Mesoangioblasts from Ventricular Vessels Can Differentiate in Vitro Into Cardiac Myocytes with Sinoatrial-Like Properties

Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

Contents lists available at ScienceDirect

Journal of Molecular and Cellular Cardiology

journal homepage: www.elsevier.com/locate/yjmcc

Original article Mesoangioblasts from ventricular vessels can differentiate in vitro into cardiac myocytes with sinoatrial-like properties

Andrea Barbuti a,b,⁎, Beatriz G. Galvez c, Alessia Crespi a, Angela Scavone a, Mirko Baruscotti a,b, Chiara Brioschi a, Giulio Cossu c,d, Dario DiFrancesco a,b a Department of Biomolecular Sciences and Biotechnology, The PaceLab, University of Milano, via Celoria 26, 20133 Milan, Italy b Centro Interuniversitario di Medicina Molecolare e Bioﬁsica Applicata (CIMMBA), University of Milan, Italy c Stem Cell Research Institute, San Raffaele Hospital, via Olgettina, 20132 Milan, Italy d University of Milano, Department of Biology, via Celoria 26, 20133 Milan, Italy article info abstract

Article history: Cardiac mesoangioblasts (MABs) are a class of vessel-associated clonogenic, self-renewing progenitor cells, Received 17 June 2009 recently identified in the post-natal murine heart and committed to cardiac differentiation. Cardiomyocytes Received in revised form 7 September 2009 generated during cardiogenesis from progenitor cells acquire several distinct phenotypes, corresponding to Accepted 2 October 2009 different functional properties in diverse structures of the adult heart. Given the special functional relevance Available online 22 October 2009 to rhythm generation and rate control of sinoatrial cells, and in view of their prospective use in therapeutical applications, we sought to determine if, and to what extent, cardiac mesoangioblasts could also differentiate Keywords: Adult stem cells into myocytes with properties typical of mature pacemaker myocytes. We report here that a subpopulation Mesoangioblasts of cardiac mesoangioblasts, induced to differentiate in vitro into cardiomyocytes, do acquire a phenotype Pacemaker myocytes with specific mature pacemaker myocytes properties. These include expression of the HCN4 isoform of Funny current pacemaker (“funny”, f-) channels and connexin 45 (Cx45), as well as reduced expression of inwardly- HCN channels rectifying potassium channels. Furthermore, MAB-derived myocytes form agglomerates of pacing cells displaying stable rhythmic activity, and as in native cardiac pacemaker cells, f-channel modulation by autonomic transmitters contributes to control of spontaneous rate in differentiated mesoangioblasts. These data represent the first evidence for in vitro generation of pacemaker-like myocytes from proliferating non- embryonic stem/progenitor cells. © 2009 Elsevier Ltd. All rights reserved.

1. Introduction [9] and cardiac muscle [10], where they were shown to differentiate mainly to skeletal and cardiac myocytes, respectively. During cardiac embryogenesis, common early cardiac precursors In this latter study, we have shown that ventricle-derived and aorta- differentiate into diverse cardiovascular cell types according to derived MABs can differentiate spontaneously into contracting cardio- specificgeneprograms[1,2], and some of the transcriptional myocytes expressing cardiac-specific proteins and ion channels. During networks whose activation is linked to specification of different development cardiac precursors acquire different phenotypes, with cardiomyocytes have been elucidated [3,4]. specific functional features [11–13]. An important distinction exists Study of embryonic stem (ES) cell differentiation, which recapi- between cells of the cardiac pacemaker/conduction tissue, whose tulates early cardiac development, has shown generation of multiple contribution is mainly electrical (i.e. generation and propagation of the cardiac phenotypes from common progenitors [5,6]. Adult cardiac action potential) and the working myocardium, whose main function is stem cells, on the other hand, generate cardiomyocytes of the working to respond to electrical stimuli with a contraction. muscle [7], but their ability to give rise to multiple cardiac phenotypes An obvious question arising from the finding that cardiac MABs has not yet been demonstrated. express typical cardiac progenitor markers and have a high prolifera- MABs are vessel-associated, progenitor cells originally isolated in tive potency, is whether their differentiation gives rise to multiple the embryonic aorta as clonogenic, self-renewing and multipotent cardiac phenotypes. We specifically asked if, and to what extent, cells [8]. Recently, similar cells have been identified in adult skeletal MABs could differentiate into cardiomyocytes with a mature pacemaker/conduction tissue phenotype. Our investigation was prompted by the preliminary observation that spontaneous activity ⁎ Corresponding author. Department of Biomolecular Science and Biotechnology was often seen to arise in a fraction of differentiating MABs. University of Milano, Via Celoria 26, 20133 Milan, Italy. Tel.: +39 02 50314941; fax: +39 02 50314932. We found that in both ventricle-derived and aorta-derived MAB E-mail address: [email protected] (A. Barbuti). clones, expanded under suitable culture conditions and driven to

differentiate in vitro into cardiomyocytes, a subpopulation of cells vector (Invitrogen). The constitutive promoter PCMV was then does possess features typical of mature pacemaker myocytes, such as removed (AseI/XhoI) to obtain the promoterless cGATA-6/GFP vector. spontaneous electrical activity, expression of HCN channels and Undifferentiated cardiac mesoangioblasts were transfected by connexin 45 (Cx45) and lack of the inward rectifying IK1 current. lipofectamine reagents (following manufacturer instructions) with the GATA6-GFP vector. Since GFP would be expressed only in cells that 2. Materials and methods actively transcribe the GATA-6 gene, cells were co-transfected with the pIREs2a-DsRed2 plasmid in order to evaluate transfection 2.1. Isolation and expansion of stem cells from murine ventricular vessels efﬁciency.

