Glucocorticoids paradoxically facilitate steroid resistance in T- cell acute lymphoblastic leukemias and thymocytes
Lauren K. Meyer, … , David T. Teachey, Michelle L. Hermiston
J Clin Invest. 2019. https://doi.org/10.1172/JCI130189.
Research In-Press Preview Oncology
Graphical abstract
Find the latest version: https://jci.me/130189/pdf Meyer 1 1 Glucocorticoids paradoxically facilitate steroid resistance in T-cell acute lymphoblastic
2 leukemias and thymocytes
3
4 Authors: Lauren K. Meyer1, Benjamin J. Huang1, Cristina Delgado-Martin1, Ritu P. Roy2, Aaron
5 Hechmer2, Anica M. Wandler1, Tiffaney L. Vincent3, Paolo Fortina4, Adam B. Olshen2,5, Brent L. Wood6,
6 Terzah M. Horton7, Kevin M. Shannon1,2, David T. Teachey3*, and Michelle L. Hermiston1,2*
7
8 Affiliations:
9 1Department of Pediatrics, University of California, San Francisco, CA, USA
10 2Helen Diller Family Comprehensive Cancer Center, San Francisco, CA, USA
11 3Department of Pediatrics, University of Pennsylvania, Philadelphia, PA, USA
12 4Cancer Genomics and Bioinformatics Laboratory, Sidney Kimmel Cancer Center, Thomas Jefferson
13 University, Philadelphia, PA, USA
14 5Department of Epidemiology and Biostatistics, University of California, San Francisco, CA, USA
15 6Department of Laboratory Medicine and Pathology, University of Washington, Seattle, WA, USA
16 7Texas Children’s Cancer and Hematology Centers, Baylor College of Medicine, Houston, TX, USA
17 *These authors contributed equally.
18
19 To whom correspondence should be addressed:
20 David Teachey: 3501 Civic Center Blvd., Philadelphia, PA, 19104. [email protected],
21 (267) 426-0762
22 Michelle Hermiston: 550 16th Street, 4th Floor Mailstop 0434, San Francisco, CA, 94143.
23 [email protected], (415) 476-2413
24
25 The authors have declared that no conflict of interest exists.
26
27 Meyer 2 28 Abstract
29 Glucocorticoids (GCs) are a central component of therapy for patients with T-cell acute lymphoblastic
30 leukemia (T-ALL) and while resistance to GCs is a strong negative prognostic indicator in T-ALL,
31 mechanisms of GC resistance remain poorly understood. Using diagnostic samples from patients
32 enrolled on the frontline Children’s Oncology Group (COG) T-ALL clinical trial AALL1231, we
33 demonstrated that one-third of primary T-ALLs were resistant to GCs when cultured in the presence of
34 interleukin-7 (IL7), a cytokine that is critical for normal T-cell function and that plays a well-established
35 role in leukemogenesis. We demonstrated that in these T-ALLs and in distinct populations of normal
36 developing thymocytes, GCs paradoxically induced their own resistance by promoting upregulation of
37 IL7 receptor (IL7R) expression. In the presence of IL7, this augmented downstream signal transduction
38 resulting in increased STAT5 transcriptional output and upregulation of the pro-survival protein BCL-2.
39 Taken together, we demonstrated that IL7 mediates an intrinsic and physiologic mechanism of GC
40 resistance in normal thymocyte development that is retained during leukemogenesis in a subset of T-
41 ALLs and is reversible with targeted inhibition of the IL7R/JAK/STAT5/BCL-2 axis.
42
43 Meyer 3 44 Introduction
45 T-cell acute lymphoblastic leukemia (T-ALL) is a genetically heterogeneous disease
46 characterized by a range of alterations involving transcription factors, cell cycle regulators, and signal
47 transduction effectors (1). Unlike B-cell ALL (B-ALL), where genetic factors are widely used to inform
48 risk stratification and subsequent intensification of therapy (2), few genetic lesions in T-ALL have
49 independent prognostic significance (1). As a result, efforts to implement risk-adapted therapeutic
50 strategies have been limited by a lack of genetic biomarkers, highlighting the need for functional studies
51 aimed instead at elucidating recurrent patterns of drug response and resistance across the spectrum of
52 T-ALL.
53 While outcomes for children with T-ALL have improved dramatically over the past several
54 decades, children with relapsed T-ALL continue to face poor survival rates (3), suggesting that novel
55 strategies are needed to improve the upfront efficacy of therapy in order to induce deeper remissions
56 and decrease the likelihood of disease relapse. Glucocorticoids (GCs) are a central component of T-
57 ALL therapy, and the initial response to GC therapy is an important predictor of long-term outcomes (4).
58 For example, on the ALL-BFM 95 trial, patients were stratified into those who had a prednisone good
59 response (PGR) and those who had a prednisone poor response (PPR) following seven days of
60 prednisone monotherapy. Patients with a PGR had an eight-year event free survival rate of 81.3%, as
61 opposed to only 55.1% for patients with a PPR (5). These data demonstrate that intrinsic differences in
62 GC sensitivity exist at the time of disease diagnosis and that these differences can have long-term
63 prognostic significance. Despite decades of clinical use, a comprehensive understanding of the
64 mechanistic basis for differential intrinsic GC sensitivity is lacking. GCs act by binding to a cytoplasmic
65 GC receptor (GR), which promotes translocation of GR to the nucleus where it binds to target gene loci
66 and induces a transcriptional program that results in apoptosis in lymphoid cells (6). Unlike other agents
67 used in the treatment of T-ALL, GCs are unique in that they also exist as endogenous hormones that
68 play critical roles in normal T-cell physiology. For example, endogenous GC activity has been shown to
69 interact with T-cell receptor (TCR) signaling to shape the developing T-cell repertoire (7, 8) and to
70 promote T-cell homeostasis in the periphery following an immune response (9). Given these frequent Meyer 4 71 encounters with GCs in normal physiology and the fact that GCs are potent inducers of apoptosis in
72 both normal and transformed lymphoid cells, we reasoned that T-cells must possess intrinsic
73 mechanisms that allow them to resist GC-induced apoptosis under certain developmental and
74 environmental conditions. Furthermore, we hypothesized that these mechanisms may be retained
75 during leukemogenesis and exploited to confer resistance to GC therapy in T-ALL.
76 One critical endogenous factor in the T-ALL microenvironment is the cytokine interleukin-7 (IL7).
77 In addition to promoting the survival and differentiation of developing thymocytes (10), the IL7 receptor
78 (IL7R)/JAK/STAT5 signaling pathway contributes to T-ALL pathogenesis and disease maintenance
79 (11–13). We previously demonstrated that over half of primary treatment-naïve T-ALL patient samples
80 are intrinsically resistant to the glucocorticoid dexamethasone (DEX) when cultured in the presence of
81 IL7. Of these DEX resistant samples, half could be sensitized to DEX with inhibition of JAK signaling
82 (14). Interestingly, the majority of samples with JAK/STAT5-mediated DEX resistance lacked activating
83 mutations in components of the IL7R/JAK/STAT5 pathway. In the present study, we analyzed a larger
84 cohort of fresh diagnostic samples obtained from pediatric patients enrolled on the COG frontline T-ALL
85 clinical trial AALL1231, with the goal of establishing the mechanistic basis for this DEX resistance
86 phenotype. In this cohort, we demonstrated that one-third of primary diagnostic samples are resistant to
87 DEX specifically when cultured in the presence of IL7. Furthermore, we found that subsets of normal
88 developing thymocytes similarly demonstrate this IL7-induced DEX resistance phenotype. Through
89 functional analyses, we elucidated a mechanism by which GCs paradoxically induce their own
90 resistance by augmenting the pro-survival activity of the IL7R/JAK/STAT5 pathway in distinct subsets of
91 developing thymocytes and T-ALLs. Taken together, these data suggest that IL7 facilitates GC
92 resistance in developing thymocyte populations, and that subsets of T-ALL cells retain this capacity to
93 utilize IL7 as a means of resisting GC-induced apoptosis. These findings have significant therapeutic
94 implications, as they suggest that inhibiting the IL7R/JAK/STAT5 pathway or its transcriptional targets
95 may enhance GC efficacy in patients who exhibit a poor initial response to GC therapy.
96
97 Meyer 5 98 Results
99 JAK signaling mediates dexamethasone resistance in a subset of T-ALLs
100 In a large independent cohort consisting of 73 samples from patients enrolled on COG
101 AALL1231, we validated our previous finding that in vitro DEX sensitivity is highly variable across T-ALL
102 (Figure 1A) (14). Importantly, these differences in DEX sensitivity are not dose-dependent, but persist
103 at saturating concentrations of DEX (Figure S1A). Defining “DEX resistant” as samples that retain
104 greater than 50% cell viability following DEX exposure, we found that 63% of primary diagnostic
105 samples are intrinsically DEX resistant when cultured in the presence of IL7 (Figure 1A). Binding of IL7
106 to IL7R results in the recruitment of JAK1 and JAK3, which subsequently become phosphorylated to
107 create docking sites for STAT5 (15). Consistent with our previous findings (14), inhibition of JAK
108 signaling with the JAK1/2 inhibitor ruxolitinib (RUX) was sufficient to overcome DEX resistance in 54%
109 of these DEX resistant samples (p<0.0001 for DEX versus DEX+RUX and for RUX versus DEX+RUX;
110 Figure 1B).
111 To facilitate further studies aimed at investigating the mechanistic basis for DEX resistance
112 mediated by JAK signaling, we next evaluated the human T-ALL cell line CCRF-CEM for its utility as a
113 model system in which to study the DEX resistance phenotype observed in these primary patient T-ALL
114 samples. This analysis revealed a dose-dependent reduction in DEX sensitivity with increasing
115 concentrations of IL7 (Figures 1C and S1B). Consistent with the primary patient samples, RUX was
116 sufficient to completely restore DEX sensitivity in CCRF-CEM cells in the presence of IL7 (Figure 1D).
117 Furthermore, Bliss independence analysis indicated a synergistic interaction between DEX and RUX
118 (Figure 1E). To ensure that this sensitization effect was due specifically to JAK1 inhibition by RUX and
119 not to off-target effects, we also utilized the JAK3 inhibitor tofacitinib, which should similarly inhibit IL7R
120 signaling, and the JAK2 inhibitor CHZ868, which should not inhibit IL7R signaling. In this analysis,
121 tofacitinib phenocopied the effects of RUX to overcome IL7-induced DEX resistance while CHZ868 had
122 no effect on cell viability (Figure S1C), suggesting that on-target inhibition of JAK1 or JAK3 is sufficient
123 to abrogate IL7-induced DEX resistance.
