Oncolytic Virotherapy Blockade by Microglia and Macrophages Requires STAT1/3 Zahid M

Published OnlineFirst November 8, 2017; DOI: 10.1158/0008-5472.CAN-17-0599

Cancer Translational Science Research

Oncolytic Virotherapy Blockade by Microglia and Macrophages Requires STAT1/3 Zahid M. Delwar1,2,3, Yvonne Kuo1, Yan H. Wen1,4, Paul S. Rennie3, and William Jia1,2

Abstract

The first oncolytic virotherapy employing HSV-1 (oHSV-1) STAT1/3 was determined to be responsible for suppressing was approved recently by the FDA to treat cancer, but further oHSV-1 replication in macrophages/microglia. Treatment improvements in efficacy are needed to eradicate challenging with the oxindole/imidazole derivative C16 rescued oHSV-1 refractory tumors, such as glioblastomas (GBM). Microglia/ replication in microglia/macrophages by inhibiting STAT1/3 macrophages comprising approximately 40% of a GBM tumor activity. In the U87 xenograft model of GBM, C16 treatment may limit virotherapeutic efficacy. Here, we show these cells overcame the microglia/macrophage barrier, thereby facilitat- suppress oHSV-1 growth in gliomas by internalizing the virus ing tumor regression without causing a spread of the virus to through phagocytosis. Internalized virus remained capable of normal organs. Collectively, our results suggest a strategy to expressing reporter genes while viral replication was blocked. relieve a STAT1/3-dependent therapeutic barrier and enhance Macrophage/microglia formed a nonpermissive OV barrier, oHSV-1 oncolytic activity in GBM. preventing dissemination of oHSV-1 in the glioma mass. The Significance: These findings suggest a strategy to enhance the deficiency in viral replication in microglial cells was associated therapeutic efficacy of oncolytic virotherapy in glioblastoma. with silencing of particular viral genes. Phosphorylation of Cancer Res; 78(3); 718–30. 2017 AACR.

Introduction neurovirulent g34.5 or both (9–12). Despite their excellent safety profile, the clinical efficacy of many oHSV-1s has been disap- Oncolytic viruses (OV) have been used as a therapeutic arsenal pointing (13, 14). for specifically destroying cancer cells through oncolysis, a killing Among many possible factors, one important reason for this mechanism characterized by cancer cell lysis through the course of lack of efficacy can be attributed to heterogeneity among tumors. lytic virus replication (1). In addition to direct cell killing by the Clinically, the tumor bed has been observed to be highly hetero- virus, it has been demonstrated that a virally induced immune genetic at the cellular level, and a significant portion of cells in response plays a pivotal role in OV therapy (2). As OVs can kill tumor mass is nontumorous (15), which, by OV standards, makes cancer cells via a mechanism distinct from the killing effects of them resistant to OV replication. We termed these cells tumor- conventional chemotherapy and radiotherapy, these viruses may associated nonpermissive (TANP) cells. be ideal for treating cancers that are nonresponsive to conven- Microglia/macrophages are important innate immune cells tional treatment. Among the various OVs, those that are herpes in GBM and many other non-CNS tumors. They are probably simplex virus type I based are the furthest advanced. A herpes the most common nontumor cells among all types of cellular virus–based OV (T-Vec) was recently approved by the FDA for the infiltrates (15–18), comprising around 40% (range, 5%–78%) treatment of melanoma after a successful completion of clinical of the content of the total tumor mass (19, 20) for glioma. trials in North America (3, 4). Badie and Schartner have further verifiedthesourceof Glioblastoma multiforme (GBM) is a treatment-refractory microglia/macrophages in a rodent GBM model. They showed brain tumor with a poor prognosis (5). The most intensely that microglia/macrophages contribute up to 46% of the investigated oncolytic HSV-1 (oHSV-1) viruses for treating GBM cellular mass of a rodent GBM tumor, with up to 34% origi- are mutant HSV-1s with deletions in viral gene ICP6 (6–8) or þ nating from microglia (CD45 /CD11b cells) present in the brain since embryonic development and the remaining 12% 1Centre for Brain Health, University of British Columbia, Vancouver, Canada. originating from blood-derived macrophages (identified as þ þ 2Department of Surgery, University of British Columbia, Vancouver, Canada. CD45 /CD11b cells; ref. 21). 3 Department of Urologic Sciences, University of British Columbia, Vancouver, Tumor-associated microglia/macrophages play an important 4 Canada. Department of Ophthalmology, University of British Columbia, role in tumor progression (15–17, 22). There is a positive corre- Vancouver, Canada. lation between the number of microglia/macrophages and the Note: Supplementary data for this article are available at Cancer Research malignancy of the brain tumor. Malignant gliomas, such as Online (http://cancerres.aacrjournals.org/). glioblastomas and anaplastic gliomas, showed the largest number Corresponding Author: William Jia, Department of Surgery, University of British of mixed cell populations containing microglia/macrophages, Columbia, 2211 Wesbrook Mall, Vancouver, British Columbia V6T2B5, Canada. and low malignancy glial tumors contain fewer microglial cells Phone: 604-822-0728; Fax: 604-822-0361; E-mail: [email protected] (18). Regardless of the origin of macrophages in the tumor doi: 10.1158/0008-5472.CAN-17-0599 microenvironment, a large body of work has suggested that tumor 2017 American Association for Cancer Research. cells communicate with macrophages (15). Importantly, the

