mechanisms of resistance to crizotinib in patients with ALK gene reaaranged NON-Small Cell lung cancer. Clinical Cancer Research, 18(5), 1472–1482. https://doi.org/10.1158/1078-0432.CCR-11-2906.Mechanisms Doerr, A. (2009). Membrane protein structures. Nature Methods, 6(1), 35–35. https://doi.org/10.1038/nmeth.f.240 Ekstrand, A. J., Sugawa, N., James, C. D., & Collins, V. P. (1992). Amplified and rearranged epidermal growth factor receptor genes in human glioblastomas reveal deletions of sequences encoding portions of the N- and/or C-terminal tails. Proceedings of the National Academy of Sciences of the United States of America, 89(10), 4309–13. Retrieved from

http://www.ncbi.nlm.nih.gov/pubmed/1584765 Englund, C., Loren, C. E., Grabbe, C., Varshney, G. K., Deleuil, F., Hallberg, B., & Palmer, R. H. (2003). Jeb signals through the Alk receptor tyrosine kinase to drive visceral muscle fusion. Nature, 425(6957), 512–516. https://doi.org/10.1038/nature01950 Fantauzzo, K. A., & Soriano, P. (2015). Receptor tyrosine kinase signaling: Regulating neural crest development one phosphate at a time. Current Topics in Developmental Biology (1st ed., Vol. 111). Elsevier Inc. https://doi.org/10.1016/bs.ctdb.2014.11.005 Fields, S., & Song, O. (1989). A novel genetic system to detect protein-protein interactions. [Yeast two hybrid]. Nature, 340(6230), 245–246. https://doi.org/10.1038/340245a0 Frederick, L., Wang, X. Y., Eley, G., & James, C. D. (2000). Diversity and frequency of epidermal growth factor receptor mutations in human glioblastomas. Cancer Research, 60(5), 1383–7. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10728703 Freeman, M. (2000). Feedback control of intercellular signalling in development. Nature, 408(November), 313–319. https://doi.org/10.1038/35042500 Fu, M., Zhang, W., Shan, L., Song, J., Shang, D., Ying, J., & Zhao, J. (2014). Mutation status of somatic EGFR and KRAS genes in Chinese patients with prostate cancer (PCa). Virchows Archiv, 464(5), 575–581. https://doi.org/10.1007/s00428-014-1566-x Gainor, J. F., & Shaw, A. T. (2013). Emerging paradigms in the development of resistance to tyrosine kinase inhibitors in lung cancer. Journal of Clinical Oncology, 31(31), 3987–3996. https://doi.org/10.1200/JCO.2012.45.2029 Galkin, A. V, Melnick, J. S., Kim, S., Hood, T. L., Li, N., Li, L., … Warmuth, M. (2007). Identification of NVP-TAE684, a potent, selective, and efficacious inhibitor of NPM-ALK. Proceedings of the National Academy of Sciences of the United States of America, 104(1), 270–5. https://doi.org/10.1073/pnas.0609412103 George, R. E., Sanda, T., Hanna, M., Fröhling, S., Luther, W., Zhang, J., … Look, A. T. (2008). Activating mutations in ALK provide a therapeutic target in neuroblastoma. Nature, 455(7215), 975–8. https://doi.org/10.1038/nature07397 Guan, J., Umapathy, G., Yamazaki, Y., Wolfstetter, G., Mendoza, P., Pfeifer, K., … Palmer, R. H. (2015). FAM150A and FAM150B are activating ligands for anaplastic lymphoma kinase. eLife, 4(September 2015), 1–16. https://doi.org/10.7554/eLife.09811 Hallberg, B., & Palmer, R. H. (2013). Mechanistic insight into ALK receptor tyrosine kinase in human cancer biology. Nature Reviews. Cancer, 13(10), 685–700. https://doi.org/10.1038/nrc3580 Hallberg, B., & Palmer, R. H. (2016). The role of the ALK receptor in cancer biology. Annals of Oncology, 27(Supplement 3), iii4-iii15. https://doi.org/10.1093/annonc/mdw301 Hanks, S., & Quinn, A. (1991). Protein kinase catalytic domain sequence database: identification of conserved features of primary structure and classification of family members. Methods in Enzymology. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/1956325 Hubbard, S. R. (2002). [Frontiers in Bioscience 7, d330-340, February 1, 2002] AUTOINHIBITORY MECHANISMS IN RECEPTOR TYROSINE KINASES Stevan R. Hubbard. New York, (4), 330–340. Hubbard, S. R., & Miller, W. T. (2007). Receptor tyrosine kinases: mechanisms of activation and signaling. Current Opinion in Cell Biology. https://doi.org/10.1016/j.ceb.2007.02.010 Hubbard, S. R., & Till, J. H. (2000). and F Unction. New York, 69(1), 373–98. https://doi.org/10.1146/annurev.biochem.69.1.373 Hunter, T. (1998). The Croonian Lecture 1997. The phosphorylation of proteins on tyrosine: its