124 Meyer 6 125 Dexamethasone exposure augments IL7R/JAK/STAT5 pathway activity
126 To confirm that IL7 induces DEX resistance in CCRF-CEM cells via signaling through IL7R, we
127 first used CRISPR/Cas9 genome editing to generate clonal populations of scramble control and IL7Ra
128 knockout (KO) CCRF-CEM cells (Figure S2A). In the KO clones, loss of IL7Ra expression was
129 sufficient to restore DEX sensitivity in the presence of IL7 (Figure 2A). We next asked whether IL7R
130 signaling interferes with the activation and/or function of GR. First, to determine whether exposure to
131 IL7 alters the availability of GR for DEX binding, we assessed GR protein expression in CCRF-CEM
132 cells treated with DEX with or without IL7. Under these conditions, DEX exposure effectively induced
133 GR expression to comparable levels regardless of the presence of IL7 (Figure S2B). Furthermore, upon
134 exposure to DEX both in the absence and presence of IL7, GR effectively translocated to the nucleus
135 and became phosphorylated on Ser211 (Figure S2C), a modification that has been shown to correlate
136 with the capacity to activate or repress transcription (16). Finally, to determine whether IL7 interferes
137 with induction of the GR transcriptional program, we performed RNA sequencing (RNA-seq) on four
138 scramble control CCRF-CEM cell clones exposed to vehicle control or DEX with or without IL7 for four
139 hours to elucidate primary GR target genes. Under these conditions, IL7 did not interfere with GR-
140 mediated transcript induction or repression (Figure S2D and Table S1). Taken together, these data
141 suggest that GR activity remains intact in the presence of IL7.
142 In some mature T-cell populations, GCs have been shown to induce expression of IL7Ra (17–
143 20). Specifically, chromatin immunoprecipitation (ChIP) studies in both murine (21) and human (22)
144 lymphocytes have demonstrated that GR is recruited to a GR binding motif in a noncoding sequence
145 upstream of the IL7Ra promoter, and deletion of this region is sufficient to abrogate GR-induced
146 upregulation of IL7Ra (17), suggesting that IL7Ra upregulation occurs as a direct transcriptional effect
147 of activated GR. To determine if DEX modulates IL7Ra expression in CCRF-CEM cells, we measured
148 IL7RA transcript before and after DEX exposure and found a time-dependent increase in IL7RA
149 transcript expression (Figure 2B) that occurred both in the absence and presence of IL7 (Figure S2E).
150 DEX exposure also increased IL7Ra protein expression at the cell surface relative to untreated cells
151 (p<0.0001). This increase was inhibited in the presence of the translation inhibitor cycloheximide Meyer 7 152 (CHX), suggesting that the increase in cell surface IL7Ra reflects de novo protein synthesis rather than
153 re-localization of existing protein (Figure 2C). Given our finding that inhibition of JAK signaling is
154 sufficient to sensitize cells to DEX in the presence of IL7, we next asked whether the increase in cell
155 surface IL7Ra expression is associated with an increased capacity for JAK signaling downstream of
156 IL7R. We first exposed CCRF-CEM cells to DEX for 24 hours, then stimulated them with IL7 and
157 measured the induction of phosphorylated STAT5 (pSTAT5) as a downstream effector of JAK signaling
158 (Figure S2F). Under these conditions, DEX exposure resulted in significantly more robust pSTAT5
159 induction in response to IL7 stimulation relative to untreated cells (p=0.0002). Furthermore, pre-treating
160 these cells with RUX for one hour prior to IL7 stimulation was sufficient to abrogate the increased
161 JAK/STAT5 signaling following DEX exposure (Figures 2D and S2G). Importantly, IL7 stimulation,
162 either with or without DEX pre-treatment, did not induce phosphorylation of other STAT proteins that
163 are activated downstream of other g chain cytokine receptors (Figure S2H). Given this specific increase
164 in STAT5 activation upon IL7 stimulation following DEX exposure, we then asked whether the increase
165 in IL7Ra expression is associated with a sustained increase in STAT5 transcriptional activity. To test
166 this, we transiently transfected CCRF-CEM cells with a STAT5-luciferase reporter construct and
167 assessed STAT5-induced luciferase activity in cells exposed to DEX in the presence or absence of IL7
168 for 36 hours. This analysis revealed a significant induction of STAT5 transcriptional activity in cells
169 exposed to the combination of DEX and IL7 relative to either DEX or IL7 alone (p<0.0001 versus both
170 DEX alone and IL7 alone). Furthermore, the addition of RUX was sufficient to overcome this increase in
171 transcriptional activity (Figure 2E). To further confirm this increase in STAT5 transcriptional output, we
172 performed RNA-seq on scramble control CCRF-CEM cell clones treated with DEX with or without IL7
173 for four hours. Using gene set enrichment analysis (GSEA) with gene sets derived from published
174 STAT5 ChIP with sequencing (ChIP-seq) data in human CD4+ T-cells (23), we found enrichment for
175 transcriptional targets of STAT5A and STAT5B (p<0.0001; FDR<0.0001), STAT5A alone (p=0.002;
176 false discovery rate (FDR)=0.001), and STAT5B alone (p<0.0001; FDR=0.001) in cells exposed to DEX
177 plus IL7 relative to IL7 alone (Figure 2F and Table S2), further supporting the finding that, in the
178 presence of IL7, DEX exposure augments activation of the STAT5 transcriptional program. Meyer 8 179
180 BCL-2 is a critical mediator of IL7-induced dexamethasone resistance
181 Based on these findings, we hypothesized that STAT5 may be an important downstream
182 mediator of DEX resistance in the presence of IL7. To directly interrogate the role of STAT5 in this
183 context, we used CRISPR/Cas9 genome editing to generate clonal populations of STAT5A KO,
184 STAT5B KO, and STAT5A/B double KO CCRF-CEM cells (Figure 3A). Importantly, deletion of one or
185 both STAT5 isoforms did not affect expression of GR relative to scramble control clones (Figure S3A).
186 Exposure of STAT5 KO cells to DEX in the presence or absence of IL7 revealed that deletion of
187 STAT5B, but not of STAT5A, was sufficient to significantly attenuate DEX resistance in the presence of
188 IL7 (Figures 3B and S3B). These data suggest that transcriptional targets of STAT5B represent
189 candidate DEX resistance genes. To identify these candidate genes, we performed RNA-seq on
190 scramble control and STAT5A/B KO CCRF-CEM cell clones treated with DEX with or without IL7 for
191 sixteen hours. Using these data, we found that deletion of STAT5A/B did not affect the capacity for
192 DEX-induced upregulation of IL7RA (Figure S3C), further confirming that IL7R upregulation is a GR-
193 dependent but STAT5-independent transcriptional event. Using differential expression analysis, we
194 identified the top differentially expressed genes between scramble control cells treated with DEX alone
195 or with the combination of DEX and IL7 (Table S3). We then compared this gene list to the core
196 enrichment genes from the STAT5B gene set (Figure 2F and Table S2) to identify STAT5B target
197 genes that are differentially expressed in cells exposed to DEX relative to the combination of DEX and
198 IL7. This analysis identified the anti-apoptotic family member BCL2 (log fold change = 1.48 for DEX+IL7
199 relative to DEX alone) and the Rho guanine nucleotide exchange factor ARHGEF3 (log fold change =
200 1.64) as two candidate mediators of DEX resistance in the presence of IL7 (Figure 3C). Consistent with
201 their presence on both of these gene lists, targeted analysis of the RNA-seq data revealed that these
202 genes were induced by the combination of DEX and IL7 relative to DEX or IL7 alone only in the
203 scramble control clones and not in the STAT5A/B KO clones (Figures 3D and 3E).
204 Given the anti-apoptotic function of BCL-2 and the importance of downregulation of BCL-2 for
205 DEX-induced apoptosis in T-ALL cells (24), we focused subsequent analyses on BCL-2 expression and Meyer 9 206 function. Interestingly, other anti-apoptotic BCL-2 family members were not regulated in a similar
207 manner in response to DEX and IL7 (Figure S3D), suggesting a BCL-2-specific effect. To determine
208 whether the induction of BCL-2 expression upon exposure to DEX and IL7 is mediated specifically by
209 STAT5B, we assessed BCL-2 protein expression in scramble control and STAT5 single and double KO
210 CCRF-CEM cell clones. This analysis revealed upregulation of BCL-2 with the combination of DEX and
211 IL7 in scramble control and STAT5A single KO clones, but not in either the STAT5B single KO or
212 STAT5A/B double KO clones, consistent with a central role for STAT5B in the regulation of BCL-2
213 expression (Figures 3F and S3E).
214 Given that this increased STAT5 transcriptional activity depends first on the upregulation of
215 IL7Ra as a primary transcriptional target of GR, we reasoned that STAT5-mediated upregulation of
216 BCL-2 must occur as a secondary transcriptional effect following exposure to DEX and IL7. To test this,
217 we performed qPCR to measure the changes in expression over time of BCL2 and of primary GR target
218 genes in CCRF-CEM cells cultured in the presence of DEX and IL7. This analysis revealed that while
219 primary GR transcriptional targets are upregulated as early as two hours following DEX treatment,
220 BCL2 is not significantly upregulated until the eight-hour time point (Figure S3F). To further confirm that
221 BCL2 is upregulated as a secondary transcriptional target, we exposed CCRF-CEM cells to DEX with
222 or without IL7 in the presence or absence of CHX and measured transcript and protein expression of
223 BCL2 and of the primary GR transcriptional target BCL2L11 (BIM) (24). CHX was sufficient to inhibit the
224 upregulation of BIM and BCL-2 protein expression, suggesting effective inhibition of translation and de
225 novo protein synthesis (Figure S3G). BCL2L11 transcript expression was induced by DEX both in the
226 absence and presence of CHX, consistent with this being a primary transcriptional target of GR, the
227 upregulation of which is not dependent on intermediary de novo protein synthesis. In contrast, BCL2
228 transcript expression was upregulated only in the absence of CHX, suggesting a dependence on de
229 novo protein synthesis, consistent with this being a secondary transcriptional event (Figure 3G).