The methods used for the identification, isolation, expansion of 2.5. Immunofluorescence and confocal analysis cardiac mesoangioblasts were as previously described [10]. Briefly, 2- to 4-week-old C57 mice were sacrificed and the hearts quickly removed. For immunofluorescence analysis, cells were grown onto 1% Ventricles were kept in DMEM without FCS and cut into small pieces gelatin-coated glass coverslips and fixed in formaldehyde (4%) for including large vessels. Pieces were placed in 1% gelatin B (Sigma)- 10 min on ice, and then rinsed for 20 min with PBS containing 0.1 mol/L coated 35 mm petri dishes and kept in DMEM solution supplemented glycine. The cells were permeabilized in PBS solution containing 1% with 20% FBS, 5 mmol/L L-glutamine and 100 U/mL penicillin, BSA and 0.3% Triton X-100 and incubated overnight at 4 °C with

0.07 mmol/L streptomycin at 37 °C (5% CO2). After 2–3weeks,ontop primary antibodies (anti-myosin slow 1:500, Sigma; anti-GATA-6 of a layer of fibroblast–like cells, small, round, phase-bright cells were 1:100, Abcam; anti-connexin 43 1:50, Chemicon; anti-connexin 45 identifiable. These cells were collected and progressively expanded as 1:50, Chemicon; anti-HCN1-4, 1:100, Alomone Labs, anti-β1 and anti- separate clones in 10% FBS-DMEM maintaining medium. β2 adrenergic receptors 1:200 and anti-muscarinic M2 receptors All experimental protocols conformed to guidelines for the care 1:200, Santa Cruz). Coverslips were then washed in PBS and incubated and use of laboratory animals as established by State (D.L. 116/1992) for 1 hour with fluorophore-conjugated secondary antibodies (anti and European directives (86/609/CEE). mouse-TRITC, anti rabbit-FITC, 1:1000, Molecular Probes; anti mouse- Cy5, 1:1000, Chemicon). When needed, rhodamin–phalloidin (1 U/ 2.2. Differentiation coverslip, Molecular Probes) was added and the cells were incubated for 30 min at room temperature. Primary and secondary antibodies Spontaneous differentiation was induced by lowering serum (FCS) were diluted in PBS. After a final washout with PBS, coverslips were concentration in the growth medium (DMEM) from 10% to 2%. After mounted with Vectashield mounting medium with DAPI (Vector). 5 days of culture in differentiating medium most clones showed a high Fluorescence staining was analyzed by Video Confocal microscopy degree of cardiac differentiation based on myosin staining, and a few (ViCo Nikon). To test whether HCN2 and HCN1 antibodies were clones displayed several foci of spontaneously beating cells. Two functional, controls were performed in CHO cells transfected with the ventricle-derived clones (dubbed J2, J8) and an aorta-derived clone (I4) mouse HCN2 isoform and in murine ES cell-derived cardiomyocytes, were selected for further analysis due to their high rate of differentiation respectively, and results were positive; control experiments with into autorhythmic cells; all data presented here refer to these clones. secondary antibodies only were also carried out for all types of antibodies used, and resulted in no staining (data not shown). 2.3. RT-PCR analysis 2.6. Electrophysiology and data analysis RT-PCR analysis was carried out in both undifferentiated and differentiated MABs; in the latter case cells were kept in differenti- Action potentials were recorded from uniformly beating cell ation conditions for at least 5 days and the appearance of agglomerates or single cells superfused with Tyrode solution contain- spontaneously beating cells assessed under the microscope before ing (mmol/L): 140 NaCl, 5.4 KCl, 1.8 CaCl2, 1 MgCl2, 5.5 D-glucose, 5 RNA isolation. Total RNA was isolated with TRIzol protocol (Invitro- Hepes-NaOH; pH 7.4. Temperature was 36 °C. Patch-clamp pipettes gen, Carlsbad, CA) and reverse transcribed (Platinum Taq DNA had resistances of 3–6MΩ when filled with an intracellular-like polymerase, Invitrogen). RT-PCR was performed using primers and solution containing (mmol/L) 130 K-aspartate, 10 NaCl, 5 EGTA-KOH, conditions as described previously [10]. Forward and reverse primers 2 CaCl2, 2 MgCl2, 2 ATP (Na-salt), 5 creatine phosphate, 0.1 GTP (Na- used for Tbx3 were CCCGAAGAAGAGGTGGAGGACGAC and GATGGA- salt), 10 Hepes-KOH; pH 7.2. Isoproterenol and acetylcholine (Sigma) GACAGCAGGAGAGGAT, respectively. were added to the Tyrode solution at the desired concentration from concentrated stock solutions (1 mmol/L). 2.4. Plasmid preparation and cell transfection For single-cell voltage-clamp experiments, MABs-derived cardiomyocytes were dispersed by trypsin, plated at a low density on 35 mm GATA-6 is a transcription factor activated early during cardiogen- gelatin (1%)-coated petri dishes and allowed to settle overnight. The esis in vertebrates [14,15]. An upstream regulatory element of this following day, cells were placed on the stage of an inverted gene (GATA-6 enhancer) becomes active prior to formation of the microscope and superfused with Tyrode solution at 36 °C. To better linear heart tube and is inactivated in prospective ventricular cells dissect the If current, 1 mmol/L BaCl2 and 2 mmol/L MnCl2 were prior to E9.5 [14]. Although there is a low degree of homology added to normal Tyrode during voltage-clamp recordings. between the 1.5-kb sequence of the chicken GATA-6 enhancer and the If was activated by hyperpolarizing test steps to the range −45/− mouse genome, previous work has demonstrated that the regulatory 125 mV from a holding potential of −35 mV, followed by 1.5 s steps to mechanism underlying cardiac restricted expression is conserved −125 mV for full activation [18]. Each test step was long enough to between chicken and mouse [14–16]; expression of the reporter reach steady-state current activation. Normalized tail currents genes LacZ or GFP driven by the chicken GATA-6 enhancer specifically measured at −125 mV were used to plot activation curves, which highlights the developing atrioventricular conduction system in vivo, were fitted to the Boltzmann distribution: y=(1/(1+exp((V−V1/2)/s), in transgenic mice [14,15] or in vitro, in mouse ES cell-derived where V is voltage, y fractional activation, V1/2 the half-activation voltage, pacemaker cells [17]. and s the inverse-slope factor. Time constants of current activation were The chicken GATA-6 (cGATA-6) proximal enhancer sequence was obtained by fitting current traces with a single exponential function after excised using SalI/BamHI from the vector pPD46.21 and inserted, an initial delay. Fully-activated current–voltage relations were obtained using the same restriction enzymes, into the MCS of the pEGFP-N1 as previously described [18]. A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423 417

Shifts of the If activation curve induced by neurotransmitters were obtained by a previously described protocol [19]. + The inwardly rectifying K current (IK1) was measured as the Ba2+ -sensitive current and was obtained by applying 4 s voltage ramps in the range −100/−25 mV, from a holding potential of −80 mV, with and without 2 mmol/L BaCl2 in the extracellular solution.