role in cell growth and disease. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 353(1368), 583–605. https://doi.org/10.1098/rstb.1998.0228 Infarinato, N. R., Park, J. H., Krytska, K., Ryles, H. T., Sano, R., Szigety, K. M., … Mark, A. (2016). HHS Public Access, 6(1), 96–107. https://doi.org/10.1158/2159-8290.CD-15- 1056.The Ishihara, T., Iino, Y., Mohri, A., Mori, I., Gengyo-Ando, K., Mitani, S., & Katsura, I. (2002). HEN-1, a secretory protein with an LDL receptor motif, regulates sensory integration and learning in Caenorhabditis elegans. Cell, 109(5), 639–649. https://doi.org/10.1016/S0092- 8674(02)00748-1 Iwahara, T., Fujimoto, J., Wen, D., Cupples, R., Bucay, N., Arakawa, T., … Yamamoto, T. (1997). Molecular characterization of ALK, a receptor tyrosine kinase expressed specifically in the nervous system. Oncogene, 14(4), 439–449. https://doi.org/10.1038/sj.onc.1200849 Janoueix-Lerosey, I., Lequin, D., Brugieres, L., Ribeiro, A., de Pontual, L., Combaret, V., … Delattre, O. (2008). Somatic and germline activating mutations of the ALK kinase receptor in neuroblastoma. Nature, 455(7215), 967–970. https://doi.org/10.1038/nature07398 Jemal, A., Clegg, L. X., Ward, E., Ries, L. A. G., Wu, X., Jamison, P. M., … Edwards, B. K. (2004). Annual report to the nation on the status of cancer, 1975-2001, with a special feature regarding survival. Cancer, 101(1), 3–27. https://doi.org/10.1002/cncr.20288 Johnson, L. N. (2009). The regulation of protein phosphorylation. Biochemical Society Transactions, 37(Pt 4), 627–41. https://doi.org/10.1042/BST0370627 Katayama, R., Khan, T. M., Benes, C., Lifshits, E., Ebi, H., Rivera, V. M., … Shaw, A. T. (2011). Therapeutic strategies to overcome crizotinib resistance in non-small cell lung cancers harboring the fusion oncogene EML4-ALK. Proceedings of the National Academy of Sciences of the United States of America, 108(18), 7535–40. https://doi.org/10.1073/pnas.1019559108 Katayama, R., Shaw, A. T., Khan, T. M., Mino-Kenudson, M., Solomon, B. J., Halmos, B., … Engelman, J. A. (2012). Mechanisms of Acquired Crizotinib Resistance in ALK- Rearranged Lung Cancers. Sci Transl Med. February, 8(4120), 120–17. https://doi.org/10.1126/scitranslmed.3003316 Knighton, D. R., Zheng, J. H., Ten Eyck, L. F., Ashford, V. A., Xuong, N. H., Taylor, S. S., & Sowadski, J. M. (1991). Crystal structure of the catalytic subunit of cyclic adenosine monophosphate-dependent protein kinase. Science (New York, N.Y.), 253(5018), 407–14. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/1862342 Kodama, T., Tsukaguchi, T., Yoshida, M., Kondoh, O., & Sakamoto, H. (2014). Selective ALK inhibitor alectinib with potent antitumor activity in models of crizotinib resistance. Cancer Letters, 351(2), 215–21. https://doi.org/10.1016/j.canlet.2014.05.020 Kornev, A. P., & Taylor, S. S. (2010). Defining the conserved internal architecture of a protein kinase. Biochimica et Biophysica Acta - Proteins and Proteomics, 1804(3), 440–444. https://doi.org/10.1016/j.bbapap.2009.10.017 Kotlyar, M., Pastrello, C., Pivetta, F., Lo Sardo, A., Cumbaa, C., Li, H., … Jurisica, I. (2015). In silico prediction of physical protein interactions and characterization of interactome orphans. Nature Methods, 12(1), 79–84. https://doi.org/10.1038/nmeth.3178 Kwak, E. L., Bang, Y.-J., Camidge, D. R., Shaw, A. T., Solomon, B., Maki, R. G., … Iafrate, A. J. (2010). Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. The New England Journal of Medicine, 363(18), 1693–703. https://doi.org/10.1056/NEJMoa1006448

Labelle-Côté, M., Dusseault, J., Ismaïl, S., Picard-Cloutier, A., Siegel, P. M., & Larose, L. (2011). Nck2 promotes human melanoma cell proliferation, migration and invasion in vitro and primary melanoma-derived tumor growth in vivo. BMC Cancer, 11(1), 1–19. https://doi.org/10.1186/1471-2407-11-443 Ladanyi, M., & Pao, W. (2008). Lung adenocarcinoma: guiding EGFR-targeted therapy and beyond. Modern Pathology : An Official Journal of the United States and Canadian Academy of Pathology, Inc, 21 Suppl 2, S16-22. https://doi.org/10.1038/modpathol.3801018 Lawrence, B., Perez-Atayde, A., Hibbard, M. K., Rubin, B. P., Cin, P. D., Pinkus, J. L., … Fletcher, J. A. (2000). TPM3-ALK and TPM4-ALK oncogenes in inflammatory myofibroblastic tumors. American Journal of Pathology, 157(2), 377–384. https://doi.org/10.1016/S0002-9440(10)64550-6 Lee, H. H., Norris, A., Weiss, J. B., & Frasch, M. (2003). Jelly belly protein activates the receptor tyrosine kinase Alk to specify visceral muscle pioneers. Nature, 425(6957), 507– 512. https://doi.org/10.1038/nature01916 Lemmon, M. A., & Schlessinger, J. (2010). Cell signaling by receptor tyrosine kinases. Cell, 141(7), 1117–34. https://doi.org/10.1016/j.cell.2010.06.011 Levis, M., & Small, D. (2003). FLT3: ITDoes matter in leukemia. Leukemia, 17(9), 1738–52. https://doi.org/10.1038/sj.leu.2403099 Li, R., & Morris, S. W. (2008). Development of anaplastic lymphoma kinase (ALK) small- molecule inhibitors for cancer therapy. Medicinal Research Reviews. https://doi.org/10.1002/med.20109 Lu, K. V., Jong, K. A., Kim, G. Y., Singh, J., Dia, E. Q., Yoshimoto, K., … Mischel, P. S. (2005). Differential induction of glioblastoma migration and growth by two forms of pleiotrophin. Journal of Biological Chemistry, 280(29), 26953–26964. https://doi.org/10.1074/jbc.M502614200 Lynch, T. J., Bell, D. W., Sordella, R., Gurubhagavatula, S., Okimoto, R. A., Brannigan, B. W., … Haber, D. A. (2004). Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. The New England Journal of Medicine, 350(21), 2129–39. https://doi.org/10.1056/NEJMoa040938 Manning, G. (2002). The Protein Kinase Complement of the Human Genome. Science, 298(5600), 1912–1934. https://doi.org/10.1126/science.1075762 Maris, J. M., Hogarty, M. D., Bagatell, R., & Cohn, S. L. (2007). Neuroblastoma. Lancet, 369(9579), 2106–2120. https://doi.org/10.1016/S0140-6736(07)60983-0 Martinsson, T., Eriksson, T., Abrahamsson, J., Caren, H., Hansson, M., Kogner, P., … Hallberg, B. (2011). Appearance of the novel activating F1174S ALK mutation in neuroblastoma correlates with aggressive tumor progression and unresponsiveness to therapy. Cancer Research, 71(1), 98–105. https://doi.org/10.1158/0008-5472.CAN-10-2366 Mathew, P., Morris, S. W., Kane, J. R., Shurtleff, S. A., Pasquini, M., Jenkins, N. A., … Copeland, N. G. (1995). Localization of the murine homolog of the anaplastic lymphoma kinase (AlK) gene on mouse chromosome 17. Cytogenetics and Cell Genetics, 70(1–2), 143–4. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/7736780 Mathivet, T., Mazot, P., & Vigny, M. (2007). In contrast to agonist monoclonal antibodies, both C-terminal truncated form and full length form of Pleiotrophin failed to activate vertebrate ALK (anaplastic lymphoma kinase)? Cellular Signalling, 19(12), 2434–2443. https://doi.org/10.1016/j.cellsig.2007.07.011 Mologni, L., Ceccon, M., Pirola, A., Chiriano, G., Piazza, R., Scapozza, L., & Gambacorti-