718 Cancer Res; 78(3) February 1, 2018

Oncolytic Virotherapy Inhibition by Microglia/Macrophages

communication has been shown to occur in both directions, in Reagents and cells that glioma cells attract macrophage infiltration, while macro- The NF-kB inhibitor, Bay-11, the imidazolo-oxindole deriv- phages promote glioma growth and metastasis (15, 17). ative C16, and the iNOS inhibitor, aminoguanidine hydrochlo- The abundant microglia/macrophages in human GBM com- ride were obtained from Santa Cruz Biotechnology, Millipore, promise the major component of TANP cells and contribute and Tocris Bioscience, respectively. U87 (human GBM) cells significantly to the poor efficacy of OVs. A previous study found and Vero (African green monkey kidney) cells were obtained that chemical ablation of microglia/macrophages subsequently from ATCC. BV2 (mouse microglia) cells were kindly provided enhances the antitumor effect of oHSV-1 in a glioma-bearing by Dr. Stephanie Booth, Department of Medical Microbiology rodent model (23). Even for some so-called "cold" tumors that and Infectious Diseases, University of Manitoba (Manitoba, do not have large number of macrophages in the tumor mass, Canada). All cells were maintained in DMEM supplemented oncolytic virotherapy often turns the tumor to "hot" with with 10% FBS and 1% antibiotics (penicillin and streptomy- significant macrophage infiltration as fast reacting innate cin). Total passages of the cells were less than 30 times, and they immune responses. Although those macrophages are probably were routinely tested for mycoplasma. However, cell lines were M1-type that are important in killing tumor cells as shown by a not authenticated in our hand. All cells were maintained at recent study (24), they are equally or more effective in clearing 37 Cin5%CO2. out the OVs to hinder the antitumor effectiveness of OV therapy. Virus replication assay As the most predominant TANP cells in GBM, a better under- G207 virus was obtained from NeuroVir Therapeutics Inc. U87 standing of this interaction is essential for the development of (5 104) cells alone, or with the indicated number of microglia novel strategies for oncolytic virotherapy against GBM and other cells in coculture, were incubated overnight with culture medium solid tumors. This report addresses the mechanism and effect of (DMEM with 10% FBS and 1% antibiotics). The next day, cells – microglia/macrophages in response to oHSV-1 infected human were infected with G207 virus at a multiplicity of infection (MOI) glioblastoma and prostate cancer cells. We hypothesized that, of 1. Viruses were harvested after 2 to 4 days postinfection. After by modifying the cellular activity of tumor-associated microglia/ three freeze-thaw cycles, viruses were titrated in triplicate on Vero fi macrophages, we might enhance the ef cacy of oHSV-1 in GBM. cells by a standard plaque assay on 12-well plates. Indeed, we found that the presence of microglia/macrophages is sufficient to hinder oHSV-1 replication in glioma cells. Our findings suggest that microglia impede the dissemination of Phagocytosis assay oHSV-1 among glioma cells mainly by uptaking oHSV-1 The phagocytosis assay was performed according to the through phagocytosis. Furthermore, although oHSV-1 fails to manufacturer's protocol (Phagocytosis Assay Kit, Cayman fl replicate in microglia/macrophages, some transgenes carried by Chemical). Brie y, microglia cells in wells of a 24-well plate the virus can still be expressed. We further found that phos- were infected with G207 or vehicle at an MOI of 1, and a 10% phorylation of STAT-1 and 3 are critical for inhibition of viral latex bead-rabbit IgG-FITC solution was added to each well. At replication in microglia/macrophages. We then discovered that 1 hour postinfection, cells were washed three times with PBS. C16, an oxindole/imidazole derivative (25), selectively inhibits After 24 hours, cells were incubated with Trypan blue solution fi the phosphorylation of STAT-1 and 3 to allow viral replication in for 2 minutes to quench nonspeci c staining. After washing tumor-associated macrophages, thereby increasing viral dissem- twice, cells were lysed using 1 lysis reagent (Promega). Fluo- ination and tumor destruction in a subcutaneous mouse glioma rescence intensity was measured in a plate reader (Envision model. 2103 Multilabel reader, PerkinElmer) using an excitation of 485 nm and an emission of 535 nm. Virus and IgG latex bead interactions were detected by coin- Materials and Methods cubating cells with either vehicle or 1%, 10%, or 20% IgG latex Microglia isolation and culture beads and G207 (MOI:1). After 24 hours of coincubation, cells E18 Sprague-Dawley rats were obtained from Charles River were incubated overnight with 1 mg/mL X-gal solution (Sigma) Laboratories. Rat primary microglia isolation and culture was for LacZ staining. Cells were counterstained with DAPI to quantify conducted according to the standard protocol (26). In brief, the total number of cells in each microscopic field. Stained cells cortices were isolated from day 18 embryonic E18 Sprague-Daw- were then visualized and imaged by using a light microscope ley rat brains. After a 30-minute incubation in trypsin/EDTA (magnification, 20). LacZ-positive cells and DAPI-stained cells (Invitrogen), harvested tissue was washed with culture medium were manually quantified. Data represented the ratio of the and minced in the presence of DNase I (Invitrogen). The cell number of LacZ-positive cells to the total number of cells in each suspension was then centrifuged, resuspended in fresh culture image (n ¼ 5). medium, and plated on 10-cm culture dishes to high confluence. Microglia cells were grown in DMEM (Sigma) supplemented with Cell-conditioned medium collection and treatment 10% FBS (Invitrogen) and 1% antibiotics (penicillin and strep- For collecting the cell-conditioned medium, U87 (5 104), 4 4 tomycin) and maintained at 37 Cin5%CO2. The culture microglia (5 10 ), or a U87 þ microglia coculture (5 10 þ medium was changed every 3 to 4 days. After 7 to 10 days, 5 104) were incubated in cell culture medium for 24 hours in a microglia were harvested by gently rocking the plate a few times. 24-well plate. To examine the effect of cell-conditioned medium Finally, microglia floating in the supernatant were plated on a on G207 growth, previously collected conditioned medium poly-L-lysine–coated plate. Cell purity was routinely tested by (50%) was added to U87 (5 104) cells (seeded on a 24-well immunocytochemistry staining for ITGAM (1:200; ProSci Inc.), plate) and then infected with G207. Viruses were harvested 3 days which is a microglia-specific integrin protein. postinfection and titrated by a plaque assay on Vero cells.

www.aacrjournals.org Cancer Res; 78(3) February 1, 2018 719

Delwar et al.