2.7. Flow cytometry

MABs co-transfected with the cGATA-6/GFP and pIREs2a-DsRed2 plasmid vectors (see above) were detached with PBS containing 5 mmol/L EDTA and analyzed in a FACSCalibur ﬂow cytometer (Becton Dickinson) as previously described [10].

3. Results

3.1. Identiﬁcation of a subpopulation of cardiac mesoangioblasts with sinoatrial-like/conduction tissue markers

We have reported previously that mesoangioblasts isolated from ventricular vessels can differentiate in vitro into cardiomyocytes either when co-cultured with newborn ventricular myocytes or spontaneously, when the serum concentration in the culture medium is lowered [10]. We noticed that with certain MAB clones, switching to low serum differentiating medium induced in most cells a change of morphology accompanied by the appearance of several foci of spontaneous activity. Although we concentrated our analysis on a particular ventricle-derived clone (dubbed J2), sinoatrial-like properties were also investigated in two additional clones, a ventricle- derived clone (J8) and an aorta-derived clone (I4). We have previously reported that MABs express both stem cell markers and early cardiac markers [10]; here we have confirmed that Fig. 1. MABs of the J2 clone express cardiac markers. RT-PCR analysis of undifferentiated both undifferentiated (Fig. 1U) and spontaneously differentiated (Fig. (U) and differentiated (D) MABs of the J2 clone showing expression of markers of early 1D) J2 MABs express several early cardiac markers such as Nkx2.5, cardiac differentiation and of the housekeeping gene β-tubulin. Data from RT-PCR GATA-4, TBX5, Cx43 and ANF. They express also the transcription analysis of RNA extracted from mature cardiomyocytes (CMC), undifferentiated ES cells factors GATA-6, ISL-1 and TBX2, known to be specifically involved in (ESC), fibroblasts and human microvascular endothelial cells (HMEC) were included in early phases of the cardiac conduction system differentiation [2,14– the analysis as positive or negative controls. 17,20,21] and TBX3, a transcriptional repressor that specifically delineates the SAN and the conduction system during heart organized sarcomeric structure (red). On average, the fractions of development [3]. undifferentiated (28.2±10.2%, n=4 independent experiments) and For all transcripts, RT-PCR control runs were carried out also in differentiated (30.0±4.1%, n=4 independent experiments) MABs cardiomyocytes (CMC) and ES cells (ESC). Furthermore, RT-PCR positive for GATA-6 staining were not significantly different analysis of transcripts (Nkx2.5, GATA-6 and TBX2) expressed in all the (Student t-test). above cell types was performed also on murine fibroblasts and human Expression of GATA-6 in a fraction of cells was further confirmed microvascular endothelial cells (HMEC) as negative controls. by co-transfecting undifferentiated cells with a plasmid containing an Figs. 2A–D show phase contrast (A) and immunofluorescence enhancer region of the GATA-6 gene driving GFP expression (GATA-6/ sections (B–D) of representative undifferentiated (left) and differen- GFP, see also Materials and methods) and a control plasmid which tiated MABs (right). constitutively expresses the DsRed fluorescent protein. Flow-cyto- While myosin (red) is not expressed in undifferentiated cells, it metry analysis indicated that about 27% of transfected cells expressed forms a contractile system organized in striated, sarcomeric-like GFP (Fig. S1) as shown in a representative confocal image in Fig. 3C. structure in cells after differentiation (Fig. 2B). As shown in Fig. 2C, Furthermore, some GFP-positive transfected MABs could acquire the Cx43 protein (cyan) was not expressed to a detectable level in spontaneous activity when grown in differentiating medium (Sup- undifferentiated cells but was widely expressed in differentiated plementary video 1). MABs. Enlargements shown in panel D show that the actin These data support the hypothesis that a subpopulation of cardiac cytoskeleton (red) was not organized in sarcomeric structures in MABs is committed to differentiate towards a mature pacemaker/ undifferentiated MABs, while differentiated cells presented a well conduction tissue phenotype. Cells displaying spontaneous activity developed sarcomeric structure and a strong Cx43 signal localized will be referred to below as Mesoangioblast-derived Pacemaker to membrane regions delimiting contact areas between adjacent Cells (Md-PCs). cells.

To verify the presence of a subpopulation of MABs committed to 3.2. Properties of If current expressed by Md-PCs differentiate into sinoatrial-like/conduction tissue myocytes, cells were labelled with an anti-GATA-6 antibody and with phalloidin. To determine the electrophysiological properties of Md-PCs, Fig. 3 shows that a fraction of cells displayed GATA-6 staining single cells or small cell agglomerates showing spontaneous activity (green) both before (Fig. 3A) and after differentiation (Fig. 3B); as were investigated by patch-clamp analysis. Spontaneous activity expected GATA-6 staining was localized mostly in nuclei and after recorded from isolated Md-PCs revealed action potentials charac- differentiation, it was expressed in cells which had developed an terized by a clear slow “diastolic” depolarization phase (Fig. 4A and 418 A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

activation was 756±107 ms at −85 mV (n=16) and was strongly voltage-dependent (Fig. 4D). Taking into account that reported values

of If kinetics are subject to large variability, the kinetics recorded in Md-PCs were in a range compatible with data in SAN tissues from different species [23], although they differed slightly from published murine SAN data [24]. The mean fully-activated I/V relation (Fig. 4E) was approximately linear in the range −115 to −5 mV with a reversal potential of −17.5 mV, in agreement with data from SAN

recordings [18]. The If current of Md-PCs was blocked by extracellular Cs+ (2 mmol/L CsCl), a known blocker of native f- and HCN channels [18] (not shown).