Passerini, C. (2015). NPM/ALK mutants resistant to ASP3026 display variable sensitivity to alternative ALK inhibitors but succumb to the novel compound PF-06463922. Oncotarget, 6(8), 5720–34. https://doi.org/10.18632/oncotarget.3122 Moog-Lutz, C., Degoutin, J., Gouzi, J. Y., Frobert, Y., Brunet-de Carvalho, N., Bureau, J., … Vigny, M. (2005). Activation and inhibition of anaplastic lymphoma kinase receptor tyrosine kinase by monoclonal antibodies and absence of agonist activity of pleiotrophin. J Biol Chem, 280(28), 26039–26048. https://doi.org/10.1074/jbc.M501972200 Morris, S. W., Kirstein, M. N., Valentine, M. B., Dittmer, K. G., Shapiro, D. N., Saltman, D. L., & Look, A. T. (1994). Fusion of a kinase gene, ALK, to a nucleolar protein gene, NPM, in non-Hodgkin’s lymphoma. Science (New York, N.Y.), 263(5151), 1281–4. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8122112 Morris, S. W., Naeve, C., Mathew, P., James, P. L., Kirstein, M. N., Cui, X., & Witte, D. P. (1997). ALK, the chromosome 2 gene locus altered by the t(2;5) in non-Hodgkin’s lymphoma, encodes a novel neural receptor tyrosine kinase that is highly related to leukocyte tyrosine kinase (LTK). Oncogene, 14(18), 2175–2188. https://doi.org/10.1038/sj.onc.1201062 Mossé, Y. P., Laudenslager, M., Longo, L., Cole, K. A., Wood, A., Attiyeh, E. F., … Maris, J. M. (2008). Identification of ALK as a major familial neuroblastoma predisposition gene. Nature, 455(7215), 930–935. https://doi.org/10.1038/nature07261 Mossé, Y. P., Wood, A., & Maris, J. M. (2009). Inhibition of ALK signaling for cancer therapy. Clinical Cancer Research : An Official Journal of the American Association for Cancer Research, 15(18), 5609–14. https://doi.org/10.1158/1078-0432.CCR-08-2762 Motegi, A., Fujimoto, J., Kotani, M., Sakuraba, H., & Yamamoto, T. (2004). ALK receptor tyrosine kinase promotes cell growth and neurite outgrowth. Journal of Cell Science, 117(Pt 15), 3319–29. https://doi.org/10.1242/jcs.01183 Murga-Zamalloa, C. a, Mendoza-Reinoso, V., Sahasrabuddhe, a a, Rolland, D., Hwang, S. R., McDonnell, S. R. P., … Lim, M. S. (2016). NPM-ALK phosphorylates WASp Y102 and contributes to oncogenesis of anaplastic large cell lymphoma. Oncogene, 36(August), 1–10. https://doi.org/10.1038/onc.2016.366 Murugan, A. K., & Xing, M. M. (2011). Anaplastic thyroid cancers harbor novel oncogenic mutations of the ALK gene. Cancer Research, 71(13), 4403–4411. https://doi.org/10.1158/0008-5472.CAN-10-4041 Nakajima, H., Ishikawa, Y., Furuya, M., Sano, T., Ohno, Y., Horiguchi, J., & Oyama, T. (2014). Protein expression, gene amplification, and mutational analysis of EGFR in triple-negative breast cancer. Breast Cancer, 21(1), 66–74. https://doi.org/10.1007/s12282-012-0354-1 Osajima-Hakomori, Y., Miyake, I., Ohira, M., Nakagawara, A., Nakagawa, A., & Sakai, R. (2005). Biological role of anaplastic lymphoma kinase in neuroblastoma. The American Journal of Pathology, 167(1), 213–22. https://doi.org/10.1016/S0002-9440(10)62966-5 Overington, J. P., Al-Lazikani, B., & Hopkins, A. L. (2006). How many drug targets are there? Nature Reviews. Drug Discovery, 5(12), 993–6. https://doi.org/10.1038/nrd2199 Palmer, R. H., Vernersson, E., Grabbe, C., & Hallberg, B. (2009). Anaplastic lymphoma kinase: signalling in development and disease. The Biochemical Journal, 420(3), 345–361. https://doi.org/10.1042/BJ20090387 Pao-Chun, L., Chan, P. M., Chan, W., & Manser, E. (2009). Cytoplasmic ACK1 interaction with multiple receptor tyrosine kinases is mediated by Grb2: An analysis of ACK1 effects on Axl signaling. Journal of Biological Chemistry, 284(50), 34954–34963.