Western blots for overnight at 37C. Cell viability was measured at 595 nm Total protein was harvested with sample buffer (125 mmol/L using a plate reader (Envision 2103 Multilabel reader, Tris-HCL, 50% glycerol, 4% bromophenol blue, and 5% 2- PerkinElmer). mercaptoethanol) and boiled for 5 minutes. Protein samples weresubjectedtoSDS-PAGE(8%gel),transferredtonitrocel- U87 xenograft model lulose membranes, and blocked with 5% nonfat milk (Bio-Rad) Female athymic nude mice 5 to 6 weeks old were obtained in TBS-Tween 20 (TBS-T) for 1 hour at room temperature. The from Harlon Laboratories. Human glioma U87 cells were membranes were then incubated with primary antibody (anti– implanted subcutaneously into the lower flank. When b-actin 1:1,000; Cell Signaling Technology or anti-STAT1 the tumor size reached approximately 75 to 100 mm3, 1:1,000; Cell Signaling Technology, anti-STAT3 1:1,000; Cell vehicle or C16 (5 mg/kg) was administered intraperitoneally. Signaling Technology, anti–phospho-STAT1 (Tyr701) 1:1,000; At 2 to 4 days after the initial C16 administration, the Cell Signaling Technology, anti–phospho-STAT3 (Tyr705) vehicle or oHSV-1 was injected intratumorally. Tumor 1:1,500; Cell Signaling Technology, anti–phosphor-eIF2a volumes were then measured using a caliper (height (ser51) 1:1,000; Cell Signaling Technology, anti-ICP27 length width/2). At the end of the experiment, mice were 1:1,000; Abcam, or anti-ICP4 1:750; Abcam) overnight at 4C. euthanized by CO asphyxiation. All in vivo procedures were The following day, membranes were washed three times with 2 approved by the UBC Animal Care Committee and per- TBS-T and incubated with the corresponding secondary anti- formed according to the guidelines of the Canadian Council body (1:3,000; PerkinElmer) for one hour at room tempera- on Animal Care. ture. Membranes were washed three times with TBS-T before visualization using ECL reagent (PerkinElmer) and a VersaDoc imaging system (Bio-Rad). Band densities were measured using Tissue DNA extraction and qPCR ImageJ software (NIH, Bethesda, MD). DNA was extracted from 4% paraformaldehyde-fixed tumor tissues using an EZNA Tissue DNA Kit (Omega Bio-tek). RNA extraction and RT-PCR Extracted DNAs were subjected to qPCR analysis using Sybr Green Master Mix (Invitrogen) supplemented with ICP27 U87 and BV2 microglia cells were infected with oHSV-1 at an 0 0 MOI of 1. Total RNA was isolated 24 hours postinfection from primers: 5 -GTCTGGCGGACATTAAGGACA-3 (forward) and 50-TGGCCAGAATGACAAACACG-30 (reverse); and b-actin pri- BV2 or U87 cells using TRIzol reagent (Invitrogen). RT-PCR was 0 0 0 performed by a one-step real time PCR using KAPA SYBR FAST mers: 5 -ACGAGGCCCAGAGCAAGAG-3 (forward) and 5 - 0 fi One-Step qRT-PCR Universal (D-MARK Biosciences) following TCTCCATGTCGTCCCAGTTG-3 (reverse). Ampli cation was the manufacturer's protocol. cDNA was amplified with the fol- carried out using a Quant Studio 6 Flex qPCR system (Applied lowing primers. ICP4: 50-GGCCTGCTTCCGGATCTC-30 (forward) Biosystems). and 50-GGTGATGAAGGAGCTGCTGTT-30 (reverse); ICP27: 50- 0 0 GTCTGGCGGACATTAAGGACA-3 (forward) and 5 -TGGCCA- IHC 0 0 GAATGACAAACACG-3 (reverse); b-actin: 5 -ACGAGGCCCA- Harvested tumor tissues were fixed for 24 hours with 4% 0 0 GAGCAAGAG-3 (forward) and 5 -TCTCCATGTCGTCCCAG- paraformaldehyde, followed by 72-hour incubation with 30% 0 0 0 TTG-3 (reverse); ICP8: 5 -GCGCCCCATGGTCGTGTT-3 (for- sucrose. Tissues were then embedded in OCT (Sakura Tissue 0 0 0 ward) and 5 -CTCCGCCGCCGAGGTTC-3 (reverse); GC: 5 - Tek), sectioned (20 mm) using a cryostat (Leica CM 3050 S), 0 0 GCCGCCGCCTACTACCC-3 (forward) and 5 -GCTGCCGCGA- and placed on Fisherbrand Superfrost Plus microscope slides 0 0 CTGTGATG-3 (reverse); VP5: 5 - TGAACCCCAGCCCCAGAA- (Thermo Fisher Scientific). Slides were then washed with PBS, 0 0 0 ACC 3 (forward) and 5 - CGAGTAAACCATGTTAAGGACC 3 and cells were permeabilized with 0.125% Triton X-100 for 5 DDC (reverse). Results were expressed as 2 t. minutes, and incubated with 5% goat serum (Santa Cruz Biotechnology) for an hour to block nonspecific binding. Cells b-Galactosidase staining were then incubated overnight at 4 C with either anti–HSV-1 Cells plated onto 8-well chamber slides were infected with antibody (1:50; Abcam) or anti F4/80 antibodies (1:50; G207 virus, and mock-infected cells were used as a control. Abcam). On the following day, sections were washed three Twenty-four hours postinfection, cells were fixed with 0.5% times and then incubated with either goat anti-rabbit IgG Alexa glutaraldehyde solution. Fixed cells were washed twice with PBS Fluor 488 or goat anti-rat IgG Alexa Fluor 568 secondary and then incubated with 1 mg/mL X-gal solution (Sigma) diluted antibody (1:500; Invitrogen) for an hour at room temperature. with X-gal staining solution (5 mmol/L K3Fe, 5 mmol/L K4Fe and After washing three times, sections were then mounted with 2 mmol/L MgCl2)at37C for 1 hour. Stained cells were then DAPI Fluoromount G (Electron Microscopy Sciences) and visualized and imaged by a light microscope. visualized and imaged by using a confocal microscope (Olympus). Cell proliferation assay Cells were seeded in a 96-well plate at a density of 1 104 Statistical analysis (U87). After an overnight incubation, cells were treated Statistical analysis was performed with SPSS 18 or Micro- with vehicle only, viruses with a specified MOI. After 3 days soft Excel, and significance (P < 0.05) was determined using of treatment, cell viability was measured by means of an an independent sample t test, or significance at P < 0.001, MTT assay (Sigma) following the manufacturer's instructions. P < 0.01, or P < 0.05 was determined using a two-tailed In brief, cells were incubated with the MTT solution for Student t test, respectively. Data were expressed as means 3 hours at 37C and were then incubated with lysis buffer SD or SE.

720 Cancer Res; 78(3) February 1, 2018 Cancer Research

Oncolytic Virotherapy Inhibition by Microglia/Macrophages

Figure 1. The presence of microglia in GBM culture suppresses viral growth and the oncolytic capacity of oHSV-1. A, The growth of G207 in U87 cells was determined by a single-step assay. B, The cytotoxic effect of G207 in U87 cells was measured by an MTT cell proliferation assay at 3 days postinfection. C, To study the effect of microglia on G207 growth in U87 (5 104) cells alone as well as in U87 (5 104) in combination with different numbers of primary rat microglia (MG), the cells were infected with G207 at an MOI of 1. D, U87 (5 104) cells alone and a U87 (5 104) þ microglia (5 104) coculture were infected at an MOI of 1 with ICP6 gene-mutated oHSV-1, HrR3, TK-deleted oHSV-1, b17-TK, or wild-type HSV-1 KOS. Virus replication efﬁciency was determined using a single-step virus growth assay at 4 days postinfection. Data are reported as means SD.

Results Microglia form a barrier to prevent oHSV-1 dissemination The presence of microglia hinders the oncolytic efficacy of To understand the mechanism of microglia-mediated suppres- oHSV-1 against U87 cells sion of oHSV-1 oncolysis of glioma cells, we first asked whether The efficiency of G207 replication in U87 cells was determined the microglia-mediated inhibition of viral production in U87 cells by a one-step viral growth assay (Fig. 1A). The antiproliferative could be caused by products secreted by microglia. To answer this effect of G207 was evaluated by means of an MTT assay. A dose- question, we measured G207 production in U87 cells cultured dependent antiproliferative effect was observed, and the IC50 for with conditioned medium from microglia cultures. To our sur- G207 at MOI ¼ 1 was determined after 72 hours of infection (Fig. prise, neither microglia nor microglia–glioma coculture condi- 1B). Our results confirmed that G207 can effectively replicate and tioned medium showed any inhibition of viral production (Fig. lyse U87 cells. 2A). Moreover, conditioned medium from oHSV-1–infected We then measured the growth of G207 in U87 cells in the microglia (virus-free) had no effect on virus replication in glioma presence of different numbers of microglia cells. The addition of cells (Supplementary Fig. S2). In addition, a noncytotoxic dose of microglial to U87 culture inhibited G207 replication in a "dose"- nitric oxide also did not have any anti–HSV-1 effect (Supplemen- dependent manner. G207 replication was reduced by 50% and tary Fig. S3). almost 100% with the addition of 6.25 103 and 1 105 We next asked whether oHSV-1 can infect and replicate in microglial cells to U87 (5 104) cultures, respectively (Fig. microglia cells. Both rodent primary cultured microglial cells and 1C). To further confirm that microglia-mediated oHSV-1 growth BV2 microglia infected with G207 showed LacZ staining, indi- suppression is not strain specific, we tested different HSV-1 strains, cating that the virus can enter the cell and express the reporter gene including HrR3 (ICP6 mutated), b17-TK (a TK mutant), and KOS carried by the virus (27) (Fig. 2B). Concentration-dependent HSV- (wild type) and observed similar inhibition of viral replication 1 infection in microglial cells was also observed with GFP-expres- among all HSV-1 strains tested (Fig. 1D). Moreover, we observed sing UL5354 virus, an ICP27 nonfunctional HSV-1 that is repli- that oHSV-1 trigger classical activation (M1 polarization) of cation deficient but expresses the GFP reporter gene (Supplemen- microglial cells (Supplementary Fig. S1). tary Fig. S4).

www.aacrjournals.org Cancer Res; 78(3) February 1, 2018 721

Delwar et al.