The mean cell capacitance of Md-PCs was 91.2±8.8 pF and the If current density measured at −115 mV was 3.1±0.5 pA/pF (n=16), a value lower than that reported in murine SAN myocytes (18±9 pA/ pF as mean±SD at −120 mV; cell capacitance 24±2 pF) [24].

Analysis of If current recorded from spontaneously beating J8 and I4 MABs yielded a mean V1/2 of −74.3±3.3 (n=3) and −71.3± 4.5 mV (n=5) and mean current densities of 2.9±0.6 (n=4) and 2.1±0.4 pA/pF (n=5), respectively; values not different from those of clone J2. Interestingly, differentiated MABs presenting a stable resting potential but able to ﬁre action potentials when electrically

stimulated, were characterized by a signiﬁcantly smaller If density (0.25±0.2 pA/pF at −115 mV, n=8; pb0.05) than Md-PCs. Mean cell capacitance of these quiescent cells was 33.9±5.3 pF, a value signiﬁcantly smaller than that of Md-PCs, providing further evidence that Md-PCs represent a distinct population of MABs-derived

myocytes. We did not ﬁnd evidence for any detectable If current in undifferentiated MABs (n=13).

3.3. Identiﬁcation of HCN isoforms expressed by Md-PCs

In order to identify the molecular components of f-channels in Md- PCs, we investigated the expression of all four HCN isoforms (HCN1-4) by immunofluorescence staining. In Fig. 5, representative single sections of Md-PCs labelled with anti-HCN1–4 antibodies are shown (A to H). Signals of either HCN1 or HCN2 isoforms were never observed at detectable levels (Figs. 5A, B, E and F), and signals of HCN3 were detected in only a few cells (Figs. 5C and G). On the other hand, we detected strong membrane signals of HCN4 (Figs. 5D and H) in 27% of cells (39 out of 142). HCN staining was only detected in those Md-PCs which expressed an organized contractile system, as verified by F- actin staining (red in Figs. 5E–H). Control immunofluorescence Fig. 2. Properties of differentiated vs. undifferentiated MABs. (A) Morphology of experiments using the secondary antibodies only were run to test undifferentiated (left) and differentiated cardiac MABs (right) in phase contrast signal specificity; furthermore, controls were also performed by images. Undifferentiated cells were small and elongated, while differentiated cells were transfecting HEK or CHO cells with HCN1 and HCN2 channels, which – bigger and had an irregular shape. (B D) Single confocal immunostaining sections. confirmed the efficiency of anti HCN1 and HCN2 antibodies (data not Differentiated MABs displayed an organized contractile system visible by staining for fi myosin (red, B) and F-actin (labelled with rhodamine-conjugated phalloidin, red, D) shown). According to electrophysiological data, we did not nd and expressed Cx43 in regions of cell-to-cell contact (cyan, C). Neither an ordered expression of any HCN isoforms in undifferentiated MABs (data not contractile system nor Cx43 were expressed in undifferentiated MABs (B–D left). Nuclei shown). These data clearly indicate that HCN4 is the main HCN μ μ labeled by DAPI (blue) in all sections. Bars 20 m in A to C, 10 minD. isoform in differentiated MABs. In Fig. 5D above we have shown that HCN4 is the most highly Supplementary video 2) typical of sinoatrial myocytes [22]. Since expressed isoform in differentiated MABs. HCN4 is the main isoform sinoatrial myocytes are characterized by the expression of the expressed in the cardiac pacemaker tissues of different species pacemaker “funny” (If) current, we investigated the presence and [25,26], and is considered as a marker of SAN differentiation the properties of this current in Md-PC derived from the J2 and J8 [3,27,28]. We therefore investigated whether there is a correlation ventricle-derived clones and from the I4 aorta-derived clone. In Fig. between expression of HCN4 and GATA-6 in Md-PCs. An analysis

4B, the If current was recorded from the same cell shown in Fig. 4A conducted in differentiated MABs by double staining with anti-HCN4 during a protocol used to measure the voltage-dependence of and anti-GATA-6 antibodies revealed that in n=102 cells, 28 out of activation (range −35/−125 mV). The If current was recorded in all 34 cells expressing GATA-6 (red) also expressed HCN4 (green) spontaneously beating Md-PCs showing a clear pacemaker depolar- (82.4%; see representative cell in Fig. 6A), while of the remaining 68 ization phase (n=10). GATA-6 negative cells, one only expressed HCN4 (1.5%, not shown).

Analysis from n=16 cells from clone J2 yielded a mean If This indicates that HCN4 is expressed essentially only within the activation curve with a half activation voltage (V1/2)of−72.5± GATA-6 positive subpopulation. These data further support the 2.1 mV and an inverse slope factor of 7.7±0.5 mV when ﬁtted to a evidence for a subpopulation of MABs with a sinoatrial-like/ Boltzmann distribution curve (Fig. 4C). The mean time constant of conduction tissue phenotype. A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423 419

Fig. 3. A subpopulation of MABs expresses GATA-6. Single confocal sections of MABs showing GATA-6 staining (green, right) in a fraction of both undifferentiated (A) and differentiated cells (B); in the latter case, GATA-6 was expressed in cells with a developed sarcomeric structure; F-actin (Phalloidin) is shown in red. (C) Single confocal image of MABs co-transfected with c-GATA-6/GFP and pIREs2a -DsRed2 vectors (red, left) showing that in a portion of cells the GATA-6 enhancer was active (green, right). Nuclei labeled by DAPI (blue) in all sections. Bars 20 μm.