https://doi.org/10.1074/jbc.M109.072660 Pao, W., Miller, V. A., Politi, K. A., Riely, G. J., Somwar, R., Zakowski, M. F., … Varmus, H. (2005). Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS Medicine, 2(3), e73. https://doi.org/10.1371/journal.pmed.0020073 Pawson, T., Gish, G. D., & Nash, P. (2001). SH2 domains, interaction modules and cellular wiring. Trends in Cell Biology, 11(12), 504–511. https://doi.org/10.1016/S0962- 8924(01)02154-7 Peraldo-Neia, C., Migliardi, G., Mello-Grand, M., Montemurro, F., Segir, R., Pignochino, Y., … Aglietta, M. (2011). Epidermal Growth Factor Receptor (EGFR) mutation analysis, gene expression profiling and EGFR protein expression in primary prostate cancer. BMC Cancer, 11(1), 31. https://doi.org/10.1186/1471-2407-11-31 Petschnigg, J., Groisman, B., Kotlyar, M., Taipale, M., Zheng, Y., Kurat, C. F., … Stagljar, I. (2014). The mammalian-membrane two-hybrid assay (MaMTH) for probing membrane- protein interactions in human cells. Nature Methods, 11(5), 585–92. https://doi.org/10.1038/nmeth.2895 Powers, C., Aigner, A., Stoica, G. E., McDonnell, K., & Wellstein, A. (2002). Pleiotrophin signaling through anaplastic lymphoma kinase is rate-limiting for glioblastoma growth. Journal of Biological Chemistry, 277(16), 14153–14158. https://doi.org/10.1074/jbc.M112354200 Pulford, K., Lamant, L., Morris, S. W., Butler, L. H., Wood, K. M., Stroud, D., … Mason, D. Y. (1997). Detection of anaplastic lymphoma kinase (ALK) and nucleolar protein nucleophosmin (NPM)-ALK proteins in normal and neoplastic cells with the monoclonal antibody ALK1. Blood, 89(4), 1394–404. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9028963 Regad, T. (2015). Targeting RTK signaling pathways in cancer. Cancers, 7(3), 1758–1784. https://doi.org/10.3390/cancers7030860 Robertson, S. C., Tynan, J. A., & Donoghue, D. J. (2000). RTK mutations and human syndromes - When good receptors turn bad. Trends in Genetics, 16(6), 265–271. https://doi.org/10.1016/S0168-9525(00)02021-7 Robinson, D. R., Wu, Y.-M., & Lin, S.-F. (2000). The protein tyrosine kinase family of the human genome. Oncogene, 19(49), 5548–5557. https://doi.org/10.1038/sj.onc.1203957 Roskoski, R. (2012). ERK1/2 MAP kinases: Structure, function, and regulation. Pharmacological Research, 66(2), 105–143. https://doi.org/10.1016/j.phrs.2012.04.005 Roskoski, R. (2013). Anaplastic lymphoma kinase (ALK): Structure, oncogenic activation, and pharmacological inhibition. Pharmacological Research, 68(1), 68–94. https://doi.org/10.1016/j.phrs.2012.11.007 Sakamoto, H., Tsukaguchi, T., Hiroshima, S., Kodama, T., Kobayashi, T., Fukami, T. A., … Aoki, Y. (2011a). CH5424802, a Selective ALK Inhibitor Capable of Blocking the Resistant Gatekeeper Mutant. Cancer Cell, 19(5), 679–690. https://doi.org/10.1016/j.ccr.2011.04.004 Sakamoto, H., Tsukaguchi, T., Hiroshima, S., Kodama, T., Kobayashi, T., Fukami, T. A., … Aoki, Y. (2011b). CH5424802, a selective ALK inhibitor capable of blocking the resistant gatekeeper mutant. Cancer Cell, 19(5), 679–90. https://doi.org/10.1016/j.ccr.2011.04.004 Schlessinger, J. (2000). Cell Signaling by Receptor Tyrosine Kinases A large group of genes in all eukaryotes encode for. October, 103(2), 211–225.

https://doi.org/10.1016/j.cell.2010.06.011 Schlessinger, J., & Lemmon, M. A. (2003). SH2 and PTB domains in tyrosine kinase signaling. Science’s STKE : Signal Transduction Knowledge Environment, 2003(191), RE12. https://doi.org/10.1126/stke.2003.191.re12 Schönherr, C., Ruuth, K., Eriksson, T., Yamazaki, Y., Ottmann, C., Combaret, V., … Hallberg, B. (2011). The neuroblastoma ALK(I1250T) mutation is a kinase-dead RTK in vitro and in vivo. Translational Oncology, 4(4), 258–65. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/21804922 Schönherr, C., Ruuth, K., Yamazaki, Y., Eriksson, T., Christensen, J., Palmer, R. H., & Hallberg, B. (2011). Activating ALK mutations found in neuroblastoma are inhibited by Crizotinib and NVP-TAE684. The Biochemical Journal, 440(3), 405–13. https://doi.org/10.1042/BJ20101796 Ségaliny, A. I., Tellez-Gabriel, M., Heymann, M. F., & Heymann, D. (2015). Receptor tyrosine kinases: Characterisation, mechanism of action and therapeutic interests for bone cancers. Journal of Bone Oncology, 4(1), 1–12. https://doi.org/10.1016/j.jbo.2015.01.001 Seto, T., Kiura, K., Nishio, M., Nakagawa, K., Maemondo, M., Inoue, A., … Tamura, T. (2013). CH5424802 (RO5424802) for patients with ALK-rearranged advanced non-small-cell lung cancer (AF-001JP study): A single-arm, open-label, phase 1-2 study. The Lancet Oncology, 14(7), 590–598. https://doi.org/10.1016/S1470-2045(13)70142-6 Shaw, A. T., & Engelman, J. A. (2013). ALK in lung cancer: Past, present, and future. Journal of Clinical Oncology, 31(8), 1105–1111. https://doi.org/10.1200/JCO.2012.44.5353 Shiota, M., Fujimoto, J., Semba, T., Satoh, H., Yamamoto, T., & Mori, S. (1994). Hyperphosphorylation of a novel 80 kDa protein-tyrosine kinase similar to Ltk in a human Ki-1 lymphoma cell line, AMS3. Oncogene, 9(6), 1567–74. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8183550 Siaw, J. T., Wan, H., Pfeifer, K., Rivera, V. M., Guan, J., Palmer, R. H., … Joachim T. Siaw, H. W. K. P. V. M. R. J. G. R. H. P. B. H. (2016). Brigatinib, an anaplastic lymphoma kinase inhibitor, abrogates activity and growth in ALK-positive neuroblastoma cells, Drosophila and mice. Oncotarget, 7(20), 29011–29022. https://doi.org/10.18632/oncotarget.8508 Snider, J., Kittanakom, S., Damjanovic, D., Curak, J., Wong, V., & Stagljar, I. (2010). Detecting interactions with membrane proteins using a membrane two-hybrid assay in yeast. Nature Protocols, 5(7), 1281–93. https://doi.org/10.1038/nprot.2010.83 Snider, J., Kotlyar, M., Saraon, P., Yao, Z., Jurisica, I., & Stagljar, I. (2015). Fundamentals of protein interaction network mapping. Molecular Systems Biology, 11(12), 848. https://doi.org/10.15252/msb.20156351 Soda, M., Choi, Y. L., Enomoto, M., Takada, S., Yamashita, Y., Ishikawa, S., … Mano, H. (2007). Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer. Nature, 448(7153), 561–566. https://doi.org/10.1038/nature05945 Sorkin, A., & Goh, L. K. (2009). Endocytosis and intracellular trafficking of ErbBs. Experimental Cell Research, 315(4), 683–96. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/19278030 Souttou, B., Carvalho, N. B., Raulais, D., & Vigny, M. (2001). Activation of anaplastic lymphoma kinase receptor tyrosine kinase induces neuronal differentiation through the mitogen-activated protein kinase pathway. The Journal of Biological Chemistry, 276(12), 9526–31. https://doi.org/10.1074/jbc.M007333200 Stagljar, I., & Fields, S. (2002). Analysis of membrane protein interactions using yeast-based