722 Cancer Res; 78(3) February 1, 2018 Cancer Research

Oncolytic Virotherapy Inhibition by Microglia/Macrophages

As previous studies reported that HSV-1 gains entry into corneal guanidine hydrochloride upregulated expression of ICP4 and fibroblasts (28) and ocular cells (29) through a phagocytosis-like ICP27 by 1.8- and 25-fold, respectively (Fig. 3B). To verify that uptake, we then examined whether G207 can also gain entry into C16-mediated viral gene transcriptional augmentation is not due microglia through this form of uptake as microglia/macrophages to the double deletion of ICP34.5 and ICP6 in G207, we then are well known for their phagocytic capability. Accordingly, we assessed the effect of C16 on wild-type (KOS), and ICP6-mutated measured phagocytic activity of the microglia in the presence of (HrR3) HSV-1–infected BV2 cells. C16 treatment also upregulated G207. Interestingly, the results of the phagocytosis assay using IgG ICP4 and ICP27 expression in KOS and HrR3-infected BV2 cells latex beads (Phagocytosis Assay Kit, Cayman Chemical) demon- (Fig. 3C). In agreement with the result, treatment with 1 and 10 strated that the capacity of microglia to engulf the beads by mmol/L C16 significantly enhanced the replication by 9 and 8 phagocytosis was significantly reduced in the presence of times, respectively (Fig. 3D). G207. The addition of G207 at a MOI of 0.1 and 1 hindered the Finally, we asked whether C16 can overcome the microglia- phagocytosis of IgG latex beads by 20% and 60%, respectively mediated suppression of viral replication in glioma cells. As (Fig. 2C, I). Similar dose-dependent phagocytosis hindrance was shown in Fig. 3E, oHSV-1 viral replication increased by 33% in observed in BV2 microglia cells as well (Fig. 2C, II). As one the glioma–microglia cocultures treated with C16. However, C16 possible explanation is that G207 and IgG latex beads may did not enhance oHSV-1 replication in U87 glioma cultures alone compete with each other in phagocytosis, we measured virally (Supplementary Fig. S5). infected microglia in the presence of an excessive amount of IgG latex beads. The latex beads caused a reduction in the number of C16 rescues oHSV-1 in microglial cells by inhibiting STAT1 and G207 "infected" microglial cells in a concentration-dependent 3 activity fashion (Fig. 2D). Thus, it appears that oHSV-1 entered the As part of an effort to understand the mechanism of C16 in microglia via the same phagocytotic mechanism as the IgG beads. facilitating viral replication in microglia/macrophages, we first It is worth noting that when BV2 cells were pretreated with G207 looked at the activity level of phosphorylated eIF2a in oHSV-1– and an hour later, were then treated with IgG latex, the uptake of infected BV2 cells, as C16 was reported to be a PKR inhibitor IgG latex beads was significantly increased, suggesting that the (25, 30). To our surprise, there was no change in the phosphor- virus may stimulate the phagocytic activity of these cells (Fig. 2E). ylated eIF2a status in C16-treated microglia at the concentrations Interestingly, the result of the viral growth assay in primary used (Fig. 4A). We then examined activities of STAT1 and STAT3 in cultured rat microglial cells (Fig. 2F, I) and BV2 cells (Fig. 2F, II) BV2 microglia with and without G207 infection. G207 upregu- demonstrated that G207 failed to produce its progeny in the lated phosphorylation of STAT1 (Tyr701) and STAT3 (Tyr705) in microglia. These results suggest that microglia internalized the microglia cells (Fig. 4A), which was significantly suppressed by viruses through a phagocytosis-like uptake but did not allow viral C16. The overall expression level of STAT1 but not STAT3 was replication. upregulated in G207-infected microglial cells, and that level was also reduced after C16 treatment. The C16-induced inhibition of C16 overcomes the microglia-mediated oHSV-1 replication STAT1/3 phosphorylation was also confirmed in LPS-stimulated barrier microglia (Fig. 4B). To further understand the molecular processes by which HSV-1 replication is prevented in microglia, we measured transcript C16 selectively facilitates oHSV-1 replication in glioma levels of a panel of viral genes in glioma (U87) and microglial xenografts by overcoming barriers of tumor-associated (BV2) cells. The viral genes included ICP4, ICP27, ICP8, VP5, and macrophages glycoprotein C (gC), representing immediate early, early, and late To demonstrate that the effect of C16 described above can be genes, respectively. Quantitative RT-PCR results showed that translated into the enhanced efficacy of intratumoral replication transcription of ICP27, ICP8, VP5, and gC but not ICP4 was of oHSV in vivo, C16 was intraperitoneally injected into animals significantly suppressed in BV2 cells compared with U87 cells bearing subcutaneously implanted U87 tumors that received (Fig. 3A). G207 intratumorally. Administration of C16 significantly To understand the events in intracellular signaling that inhibit enhanced the oHSV-1 titer in the tumor mass (Fig. 5A). IHC viral gene expression in G207-stimulated microglia, we tested the demonstrated an increased number of cells harboring replicating effects of a PKR inhibitor (C16), an NF-kB inhibitor (Bay11) and HSV-1 in animals cotreated with oHSV-1 and 5 mg/kg C16 an iNOS inhibitor (AG) on viral immediate early ICP27 and ICP4 compared with those treated with oHSV-1 alone. Furthermore, gene expression in BV2 cells. C16 but neither Bay11 nor amino- numerous cells with colocalization of HSV-1 and macrophage

Figure 2. oHSV-1s are capable of infecting microglia, but are unable to replicate. A, Conditioned medium was collected from U87, microglia (MG), and coculture (U þ M) cell culture supernatants. U87 cells were infected with G207 at an MOI of 1 in the conditioned media above. Viruses were harvested 72 hours postinfection and titrated on Vero cells. B, Rat primary microglia (MG) or BV2 microglia cells were infected with G207 virus at an MOI of 3 or with mock preparations. To detect viral reporter gene expression, cells were stained for b-galactosidase (arrow) after 24 hours of infection. C, Primary cultured microglia (I) or BV2 microglia (II) were infected with a mock preparation or with oHSV-1 (G207) virus at the indicated MOI in the presence of a 10% latex bead-rabbit IgG-FITC solution. Phagocytosis was measured on a fluorescence plate reader after 24 hours of incubation. D, Microglial cells were incubated with G207 at an MOI of 1 with vehicle or the indicated concentration of latex bead-IgG-FITC solution. Cells were stained with b-galactosidase after 24 hours of treatment to examine virus entry. LacZ-positive cells were quantified from 5 randomly selected fields using a light microscope (means SD). E, BV2 microglial cells were infected with a mock preparation or G207 with the indicated MOI. After 1 hour, postinfected cells were washed three times with PBS and then incubated with a 10% latex bead-rabbit IgG-FITC solution. After 24 hours of treatment, the degree of phagocytosis was measured on a fluorescence plate reader. F, MG (I) or BV2 (II) microglia were infected with G207 at an MOI of 1 to study the replication capacity of G207. Viruses were harvested at 24, 48, and 72 hours postinfection and then titrated on Vero cells.

www.aacrjournals.org Cancer Res; 78(3) February 1, 2018 723

Delwar et al.