230 To establish the functional significance of BCL-2 upregulation, we first performed BH3 profiling
231 with the BCL-2 inhibitor ABT-199 in CCRF-CEM cells treated with DEX with or without IL7. Under these
232 conditions, DEX alone produced a significant increase in apoptotic priming (p=0.0007). This effect was Meyer 10 233 attenuated in the presence of IL7 (p=0.64), suggesting that the increase in BCL-2 expression with the
234 combination of DEX and IL7 is sufficient to oppose the induction of the apoptotic program (Figure 4A).
235 To determine whether ABT-199 may have a therapeutic role to enhance DEX sensitivity in the
236 presence of IL7, we exposed CCRF-CEM cells to DEX in the presence of IL7 and increasing
237 concentrations of ABT-199. This analysis demonstrated that ABT-199 potently sensitizes cells to DEX
238 in the presence of IL7 in a synergistic manner (Figures 4B and 4C). In addition, we utilized a series of
239 short hairpin RNAs (shRNAs) to knock down BCL-2 expression in CCRF-CEM cells and found that loss
240 of BCL-2 expression increases sensitivity to DEX in the presence of IL7 in a manner that correlates with
241 the degree of BCL-2 knockdown (Figures S4A and 4D-E). To assess the importance of high BCL-2
242 expression in a patient cohort for which clinical outcome data are available, we next analyzed published
243 gene expression data from 265 diagnostic T-ALL samples obtained from patients enrolled on the prior
244 COG T-ALL trial AALL0434 (1). Consistent with our in vitro findings, we found that patients who were
245 minimal residual disease (MRD) positive at the end of induction therapy had significantly higher BCL-2
246 expression relative to patients who were MRD negative (p=0.0009 for patients with MRD <1% and
247 p<0.0001 for patients with MRD >1%; Figure 4F), suggesting a relationship between high BCL-2
248 expression and relative GC resistance. In contrast, shRNA-mediated knockdown of the other candidate
249 resistance gene, ARHGEF3, had no effect to overcome IL7-induced DEX resistance (Figures S4B-C)
250 and ARHGEF3 expression did not differ according to MRD status in the AALL0434 patient cohort
251 (Figure S4D). Taken together, these data support a model (Figure 4G) whereby DEX (i), through
252 upregulating IL7Ra expression (ii), paradoxically induces its own resistance by augmenting JAK/STAT5
253 signaling (iii) and activation of STAT5B target genes (iv), including BCL2. This upregulation of BCL-2 in
254 turn is sufficient to antagonize the pro-apoptotic effects of DEX.
255
256 IL7 induces dexamethasone resistance in subsets of developing thymocytes
257 We next sought to determine why IL7-mediated DEX resistance occurs only in a subset of
258 primary patient T-ALL samples. In our previous patient cohort, we demonstrated that 64% of samples
259 with IL7-mediated DEX resistance did not have activating mutations in the IL7R/JAK/STAT5 pathway Meyer 11 260 (14), suggesting that this phenotype is not dictated by the mutational status of a T-ALL sample. Given
261 these findings, an alternative hypothesis is that IL7-mediated DEX resistance might reflect a physiologic
262 mechanism of GC resistance that occurs in normal populations of developing thymocytes, as both GC
263 sensitivity and IL7R expression are known to vary throughout development (10, 25). To test this
264 hypothesis, we evaluated normal murine thymocytes to determine if IL7R/JAK/STAT5 signaling
265 modulates DEX sensitivity. We first exposed mice to DEX in vivo and assessed the relative sensitivity
266 of the major thymocyte subpopulations. In this analysis, DEX induced a significant reduction in overall
267 thymic cellularity (p=0.02; Figure S5A) and resulted in a dramatic shift in the distribution of the major
268 thymocyte subpopulations. Consistent with previous reports (25), we found that DEX induced a
269 significant reduction in the proportion of CD4/CD8 double positive (DP) thymocytes (p<0.0001), with a
270 compensatory increase in the percentage of the earlier double negative (DN) thymocytes (p=0.005) and
271 later single positive (SP) thymocytes (p<0.0001 for both CD4 and CD8 SP thymocytes; Figures 5A,
272 S5B, and S5C). Importantly, we recapitulated the findings by other investigators (26) that GR
273 expression is paradoxically lowest at the DP stage of development despite these cells being highly DEX
274 sensitive, suggesting that GR expression is insufficient to explain this pattern of differential sensitivity
275 (Figure S5D). To determine if this differential DEX sensitivity reflects differences in the apoptotic
276 potential of these thymocyte subpopulations in their basal state, we performed BH3 profiling on freshly
277 harvested thymocytes. We found that DP thymocytes have significantly higher apoptotic potential
278 relative to DN or SP thymocytes (p=0.002, p=0.0004, and p=0.01 versus DN, CD4 SP, and CD8 SP
279 thymocytes, respectively; Figure 5B), consistent with the pattern of DEX sensitivity observed in vivo.
280 We next evaluated basal IL7Ra expression and signaling capacity across the major thymocyte
281 subpopulations. Consistent with previous reports (10), we found a reduction in IL7Ra expression and
282 IL7-induced pSTAT5 in the DP thymocytes relative to the DN and SP thymocytes (Figures 5C and 5D).
283 Based on these findings and the pattern of DEX sensitivity we observed in vivo, we hypothesized that
284 the presence of IL7 in the in vivo microenvironment might activate JAK/STAT5 signaling in DN and SP
285 thymocytes, which could in turn confer protection against the GC surges that occur during a physiologic
286 stress response (27) and against pharmacologic concentrations of GCs. To test this hypothesis, we first Meyer 12 287 exposed thymocytes to vehicle or DEX ex vivo in the absence or presence of increasing concentrations
288 of IL7. DN and SP thymocytes demonstrated profound DEX resistance specifically in the presence of
289 IL7, while DP thymocytes remained highly sensitive to DEX regardless of IL7 (Figure 5E), consistent
290 with their reduced IL7Ra expression (Figure 5C). To determine whether the mechanism of JAK/STAT5-
291 mediated DEX resistance that we elucidated in CCRF-CEM cells is applicable in these thymocyte
292 subpopulations, we exposed thymocytes to DEX ex vivo and assessed cell surface IL7Ra expression
293 and BCL-2 expression. Consistent with the observed pattern of DEX resistance in the presence of IL7,
294 DN and SP thymocytes significantly upregulated both IL7Ra expression (p<0.0001 for DN, CD4 SP and
295 CD8 SP thymocytes; Figure 5F) and BCL-2 expression (p=0.01, p=0.0005, and p=0.001 for DN, CD4
296 SP, and CD8 SP thymocytes, respectively; Figure 5G) following exposure to DEX in the presence of
297 IL7. Finally, to determine if this mechanism is applicable in vivo under normal physiologic conditions,
298 we treated mice with DEX and assessed BCL-2 protein expression in the major thymocyte
299 subpopulations. DN and CD4 SP thymocytes, but not DP thymocytes, significantly upregulated BCL-2
300 expression in response to DEX (p=0.007 and p=0.004 for DN and CD4 SP thymocytes, respectively;
301 Figure 5H). Finally, to determine whether human thymocytes demonstrate a similar pattern of IL7Ra
302 expression and IL7-induced DEX resistance throughout development, we performed ex vivo analysis of
303 healthy human thymocytes. Similar to the pattern observed in murine thymocytes, DN and SP
304 thymocytes had the most significant increase in cell surface IL7Ra expression following exposure to
305 DEX (Figure S5E) and had the most profound IL7-induced DEX resistance (Figure S5F).
306
307 Developmental stage correlates with IL7-induced dexamethasone resistance in T-ALL
308 To further address the hypothesis that IL7R/JAK/STAT5-mediated DEX resistance may be
309 retained from normal thymocyte development in a subset of T-ALLs, we performed RNA-seq on 76
310 primary diagnostic T-ALL samples from patients enrolled on COG AALL1231. Using a gene set derived
311 from a comparison of early versus late developing thymocytes (28), we performed unbiased
312 hierarchical clustering of these patient samples to classify samples as developmentally “early” or “late”
313 (Figure 6A). We next performed detailed in vitro analysis of 15 of the early T-ALL samples and 12 of the Meyer 13 314 late T-ALL samples isolated from patient derived xenografts (PDXs). Additional information about these
315 samples is presented in Table S4. There were no differences in basal GR expression between these
316 two groups (Figure S6A). Upon analysis of cell surface IL7Ra expression, we found that the early
317 samples tended to have higher basal IL7Ra expression and a more robust induction of IL7Ra upon
318 exposure to DEX (Figure 6B). This higher basal IL7Ra expression was also associated with an
319 increased response to IL7 stimulation, as measured by pSTAT5 (Figure S6B). Consistent with this
320 finding, only the early sample group demonstrated a significant increase in DEX resistance in the
321 presence of IL7 (p=0.0007 and p=0.69 for early and late samples, respectively; Figure 6C). To
322 determine whether this resistance phenotype was associated with activating mutations in the
323 IL7R/JAK/STAT pathway, we performed variant calling using the RNA-seq data and found no
324 enrichment for IL7R pathway mutations in the early samples (Figure S6C and Table S5), consistent
325 with our previous analysis (14). Similar to the findings in CCRF-CEM cells, these early samples
326 demonstrated an increase in BCL-2 protein expression in the presence of IL7, which was further
327 augmented upon concomitant exposure to DEX and attenuated with the addition of RUX (Figure 6D).
328 Moreover, both RUX and ABT-199 significantly sensitized early T-ALL samples to DEX in the presence
329 of IL7 (p<0.0001 and p=0.0005 for the addition of RUX or ABT-199, respectively, to DEX plus IL7;
330 Figure 6E). To evaluate the utility of RUX for overcoming DEX resistance in vivo in a preclinical model,
331 we transplanted mice with early T-ALL T24 and treated them with DEX with or without RUX, using
332 survival as the primary endpoint. As we observed in vitro (Figure S6D), the combination of DEX and
333 RUX demonstrated increased in vivo efficacy relative to either agent alone (p=0.003 for RUX versus
334 DEX+RUX and p=0.02 for DEX versus DEX+RUX; Figure 6F).
335
336 Meyer 14 337 Discussion
338 The poor survival rates observed in children with relapsed T-ALL (3) suggest a need for
339 strategies to enhance the efficacy of upfront therapy as a means of improving cure rates by decreasing
340 the likelihood of disease relapse. While many studies have focused on understanding mechanisms of
341 acquired drug resistance that arise during T-ALL treatment (29), the goal of our current study was
342 instead to elucidate mechanisms of intrinsic drug resistance that dictate the initial response to therapy.