3.4. Lack of IK1 current and expression of connexin 45 previously reported in cardiac MABs (−2.4 pA/pF at −100 mV) [10]. Additional properties typical of pacemaker cells of the SAN are the expression of Cx 45 [29,30] and the lack of the inwardly rectifying K+ 3.5. Spontaneous activity and autonomic modulation of rate current (IK1). While Cx43 is the most abundant connexin isoform expressed in the heart, the cardiac conduction tissue and speciﬁcally A fundamental function of cardiac pacemaker cells is rate the SAN tissue expresses, among others, the low-conductance isoform modulation by neurotransmitters. A major role in mediating auto- Cx45 [31–33]. As illustrated in Fig. 6B, differentiated MABs were nomic rate control is played by cAMP-dependent modulation of positive for anti-Cx45 antibodies (cyan) in regions of contact among f-channels [34]. To verify whether in Md-PCs spontaneous rate is adjacent cells displaying a clear sarcomeric structure (red). No Cx45 modulated, action potentials were recorded from rhythmically and signal was detected in undifferentiated cells (not shown). We also synchronously contracting cell agglomerates whose rates were stable found no evidence for Cx40, a connexin isoform typical of atrial tissue for longer than one minute. Cells were superfused with the control [3,33,31], in either undifferentiated or differentiated cells (not solution to which either isoproterenol (Iso, 1 μmol/L) or acetylcholine shown). (ACh, 0.1 μmol/L) were added. In Figs. 7A, B (upper panels),

Lack of IK1 keeps sinoatrial cells at relatively depolarized voltages, superimposed action potentials recorded from two representative such that a moderate activation of If provides the inward current ﬂow Md-PC clumps before (solid line) and during agonist stimulation necessary for normal diastolic depolarization to develop. (dashed line) are shown as indicated. The mean percent changes of

We therefore evaluated whether expression of If and IK1 were rate, relative to control, were +32±8.2% (Iso 1 μmol/L, n=7) and inversely correlated. In Figs. 6C, D representative current traces −7.3±2% (ACh 0.1 μmol/L, n=4); both changes were significant recorded by a ramp protocol in the range −100 to −25 mV in Tyrode (pb0.05). 2+ and during perfusion of 2 mmol/L Ba from a Md-PC not expressing To determine the If contribution to neurotransmitter-mediated (C, left) or expressing If (D, left) are shown. Mean I/V relations for IK1 rate changes, we investigated the actions of Iso and ACh on If by in Md-PCs expressing no If (C, right) and in Md-PCs expressing If (D, applying hyperpolarizing two-step protocols as in Figs. 7A, B (lower right) show a clear difference in current density; at −100 mV this was panels). Iso (1 μmol/L) increased If during the first step (to mid- −1.93±0.49 (n=10) and −0.175±0.04 pA/pF (n=5) in cells activation voltage) but decreased it during the second step (to full- without (C) and with If (D), respectively (significantly different, activation voltage) as expected for a positive shift of the activation pb0.05). The IK1 density in cells not expressing If was close to that curve with no substantial alteration of the fully activated current [18]; 420 A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

high spontaneous rate of cardiac differentiation of these progenitors which allows the prospective use of these cells for systemic delivery and in vivo transplantation. Whether this means that cardiac MABs represent newly discovered progenitors or that they represent a different developmental stage of a more undifferentiated cell type is at the moment difficult to establish. Indeed, the various cardiac progenitors so far isolated are characterized by a high phenotypic variability, possibly related to differences in isolation protocols and culture conditions. Upon differentiation, cardiac MABs often displayed spontaneous activity suggesting that at least a fraction of these cells become pacemaker myocytes, capable of self-generating action potentials. During normal cardiac development, progenitor cells committed to become mature pacemaker myocytes appear as early as at embryonic day E7.5 and then develop further to form the mature sinoatrial node (SAN) and conduction system [36]. The proper development and preservation of these structures is essential since mice lacking transcription factors specifically involved in the development of the SAN, present severe cardiac morphological and functional abnormalities (hypoplastic SAN and severe bradycardia) and die before birth [37,38]. As a means to identify sinoatrial-like MABs, we proceeded to first verify the expression of conduction tissue-specific markers, and then to characterize the electrophysiological properties of beating cells. Cardiac MABs express several factors involved in early cardiac differentiation (see also[10]); among these, factors such as ISL-1, TBX2, TBX3, GATA-6 are especially relevant to the development of the SAN and cardiac conduction system [2,3,14,15,17,39]. ISL-1 controls the differentiation of cells of the second heart field during heart development; ISL-1+ cells differentiate into many Fig. 4. Spontaneous activity of Md-PCs and expression of the funny current. (A) cardiac cell types and contribute significantly to the formation of Spontaneous pacemaker-like action potentials recorded from an Md-PC showing a clear the SAN [2,40]. It is important to note also that ISL-1+ cells persist as “diastolic” depolarization phase in the approximate range −65 to −55 mV. The cardiac precursors in the postnatal heart [13,41]. frequency in this cell calculated over a period of 30 s was 126 bpm. (B) If current traces TBX2 and its homologous TBX3 are transcriptional repressors recorded from the same cell during a protocol for measurement of the activation curve, consisting of hyperpolarizing steps from a holding potential of −35 mV to the range widely expressed in cardiac precursors. During development, TBX3 is −45/−125 mV, followed by a fully activating step to −125 mV (see Materials and expressed only in regions committed to form the SAN/conduction fi methods). (C) Mean If activation curve; individual curves (n=16 cells) were tted to system, and is downregulated elsewhere. Interestingly, ectopic the Boltzmann equation and averaged, and mean V1/2 and s parameters used to plot the expression of TBX3 can induce pacemaker properties in atrial best fitting curve (full line, values in text). (D) Mean voltage dependence of time myocytes [37]. constants of activation from n=14 cells. (E) Mean fully-activated I/V relation of If current density (normalized to cell capacitance) from n=6 cells; linear regression (full We used GATA-6, which marks the cardiac conduction system line) yielded a reversal potential of −17.5 mV and a conductance of 0.0327 mS/μF. [14,15,17], to identify a subpopulation of cardiac MABs genetically predisposed to become pacemaking cells. About 28% of undifferenti- ACh had the opposite action, indicating a negative shift of the ated and 30% of differentiated MABs expressed this transcription activation curve [35]. Mean shifts of the If activation curve were factor. Undifferentiated MABs were also transfected with a construct 6.0±0.5 mV (n=6) and −4.4±0.2 mV (n=5) for 1 μmol/L Iso and carrying the GFP gene under the cGATA-6 proximal enhancer. FACS 0.1 μmol/L ACh, respectively. analysis of transfected cells yielded a 27% of GFP-positive cells These data show that rate of electrically coupled Md-PCs can be confirming the presence of a viable subpopulation of GATA-6 positive modulated by autonomic agonists, implying that at this stage of cells (Supplementary video 1). The fact that the fraction of GATA-6+ differentiation, Md-PCs already possess the functional signal trans- cells is similar to that of differentiated MABs expressing the duction pathways necessary for a physiological control of heart rate. pacemaker current If (34.5%) or the HCN4 isoform (27%), confirms Expression of β-adrenergic and muscarinic receptors able to that about one third of all MABs are precursors committed to couple adrenergic and cholinergic transmitters to f- channels was differentiation towards a sinoatrial-like phenotype. verified by immunolocalization analysis. In Fig. S2A-C, single confocal Synchronous beating of cell agglomerates is possible only if cells sections from differentiated MABs show that β1 and β2 adrenergic are electrically coupled by gap junction-forming connexins. In the and M2 muscarinic receptors are all expressed. mammalian heart, the three most highly expressed connexin isoforms are Cx43, Cx45 and Cx40. Cx43 is widely expressed throughout the 4. Discussion heart; Cx40 is expressed abundantly throughout atria and the ventricular conduction system while Cx45 is highly expressed Cardiac MABs are vessel-associated clonogenic, self-renewable specifically in the SAN and conduction system [31–33]. We found by progenitor cells committed to cardiac differentiation [10]. When immunofluorescence analysis that differentiated cardiac MABs ex- cultured in low-serum medium, these cells differentiate into press both Cx43 and Cx45 (Figs. 2, 6) but not Cx40 (data not shown). cardiomyocytes that express typical cardiac ion channels [10]. While RT-PCR data indicate the presence of Cx43 (see Fig. 1), no Distinctive features of cardiac MABs, not previously described in staining was detected, in undifferentiated cells, for this or any of the other adult cardiac stem cells, are the co-expression of early above connexin isoforms, suggesting that Cx43 expression is either endothelial (CD34, CD31), pericyte (alkaline phosphatase, NG2, under the level of detection or is prevented by cellular mechanisms smooth α actin) and cardiac markers (Nkx2.5, GATA-4) and the controlling mRNA processing. A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423 421