Figure 3. Mechanism of oHSV-1 replication blockade in microglial cells. A, The mRNA levels of different genes of the G207 virus (ICP4, ICP27, ICP8, VP5, and GC) were measured by qRT-PCR. Ratios of the relative mRNA level C (2 DD t) of oHSV-1 (G207)-infected BV2 and U87 cells (BV2/U87) are shown. B, BV2 cells were pretreated with the indicated chemical compounds for 1 to 2 hours and then infected with oHSV-1 (G207) at an MOI of 1. Total proteins were harvested at 24 hours posttreatment. C, BV2 cells were pretreated with vehicle or 1 mmol/L of C16 for 1 to 2 hours and then infected with either KOS or HrR3 virus in the presence of C16. Total proteins were harvested at 24 hours posttreatment and ICP27, ICP4, and b-actin expression was measured by Western blot assay (B and C). D, BV2 cells were pretreated with vehicle or indicated concentration of C16 for 1 to 2 hours and then infected with oHSV-1 (G2O7). Viruses were harvested after 48 hours of treatment with this combination and titrated on Vero cells. E, U87 and MG cocultures were pretreated with 0.5 mmol/L of C16 for 1 hour and then infected with oHSV-1 (G207) at an MOI of 1. After 48 hours of treatment with this combination, viruses were harvested and titrated by a plaque-forming assay on Vero cells.

724 Cancer Res; 78(3) February 1, 2018 Cancer Research

Oncolytic Virotherapy Inhibition by Microglia/Macrophages

Figure 4. C16 inhibits STAT 1 and 3 phosphorylation. A, BV2 cells were pretreated with vehicle or C16 (1 mmol/L) for 2 hours and then incubated with vehicle or oHSV-1 (G2O7) at an MOI of 1 or with the oHSV-1 and C16 combination for 24 hours. B, BV2 cells were treated with either vehicle or LPS (1 mg/mL) alone or a combination of LPS (1 mg/mL) and C16 (1 mmol/L) for 24 hours. Total protein was harvested and subjected to a Western blot assay. b-Actin expression was used for a loading control (means SE).

markers (F4/80) were seen in animals cotreated with oHSV-1 and cation, albeit the same number of microglia is sufficient to C16 but not oHSV-1 alone, indicating increased viral replication suppress viral replication when cocultured with glioma cells. As in the macrophages after C16 treatment (Fig. 5B). we do not know the concentrations and stability of the factors released by microglia in the tumor mass, we cannot rule out the possible antiviral effect of these soluble proinflammatory med- C16 significantly improves human glioma xenograft regression iators in vivo as suggested by Meisen and colleagues (36). with a good safety profile Our data suggest that the microglia phagocytosis pathway Finally, we asked whether C16-mediated facilitation of may play a major role in the clearance of oHSV-1. More oHSV-1 replication in a tumor is capable of augmenting anti- importantly, oHSV-1 entering macrophages/microglia via this tumor oncolysis. Indeed, tumors in animals treated with C16 pathway were unable to replicate. Therefore, macrophages/ (5 mg/kg) and the oHSV-1 combination were 9.3-, 8.2-, and 6- microglia form a physical barrier that can effectively block fold smaller than those treated with the vehicle, C16 alone, or dissemination of OVs within the tumor mass. Furthermore, we oHSV-1 alone, respectively (Fig. 6A). Furthermore, qPCR virus also found that upon viral infection, the phagocytotic activity of copy numbers in the liver, brain, and gastrointestinal tract were microglia was enhanced. virtually undetectable, demonstrating that viral replication was Our gene expression profiling of microglial cells infected by restricted to the tumors only without spreading to normal oHSV-1 demonstrated that expression of the immediate early organs (Fig. 6B). ICP27 gene, the early ICP8 gene, and the late VP5 and gC genes carried by HSV-1 are significantly decreased in microglia. Down- Discussion regulation of early and late genes, such as ICP8 (37) and gC (38), In this study, we demonstrated that the presence of microglia/ might be the result of the silence of the immediate early gene macrophages impedes oHSV-1 oncolytic replication in GBM cells. ICP27 that is required for viral DNA synthesis and late gene This finding is consistent with previous reports that inhibition of expression (37, 39). However, although the silence of ICP27 is the innate immune response enhances the efficacy of oncolytic necessary, it is not sufficient for blocking HSV replication in viruses (31–34). microglia as restoring ICP27 expression by transfecting an exog- As microglia/macrophages release a wide array of proinflam- enous copy of ICP27 could not rescue viral replication (Supple- matory mediators, including nitrogen intermediates, cytokines, mentary Fig. S6). and chemokines, in response to pathogen stimulation (35), one Interestingly, some viral genes such as ICP4 and virally carried may expect that these cells would inhibit OV replication by exogenous genes such as lacZ or GFP reporter can still be expressed releasing these factors (36). Surprisingly, we did not find that after oHSV is taken up by microglia/macrophages. These findings microglia-conditioned medium had any effect on oHSV-1 repli- suggest that HSV-1 can potentially target microglia/macrophages

www.aacrjournals.org Cancer Res; 78(3) February 1, 2018 725

Delwar et al.

Figure 5. C16 triggers oHSV-1 protein expression in microglia/macrophages and enhances virus concentration in glioblastomas in vivo. A, U87 xenograft mice were treated with vehicle or 5 mg/kg of C16 with or without 6 106 PFU oHSV-1 (G207) viruses. Two doses of G207 or vehicle and four doses (every 3 or 4 days) of C16 were administered. Tumors were harvested at day 13 posttreatment. Total genomic DNA was extracted from the harvested tumors (n ¼ 2), and viral DNA C (ICP27) was measured by qPCR (normalized to b-actin). Data shown are relative 2 DD t values SE. B, Inﬁltrated macrophages (F4/80) and replicable viruses (HSV-1) were detected in U87 tumors by immunostaining.

to express therapeutic genes that may modify the tumor blockage of viral replication in microglia/macrophages for the microenvironment. following reasons: (i) the inhibition of viral gene expression It is well known that the IFN-inducible, dsRNA-dependent occurred at the transcriptional level; (ii) C16 enhanced viral protein kinase, PKR, plays a key role in the innate immunity replication in all viral strains tested regardless of their g34.5 status response to viral infection (40). After infection with HSV-1, (43, 44); (iii) in agreement with previous studies, we also normal host cells activate PKR, thereby shutting down protein observed inhibition of eIF-2a phosphorylation by C16 in primary synthesis through inactivating eukaryotic initiation factor-2 (eIF- astrocytes (25, 30); however, no change was seen in microglia or 2a) via increased phosphorylation. It is also known that g34.5 of glioma cells (Supplementary Fig. S7), suggesting that C16 has a HSV-1 counteracts PKR and IFN-mediated antiviral activity (41) possible cell-type speciﬁcity in terms of eIF-2a phosphorylation by recruiting the cellular protein phosphatase 1a, which reverses inhibition. Instead, we found that C16 signiﬁcantly inhibited PKR-mediated phosphorylation of eIF2a (41, 42). Originally, we phosphorylation of STAT1/3 in oHSV-1–infected microglia/ thought that inhibition of viral protein synthesis might be attrib- macrophages and thereby rescued the replication of oHSV-1. utable to eIF2a-mediated blockage of protein synthesis, which led More interestingly, inhibition of STAT1/3 phosphorylation by us to the use of the oxindole/imidazole derivative C16, a known C16 was only evident in oHSV-1–infected cells and not in mock- PKR inhibitor (25, 30). However, subsequent results indicated infected cells. Previously, C16 was reported to inhibit three that activation of PKR is unlikely to be the mechanism behind the dormant host fucosyltransferase genes (FUT3, FUT5, and FUT6)