343 In particular, the prognostic significance of the initial GC response in T-ALL (4) suggests a need for a
344 deeper understanding of the mechanisms governing intrinsic differences in GC sensitivity. Here we
345 demonstrate that functional analysis of a large number of diagnostic patient samples reveals recurrent
346 patterns of intrinsic GC resistance across this otherwise genetically heterogeneous patient population.
347 We confirm in this validation cohort that over half of the diagnostic T-ALL samples analyzed exhibit
348 intrinsic DEX resistance in vitro, which has in turn been shown to correlate with clinical outcomes (30).
349 Furthermore, we show that within this subset, half of the samples are resistant to DEX specifically in the
350 presence of IL7.
351 Our data support a model whereby GCs paradoxically induce their own resistance by
352 upregulating IL7Ra expression. In the presence of IL7, this leads to increased downstream signal
353 transduction and STAT5 transcriptional output. This ultimately results in the upregulation of BCL-2,
354 which is sufficient to counteract the pro-apoptotic effect of DEX. Given the prevalence of this
355 phenotype, our data suggest that a significant percentage of T-ALL patients may benefit from the
356 upfront addition of JAK or BCL-2 inhibitors as a means of improving the efficacy of GC therapy.
357 Furthermore, we demonstrate the synergistic potential of combining DEX with these agents, suggesting
358 that combination therapy may allow for a reduction in DEX dosing, thereby minimizing the numerous
359 acute and chronic toxicities associated with steroid exposure (31) while simultaneously maximizing
360 efficacy. In addition, our data demonstrate that STAT5B is primarily responsible for the upregulation of
361 BCL-2 expression in this context, consistent with previous reports demonstrating that knockdown of
362 STAT5A is insufficient to modulate IL7-mediated regulation of BCL-2 expression (11). Interestingly, this
363 is also consistent with the finding that activating mutations in STAT5B, but not in STAT5A, commonly Meyer 15 364 occur in T-ALL (1). These data support further investigation of the use of ABT-199 as a rational
365 therapeutic strategy to enhance the efficacy of DEX in patients with STAT5B-mutated T-ALL.
366 In addition to mediating GC resistance in over one-third of diagnostic T-ALL samples, we
367 demonstrate that IL7 similarly induces GC resistance in those populations of normal thymocytes in
368 which IL7R signaling is important for survival and proliferation (10). Developing thymocytes are
369 continuously exposed to endogenous GCs, but we and others (25) demonstrate that susceptibility to
370 GC-induced apoptosis is variable over the course of thymocyte development. These data suggest that
371 normal thymocyte populations must possess intrinsic mechanisms of GC resistance at distinct stages of
372 development and/or under certain environmental conditions. In particular, we find that IL7-induced DEX
373 resistance occurs in DN thymocytes and is enriched in T-ALL samples with an “early thymocyte” gene
374 expression signature. Importantly, these early thymocytes undergo gene rearrangement to generate a
375 fully rearranged TCR, which will be tested for functionality and auto-reactivity in the subsequent DP
376 stage, a key process in the generation of mature functional T-cells (10). Teleologically, susceptibility to
377 GC-induced apoptosis would be maladaptive early in development, as it would limit the availability of
378 cells for this selection process. Our data therefore suggest that IL7-induced GC resistance may protect
379 these early thymocyte populations from apoptosis in the presence of endogenous GCs. Furthermore,
380 we demonstrate that this mechanism of intrinsic resistance is retained in T-ALLs resembling early
381 thymocytes, where it may be exploited to enable resistance to pharmacologic concentrations of GCs.
382 Taken together, our data provide strong rationale for the idea that differential sensitivity to GC
383 therapy at the time of disease diagnosis reflects developmentally programmed mechanisms of intrinsic
384 GC resistance that are retained during the process of leukemogenesis. This work supports further
385 studies aimed at elucidating additional mechanisms of GC resistance at distinct stages of thymocyte
386 development as a means of understanding the factors that contribute to intrinsic GC resistance in T-
387 ALL.
388
389 Meyer 16 390 Methods
391 Patient samples and patient derived xenografts
392 Diagnostic blood samples were obtained from patients enrolled on the COG trial AALL1231.
393 Immunophenotyping was performed and reviewed by immunophenotyping experts in COG. To
394 establish patient derived xenografts, cells were injected into NOD/SCID/Il2rgtm1wjl/Szj (NSG) mice
395 obtained from Jackson Laboratories. Engraftment was monitored using flow cytometric analysis of
396 peripheral blood with antibodies against human CD45 (BD Biosciences; 560973) and CD7 (BioLegend;
397 343105).
398
399 CCRF-CEM cells
400 CCRF-CEM cells were purchased from the UCSF Cell Culture Facility (ATCC CCL-119). Cells
401 were authenticated via short tandem repeat DNA profiling and were routinely tested for mycoplasma
402 contamination using the PlasmoTest detection kit (InvivoGen).
403
404 Preclinical trial
405 Five five-week-old male NSG mice per treatment arm were randomized to receive vehicle
406 control, DEX, RUX, or the combination of DEX and RUX once the peripheral blood blast count reached
407 1%. RUX was administered in chow form (Incyte) continuously over the trial duration. DEX (Fresenius
408 Kabi and Children’s Hospital of Philadelphia Pharmacy) was administered at 7.5g/day by intraperitoneal
409 injection. Mice were euthanized when they became moribund.
410
411 In vivo dexamethasone treatment in C57BL/6x129Sv/Jae mice and isolation of human and
412 murine thymocytes
413 Six to eight-week-old male F1 C57BL/6x129Sv/Jae mice were obtained from the University of
414 California, San Francisco Laboratory Animal Resource Center (LARC) breeding core. Mice were
415 treated with 2mg/kg dexamethasone sodium phosphate (NDC 63323-516-10; University of California,
416 San Francisco pharmacy) or vehicle control (phosphate buffered saline) once daily for three days. Meyer 17 417 Healthy human thymocytes were obtained from children undergoing cardiothoracic surgery at the
418 University of California, San Francisco. Antibodies against murine CD4 (BioLegend; 100425) and CD8
419 (BioLegend; 100707) or human CD4 (Biolegend; 317420) or CD8 (BioLegend; 344706) were used to
420 identify thymocyte subpopulations.
421
422 In vitro viability assays
423 In vitro viability assays were performed by exposing cells to vehicle control or dexamethasone
424 (Sigma; D4902), ruxolitinib (Selleckchem; S1378), tofacitinib (Selleckchem; S5001), CHZ868 (MedKoo;
425 407137), or ABT-199 (ApexBio; A8194) for 72 hours (CCRF-CEM cells), 48 hours (PDX cells), or 24
426 hours (thymocytes) with or without recombinant human or murine IL7 (Peprotech; 200-07 and 217-17).
427 Cells were then stained with Hoechst 33258 (Molecular Probes; H3569) and analyzed by flow
428 cytometry.
429
430 CRISPR/Cas9 genome editing of CCRF/CEM cells
431 Cas9 protein containing a nuclear localization signal (Cas9-NLS) was purchased from the QB3
432 MacroLab at the University of California, Berkeley. Trans-activating CRISPR RNA (tracrRNA) and
433 single guide RNAs (sgRNAs) were purchased from Dharmacon. sgRNA sequences targeting IL7Ra,
434 STAT5A, and STAT5B were obtained from the Brunello sgRNA library (32) and are as follows: IL7Ra –
435 AAAGAGCAATATATGTGTGA; STAT5A – ACATTCTGTACAATGAACAG; STAT5B –
436 GTTCATTGTACAATATATGG. The scramble control cells were generated using a non-targeting
437 sgRNA: GGTTCTTGACTACCGTAATT.
438 Ribonucleoproteins were prepared according to established methods (33). Electroporation was
439 performed using the Amaxa Cell Line Nucleofector Kit C (Lonza, VACA-1004) and an Amaxa
440 Nucleofector II Device with the electroporation code X-001. Editing was assessed by PCR amplification
441 using the following primers: IL7Ra forward – 5’-TGAACATGCCTCCACTCACC-3’; IL7Ra reverse – 5’-
442 CACACCTGGGTTTGAAGATCC-3’; STAT5A forward – 5’- TGGGGATAGTTCCTGAGGCT-3’; STAT5A
443 reverse – 5’ TGCCACCTCTTACACTTGCC-3’; STAT5B forward – 5’- TGTGCCCCTTAGGATGAAGC- Meyer 18 444 3’; STAT5B reverse – 5’- AATCACAGGAGGCACTGTTCC-3’. The amplicons were Sanger sequenced
445 and the sequencing traces were analyzed using the TIDE analysis software (34). Clonal populations
446 were generated using limiting dilution cell plating.
447
448 Western blotting
449 For analysis of protein expression in whole cell lysates, CCRF-CEM cells were resuspended in
450 RIPA buffer. For analysis of cytoplasmic and nuclear protein, protein fractions were generated using the
451 NE-PER kit (ThermoFisher Scientific; 78833). Immunoblotting was performed with the following
452 antibodies: STAT5A (Abcam; ab32043), STAT5B (Abcam; ab178941), GR (Cell Signaling Technology;
453 12041), GR pS211 (Cell Signaling Technology; 4161), b-actin (Cell Signaling Technology; 3700), and
454 p84 (Genetex; GTX70220). Donkey anti-rabbit IRDye800 and donkey anti-mouse IRDye680 secondary
455 antibodies (LI-COR Biosciences) were used and imaging was performed using the Odyssey Imaging
456 System (LI-COR Biosciences).
457
458 Quantitative PCR (qPCR)
459 CCRF-CEM cells were cultured in the presence or absence of 1µM DEX, 100ng/mL IL7, and/or
460 10µg/mL cycloheximide for 16 hours unless otherwise indicated. RNA was isolated using the RNeasy
461 Mini Kit (Qiagen) and cDNA was generated using the Superscript III kit (ThermoFisher Scientific).
462 Taqman quantitative PCR probes (Applied Biosystems) were used in conjunction with Taqman Master
463 Mix (Applied Biosystems) to assess transcript levels for the following genes: GAPDH (Hs02786624_g1;
464 VIC-MGB), IL7Ra (Hs00902334_m1; FAM-MGB), BCL2L11 (Hs00708019_s1; FAM-MGB), BCL2
465 (Hs00608023_m1; FAM-MGB), FKBP5 (Hs01561006_m1; FAM-MGB), GILZ (Hs00608272_m1; FAM-
466 MGB), NR3C1 (H200353740_m1; FAM-MGB), MYC (Hs00153408_m1; FAM-MGB), and ARHGEF3
467 (Hs00989814_m1; FAM-MGB). Experiments were performed in technical triplicate and were run on a
468 QuantStudio 5 Real-Time PCR Instrument (Applied Biosystems). The fold change in transcript
469 expression was calculated relative to cells treated with vehicle control using the delta-delta Ct method,
470 unless otherwise indicated, with the use of GAPDH transcript for normalization. Meyer 19 471
472 Measurement of cell surface IL7Ra
473 For analysis of cell surface IL7Ra expression, cells were treated with 1µM DEX for 24 hours.
474 Murine thymocyte experiments were performed in the presence of 100pg/mL recombinant murine IL7.
475 Antibodies against human (BioLegend; 351315) or murine (Tonbo Biosciences; 20-1271) IL7Ra were
476 used in conjunction with Hoechst 33258 to allow for gating on viable cells. Data are presented as the
477 median fluorescent intensity (MFI) of the IL7Ra signal.