Fig. 5. Expression of HCN isoforms in Md-PCs. (A–D) Single-section confocal images of Md-PCs labelled with anti-HCN1, HCN2, HCN3 and HCN4 antibodies, as indicated (green). (E–H) Higher magniﬁcation images of Md-PCs co-labeled with anti-HCNs antibodies and phalloidin or anti-myosin antibodies (red), to show sarcomeric structures. HCN1 and HCN2 stainings were never observed and the HCN3 signal was detected rarely. The HCN4 signal was strong and distributed in spots on cell membranes in a substantial fraction of cells analysed (39 out of 142). Bars 20 μm.

Along with the marker expression data discussed above, electro- immunostaining data on the expression of HCN isoforms, indicate that physiological analysis also provided evidence for sinoatrial-like HCN4 is the main isoform contributing to the If current in MD-PCs, properties in a subpopulation of cardiac MABs. with small or no contributions from the other HCN isoforms. A further Hallmarks of cardiac pacemaker myocytes from the SAN are action confirmation that Md-PCs represent a distinct peculiar population of potentials with a phase 4 depolarization, the lack of IK1 current and myocytes comes from capacitance data which clearly show that Md- the functional expression of the pacemaker current If [18,22,29].We PCs are significantly bigger than quiescent MABs (91.2 vs. 33.9 pF, found that single cells retaining rhythmic activity after enzymatic respectively). dissociation from differentiated MAB cultures (Md-PCs) are charac- The detailed analysis of HCN subunit distribution revealed that terized by SAN-like action potentials with a clear phase 4 depolariza- differentiated MABs express mostly HCN4, the predominant isoform tion (Fig. 4). A large fraction of spontaneously beating Md-PCs (68.3 %) in the SAN of several species [19,25–28,30]. Since HCN4 is expressed expressed the If current; furthermore, cells expressing If showed a very early during cardiac development/differentiation in the pro- significantly reduced IK1 current. Kinetic properties of If recorded in genitors which also express the transcription factors TBX3, ISL-1 and MD-PCs are similar to those of If recorded from ES cell-derived GATA-6 [3,17,36,40] and since our data show a strong correlation pacemaker-like cells [42] and from HCN4-transfected COS cells [43] between the expression of HCN4 and GATA-6, we can conclude that under similar experimental conditions; these data, together with the subpopulation of GATA-6+ MABs are effectively committed to 422 A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

Fig. 6. Sinoatrial-like features of Md-PCs. (A) Representative Md-PC showing coexpression of HCN4 (green) and GATA-6 (red). (B) Single-section image of Md-PCs labelled with the anti- Cx45 antibody (cyan). Staining was localized to the region of contact between adjacent cells; the sarcomeric structure was detected by phalloidin staining (red). In all panels nuclei were labelled with DAPI (blue). Bars, 20 μm. (C, D) Left panels show plots of membrane currents recorded upon application of a ramp protocol (see Materials and methods) before and during 2+ perfusion with 2 mmol/L Ba from a representative Md-PC expressing no If (C) and from one expressing If (D). Right panels show mean steady-state I–V relations of the Ba-sensitive inwardly rectifying current (IK1) obtained from n=10 If -laking (C) and n=5 If -expressing cells (D). Average data are plotted as mean±SEM values (dotted lines). acquire a sinoatrial-like phenotype, and upon differentiation express correspondingly accelerated the rate of spontaneously beating Md- molecular features typical of these cells. PCs, while muscarinic stimulation had the opposite effect on If and β-adrenergic receptors stimulation activated If by shifting the slowed spontaneous rate. These effects are analogous to those exerted current activation voltage-dependence to more positive voltages and by If-mediated autonomic modulation of SAN rate [18,22,34], and