726 Cancer Res; 78(3) February 1, 2018 Cancer Research

Oncolytic Virotherapy Inhibition by Microglia/Macrophages

Figure 6. C16 increases the oncolytic efficacy of oHSV-1 in vivo. A, U87 xenograft mice were treated with vehicle or 5 mg/kg of C16 with or without a single dose of 1 108 PFU oHSV-1 (HrR3) viruses (n ¼ 5). Multiple doses of vehicle or C16 were injected intraperitoneally on alternate days. Tumor volumes were measured using a caliper (height length width/2). In the figure, , significant (P 0.05) tumor regression with the oHSV-1 and C16 combination versus vehicle or C16 alone or oHSV-1 alone (SE). B, Tumors and other organs were harvested once the animals had reached the endpoint, and total genomic DNA was extracted from the harvested organs (n ¼ 3). Viral DNA (ICP27) was measured using qPCR (normalized to b-actin). Data shown are C relative 2 DD t values SE.

expression in wild-type HSV-1–infected human diploid embry- data demonstrated enhanced oHSV-1 replication in microglia/ onic lung fibroblasts, which thereby stimulated HSV-1–induced macrophages upon C16-mediated inhibition of STAT1 and expression of sialyl Lewis X independently to PKR-stimulated STAT3. However, C16-mediated virus replication enhancement translation inhibition (45). Interestingly, they also observed that was only evident in microglia/macrophages and not in glioma C16 treatment in HSV-1–infected cell reduced IL6 production, cells. In agreement with our findings, functions of both STAT1 and which is one of the main cytokine to activate STAT signaling. STAT STAT3 were reported to be cell-type specific (53, 54). Shin and blockade effect of C16 observed in our study might be the colleagues have demonstrated that HSV-1–mediated countermea- outcome of C16-mediated inhibition of IL6 (45). sures against IFN are ineffective in monocytes (54). Apparently, STATs are well known for their antimycobacterial and antiviral the STAT1 pathway is more functional in monocytes and macro- effects (46–48). Among the different members of the STAT family, phages. As ICP27 plays a vital role in countering the cellular IFN STAT1 is the most known for regulating the antiviral IFN signaling response (41, 55), silencing ICP27 by STAT1/3 may render HSV-1 cascade (49), and IFN has in turn been reported to inhibit HSV-1 ineffective in evading the intracellular antiviral mechanism within (50). As expected, elevated STAT1 phosphorylation was observed microglia/macrophages. in oHSV-1–infected microglia/macrophages, which might have Our in vivo data using a U87 human glioma xenograft model been the consequence of the cellular defense against the viral also confirmed that C16 rescued oHSV-1 gene expression in infection. tumor-infiltrating macrophages and augmented the oHSV-1 viral We found that the phosphorylation of STAT3 was also upre- load in the tumor mass. As the permeability of blood–brain gulated in oHSV-1–infected microglia/macrophages. STAT3 is barrier to C16 is not known, we did not use intracranial glioma another member of the STAT family that is known for its onco- model in the current study. However, both brain-resident micro- genic function, tumor cell proliferation, survival, and invasion glia and peripheral macrophages are abundant in intracerebral (51). Inhibition of STAT-3 activity induces cell death mediated by tumor (19, 21), and their function is almost identical (15). To apoptosis (52). The role of STAT3 in HSV-1 infection is not clearly further demonstrate that the effect of C16 is mainly on macro- understood. In fact, there have been no studies on the role of phage/microglia but not tumor type specific, we used a human STAT3 in the antiviral function of microglia/macrophages. Our prostate cancer LNCaP xenograft model in the same animals. C16

www.aacrjournals.org Cancer Res; 78(3) February 1, 2018 727

Delwar et al.

Figure 7. Schematic diagram of microglial barrier in oHSV-1 therapy.

also significantly enhanced oHSV-1 antitumor efficacy in that microglia/macrophages. This suggests that tumor-associated model (Supplementary Fig. S8). As infiltrated macrophages are microglia/macrophages may be utilized for expressing virally evident in almost all tumor types (56), our finding that macro- carried therapeutic genes. More importantly, we discovered that phages prevent oncolytic herpes virus antitumor efficacy by a C16 is a strong phosphorylation inhibitor of STAT1/3 and selec- STAT-dependent mechanism might be applicable to all types of tively restore viral replication in microglia/macrophages by revers- tumors. However, C16 effect on other immune cells, specially ing the character of TANP cells from nonpermissive to permissive, activated natural killer (NK) cells remained to be evaluated, as thereby allowing enhanced intratumoral viral production and Alvarez-Breckenridge and colleagues 2012 (57) observed that dissemination (summarized in Fig. 7). Inhibition of STAT3 activated NK cells are recruited into infection site and reduce the phosphorylation by C16 may further suppress tumor growth. antitumor efficacy of oHSV-1. The combined effects of the above dramatically increase the Importantly, we observed that the effect of C16 on enhanced antitumor efficacy of the oncolytic virus. Our research has viral replication in macrophages was restricted to tumors; no viral provided strong evidence that C16 is an excellent candidate for replication was detectable outside of tumor tissue using a sensitive clinical application in combination with oncolytic virotherapy PCR method. It remains to be confirmed whether the selective because of its capacity to significantly augment the antitumor facilitation of oHSV-1 oncolysis by C16 was due to locally efficacy of oHSV-1. delivered virus or to the difference between normal microglia/ macrophages and tumor-associated macrophages/microglia. Disclosure of Potential Conflicts of Interest In any case, our results suggest that activation of STAT1/3 is fi Z.M. Delwar is a research scientist at Valeo Solutions Inc. and reports suf cient for inhibiting viral replication of oHSV-1 in microglia/ receiving a research grant, which is partially sponsored by Virogin Biotech Ltd. – macrophages even when the PKR eIF2a axis remains active. through Mitacs. W. Jia is the chief scientificofficer at Virogin Biotech Ltd. No Furthermore, as STAT3 has been a target for cancer treatment and potential conflicts of interest were disclosed by the other authors. as our data demonstrated that C16 inhibits the proliferation of various types of cancer cells (Supplementary Fig. S9), inhibition of Authors' Contributions STAT3 activity by C16 may significantly facilitate oHSV-1– Conception and design: Z.M. Delwar, P.S. Rennie, W. Jia induced tumor regression and enhance viral dissemination in a Development of methodology: Z.M. Delwar, Y.H. Wen, P.S. Rennie, W. Jia tumor mass. Acquisition of data (provided animals, acquired and managed patients, In summary, our current study suggests that the antitumor provided facilities, etc.): Z.M. Delwar, Y. Kuo efficacy of oHSV-1 is partially determined by the number of TANP Analysis and interpretation of data (e.g., statistical analysis, biostatistics, cells in the tumor mass, especially the amount of microglia/ computational analysis): Z.M. Delwar, P.S. Rennie, W. Jia macrophages that uptake the viruses but do not permit viral Writing, review, and/or revision of the manuscript: Z.M. Delwar, P.S. Rennie, W. Jia replication. This is mainly due to upregulated STAT1/3 phosphor- Administrative, technical, or material support (i.e., reporting or organizing ylation. However, we found that some viral and exogenous genes data, constructing databases): P.S. Rennie carried by oHSV-1 can still be expressed after uptake of the virus by Study supervision: P.S. Rennie, W. Jia