478
479 Cytokine stimulation and intracellular flow cytometry
480 Phosphoflow cytometry for measurement of STAT protein phosphorylation following IL7
481 stimulation was performed as previously described (14). Briefly, CCRF-CEM cells were exposed to
482 vehicle control or 1µM DEX for 24 hours, allowed to rest for one hour in serum free media, and
483 stimulated with IL7 at a concentration of 100ng/mL for 15 minutes. PDX cells were similarly allowed to
484 rest in serum free media for one hour followed by stimulation with 100ng/mL IL7 for 15 minutes. Cells
485 were subsequently fixed with 2% paraformaldehyde and permeabilized with methanol. STAT protein
486 phosphorylation was assessed using antibodies against pSTAT1 pY701 (BD Biosciences;
487 BDB612564), pSTAT3 pY705 (BD Biosciences; BDB612569), pSTAT5 pY694 (BD Biosciences;
488 BDB612599), and pSTAT6 pY641 (BD Biosciences; BDB612601). BIM and BCL-2 protein expression
489 were assessed following cell fixation and permeabilization using antibodies against BIM (Cell Signaling
490 Technology; 2933) and anti-human (Life Technologies; A15796) or anti-mouse (BioLegend; 633509)
491 BCL-2. GR expression was assessed using an anti-GR antibody. A donkey anti-rabbit secondary
492 antibody (Jackson ImmunoResearch Laboratories) was used for flow cytometric detection of BIM and
493 GR protein.
494
495 Luciferase reporter assay
496 CCRF-CEM cells were transiently transfected with the pGL4.52[luc2P/STAT5 RE/hygro] vector
497 (Promega; E4651) using the Lipofectamine 3000 Transfection Reagent (Life Technologies). Eighteen Meyer 20 498 hours after transfection, cells were treated in the absence or presence of 1µM DEX, 100ng/mL
499 recombinant human IL7, and/or 500nM ruxolitinib for 36 hours. Luciferase activity was assessed with
500 the ONE-Glo Luciferase Assay System (Promega) and a Biotek Synergy 2 instrument. Relative
501 luminescence was calculated by normalizing values to those obtained from cells treated with vehicle
502 control.
503
504 RNA-seq analysis
505 Scramble control and STAT5 knockout CCRF-CEM cell clones were cultured in vehicle control
506 or in the presence or absence of 1µM DEX and/or 100ng/mL recombinant human IL7 for 4 or 16 hours.
507 RNA was isolated using the RNeasy Mini Kit and cDNA was generated using the Superscript III kit and
508 quantified using a NanoDrop spectrophotometer (ThermoFisher). RNA quality was assessed using an
509 Agilent Bioanalyzer (Agilent Technologies). Libraries were prepared using 1ng of RNA and were
510 sequenced on the HiSeq 2500 (Illumina) to generate 50bp single end reads.
511 GR regulated genes were identified using edgeR, as previously described (35), by comparing
512 scramble control clones treated with vehicle to those treated with DEX for four hours. A gene set was
513 created using the statistical thresholds of absolute log fold change >1 and false discovery rate (FDR)
514 <0.05. This analysis was then applied to perform the same comparison between scramble control
515 clones treated with vehicle versus DEX plus IL7 for four hours. For the analysis of STAT5 target genes,
516 gene set enrichment analysis (GSEA) was performed as previously described (36) by comparing
517 scramble control clones treated with IL7 versus DEX plus IL7 using gene sets derived from published
518 STAT5 ChIP-seq experiments in human CD4+ T-cells (23). The default settings were used for GSEA,
519 including permutation based on phenotype. These data have been deposited in NCBI’s Gene
520 Expression Omnibus and are accessible through GEO Series accession number GSE137893.
521 For the fresh diagnostic T-ALL samples, total RNA was prepared using Trizol (ThermoFisher)
522 based extraction. Samples were purified and concentrated using the RNeasy Mini or RNeasy MinElute
523 Kit alone with the DNase Set (Qiagen). RNA concentration was determined using a NanoDrop
524 spectrophotometer. RNA quality was assessed using an Agilent 2200 TapeStation (Agilent Meyer 21 525 Technologies). 100ng of RNA was used to prepare libraries using the TruSeq RNA Exome RNA kit
526 (Illumina). For RNA samples with DV200 below 30%, 200ng of total RNA was used to prepare libraries.
527 Libraries were sequenced on a NextSeq 500 using 150bp paired-end chemistry.
528 Primary T-ALL cell transcript expression was calculated via a local software pipeline built
529 around the Bowtie 2 Aligner (v2.3.4.1) and RSEM’s (v1.2.3.0) expectation-maximization quantification
530 that utilized the Ensembl GRCh38 release 85 reference. After demultiplexing, converting primary
531 sequence data to fastq format, and trimming adapters, sequences were aligned against an HG38 rRNA
532 reference using the bwa (v0.7.12) aligner in order to screen out rRNA. Only non-rRNA aligning
533 sequences advanced into the Bowtie 2/RSEM analysis stream. These data were used to generate gene
534 signatures associated with early versus late thymocyte development via hierarchical clustering and
535 dendrogram analysis.
536 All sequencing analysis, including read alignment, quality and performance metrics, post-
537 processing, variant calling, and variant annotation were performed as previously described (37, 38)
538 using the hg38 build of the human genome. Briefly, reads were aligned with Burrows-Wheeler Aligner
539 (39) and processed using Picard (http://broadinstitute.github.io/picard) and the Genome Analysis
540 Toolkit (GATK) (40) to perform base quality recalibration and multiple sequence realignment. Single
541 nucleotide variants and indels were detected with the MuTect (41) and BCFtools algorithms,
542 respectively. Variants were negatively selected against based on IGSR SNP (42) and ExAC SNP (43)
543 databases and positively selected for based on recurrently mutated sites or regions within COSMIC
544 (Acute T Lymphoblastic Leukemia associated subset of mutations) (44) or as previously reported (1).
545 Candidate somatic mutations were manually reviewed using Integrative Genomics Viewer (45). These
546 data have been deposited in NCBI’s Gene Expression Omnibus and are accessible through GEO
547 Series accession number GSE137768.
548
549 BH3 profiling
550 BH3 profiling was performed according to established methods (46). CCRF-CEM cells were
551 treated with or without 1µM DEX and/or 100ng/mL recombinant human IL7 for 16 hours prior to Meyer 22 552 analysis. Thymocyte BH3 profiling was performed immediately after harvesting thymocytes.
553 Cytochrome c staining was performed using an anti-cytochrome c antibody (BioLegend; 612310).
554
555 shRNA-mediated knockdown of BCL2 and ARHGEF3
556 The miR30-PGK-NeoR-IRES-GFP cassette from LMN-GFP (32) was cloned into a pCDH
557 Expression Lentivector (System Biosciences) to generate the construct pCDH-LMN-GFP. Short hairpin
558 RNA (shRNA) sequences targeting human BCL2 are as follows: shBCL2-1 – 5’-
559 TTTTATTCCAATTCCTTTCGGA-3’; shBCL2-2 – 5’-TAGCTGATTTGAAACTTCCCAA-3’; shBCL2-3
560 – 5’-TACTTCATCACTATCTCCCGGT-3’; shBCL2-4 – 5’-TTTAAGTACAGCATGATCCTCT-3’;
561 and shBCL2-5 – 5’-TATCAGTCTACTTCCTCTGTGA-3’. shRNA sequences targeting human
562 ARHGEF3 are as follows: shARHGEF3-1 – 5’-TTTGATTCAACTCTTGTTCTGT-3’; shARHGEF3-2 –
563 TATATCTTGTCACACAGCTTGA-3’; shARGHEF3-3 – TATAGCTTCTTCCAAGTGCTGC-3’. 97-mer
564 oligonucleotides were generated as previously described (47) and amplified using the following primers:
565 forward – 5’- TACAATACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’; reverse –
566 ACTTAGAAGAATTCCGAGGCAGTAGGCA-3’. A non-targeting shRNA (shControl) sequence was
567 used as a control: 5’-TAGATAAGCATTATAATTCCTA-3’. Oligonucleotides were cloned into the EcoRI
568 and XhoI sites of pCDH-LMN-GFP and lentivirus was generated via calcium phosphate transfection of
569 HEK293T cells using the packaging and envelope plasmids psPAX2 and pCMV-VSVG. Viral
570 supernatants were collected 48 hours after transfection and concentrated using Lenti-X Concentrator
571 (Clontech). Following lentiviral transduction, GFP positive cells were sorted using a Sony SH800
572 instrument and subsequently expanded.
573
574 Flow cytometry
575 Flow cytometry was performed using a BD FACSVerse and data were analyzed using FlowJo software.
576
577 Statistics Meyer 23 578 Statistical analyses were performed using Prism 8 (GraphPad). All tests were two-sided and the
579 threshold for significance was p≤0.05. Comparisons between groups were made using t-tests, with one-
580 way ANOVA and Tukey’s method for multiple comparisons adjustment for comparisons of three or
581 more groups. For in vivo survival analysis, the log-rank test was used to perform pairwise comparisons
582 between survival curves. Interactions between drugs were assessed using Bliss independence analysis
583 (48). Error bars represent the standard error of the mean.