technologies. Trends in Biochemical Sciences, 27(11), 559–563. https://doi.org/10.1016/S0968-0004(02)02197-7 Stevens, T. J., & Arkin, I. T. (2000). Do more complex organisms have a greater proportion of membrane proteins in their genomes? Proteins, 39(4), 417–20. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10813823 Stoica, G. E., Kuo, A., Aigner, A., Sunitha, I., Souttou, B., Malerczyk, C., … Wellstein, A. (2001). Identification of Anaplastic Lymphoma Kinase as a Receptor for the Growth Factor Pleiotrophin. Journal of Biological Chemistry, 276(20), 16772–16779. https://doi.org/10.1074/jbc.M010660200 Stoica, G. E., Kuo, A., Powers, C., Bowden, E. T., Sale, E. B., Riegel, A. T., & Wellstein, A. (2002). Midkine binds to anaplastic lymphoma kinase (ALK) and acts as a growth factor for different cell types. Journal of Biological Chemistry, 277(39), 35990–35998. https://doi.org/10.1074/jbc.M205749200 Stute, C., Schimmelpfeng, K., Renkawitz-Pohl, R., Palmer, R. H., & Holz, A. (2004). Myoblast determination in the somatic and visceral mesoderm depends on Notch signalling as well as on milliways(mili(Alk)) as receptor for Jeb signalling. Development, 131(4), 743–754. https://doi.org/10.1242/dev.00972 Sun, Y., Rombola, C., Jyothikumar, V., & Periasamy, A. (2013). Förster resonance energy transfer microscopy and spectroscopy for localizing protein-protein interactions in living cells. Cytometry. Part A : The Journal of the International Society for Analytical Cytology, 83(9), 780–93. https://doi.org/10.1002/cyto.a.22321 Tartari, C. J., Gunby, R. H., Coluccia, A. M. L., Sottocornola, R., Cimbro, B., Scapozza, L., … Gambacorti-Passerini, C. (2008). Characterization of some molecular mechanisms governing autoactivation of the catalytic domain of the anaplastic lymphoma kinase. The Journal of Biological Chemistry, 283(7), 3743–3750. https://doi.org/10.1074/jbc.M706067200 Taylor, S. S. S., & Kornev, A. A. P. (2011). Protein Kinases: Evolution of Dynamic Regulatory Proteins. Trends in Biochemical Sciences, 36(2), 65–77. https://doi.org/10.1016/j.tibs.2010.09.006.Protein Ubersax, J. a, & Ferrell, J. E. (2007). Mechanisms of specificity in protein phosphorylation. Nature Reviews. Molecular Cell Biology, 8(7), 530–41. https://doi.org/10.1038/nrm2203 Ullrich J., A. . S. (1990). Signal transduction by receptors with tyrosine kinase activity. Cell, 61, 203–212. Umapathy, G., El Wakil, A., Witek, B., Chesler, L., Danielson, L., Deng, X., … Hallberg, B. (2014). The kinase ALK stimulates the kinase ERK5 to promote the expression of the oncogene MYCN in neuroblastoma. Science Signaling, 7(349), ra102. https://doi.org/10.1126/scisignal.2005470 Vernersson, E., Khoo, N. K. S., Henriksson, M. L., Roos, G., Palmer, R. H., & Hallberg, B. (2006). Characterization of the expression of the ALK receptor tyrosine kinase in mice. Gene Expression Patterns, 6(5), 448–461. https://doi.org/10.1016/j.modgep.2005.11.006 von Zastrow, M., & Sorkin, A. (2007). Signaling on the endocytic pathway. Current Opinion in Cell Biology, 19(4), 436–445. https://doi.org/10.1016/j.ceb.2007.04.021 Wagner, M. J., Stacey, M. M., Liu, B. A., & Pawson, T. (2013). Molecular Mechanisms of SH2- and PTB- Domain-Containing Proteins in Receptor Tyrosine Kinase Signaling, 1–20. https://doi.org/10.1101/cshperspect.a008987 Wang, Y.-W., Tu, P.-H., Lin, K.-T., Lin, S.-C., Ko, J.-Y., & Jou, Y.-S. (2011). Identification of

oncogenic point mutations and hyperphosphorylation of anaplastic lymphoma kinase in lung cancer. Neoplasia (New York, N.Y.), 13(8), 704–15. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/21847362 Ward, C. W., Lawrence, M. C., Streltsov, V. A., Adams, T. E., & McKern, N. M. (2007). The insulin and EGF receptor structures: new insights into ligand-induced receptor activation. Trends in Biochemical Sciences, 32(3), 129–137. https://doi.org/10.1016/j.tibs.2007.01.001 Webb, T. R., Slavish, J., George, R. E., Look, A. T., Xue, L., Jiang, Q., … Morris, S. W. (2009). Anaplastic lymphoma kinase: role in cancer pathogenesis and small-molecule inhibitor development for therapy. Expert Review of Anticancer Therapy, 9(3), 331–56. https://doi.org/10.1586/14737140.9.3.331 Wolanin, P. M., Thomason, P. A., & Stock, J. B. (2002). Histidine protein kinases: key signal transducers outside the animal kingdom. Genome Biology, 3(10), REVIEWS3013. https://doi.org/10.1186/gb-2002-3-10-reviews3013 Yao, Z., Darowski, K., St-Denis, N., Wong, V., Offensperger, F., Villedieu, A., … Stagljar, I. (2017). A Global Analysis of the Receptor Tyrosine Kinase-Protein Phosphatase Interactome. Molecular Cell, 65(2), 347–360. https://doi.org/10.1016/j.molcel.2016.12.004 Zhang, H., Pao, L. I., Zhou, A., Brace, A. D., Halenbeck, R., Hsu, A. W., … Williams, L. T. (2014). Deorphanization of the human leukocyte tyrosine kinase (LTK) receptor by a signaling screen of the extracellular proteome. Proceedings of the National Academy of Sciences of the United States of America, 111(44), 15741–5. https://doi.org/10.1073/pnas.1412009111 Zhang, Q., Raghunath, P. N., Xue, L., Majewski, M., Carpentieri, D. F., Odum, N., … Wasik, M. A. (2002). Multilevel dysregulation of STAT3 activation in anaplastic lymphoma kinase- positive T/null-cell lymphoma. J Immunol, 168(1), 466–474. https://doi.org/10.4049/jimmunol.168.1.466 Zou, H. Y., Li, Q., Lee, J. H., Arango, M. E., McDonnell, S. R., Yamazaki, S., … Christensen, J. G. (2007). An orally available small-molecule inhibitor of c-Met, PF-2341066, exhibits cytoreductive antitumor efficacy through antiproliferative and antiangiogenic mechanisms. Cancer Research, 67(9), 4408–17. https://doi.org/10.1158/0008-5472.CAN-06-4443 Zwang, Y., & Yarden, Y. (2009). Systems biology of growth factor-induced receptor endocytosis. Traffic, 10(4), 349–363. https://doi.org/10.1111/j.1600-0854.2008.00870.x