728 Cancer Res; 78(3) February 1, 2018 Cancer Research

Oncolytic Virotherapy Inhibition by Microglia/Macrophages

Acknowledgments The costs of publication of this article were defrayed in part by the payment of advertisement We thank Mary Bowden, Hanadi Qashqari, and Erin Kwa for helping with in page charges. This article must therefore be hereby marked in vivo experiments, Western blot analyses, and cytotoxicity assays, respectively. W. Jia accordance with 18 U.S.C. Section 1734 solely to indicate this fact. had been awarded grants from Canadian Cancer Society. P.S. Rennie and Z. Delwar had been awarded a grant from Mitacs. Z. Delwar had been awarded a graduate training award (4-year doctoral fellowship) from University of British Received March 21, 2017; revised May 4, 2017; accepted November 2, 2017; Columbia. published OnlineFirst November 8, 2017.

References 1. Parato KA, Senger D, Forsyth PA, Bell JC. Recent progress in the battle 22. Graeber MB, Scheithauer BW, Kreutzberg GW. Microglia in brain tumors. between oncolytic viruses and tumours. Nat Rev Cancer 2005;5: Glia 2002;40:252–9. 965–76. 23. Fulci G, Dmitrieva N, Gianni D, Fontana EJ, Pan X, Lu Y, et al. Depletion of 2. Fukuhara H, Todo T. Oncolytic herpes simplex virus type 1 and host peripheral macrophages and brain microglia increases brain tumor titers of immune responses. Curr Cancer Drug Targets 2007;7:149–55. oncolytic viruses. Cancer Res 2007;67:9398–406. 3. Sheridan C. Amgen announces oncolytic virus shrinks tumors. Nat Bio- 24. Saha D, Martuza RL, Rabkin SD. Macrophage polarization contributes to technol 2013;31:471–2. glioblastoma eradication by combination immunovirotherapy and 4. Andtbacka RH, Kaufman HL, Collichio F, Amatruda T, Senzer N, Chesney J, immune checkpoint blockade. Cancer Cell 2017;32:253–67. et al. Talimogene laherparepvec improves durable response rate in patients 25. Ingrand S, Barrier L, Lafay-Chebassier C, Fauconneau B, Page G, Hugon J. with advanced melanoma. J Clin Oncol 2014;33:2780–8. The oxindole/imidazole derivative C16 reduces in vivo brain PKR activa- 5. Zhang J, Stevens MF, Laughton CA, Madhusudan S, Bradshaw TD. Acquired tion. FEBS Lett 2007;581:4473–8. resistance to temozolomide in glioma cell lines: molecular mechanisms 26. Ni M, Aschner M. Neonatal rat primary microglia: isolation, culturing, and potential translational applications. Oncology 2010;78:103–14. and selected applications. Curr Protoc Toxicol 2010;Chapter 12:Unit 6. Mineta T, Rabkin SD, Martuza RL. Treatment of malignant gliomas using 12.17. ganciclovir-hypersensitive, ribonucleotide reductase-deficient herpes sim- 27. Shukla D, Dal Canto MC, Rowe CL, Spear PG. Striking similarity of murine plex viral mutant. Cancer Res 1994;54:3963–6. nectin-1a to human nectin-1a (HveC) in sequence and activity as a 7. Goldstein DJ, Weller SK. Herpes simplex virus type 1-induced ribonucle- glycoprotein D receptor for alphaherpesvirus entry. J Virol 2000;74: otide reductase activity is dispensable for virus growth and DNA synthesis: 11773–81. isolation and characterization of an ICP6 lacZ insertion mutant. J Virol 28. Clement C, Tiwari V, Scanlan PM, Valyi-Nagy T, Yue BY, Shukla D. A novel 1988;62:196–205. role for phagocytosis-like uptake in herpes simplex virus entry. J Cell Biol 8. Yoon SS, Nakamura H, Carroll NM, Bode BP, Chiocca EA, Tanabe KK. An 2006;174:1009–21. oncolytic herpes simplex virus type 1 selectively destroys diffuse liver 29. Tiwari V, Shukla D. Nonprofessional phagocytosis can facilitate herpesvi- metastases from colon carcinoma. FASEB J 2000;14:301–11. rus entry into ocular cells. Clin Dev Immunol 2012;2012:651691. doi: 9. Kanai R, Rabkin SD, Yip S, Sgubin D, Zaupa CM, Hirose Y, et al. Oncolytic 10.1155/2012/651691. virus-mediated manipulation of DNA damage responses: synergy with 30. Bose A, MoutonLiger F, Paquet C, Mazot P, Vigny M, Gray F, et al. chemotherapy in killing glioblastoma stem cells. J Natl Cancer Inst Modulation of tau phosphorylation by the kinase PKR: implications in 2012;104:42–55. Alzheimer's disease. Brain Pathol 2011;21:189–200. 10. Mineta T, Rabkin SD, Yazaki T, Hunter WD, Martuza RL. Attenuated multi– 31. Friedman A, Tian JP, Fulci G, Chiocca EA, Wang J. Glioma virotherapy: mutated herpes simplex virus–1 for the treatment of malignant gliomas. effects of innate immune suppression and increased viral replication Nat Med 1995;1:938–43. capacity. Cancer Res 2006;66:2314–9. 11. Kooby DA, Carew JF, Halterman MW, Mack JE, Bertino JR, Blumgart LH, 32. Fulci G, Breymann L, Gianni D, Kurozomi K, Rhee SS, Yu J, et al. Cyclo- et al. Oncolytic viral therapy for human colorectal cancer and liver phosphamide enhances glioma virotherapy by inhibiting innate immune metastases using a multi-mutated herpes simplex virus type-1 (G207). responses. Proc Natl Acad Sci 2006;103:12873–8. FASEB J 1999;13:1325–34. 33. Lamfers ML, Fulci G, Gianni D, Tang Y, Kurozumi K, Kaur B, et al. 12. Varghese S, Rabkin SD. Oncolytic herpes simplex virus vectors for cancer Cyclophosphamide increases transgene expression mediated by an onco- virotherapy. Cancer Gene Ther 2002;9:967–78. lytic adenovirus in glioma-bearing mice monitored by bioluminescence 13. Markert J, Medlock M, Rabkin S, Gillespie G, Todo T, Hunter W, et al. imaging. Mol Ther 2004;14:779–88. Conditionally replicating herpes simplex virus mutant, G207 for the 34. Wakimoto H, Fulci G, Tyminski E, Chiocca EA. Altered expression of treatment of malignant glioma: results of a phase I trial. Gene Ther antiviral cytokine mRNAs associated with cyclophosphamide's enhance- 2000;7:867–74. ment of viral oncolysis. Gene Ther 2004;11:214–23. 14. Liu T-C, Galanis E, Kirn D. Clinical trial results with oncolytic virotherapy: a 35. Mariani MM, Kielian T. Microglia in infectious diseases of the central century of promise, a decade of progress. Nat Clin Pract Oncol 2007;4: nervous system. J Neuroimmune Pharmacol 2009;4:448–61. 101–17. 36. Meisen WH, Wohleb ES, Jaime-Ramirez AC, Bolyard C, Yoo JY, Russell L, 15. Charles NA, Holland EC, Gilbertson R, Glass R, Kettenmann H. The brain et al. The impact of macrophage-and microglia-secreted TNFa on oncolytic tumor microenvironment. Glia 2011;59:1169–80. HSV-1 therapy in the glioblastoma tumor microenvironment. Clin Cancer 16. Watters JJ, Schartner JM, Badie B. Microglia function in brain tumors. Res 2015;21:3274–85. J Neurosci Res 2005;81:447–55. 37. Rice S, Knipe D. Gene-specific transactivation by herpes simplex virus type 17. Li W, Graeber MB. The molecular profile of microglia under the influence of 1 alpha protein ICP27. J Virol 1988;62:3814–23. glioma. Neurooncology 2012;14:958–78. 38. Jean S, LeVan KM, Song B, Levine M, Knipe DM. Herpes simplex virus 1 18. Roggendorf W, Strupp S, Paulus W. Distribution and characterization of ICP27 is required for transcription of two viral late (g2) genes in infected microglia/macrophages in human brain tumors. Acta Neuropathol 1996; cells. Virology 2001;283:273–84. 92:288–93. 39. Sacks WR, Greene CC, Aschman DP, Schaffer PA. Herpes simplex virus type 19. Morantz RA, Wood GW, Foster M, Clark M, Gollahon K. Macrophages in 1 ICP27 is an essential regulatory protein. J Virol 1985;55:796–805. experimental and human brain tumors. J Neurosurg 1979;50:305–11. 40. Cole JL. Activation of PKR: an open and shut case? Trends Biochem Sci 20. Wood GW, Morantz RA. Immunohistologic evaluation of the lymphor- 2007;32:57–62. eticular infiltrate of human central nervous system tumors. J Natl Cancer 41. Melchjorsen J, Matikainen S, Paludan SR. Activation and evasion of innate Inst 1979;62:485–91. antiviral immunity by herpes simplex virus. Viruses 2009;1:737–59. 21. Badie B, Schartner JM. Flow cytometric characterization of tumor-associ- 42. Peters GA, Khoo D, Mohr I, Sen GC. Inhibition of PACT-mediated acti- ated macrophages in experimental gliomas. Neurosurgery 2000;46: vation of PKR by the herpes simplex virus type 1 Us11 protein. J Virol 957–62. 2002;76:11054–64.