584
585 Study Approval
586 Written informed consent for the use of diagnostic specimens for research was obtained from
587 patients or their guardians at the time of sample collection, according to the Declaration of Helsinki, the
588 National Cancer Institute, and institutional review boards of participating sites. All animal experiments
589 were conducted following protocols that were approved by the Institutional Animal Care and Use
590 Committees and Institutional Review Boards of Children’s Hospital of Philadelphia or the University of
591 California, San Francisco.
592
593 Meyer 24 594 Author contributions
595 L.K.M., B.J.H., C.D.-M., K.M.S., D.T.T., and M.L.H. designed the experiments and analyzed the data.
596 L.K.M., C.D.-M., B.J.H., A.M.W., and T.L.V. performed the experiments. B.L.W. performed
597 immunophenotyping of patient samples. P.F. performed the RNA-sequencing of the primary patient
598 samples. B.J.H., R.P.R., A.H., and A.B.O. performed bioinformatics analysis. L.K.M. and M.L.H. wrote
599 the manuscript. B.J.H., C.D.-M., R.P.R., A.H., A.M.W., T.L.V., P.F., A.B.O., B.L.W., T.M.H., K.M.S., and
600 D.T.T. reviewed the manuscript.
601
602
603 Meyer 25 604 Acknowledgements
605 The authors thank Michael Adkisson, Joshua Rudolph, Andrea Barczak, and David Erle from the UCSF
606 Functional Genomics Core Facility for their assistance with the RNA-seq involving CCRF-CEM cells
607 and Anthony Letai and Jeremy Ryan for assistance with the BH3 profiling technique. This study was
608 supported by a Genentech Foundation Research Fellowship (L.K.M.), National Institutes of Health
609 Medical Scientist Training Program Grant T32GM007618 (L.K.M.), National Cancer Institute Grant
610 R01CA193776 (T.M.H., B.L.W., D.T.T., and M.L.H.), American Cancer Society Research Scholar Grant
611 RSG-13-022-01-CDD (D.T.T.), a Buster Posey Family Pediatric Cancer Pilot Award (M.L.H.), the
612 Campini Family Foundation (M.L.H.), and the Pepp Family Foundation (M.L.H.). R.P.R., A.H., and
613 A.B.O. are supported by the UCSF Helen Diller Family Comprehensive Cancer Center National
614 Institutes of Health grant P30CA082103, which also supports the shared resource facilities that were
615 used to conduct the flow cytometry work at UCSF. In addition, this work was supported by the NCTN
616 Operations Center Grant U10CA180886 and NCTN Statistics and Data Center Grant U10CA180899 to
617 the Children’s Oncology Group (COG).
618
619
620
621 Meyer 26 622 References
623 1. Liu Y et al. The genomic landscape of pediatric and young adult T-lineage acute lymphoblastic
624 leukemia [Internet]. Nat Genet 2017;advance online publication.http://dx.doi.org/10.1038/ng.3909. cited
625 2. Pui C-H, Carroll WL, Meshinchi S, Arceci RJ. Biology, risk stratification, and therapy of pediatric
626 acute leukemias: an update. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 2011;29(5):551–565.
627 3. Bhojwani D, Pui C-H. Relapsed childhood acute lymphoblastic leukaemia. Lancet Oncol.
628 2013;14(6):e205-217.
629 4. Gao J, Liu W-J. Prognostic value of the response to prednisone for children with acute lymphoblastic
630 leukemia: a meta-analysis. Eur. Rev. Med. Pharmacol. Sci. 2018;22(22):7858–7866.
631 5. Lauten M et al. Prediction of outcome by early bone marrow response in childhood acute
632 lymphoblastic leukemia treated in the ALL-BFM 95 trial: differential effects in precursor B-cell and T-cell
633 leukemia. Haematologica 2012;97(7):1048–1056.
634 6. Schmidt S et al. Glucocorticoid-induced apoptosis and glucocorticoid resistance: molecular
635 mechanisms and clinical relevance. Cell Death Differ. 2004;11 Suppl 1:S45-55.
636 7. Erlacher M et al. TCR signaling inhibits glucocorticoid-induced apoptosis in murine thymocytes
637 depending on the stage of development. Eur. J. Immunol. 2005;35(11):3287–3296.
638 8. Jamieson CA, Yamamoto KR. Crosstalk pathway for inhibition of glucocorticoid-induced apoptosis by
639 T cell receptor signaling. Proc. Natl. Acad. Sci. U. S. A. 2000;97(13):7319–7324.
640 9. Tsitoura DC, Rothman PB. Enhancement of MEK/ERK signaling promotes glucocorticoid resistance
641 in CD4+ T cells. J. Clin. Invest. 2004;113(4):619–627.
642 10. Spits H. Development of alphabeta T cells in the human thymus. Nat. Rev. Immunol.
643 2002;2(10):760–772. Meyer 27 644 11. Ribeiro D et al. STAT5 is essential for IL-7-mediated viability, growth, and proliferation of T-cell
645 acute lymphoblastic leukemia cells. Blood Adv. 2018;2(17):2199–2213.
646 12. Silva A et al. IL-7 contributes to the progression of human T-cell acute lymphoblastic leukemias.
647 Cancer Res. 2011;71(14):4780–4789.
648 13. Treanor LM et al. Interleukin-7 receptor mutants initiate early T cell precursor leukemia in murine
649 thymocyte progenitors with multipotent potential. J. Exp. Med. 2014;211(4):701–713.
650 14. Delgado-Martin C et al. JAK/STAT pathway inhibition overcomes IL7-induced glucocorticoid
651 resistance in a subset of human T-cell acute lymphoblastic leukemias. Leukemia [published online
652 ahead of print: May 9, 2017]; doi:10.1038/leu.2017.136
653 15. Mazzucchelli R, Durum SK. Interleukin-7 receptor expression: intelligent design. Nat. Rev. Immunol.
654 2007;7(2):144–154.
655 16. Chen W et al. Glucocorticoid receptor phosphorylation differentially affects target gene expression.
656 Mol. Endocrinol. Baltim. Md 2008;22(8):1754–1766.
657 17. Abe A et al. An Enhancer of the IL-7 Receptor α-Chain Locus Controls IL-7 Receptor Expression
658 and Maintenance of Peripheral T Cells. J. Immunol. Baltim. Md 1950 2015;195(7):3129–3138.
659 18. Franchimont D et al. Positive effects of glucocorticoids on T cell function by up-regulation of IL-7
660 receptor alpha. J. Immunol. Baltim. Md 1950 2002;168(5):2212–2218.
661 19. Kakal JA et al. Transcriptional regulation of the IL-7Rα gene by dexamethasone and IL-7 in primary
662 human CD8 T cells. Immunogenetics 2017;69(1):13–27.
663 20. Shimba A et al. Glucocorticoids Drive Diurnal Oscillations in T Cell Distribution and Responses by
664 Inducing Interleukin-7 Receptor and CXCR4. Immunity 2018;48(2):286-298.e6. Meyer 28 665 21. Lee H-C, Shibata H, Ogawa S, Maki K, Ikuta K. Transcriptional regulation of the mouse IL-7
666 receptor alpha promoter by glucocorticoid receptor. J. Immunol. Baltim. Md 1950 2005;174(12):7800–
667 7806.
668 22. Kruth KA et al. Suppression of B-cell development genes is key to glucocorticoid efficacy in
669 treatment of acute lymphoblastic leukemia. Blood 2017;129(22):3000–3008.
670 23. Kanai T et al. Identification of STAT5A and STAT5B target genes in human T cells. PloS One
671 2014;9(1):e86790.
672 24. Jing D et al. Opposing regulation of BIM and BCL2 controls glucocorticoid-induced apoptosis of
673 pediatric acute lymphoblastic leukemia cells. Blood 2015;125(2):273–283.
674 25. Berki T, Pálinkás L, Boldizsár F, Németh P. Glucocorticoid (GC) sensitivity and GC receptor
675 expression differ in thymocyte subpopulations. Int. Immunol. 2002;14(5):463–469.
676 26. Boldizsár F et al. Low glucocorticoid receptor (GR), high Dig2 and low Bcl-2 expression in double
677 positive thymocytes of BALB/c mice indicates their endogenous glucocorticoid hormone exposure.
678 Immunobiology 2006;211(10):785–796.
679 27. Gruber J, Sgonc R, Hu YH, Beug H, Wick G. Thymocyte apoptosis induced by elevated
680 endogenous corticosterone levels. Eur. J. Immunol. 1994;24(5):1115–1121.
681 28. Lee MS, Hanspers K, Barker CS, Korn AP, McCune JM. Gene expression profiles during human
682 CD4+ T cell differentiation. Int. Immunol. 2004;16(8):1109–1124.
683 29. Foo J, Michor F. Evolution of acquired resistance to anti-cancer therapy. J. Theor. Biol.
684 2014;355:10–20.
685 30. Pieters R et al. Relation of cellular drug resistance to long-term clinical outcome in childhood acute
686 lymphoblastic leukaemia. Lancet Lond. Engl. 1991;338(8764):399–403. Meyer 29 687 31. Inaba H, Pui C-H. Glucocorticoid use in acute lymphoblastic leukaemia. Lancet Oncol.
688 2010;11(11):1096–1106.
689 32. Doench JG et al. Optimized sgRNA design to maximize activity and minimize off-target effects of
690 CRISPR-Cas9. Nat. Biotechnol. 2016;34(2):184–191.
691 33. Schumann K et al. Generation of knock-in primary human T cells using Cas9 ribonucleoproteins.
692 Proc. Natl. Acad. Sci. U. S. A. 2015;112(33):10437–10442.
693 34. Brinkman EK, Chen T, Amendola M, van Steensel B. Easy quantitative assessment of genome
694 editing by sequence trace decomposition. Nucleic Acids Res. 2014;42(22):e168.
695 35. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression
696 analysis of digital gene expression data. Bioinforma. Oxf. Engl. 2010;26(1):139–140.
697 36. Subramanian A et al. Gene set enrichment analysis: a knowledge-based approach for interpreting
698 genome-wide expression profiles. Proc. Natl. Acad. Sci. U. S. A. 2005;102(43):15545–15550.
699 37. Iyer G et al. Genome sequencing identifies a basis for everolimus sensitivity. Science
700 2012;338(6104):221.
701 38. Al-Ahmadie H et al. Synthetic lethality in ATM-deficient RAD50-mutant tumors underlies outlier
702 response to cancer therapy. Cancer Discov. 2014;4(9):1014–1021.
703 39. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform.