Appendix 1

A1.1: Media

A1.1.1: LB media (liquid or solid media)

20 g of LB Broth Lennox (10 g of tryptone, 5 g of yeast extract and 5 g of sodium chloride) from Bioshop was dissolved in double-distilled water and the final volume was adjusted to 1 liter. 20 g of agar from Bioshop was added for solid medium only before adjusting the volume to 1 liter. The media was then autoclaved and if antibiotic was needed (e.g., LB + ampicillin media) the media allowed to cool down that can be touched by hand and then 1 ml of 1000X appropriate antibiotic was added. Liquid media was stored at room temperature and solid media was poured into sterile plates and stored at 4 C.

A1.1.2: Cell culture media

DMEM media from Gibco supplemented with 10% FBS from Gibco and 1% Penicillin/streptomycin from Wisent, Life Technologies was used in cell culture experiments. Serum starvation media was used as DMEM media supplemented with 0.1% FBS and Penicillin/streptomycin.

A1.2: Antibiotics

A1.2.1: Ampicillin stock solution (100 mg/ml)

1.0 g of ampicillin sodium salt from Bioshop was dissolved in 10 ml of double-distilled water, filter sterilized and stored at -20 C.

A1.2.2: Spectinomycin stock solution (50 mg/ml)

0.5 g of spectinomycin from Bioshop was dissolved in 10 ml of double-distilled water, filter sterilized and stored at -20 C.

A1.3: Chemical solutions

A1.3.1: Inoue buffer for competent cells preparation

10.88 g of manganese chloride tetrahydrate (MW: 197.9 g/mol), 2.20 g of calcium chloride dihydrate (MW: 147.02 g/mol), 18.65 g of potassium chloride (MW: 74.56 g/mol) and 20 mL of 0.5M PIPES pH: 6.7 were dissolved in double-distilled water and the final volume was adjusted to 1 liter. The solution was then filter sterilized and stored at -20 C. 100 ml of 0.5M PIPES pH: 6.7 (piperazine-N, N’- bis (2-ethanesulfonic acid)) was made by dissolving 15.1 g of PIPES (MW: 302.37 g/mol) in 80 ml of double-distilled water. The solution was then filter sterilized and stored at room temperature while protected from light.

A1.3.2: 0.5M BGP (-Glycerol Phosphate) pH:7.3

17.56 g of BGP (MW: 351.27) was dissolved in 80 ml of double-distilled water, pH was adjusted to 7.3 and the final volume was adjusted to 100 ml. The solution was stored at 4 ºC.

A1.3.3: 0.2M EGTA (ethylene glycol-bis (β-aminoethyl ether)-N, N, N', N'-tetraacetic acid) pH: 8.0 7.607 g of EGTA (MW: 380.35) was dissolved in 80 ml of double-distilled water, pH was adjusted to 8.0 and the final volume was adjusted to 100 ml. The solution was stored at room temperature.

A1.3.4: 0.5M EDTA (Ethylenediaminetetraacetic acid) pH: 8.0

7.306 g of EDTA (MW: 292.24) was dissolved in 30 ml of double-distilled water, pH was adjusted to 8.0 and the final volume was adjusted to 50 ml. The solution was stored at room temperature.

A1.3.5: 1M DTT (dithiothreitol)

15.42 g of DTT (MW: 154.253) was dissolved in 80 ml of double-distilled water and the final volume was adjusted to 100 ml. The solution was stored at -20 ºC.

A1.3.6: Buffer H (Cell lysis solution for western immunoblotting)

5 ml of 0.5M BGP (-Glycerol Phosphate) pH:7.3, 357 l of 0.2M EGTA (ethylene glycol-bis (β-aminoethyl ether)-N, N, N', N'-tetraacetic acid) pH: 8.0, 100 l of 0.5M EDTA (Ethylenediaminetetraacetic acid) pH: 8.0, 50 l of 1M DTT (dithiothreitol), 50 l of 0.1M vanadate and 500 l of 1% Triton X100 were mixed and adjusted to final volume of 50 ml. 1tablet of protease inhibitor from Roche was dissolved into the 50 ml of buffer H.

A1.3.7: 4X sample buffer for proteins

1.2 ml of 100% glycerol, 400 l of 1.5M Tris-Cl (MW: 121.14 g/mol) pH: 6.8, 1.2 ml of 20% SDS, 300 l of DTT and 6nM of bromophenol blue were mixed together to make 4X sample buffer. Solution was stored at room temperature or at -20 C for longer storage.

A1.3.8: 10X running buffer for western immunoblotting

30 g of Tris (MW: 121.14), 144 g of glycine (MW: 75.07) and 50 ml of 20% SDS were dissolved in double-distilled water and the final volume was adjusted to1liter. Solution was stored at room temperature.

A1.3.9: 10X transfer buffer for western immunoblotting

18.15 g of Tris (MW: 121.14), 90 g of glycine (MW: 75.07) were dissolved in double-distilled water and the final volume was adjusted to 1 liter. Solution was stored at room temperature.

A1.3.10: 10X TBS for western immunoblotting

60.55 g of Tris (MW: 121.14) and 87.66 g of NaCl were dissolved in double-distilled water and the final volume was adjusted to1liter. Solution was stored at room temperature.