Fig. 7. β- adrenergic and muscarinic cholinergic modulation of spontaneous activity and If in Md-PCs. (A, B) Action potentials (top panels) and If current (bottom panels) recorded from

Md-PCs before (solid line) and during superfusion of 1 μmol/L isoproterenol (A, dashed line) or 0.1 μmol/L acetylcholine (B, dashed line). (A) Lower panel: If was activated by a two-step protocol consisting of a 4.4 s step to −70 mV, activating approximately 50% of the current, followed by a 1-s step to −125 mV to activate the current fully. Iso increased If at −70 mV but decreased it at −125 mV, leaving unaltered the fully-activated current; this demonstrates that Iso activates If by shifting the activation curve to more positive voltages without modifying the If conductance [18,34]. (B) Lower panel: in the same cell, an identical protocol showed that ACh inhibits If by a negative shift of the activation curve [35]. A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423 423 suggest that Md-PCs possess the whole cellular machinery involved in [14] Davis DL, Edwards AV, Juraszek AL, Phelps A, Wessels A, Burch JB. A GATA-6 gene heart-region-specific enhancer provides a novel means to mark and probe a the physiological response of pacemaker channels to neurotransmit- discrete component of the mouse cardiac conduction system. Mech Dev ter stimulation. In agreement with this hypothesis, immunofluores- 2001;108:105–19. cence data confirmed the expression of β1-, β2- and muscarinic M2- [15] Adamo RF, Guay CL, Edwards AV, Wessels A, Burch JB. GATA-6 gene enhancer contains nested regulatory modules for primary myocardium and the embedded receptors on the membrane of Md-PCs (Fig. S2). nascent atrioventricular conduction system. Anat Rec A Discov Mol Cell Evol Biol In conclusion, vessel-derived mesoangioblasts represent the first 2004;280:1062–71. non-pluripotent stem/progenitor cell shown to differentiate into [16] He CZ, Burch JB. The chicken GATA-6 locus contains multiple control regions that fi different cardiac phenotypes; here in particular we have characterized confer distinct patterns of heart region-speci c expression in transgenic mouse embryos. J Biol Chem 1997;272:28550–6. a subpopulation of MABs (Md-PCs) which spontaneously differentiate [17] White SM, Claycomb WC. Embryonic stem cells form an organized, functional into sinoatrial-like myocytes. The expression of HCN channels under- cardiac conduction system in vitro. Am J Physiol, Heart Circ Physiol 2005;288: – lying spontaneous activity and the sensitivity to autonomic modulation H670 9. [18] DiFrancesco D, Ferroni A, Mazzanti M, Tromba C. Properties of the hyperpolariz- of rate are features especially suitable to a potential use of these cells as a ing-activated current (if) in cells isolated from the rabbit sino-atrial node. J Physiol substrate for developing biological pacemakers. However some ques- 1986;377:61–88. tions related to MD-PCs such as the possibility to isolate them from other [19] Barbuti A, Terragni B, Brioschi C, DiFrancesco D. Localization of f-channels to caveolae mediates specific beta2-adrenergic receptor modulation of rate in cardiomyocytes, the long-term stability of the MD-PCs phenotype and sinoatrial myocytes. J Mol Cell Cardiol 2007;42:71–8. the absence of proliferation after cell differentiation need further [20] Christoffels VM, Hoogaars WM, Tessari A, Clout DE, Moorman AF, Campione M. evaluation. Moreover, the possibility to isolate mesoangioblast from T-box transcription factor Tbx2 represses differentiation and formation of the cardiac chambers. Dev Dyn 2004;229:763–70. human heart biopsies is a required element for a prospective use of this [21] Christoffels VM, Mommersteeg MT, Trowe MO, Prall OW, Gier-de Vries C, Soufan cell substrate as a therapeutic tool. AT, et al. Formation of the venous pole of the heart from an Nkx2-5-negative precursor population requires Tbx18. Circ Res 2006;98:1555–63. [22] DiFrancesco D. Pacemaker mechanisms in cardiac tissue. Annu Rev Physiol Acknowledgments 1993;55:455–72. [23] Baruscotti M, Bucchi A, DiFrancesco D. Physiology and pharmacology of the The chicken GATA-6 (cGATA-6) proximal enhancer sequence was cardiac pacemaker ("funny") current. Pharmacol Ther 2005;107:59–79. kindly provided by Dr Burch, Fox Chase Cancer Center, Philadelphia, [24] Mangoni ME, Nargeot J. Properties of the hyperpolarization-activated current (I(f)) in isolated mouse sino-atrial cells. Cardiovasc Res 2001;52:51–64. PA. [25] Marionneau C, Couette B, Liu J, Li H, Mangoni ME, Nargeot J, et al. Specific pattern This work was supported by grants from Cariplo Foundation (1451/ of ionic channel gene expression associated with pacemaker activity in the mouse – 10.4878), EU (Normacor CT2006-018676) and MIUR (RBLA035A4X; heart. J Physiol 2005;562:223 34. [26] Shi W, Wymore R, Yu H, Wu J, Wymore RT, Pan Z, et al. Distribution and 2006055828) to DD, and from EU (Heart repair CT2005-018630), prevalence of hyperpolarization-activated cation channel (HCN) mRNA expres- Leducq Foundation and MIUR (2005058334) to GC. sion in cardiac tissues. Circ Res 1999;85:e1–6. [27] Liu J, Dobrzynski H, Yanni J, Boyett MR, Lei M. Organisation of the mouse sinoatrial node: structure and expression of HCN channels. Cardiovasc Res Appendix A. Supplementary data 2007;73:729–38. [28] Brioschi C, Micheloni S, Tellez JO, Pisoni G, Longhi R, Moroni P, et