704 Bioinforma. Oxf. Engl. 2009;25(14):1754–1760.
705 40. DePristo MA et al. A framework for variation discovery and genotyping using next-generation DNA
706 sequencing data. Nat. Genet. 2011;43(5):491–498.
707 41. Cibulskis K et al. Sensitive detection of somatic point mutations in impure and heterogeneous
708 cancer samples. Nat. Biotechnol. 2013;31(3):213–219. Meyer 30 709 42. Clarke L et al. The international Genome sample resource (IGSR): A worldwide collection of
710 genome variation incorporating the 1000 Genomes Project data. Nucleic Acids Res.
711 2017;45(D1):D854–D859.
712 43. Lek M et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature
713 2016;536(7616):285–291.
714 44. Tate JG et al. COSMIC: the Catalogue Of Somatic Mutations In Cancer. Nucleic Acids Res.
715 2019;47(D1):D941–D947.
716 45. Robinson JT et al. Integrative genomics viewer. Nat. Biotechnol. 2011;29(1):24–26.
717 46. Ryan J, Letai A. BH3 profiling in whole cells by fluorimeter or FACS. Methods San Diego Calif
718 2013;61(2):156–164.
719 47. Fellmann C et al. An optimized microRNA backbone for effective single-copy RNAi. Cell Rep.
720 2013;5(6):1704–1713.
721 48. Zhao W et al. A New Bliss Independence Model to Analyze Drug Combination Data. J. Biomol.
722 Screen. 2014;19(5):817–821.
723
724
725 Meyer 31 Figure 1
A B C
120 **** No IL7 100 110 120 **** 1ng/mL IL7 100 110 90 90 100 80 5ng/mL IL7 80 90 70 10ng/mL IL7 70 80 60 60 70 25ng/mL IL7 50 50 60 40 100ng/mL IL7 40 50 30 30 40 20 20 30 10 20 10 % Viable relative to vehicle % Viable % Viable relative to vehicle % Viable 0 10 0 % Viable relative to vehicle % Viable Vehicle 0 1 2 3 4 5 0 log([DEX] (nM)) DEX RUX
DEX+RUX D E
No IL7 100 100 50 0.4 90 IL7 10 80 IL7 + 125nM RUX 5 70 0.3 IL7 + 250nM RUX 1 60 0.5 50 IL7 + 500nM RUX 0.2 0.1 40 IL7 + 1µM RUX
[DEX] (µM) 0.05 30 0.01 0.1 20 0.005 10
% Viable relative to vehicle % Viable 0.001 0 0 .125 .25 .5 1 Vehicle 0 1 2 3 4 5 [RUX] (µM) 726 log([DEX] (nM))
727 Fig. 1. JAK/STAT inhibition overcomes DEX resistance in a subset of primary T-ALL samples 728 and in the T-ALL cell line CCRF-CEM. (A) Viability relative to vehicle control of cells from 73 primary 729 diagnostic T-ALL samples exposed to 2.5µM DEX for 48 hours in the presence of 25ng/mL IL7. The red 730 line indicates the 50% viability cutoff used to define “DEX resistant”. (B) Viability relative to vehicle 731 control of cells from the 46 DEX resistant primary diagnostic T-ALL samples in (A) exposed to 2.5µM 732 DEX and/or 0.5µM RUX for 48 hours in the presence of 25ng/mL IL7. Statistical significance was 733 assessed using one-way ANOVA with Tukey’s method for multiple comparisons adjustment. (C) 734 Viability of CCRF-CEM cells exposed to DEX in the absence or presence of increasing concentrations 735 of IL7 for 72 hours in technical triplicate. (D) Viability of CCRF-CEM cells exposed to DEX in the 736 presence of 25ng/mL IL7 in the absence or presence of increasing concentrations of RUX in technical 737 triplicate. The no IL7 (black line) and the 25ng/mL IL7 (red line) conditions are re-plotted from figure 1C. 738 (E) Heatmap of Bliss independence scores calculated as the average of technical triplicates for the 739 combination of DEX and RUX in CCRF-CEM cells cultured in the presence of 25ng/mL IL7 for 72 740 hours, in which positive values, indicated in red, are indicative of a synergistic interaction. All CCRF- 741 CEM cell data are representative of three independent experiments. ****p<0.0001, ***p<0.001, 742 **p<0.01, *p<0.05. 743
744
745
746 Meyer 32 Figure 2
A F Scramble IL7Rα KO STAT5A and STAT5B S1: No IL7 I1: No IL7 100 100 S1: + IL7 I1: + IL7 90 90 80 S2: No IL7 80 I2: No IL7 70 S2: + IL7 70 I2: + IL7 60 60
50 50 40 40 30 30 20 20
10 10 % Viable relative to vehicle % Viable relative to vehicle % Viable 0 0 Vehicle 0 1 2 3 4 Vehicle 0 1 2 3 4 log([DEX] (nM)) log([DEX] (nM))
B C **** **** STAT5A 5000 **** **** 1.0
0.9 4000 DEX+CHX 0.8 ****
CHX
Ct 0.7 3000 Δ
0.6 MFI DEX α 0.5 2000 0.4 **** IL7R Vehicle 101 102 103 104 105 0.3 ****
Fold change 1000 0.2 IL7Rα−APC 0.1 N.S. N.S. 0.0 0 0 2 4 6 8 12 16 DEX - + - + Time (hours) CHX - - + + D E **** STAT5B 30 **** **** **** **** **** 1600 No DEX 25 1400 DEX 1200 20
1000 15 800
600 10
pSTAT5 MFI pSTAT5 ** 400 N.S. N.S. 5 200 N.S.
0 Luminescence relative to vehicle 0 0 0 125 250 500 1000 DEX - + - + - + [RUX] (nM) IL7 - - + + + + IL7 - + + + + + RUX - - - - + + 747
748 Fig. 2. DEX exposure augments IL7R expression and downstream JAK/STAT signaling. (A) 749 Viability of scramble control (S1 and S2; left) and IL7Ra KO (I1 and I2; right) CCRF-CEM cell clones 750 exposed to DEX in the absence (solid lines) or presence (dotted lines) of 25ng/mL IL7 in technical 751 triplicate for 72 hours. (B) Fold change relative to the 16 hour time point of the DCt of IL7RA transcript 752 relative to GAPDH as determined by qPCR performed in technical triplicate in CCRF-CEM cells 753 exposed to 1µM DEX and 100ng/mL IL7 for the indicated period of time. (C) MFI of IL7Ra in CCRF- 754 CEM cells treated with or without 1µM DEX and/or 10µg/mL CHX in technical triplicate for 24 hours. 755 Inset shows representative histograms of IL7Ra in CCRF-CEM cells treated with or without 1µM DEX 756 and/or 10µg/mL CHX for 24 hours. (D) MFI of pSTAT5 in CCRF-CEM cells treated with or without 1µM 757 DEX for 24 hours in the absence of IL7 followed by a one-hour exposure to vehicle control or RUX prior 758 to a 15-minute stimulation with 100ng/mL IL7 in technical triplicate. Significance is relative to the DEX- 759 treated condition in the absence of IL7 stimulation. (E) Relative luminescence of CCRF-CEM cells 760 transfected with the STAT5 reporter construct and treated with or without 1µM DEX, 100ng/mL IL7, and 761 500nM RUX in technical triplicate for 36 hours prior to lysis and measurement of luciferase activity. (F) 762 GSEA plots of STAT5 gene expression signatures comparing scramble control clones (n=4) treated 763 with 100ng/mL IL7 versus the combination of 1µM DEX and 100ng/mL IL7 for 16 hours. Statistical 764 significance was assessed using one-way ANOVA with Tukey’s method for multiple comparisons 765 adjustment (B-E). With the exception of the RNA-seq experiment, all data are representative of three 766 independent experiments. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, N.S. – not significant. Meyer 33 Figure 3 A C Genes differentially expressed STAT5B gene set Scramble STAT5A KO STAT5B KO STAT5A/B KO in DEX vs. DEX+IL7 S1 S2 S3 S4 A1 A2 A3 A4 B1 B2 B3 B4 AB1 AB2 AB3 AB4 MCL1 STAT5A LETM2 TM9SF3 β−actin TP53BP2 ATP2A3 CRADD STAT5B SEC31B CD48 ATP5F1B SCLT1 β−actin CISH DNAJC18 ENPEP PDCD4 BCL2 STIP1 VPS13D ARHGEF3 BCL2L1 PTPN4 PPP1R14BP3 DOCK10 PTPRCAP ZNF101 SUMO1P3 LPIN2 AC133555.4 CCDC88C ZNF768 STIM2 LNPEP ....