A1.3.11: 1X TBST for western immunoblotting

10 ml of 10X TBS solution explained in section 2.1.3.5. and 1 ml of Tween 20 were added to 900 ml of double-distilled water. Solution was stored at room temperature.

A1.3.12: Ponceau S for western immunoblotting

1.5 g of ponceau S powder (MW: 672.63 g/mol) was dissolved in 50 ml of 1% glacial acetic acid. Solution was stored at room temperature.

A1.3.13: 2% blocking solution for western immunoblotting

1 g of BSA (Bovine Serum Albumin) was dissolved in 50 ml of 1X TBST explained in section 2.1.3.7.

A1.3.14: 10% ammonium persulfate

10 g of ammonium persulfate (MW: 228.18 g/mol) was dissolved in 100 ml of double-distilled water. Solution was stored at 4 C.

A1.3.15: 80% glycerol

80 ml of glycerol was diluted in 20 ml of double-distilled water. Solution was autoclaved and stored at room temperature.

A1.3.16: 10% Sodium Dodecyl Sulfate (SDS)

10 g of SDS (MW: 288.38 g/mol) was dissolved in double-distilled water and the final volume was adjusted to 100 ml. solution was stored at room temperature.

A1.3.17: 50X and 1X TAE buffer for DNA electrophoresis

50X TAE buffer was made by dissolving 242 g of Tris base (MW: 121.14 g/mol), 57.1 ml of glacial acetic acid (60.05 g/mol) and 100 ml of 0.5M EDTA pH:8.0 in double-distilled water and the final volume was adjusted to 1 liter. 1X TAE buffer was made by diluting 50X TAE buffer 1:50 in double-distilled water. For 1 liter, 20 ml of 50X TAE buffer was mixed in 980 ml of double-distilled water. Both solutions were stored at room temperature.

100

A1.3.18: 1M Tris, pH: 6.8 or 8.0

121.14 g of Tris base (MW: 121.14g/mol) was dissolved in 800 ml of double-distilled water. The pH was adjusted to 6.8 or 8.0 using concentrated hydrochloric acid and the final volume was adjusted to 1 liter. Solutions was stored at room temperature.

A1.3.19: 1.5M Tris, pH: 8.8

181.75 g of Tris base (MW: 121.14g/mol) was dissolved in 800 ml of double-distilled water. The pH was adjusted to 8.8 using concentrated hydrochloric acid and the final volume was adjusted to 1 liter. Solutions was stored at room temperature.

A1.3.20: 2X BES buffer for transfection

1.07 g of BES (MW: 213.25), 1.64 g of NaCl (MW: 58.44) and 0.021 g of Na2HPO4 (MW: 141.96) were dissolved in 90 ml of double-distilled water and the pH was exactly adjusted to 6.96 using 1N NaOH. The final volume was then adjusted to 100 ml, filter sterilized and stored 10 mL aliquots at -20 C.

A1.3.21: 2.5M CaCl2 for transfection

18.4 g of CaCl2 dihydrate (MW: 147.02) in 50 ml of double-distilled water, filter sterilized and stored at -20 C. This solution can be freeze-thawed.

A1.3.22: Cell lysis buffer for measuring luciferase activity

10X cell lysis buffer from Cell Signaling Technologies was diluted to 1X with double-distilled water. 1 tablet of proteinase inhibitor from Roche was dissolved in 50 ml of 1X cell lysis buffer.

A1.3.23: Lysis buffer for co-Immunoprecipitation (Co-IP)

Lysis buffer for co-Immunoprecipitation includes:

 50mM Tris pH 7.4, 150 mM NaCl, 1mM EDTA  1% Triton X-100  10% Glycerol

101

 1X Complete inhibitor (10µg/ml leupeptin, 10 µg/ml antipain, 100µg/ml benzamidine hydrochloride, 50µg/ml aprotinin)  10 µg/ml pepstatin A  1mM PMSF  1mM sodium orthovanadate  50 mM sodium fluoride  10 mM sodium pyrophosphate  0.1mg/ml Trypsin Inhibitor (TI) 

A1.3.24: Wash buffer for co-Immunoprecipitation (Co-IP)

Wash buffer for co-Immunoprecipitation includes 1X TNE (Tris pH 7.4, 150 mM NaCl, 1mM EDTA) and 0.1% Triton X-100.

A1.4: Molecular biological kits

Kit Company Presto Mini Plasmid Kit Geneaid PureLink HiPure Plasmid Filter Maxiprep Kit Invitrogen GenepHlow Gel/PCR Kit Geneaid KAPA HiFi HotStart ReadyMix PCR Kit KAPA Biosystems

A1.5: Antibodies

Primary antibody Description Anti-Tubulin Mouse, Santa Cruz Biotechnology Anti-GAPDH Mouse, Santa Cruz Biotechnology Anti-ERK1/2 Rabbit, p44/42 MAPK, Cell Signaling Technology Anti-phospho-ERK1/2 Rabbit, P-p44/42 MAPK (T202/Y204) Cell Signaling Technology Anti-phospho-ALK (pTyr1604) Rabbit, Cell Signaling Technology Anti-V5-tag (D3H8Q) Rabbit, Cell Signaling Technology Anti-Flag Mouse, Sigma-Aldrich Anti-HA Rat, Roche Anti-rabbit IgG Anti-rat IgG Anti-mouse IgG

102

A1.6: Plasmids

Name Description pDONR233 attR regions for gateway cloning C-tagged MaMTH bait vector attR regions for gateway cloning in frame with Cub-5xGAL4 transcription factor (TF), tetracycline-inducible CMV promoter, V5 tag, ampicillin resistance gene N-tagged MaMTH prey vector attR regions for gateway cloning in frame with NubI, CMV promoter, Flag tag, ampicillin resistance gene C-tagged MaMTH prey vector attR regions for gateway cloning in frame with NubI, CMV promoter, Flag tag, ampicillin resistance gene

A1.7: Mammalian cell line

Cell line Description HEK293 (Human Embryonic Kidney) Stably expressing firefly luciferase reporter gene (5xGAL4-UAS-luciferase reporter)

A1.8: Oligonucleotides

A1.8.1: Primers for sequencing ALK bait construct

Primer name Primer sequence (5' to 3') FA-ALK 1 tctacgcccgggacctac FA-ALK 2 agagagggaaggctgtcc FA-ALK 3 atttcgagtggccctgg FA-ALK 4 tctcctcgatgtgtctgac FA-ALK 5 gatagaagaagaaatccgtgtg FA-ALK 6 ggaccctgaaagccacaag FA-ALK 7 ctcatggcggggggagac FA-ALK 8 gccgatagaatatggtccac FA-ALK 9 tgtcaattacggctaccag ALK Reverse 2 cagcaccctggacagcgtc