al. Distribution of Supplementary data associated with this article can be found, in the pacemaker HCN4 channel mRNA and protein in the rabbit sinoatrial node. J Mol Cell Cardiol 2009;47:221–7. the online version, at doi:10.1016/j.yjmcc.2009.10.006. [29] Irisawa H, Brown HF, Giles W. Cardiac pacemaking in the sinoatrial node. Physiol Rev 1993;73:197–227. [30] Yamamoto M, Dobrzynski H, Tellez J, Niwa R, Billeter R, Honjo H, et al. Extended References atrial conduction system characterised by the expression of the HCN4 channel and connexin45. Cardiovasc Res 2006;72:271–81. [1] Cheng G, Litchenberg WH, Cole GJ, Mikawa T, Thompson RP, Gourdie RG. [31] Dobrzynski H, Boyett MR. What do we learn from double Cx40/Cx45-deficient Development of the cardiac conduction system involves recruitment within a mice about cardiac morphogenetic defects and conduction abnormalities? J Mol multipotent cardiomyogenic lineage. Development 1999;126:5041–9. Cell Cardiol 2006;41:774–7. [2] Moretti A, Caron L, Nakano A, Lam JT, Bernshausen A, Chen Y, et al. Multipotent [32] Boyett MR, Inada S, Yoo S, Li J, Liu J, Tellez J, et al. Connexins in the sinoatrial and embryonic isl1+ progenitor cells lead to cardiac, smooth muscle, and endothelial atrioventricular nodes. Adv Cardiol 2006;42:175–97. cell diversification. Cell 2006;127:1151–65. [33] van Veen AA, van Rijen HV, Opthof T. Cardiac gap junction channels: modulation [3] Mommersteeg MT, Hoogaars WM, Prall OW, Gier-de Vries C, Wiese C, Clout DE, of expression and channel properties. Cardiovasc Res 2001;51:217–29. et al. Molecular pathway for the localized formation of the sinoatrial node. Circ Res [34] DiFrancesco D, Tortora P. Direct activation of cardiac pacemaker channels by 2007;100:354–62. intracellular cyclic AMP. Nature 1991;351:145–7. [4] Srivastava D, Ivey KN. Potential of stem-cell-based therapies for heart disease. [35] DiFrancesco D, Tromba C. Inhibition of the hyperpolarization-activated current Nature 2006;441:1097–9. (if) induced by acetylcholine in rabbit sino-atrial node myocytes. J Physiol [5] Hescheler J, Fleischmann BK, Lentini S, Maltsev VA, Rohwedel J, Wobus AM, et al. 1988;405:477–91. Embryonic stem cells: a model to study structural and functional properties in [36] Garcia-Frigola C, Shi Y, Evans SM. Expression of the hyperpolarization-activated cardiomyogenesis. Cardiovasc Res 1997;36:149–62. cyclic nucleotide-gated cation channel HCN4 during mouse heart development. [6] Kattman SJ, Adler ED, Keller GM. Specification of multipotential cardiovascular Gene Expr Patterns 2003;3:777–83. progenitor cells during embryonic stem cell differentiation and embryonic [37] Hoogaars WM, Engel A, Brons JF, Verkerk AO, de Lange FJ, Wong LY, et al. Tbx3 development. Trends Cardiovasc Med 2007;17:240–6. controls the sinoatrial node gene program and imposes pacemaker function on [7] Kajstura J, Urbanek K, Rota M, Bearzi C, Hosoda T, Bolli R, et al. Cardiac stem cells the atria. Genes Dev 2007;21:1098–112. and myocardial disease. J Mol Cell Cardiol 2008;45:505–13. [38] Espinoza-Lewis RA, Yu L, He F, Liu H, Tang R, Shi J, et al. Shox2 is essential for the [8] Minasi MG, Riminucci M, De Angelis L, Borello U, Berarducci B, Innocenzi A, et al. differentiation of cardiac pacemaker cells by repressing Nkx2-5. Dev Biol The mesoangioblast: a multipotent, self-renewing cell that originates from the 2009;327:376–85. dorsal aorta and differentiates into most mesodermal tissues. Development [39] Hoogaars WM, Tessari A, Moorman AF, de Boer PA, Hagoort J, Soufan AT, et al. The 2002;129:2773–83. transcriptional repressor Tbx3 delineates the developing central conduction [9] Dellavalle A, Sampaolesi M, Tonlorenzi R, Tagliafico E, Sacchetti B, Perani L, et al. system of the heart. Cardiovasc Res 2004;62:489–99. Pericytes of human skeletal muscle are myogenic precursors distinct from satellite [40] Sun Y, Liang X, Najafi N, Cass M, Lin L, Cai CL, et al. Islet 1 is expressed in distinct cells. Nat Cell Biol 2007;9:255–67. cardiovascular lineages, including pacemaker and coronary vascular cells. Dev Biol [10] Galvez BG, Sampaolesi M, Barbuti A, Crespi A, Covarello D, Brunelli S, et al. Cardiac 2007;304:286–96. mesoangioblasts are committed, self-renewable progenitors, associated with [41] Laugwitz KL, Moretti A, Lam J, Gruber P, Chen Y, Woodard S, et al. Postnatal isl1+ small vessels of juvenile mouse ventricle. Cell Death Differ 2008;15:1417–28. cardioblasts enter fully differentiated cardiomyocyte lineages. Nature 2005;433: [11] Boyett MR, Honjo H, Kodama I. The sinoatrial node, a heterogeneous pacemaker 647–53. structure. Cardiovasc Res 2000;47:658–87. [42] Barbuti A, Crespi A, Capilupo D, Mazzocchi N, Baruscotti M, DiFrancesco D. [12] Buckingham M, Meilhac S, Zaffran S. Building the mammalian heart from two Molecular composition and functional properties of f-channels in murine sources of myocardial cells. Nat Rev, Genet 2005;6:826–35. embryonic stem cell-derived pacemaker cells. J Mol Cell Cardiol 2009;46: [13] Cai CL, Liang X, Shi Y, Chu PH, Pfaff SL, Chen J, et al. Isl1 identifies a cardiac 343–51. progenitor population that proliferates prior to differentiation and contributes a [43] Ishii TM, Takano M, Ohmori H. Determinants of activation kinetics in mammalian majority of cells to the heart. Dev Cell 2003;5:877–89. hyperpolarization-activated cation channels. J Physiol 2001;537:93–100.