B D E 100nM DEX BCL2 ARHGEF3 100 100nM DEX + 25ng/mL IL7 4 * 8 ** 90 Scramble Scramble ** N.S. * 80 STAT5A/B KO STAT5A/B KO N.S. 70 3 6 60 50 2 4 40 30 20 1 2 Fold change FPKM 10 Fold change FPKM % Viable relative to vehicle % Viable 0 0 0 Vehicle DEX IL7 DEX+IL7 Vehicle DEX IL7 DEX+IL7
Scramble STAT5A KOSTAT5B KO STAT5A/B KO G BCL2L11 BCL2 F N.S. 12 * 12
* 10 10 200 ****
8 8 150
6 6 100 4 4
50
BCL-2 MFI 2 2 Fold change transcript Fold change transcript Δ
0 0 0 DEX - + - + - + DEX - + - + - + -50 IL7 - - + + + + IL7 - - + + + + CHX - - - - + + CHX - - - - + +
Scramble STAT5ASTAT5B KO KO STAT5A/B KO 767 768 Fig. 3. STAT5B, but not STAT5A, mediates the upregulation of BCL-2 expression in cells 769 exposed to the combination of DEX and IL7. (A) Evaluation of STAT5A and STAT5B expression by 770 Western blot in independent scramble control (S) and STAT5 single (A or B) and double (AB) KO 771 CCRF-CEM cell clones (n=4 per genotype). (B) Viability of independent scramble control and STAT5 772 KO CCRF-CEM cell clones (n=4 per genotype) treated with 100nM DEX with or without 25ng/mL IL7 773 for 72 hours. (C) Venn diagram depicting the overlap between the top differentially expressed genes 774 between scramble control CCRF-CEM cell clones (n=4) treated with DEX versus DEX+IL7 and 775 STAT5B target genes. (D-E) Fold change in the FPKM values for (D) BCL2 transcript and (E) 776 ARHGEF3 transcript as determined by RNA-seq analysis of scramble control (n=4) and STAT5A/B 777 double KO (n=4) CCRF-CEM cell clones treated in the absence or presence of 100ng/mL IL7 and/or 778 1µM DEX for 16 hours. (F) DMFI of BCL-2 protein expression in scramble control (n=4) and STAT5 KO 779 (n=4) CCRF-CEM cell clones treated with 100ng/mL IL7 and 1µM DEX relative to 100ng/mL IL7 alone 780 for 48 hours. (G) BCL2L11 and BCL2 transcript expression in CCRF-CEM cells cultured in the absence 781 or presence of 1µM DEX, 100ng/mL IL7, and/or 10µg/mL CHX for 16 hours as determined by qPCR 782 performed in technical triplicate. Statistical significance was assessed using a paired t-test (B), two- 783 sample t-tests (D and E), or one-way ANOVA with Tukey’s method for multiple comparisons adjustment 784 (F and G). With the exception of the RNA-seq experiment, all data are representative of three 785 independent experiments. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, N.S. – not significant. Meyer 34 Figure 4 A B C
100 100 100 No IL7 90 IL7 50 0.3 90 *** 10 80 80 IL7 + 125nM ABT-199 5 70 70 IL7 + 250nM ABT-199 0.2 1 60 60 IL7 + 1µM ABT-199 50 50 0.5 40 0.1 40 N.S. 0.1 [DEX] (µM) % Priming 30 0.05 30 20 0.01 20 10 0.005 10 0 % Viable relative to vehicle % Viable 0 0 0.001 Vehicle 0 1 2 3 4 5 .125 .25 .5 IL7 log([DEX] (nM)) DEX [ABT-199] (µM) Vehicle DEX+IL7 D E No IL7 IL7 1200 N.S. 100 100 90 90 Untransduced 1000 ** * *** 80 80 shControl **** **** 800 70 70 shBCL2-1 60 60 shBCL2-2 600 50 50 shBCL2-3 40 40 shBCL2-4
BCL-2 MFI 400 30 30 shBCL2-5 200 20 20 10 10 % Viable relative to vehicle % Viable 0 0 relative to vehicle % Viable 0 Vehicle 0 1 2 3 4 5 Vehicle 0 1 2 3 4 5 log([DEX] (nM)) log([DEX] (nM))
shControlshBCL2-1shBCL2-2shBCL2-3shBCL2-4shBCL2-5 Untransduced
F G **** 60 *** No DEX i DEX
*** 40 FPKM
20
BCL2 ii
0
MRD- iii
MRD+ (<1%)MRD+ (≥1%) iv BCL-2
786 787 Fig. 4. BCL-2 mediates IL7-induced DEX resistance. (A) Percent priming of CCRF-CEM cells treated 788 in the absence or presence of 1µM DEX and/or 100ng/mL IL7 in technical triplicate for 16 hours 789 followed by BH3 profiling with 0.5µM ABT-199 for 90 minutes. (B) Viability of CCRF-CEM cells treated 790 with DEX in the absence or presence of 25ng/mL IL7 and increasing concentrations of ABT-199 for 72 791 hours in technical triplicate. The no IL7 (black line) and the 25ng/mL IL7 (red line) conditions are re- 792 plotted from figure 1C. (C) Heatmap of Bliss independence scores calculated as the average of 793 technical triplicates for the combination of DEX and ABT-199 in the presence of 25ng/mL IL7. (D) MFI 794 of BCL-2 protein expression assessed in technical triplicate in untransduced CCRF-CEM cells and 795 CCRF-CEM cells transduced with a non-targeting shRNA control (shControl) or a BCL2-targeting 796 shRNA (shBCL2-1-5). Statistical significance is relative to the untransduced cells. (E) Viability of 797 untransduced or shRNA-transduced CCRF-CEM cells treated with DEX in the absence (left) or 798 presence (right) of 25ng/mL IL7 in technical triplicate for 72 hours. (F) FPKM values for BCL2 transcript 799 obtained from published RNA-seq data from diagnostic samples from patients enrolled on COG 800 AALL0434, stratified based on day 29 bone marrow MRD. (G) Schematic of the proposed model for the 801 mechanism by which DEX paradoxically induces steroid resistance in T-ALL cells in the presence of 802 IL7. In the presence of DEX (right), GR induces an increase in IL7R expression (i) leading to an 803 increase in IL7R at the cell surface (ii). This in turn leads to an increase in STAT5 transcriptional activity 804 (iii) that ultimately results in the upregulation of BCL-2 (iv). Statistical significance was assessed using 805 one-way ANOVA with Tukey’s method for multiple comparisons adjustment (A, D, and F). All CCRF- 806 CEM cell data are representative of three independent experiments. ****p<0.0001, ***p<0.001, 807 **p<0.01, *p<0.05, N.S. – not significant. Meyer 35 Figure 5
A B * 100 100 *** ** 90 90 **** Vehicle 80 80 DEX 70 70
60 60 **** 50 50 40 40 % Priming 30 **** 30 20 20
% of total population ** 10 10
0 0
DP DN DP DN
CD4 SP CD8 SP CD4 SP CD8 SP C E Double negative Double positive
110 110 100 No IL7 100 No IL7 90 10pg/mL IL7 90 10pg/mL IL7 CD8 SP 80 100pg/mL IL7 80 100pg/mL IL7 70 1ng/mL IL7 70 1ng/mL IL7 CD4 SP 60 60 50 50 DP 40 40 30 30 DN 20 20 101 102 103 104 105 10 10 % Viable relative to vehicle % Viable relative to vehicle % Viable IL7Rα−APC 0 0 Vehicle 0 1 2 3 4 Vehicle 0 1 2 3 4 log([DEX] (nM)) log([DEX] (nM)) D CD4 single positive CD8 single positive 110 110 100 100 CD8 SP No IL7 No IL7 90 10pg/mL IL7 90 10pg/mL IL7 80 100pg/mL IL7 80 100pg/mL IL7 CD4 SP 70 1ng/mL IL7 70 1ng/mL IL7 60 60 DP 50 50 40 40 30 30 DN 20 20
% Viable relative to vehicle % Viable 10 relative to vehicle % Viable 10
1 2 3 4 5 10 10 10 10 10 0 0 Vehicle 0 1 2 3 4 Vehicle 0 1 2 3 4 pSTAT5-AlexaFluor647 log([DEX] (nM)) log([DEX] (nM))
F Ex vivo IL7Rα G Ex vivo BCL-2 H In vivo BCL-2
1200 **** 2500 2000 IL7 IL7 ** Vehicle **** *** 1000 DEX+IL7 DEX+IL7 ** DEX 2000 ** N.S. 1500 * 800 1500
MFI 1000
α 600
1000 BCL-2 MFI IL7R 400 BCL-2 MFI **** 500 N.S. 500 200
N.A. N.A. 0 0 0
DN DP DN DP DN DP
CD4 SP CD8 SP CD4 SP CD8 SP CD4 SP CD8 SP 808 Fig. 5. IL7 induces DEX resistance in subpopulations of normal developing thymocytes. (A) 809 Percentage of thymocyte subpopulations in thymi isolated from mice treated with vehicle control (n=3) 810 or DEX (n=3) at 2mg/kg/day for three days. (B) Percent priming of thymocytes in the basal state 811 following BH3 profiling with 1µM synthetic BIM peptide in technical triplicate for 90 minutes. (C) 812 Histograms of the basal expression of IL7Ra in the major murine thymocyte subpopulations. (D) 813 Histograms of pSTAT5 in the major murine thymocyte subpopulations in the basal state (unfilled 814 histograms) and following a 15-minute stimulation with 100ng/mL IL7 (filled histograms). (E) Viability of 815 murine thymocyte subpopulations following ex vivo treatment for 24 hours with DEX in the absence or 816 presence of increasing concentrations of IL7. (F) MFI of IL7Ra in murine thymocytes treated ex vivo in 817 the presence of 100pg/mL IL7 with or without 1µM DEX in technical triplicate for 24 hours. DP cells 818 could not be analyzed due to lack of viable cells remaining after DEX exposure (not analyzed; N.A.). 819 (G) MFI of BCL-2 in murine thymocytes treated ex vivo in the presence of 100pg/mL IL7 with or without 820 1µM DEX in technical triplicate for 24 hours. DP cells could not be analyzed due to lack of viable cells 821 remaining after DEX exposure (N.A.). (H) MFI of BCL-2 in thymocytes isolated from mice treated with 822 vehicle control (n=3) or DEX (n=3) at 2mg/kg/day for three days. Statistical significance was assessed 823 using two-sample t-tests (A, F, G, and H) or one-way ANOVA with Tukey’s method for multiple 824 comparisons adjustment (B). All data are representative of three independent experiments. 825 ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, N.S. – not significant. Meyer 36
826 827 Fig. 6. T-ALLs reflecting early stages of T-cell development demonstrate DEX resistance in the 828 presence of IL7. (A) Heatmap depicting the clustering of 76 primary T-ALL samples by expression of 829 genes that are upregulated in early developing thymocytes relative to later developing thymocytes. (B) 830 MFI of cell surface IL7Ra in 15 early and 12 late T-ALL PDX samples following exposure to 1µM DEX 831 for 24 hours in technical triplicate. (C) Viability relative to vehicle control of 15 early and 12 late T-ALL 832 PDX samples treated with 1µM DEX in the absence or presence of 25ng/mL IL7 for 48 hours in 833 technical triplicate. (D) MFI of BCL-2 protein expression in 10 early T-ALL PDX samples following 834 exposure to 100ng/mL IL7 with or without 1µM DEX and 500nM RUX for 16 hours in technical triplicate. 835 Some samples were not analyzed due to limitations in cell numbers. (E) Viability relative to vehicle 836 control of 15 early T-ALL samples exposed to 25ng/mL IL7 with or without 1µM DEX and/or 500nM 837 RUX or 1µM ABT-199 for 48 hours in technical triplicate. (F) Kaplan-Meier survival analysis of mice 838 transplanted with early T-ALL T24 and treated with vehicle control (n=5), DEX (n=5), RUX (n=5), or the 839 combination of DEX and RUX (n=5). Statistical significance was assessed using paired t-tests (B and 840 C), one-way ANOVA with Tukey’s method for multiple comparisons adjustment (D and E), or a log-rank 841 test (F). ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, N.S. – not significant.