103

A1.8.2: Site-directed mutagenesis primers

Primer name Primer sequence ALK F1245C F gtatttggaggaaaaccactgcatccaccgagacattgctg ALK F1245C R cagcaatgtctcggtggatgcagtggttttcctccaaatac ALK F1245V F gtatttggaggaaaaccacgtcatccaccgagacattgctg ALK F1245V R cagcaatgtctcggtggatgacgtggttttcctccaaatac ALK F145I F gtatttggaggaaaaccacatcatccaccgagacattgctg ALK F1245I R cagcaatgtctcggtggatgatgtggttttcctccaaatac ALK F1245L F gtatttggaggaaaaccacctcatccaccgagacattgctg ALK F1245L R cagcaatgtctcggtggatgaggtggttttcctccaaatac ALK L1196M F ctgccccggttcatcctgatggagctcatggcggggggag ALK L1196M R ctccccccgccatgagctccatcaggatgaaccggggcag FA-ALK-I1250T F cacttcatccaccgagacactgctgccagaaactgcctc FA-ALK-I1250T R gaggcagtttctggcagcagtgtctcggtggatgaagtg

104

Appendix 2

A2.1: Supplementary tables

A2.1.1: list of 69 selected preys (FpClass and BioGRID) tested in MaMTH 69 indicated proteins were either C- or N- terminally tagged with Nub-tag and tested for interaction with ALK-Cub-TF bait. Localization indicates where the proteins are predominantly localized (according to Uniprot). Cyt: cytosol, nucl: nucleus, PM: plasma membrane, mit: mitochondria, ER: endoplasmic reticulum. SH2/PTB indicates whether the proteins harbor an SH2 or PTB domain.

Gene name Localization Position of SH2/PTB Previously Nub-tag known ALK interactor 1 ACTG1 cyt N 2 ACTG1 cyt C 3 AP2M1 PM N 4 AP2M1 PM C 5 ARRB1 cyt, nucl, PM N 6 ARRB1 cyt, nucl, PM C 7 CASP3 cyt N 8 CASP3 cyt C 9 CD22 cyt N 10 CD22 cyt C 11 CORO1C PM N  12 DDR1 PM N 13 DDR1 PM C 14 DNAJA3 cyt, nucl, mit N 15 DNAJA3 cyt, nucl, mit C 16 EEF1A2 cyt, nucl N 17 EEF1A2 cyt, nucl C 18 FLT1 PM N 19 FLT1 PM C 20 FRS2 cyt, PM N  21 FRS2 cyt, PM C  22 FYN cyt, nucl, PM N SH2 23 FYN cyt, nucl, PM C SH2 24 GNB2L1 cyt, nucl, PM N  25 GNB2L1 cyt, nucl, PM C  26 GRB2 cyt, nucl N SH2  27 GRB2 cyt, nucl C SH2  28 HCK cyt N SH2

105

29 HCK cyt C SH2 30 HDAC1 nucl N 31 HDAC1 nucl C 32 IKBKB cyt, nucl N 33 IKBKB cyt, nucl C 34 IKBKG cyt, nucl N  35 IKBKG cyt, nucl C  36 IL2RB PM N 37 IL2RB PM C 38 IRS1 cyt, nucl, PM N  39 IRS1 cyt, nucl, PM C  40 KRT18 cyt, nucl N  41 KRT18 cyt, nucl C  42 LYN cyt, nucl, PM N SH2 43 MAP2K5 cyt, nucl N 44 MAP2K5 cyt, nucl C 45 NCL cyt N 46 NPM1 cyt, nucl N 47 NPM1 cyt, nucl C 48 NTRK2 PM N 49 NTRK2 PM C 50 NTRK3 PM N 51 NTRK3 PM C 52 PDLIM3 cyt N  53 PDLIM3 cyt C  54 PIK3R2 cyt, nucl N SH2 55 PIK3R2 cyt, nucl C SH2 56 SHC1 cyt N SH2  57 SHC1 cyt C SH2  58 SOS2 cyt N 59 SOS2 cyt C 60 STAT3 cyt, nucl N SH2  61 STAT3 cyt, nucl C SH2  62 TFG ER N 63 TFG ER C 64 TNK2 PM, nucl N  65 TNK2 PM, nucl C  66 TUBB2B cyt N 67 TUBB2B cyt C 68 VIM cyt N  69 VIM cyt C 

106

A2.1.2: Novel identified ALK interactors using MaMTH

Gene name Position of Nub-tag SH2/PTB Fold change to negative control 1 ABL1 N SH2 3.3 2 BLK N SH2 2.0 3 CBLC N SH2 2.4 4 CRK N SH2 3.8 5 DAPP1 N SH2 2.0 6 EEF1A2 N 2.4 7 FGR N SH2 4.1 8 FLT1 N 2.0 9 FRK N SH2 3.0 10 GRB10 N SH2 2.0 11 GRB14 N SH2 3.8 12 GRAP2 N SH2 2.0 13 HCK N SH2 2.7 14 HSH2D N SH2 9.1 15 LCP2 N SH2 2.3 16 LYN N SH2 2.0 17 NCK2 N SH2 5.5 18 SHB N SH2 2.5 19 SH2B1 N SH2 2.1 20 SHC4 N SH2 2.1 21 SHD N SH2 3.6 22 SH2D4A N SH2 2.4 23 SH2D4B N SH2 2.0 24 SHF N SH2 5.6 25 SLA N SH2 3.9 26 SLA2 N SH2 2.1 27 SOCS3 N SH2 2.5 28 SRMS N SH2 3.1 29 STAP1 N SH2 3.2 30 STAT2 N SH2 2.1 31 STAT5B N SH2 2.0 32 SYK N SH2 2.1 33 TNS4 N SH2 2.5 34 ZAP70 N SH2 3.0

107

A2.2: Supplementary figures

SF.1. C-Tagged MaMTH bait vector

SF.2. MaMTH bait construct

108

SF.3. N-Tagged MaMTH prey vector

109

SF.4. C-Tagged MaMTH prey vector

SF.5. N-tagged prey construct

SF.6. C-tagged prey construct