www.aacrjournals.org Cancer Res; 78(3) February 1, 2018 729

Delwar et al.

43. Todo T, Martuza RL, Rabkin SD, Johnson PA. Oncolytic herpes simplex 51. Yu H, Pardoll D, Jove R. STATs in cancer inflammation and immunity: a virus vector with enhanced MHC class I presentation and tumor cell killing. leading role for STAT3. Nat Rev Cancer 2009;9:798–809. Proc Natl Acad Sci 2001;98:6396–401. 52. Aoki Y, Feldman GM, Tosato G. Inhibition of STAT3 signaling induces 44. Wakimoto H, Kesari S, Farrell CJ, Curry WT, Zaupa C, Aghi M, et al. Human apoptosis and decreases survivin expression in primary effusion lympho- glioblastoma–derived cancer stem cells: establishment of invasive glioma ma. Blood 2003;101:1535–42. models and treatment with oncolytic herpes simplex virus vectors. Cancer 53. Hutchins AP, Diez D, Takahashi Y, Ahmad S, Jauch R, Tremblay ML, et al. Res 2009;69:3472–81. Distinct transcriptional regulatory modules underlie STAT30s cell type- 45. Norden R, Nystrom€ K, Olofsson S. Activation of host antiviral RNA-sensing independent and cell type-specific functions. Nucleic Acids Res 2013;41: factors necessary for herpes simplex virus type 1-activated transcription of 2155–70. host cell fucosyltransferase genes FUT3, FUT5, and FUT6 and subsequent 54. Yokota S-i, Yokosawa N, Kubota T, Suzutani T, Yoshida I, Miura S, et al. expression of sLex in virus-infected cells. Glycobiology 2009;19:776–88. Herpes simplex virus type 1 suppresses the interferon signaling pathway by 46. Katze MG, He Y, Gale M. Viruses and interferon: a fight for supremacy. Nat inhibiting phosphorylation of STATs and janus kinases during an early Rev Immunol 2002;2:675–87. infection stage. Virology 2001;286:119–24. 47. O'Shea JJ, Holland SM, Staudt LM. JAKs and STATs in immunity, immu- 55. Melchjorsen J, Siren J, Julkunen I, Paludan SR, Matikainen S. Induction of nodeficiency, and cancer. N Engl J Med 2013;368:161–70. cytokine expression by herpes simplex virus in human monocyte-derived 48. Khodarev NN, Roizman B, Weichselbaum RR. Molecular pathways: inter- macrophages and dendritic cells is dependent on virus replication and is feron/stat1 pathway: role in the tumor resistance to genotoxic stress and counteracted by ICP27 targeting NF-kB and IRF-3. J Gen Virol 2006;87: aggressive growth. Clin Cancer Res 2012;18:3015–21. 1099–108. 49. García-Sastre A, Biron CA. Type 1 interferons and the virus-host relation- 56. Panni RZ, Linehan DC, DeNardo DG. Targeting tumor-infiltrating macro- ship: a lesson in detente. Science 2006;312:879–82. phages to combat cancer. Immunotherapy 2013;5:1075–87. 50. Mikloska Z, Cunningham AL. Alpha and gamma interferons inhibit herpes 57. Alvarez-Breckenridge CA, Yu J, Price R, Wojton J, Pradarelli J, Mao H, et al. simplex virus type 1 infection and spread in epidermal cells after axonal NK cells impede glioblastoma virotherapy through NKp30 and NKp46 transmission. J Virol 2001;75:11821–6. natural cytotoxicity receptors. Nat Med 2012;18:1827–34.

730 Cancer Res; 78(3) February 1, 2018 Cancer Research

Oncolytic Virotherapy Blockade by Microglia and Macrophages Requires STAT1/3

Zahid M. Delwar, Yvonne Kuo, Yan H. Wen, et al.

Cancer Res 2018;78:718-730. Published OnlineFirst November 8, 2017.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-17-0599

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2017/11/08/0008-5472.CAN-17-0599.DC1

Cited articles This article cites 56 articles, 17 of which you can access for free at: http://cancerres.aacrjournals.org/content/78/3/718.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/78/3/718.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/78/3/718. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.