Cytotoxicity in NK Cells Ral Gtpases Regulate Cell-Mediated

The Journal of Immunology

Ral GTPases Regulate Cell-Mediated Cytotoxicity in NK Cells

Jesu´sSańchez-Ruiz, Raquel Mejıás, Marıá Garcıá-Belando, Domingo F. Barber, and Ana Gonza´lez-Garcıá

NK cells are key components of the immune response to virally infected and tumor cells. Recognition of target cells initiates a series of events in NK cells that culminates in target destruction via directed secretion of lytic granules. Ral proteins are members of the Ras superfamily of small GTPases; they regulate vesicular trafﬁcking and polarized granule secretion in several cell types. In this study, we address the role of Ral GTPases in cell-mediated cytotoxicity. Using a human NK cell line and human primary NK cells, we show that both Ral isoforms, RalA and RalB, are activated rapidly after target cell recognition. Furthermore, silencing of RalA and RalB impaired NK cell cytotoxicity. RalA regulated granule polarization toward the immunological synapse and the subsequent process of degranulation, whereas RalB regulated degranulation but not polarization of lytic granules. Analysis of the molecular mechanism indicated that Ral activation in NK cells leads to assembly of the exocyst, a protein complex involved in polarized secretion. This assembly is required for degranulation, as interference with expression of the exocyst component Sec5 led to reduced degranulation and impaired cytotoxicity in NK cells. Our results thus identify a role for Ral in cell-mediated cytotoxicity, impli- cating these GTPases in lymphocyte function. The Journal of Immunology, 2011, 187: 2433–2441.

atural killer cells are essential for the elimination of tu- and fusion (2–4), but the molecular mechanisms that regulate mor and virally infected cells. In NK cells, recognition granule secretion are not yet fully understood. N of target cells triggers several signaling cascades that The Ral GTPases belong to the Ras superfamily of small culminate in the formation of the immunological synapse. The syn- GTPases. Mammals have two Ral genes (RalA and RalB)that apse allows directional secretion of lytic granules to the target encode ubiquitous proteins with 85% sequence identity (5). Ral cell membrane. These granules contain perforin, granzyme, and proteins mediate some Ras functions in the cell, as certain Ral other hydrolytic enzymes able to induce apoptosis in target cells. guanine exchange factors that promote Ral activation can interact Cell-mediated cytotoxicity proceeds through several precisely re- directly with active Ras. Ral GTPases regulate gene transcription, gulated steps; target recognition is followed by extensive reor- vesicular trafficking, migration, and cytokinesis and contribute to ganization of the actin cytoskeleton and formation of a stable tumor development. To date, three Ral effectors have been iden- conjugate between the cytotoxic and the target cell. Shortly after tified: RalBP1 (6), the exocyst complex (7, 8), and the ZonaB conjugate formation, the secretory machinery is polarized. The transcription factor (9). Both RalA and RalB also bind constitu- microtubule-organizing center (MTOC), normally located near tively to phospholipase D1 and phospholipase C-d1andare the nuclear membrane, moves toward the contact zone between needed for their activation (10–12). the two cells. The lytic granules then move along the microtubules The exocyst is a protein complex involved in tethering post- toward the synapse; when they reach the plasma membrane at the Golgi secretory vesicles to specific plasma membrane domains. secretion site, the granules dock and fuse to the membrane, releas- It is composed of eight evolutionarily conserved subunits: Sec3, ing their enzymatic content (1). Several molecules such as Rab27, Sec5, Sec6, Sec8, Sec10, Sec15, Exo70, and Exo84 (13). The Munc13-4, and syntaxin 11 are implicated in granule docking exocyst is involved in establishing epithelial polarity, membrane delivery, polarized growth, and polarized secretion (14). Exocyst complex function is regulated by several small GTPases including Departamento de Inmunologıá y Oncologıá, Centro Nacional de Biotecnologıá-Consejo Ral and members of the Rab and Rho families. Active RalA and Superior Investigaciones Cientı´ficas, E-28049 Madrid, Spain RalB interact directly with the exocyst subunits Exo84 and Sec5 Received for publication September 15, 2010. Accepted for publication July 5, 2011. (7, 8, 15), although RalB binds to these proteins less efficiently This work was supported by the Spanish Ministry of Science and Innovation than RalA (16). Ral GTPases regulate exocyst assembly, and dis- (SAF2007-60490 to A.G.-G. and SAF2008-00471 to D.F.B.), the Madrid Regional ruption of Ral interaction with the exocyst alters protein targeting Government (CCG06-CSIC/SAL-0904 to A.G.-G.), and the Carlos III Health Institute to the basolateral membrane in polarized epithelial cells (7). The (Redes Tema´ticas de Investigacioń Cooperativa en Salud program), Spanish Ministry for Health and Consumer Affairs (RD08/0075/0015, Red de Investigacioń en Inflama- exocyst also mediates Ral functions such as cell transformation, cioń en Enfermedades Reuma´ticas, to D.F.B.). J.S.-R. received a Junta para la Amplia- cytokinesis, and cell migration. As Ral GTPases participate in cioń de Estudios fellowship from the Spanish National Research Council. A.G.-G. holds a Ramoń y Cajal contract from the Spanish Ministry of Science and Innovation. polarized secretion, we studied Ral function in the regulation of NK cytotoxicity and analyzed their effect on granule polarization Address correspondence and reprint requests to Dr. Ana Gonza´lez-Garcıá, Departa- mento de InmunologıáyOncologıá, Centro Nacional de Biotecnologıá-Consejo and degranulation through exocyst assembly. Superior Investigaciones Cientı´ficas, Darwin 3, Campus de Cantoblanco, E-28049 Madrid, Spain. E-mail address: [email protected] Materials and Methods The online version of this article contains supplemental material. Cells and reagents Abbreviations used in this article: MTOC, microtubule-organizing center; RBD, Ral binding domain; shRNA, short hairpin RNA; siRNA, small interfering RNA. The human NK-like YTS tumor cell line and the HLA class I-negative 721.221 B lymphoblastoid cell line were cultured in RPMI 1640 me- Copyright Ó 2011 by The American Association of Immunologists, Inc. 0022-1767/11/$16.00 dium with 10% FBS. The Drosophila cell line SC2 B7.1/ICAM-1 was www.jimmunol.org/cgi/doi/10.4049/jimmunol.1003089 2434 Ral FUNCTION IN LYTIC GRANULE-MEDIATED CYTOTOXICITY

maintained in Schneider medium containing 2 mM L-glutamine and 10% small interfering RNA (siRNA) was used (Dharmacon): 59-GGUCGGA FBS. Expression of transfected ligands in SC2 cells was induced by 24-h AAGACAAGGCAGAUdTdT-39. incubation with 1 mM CuSO4. Human NK cells were isolated from healthy donor PBMC using Dy- Cell activation nabeads Untouched Human NK Cells Kit (Invitrogen). Pure NK cells Before cell activation, human NK cells and YTS cells were starved (2 h) + 2 (.95% CD56 CD3 ) were cultured in RPMI 1640 with 10% FBS, 10% in RPMI 1640 containing 0.1% low-endotoxin BSA (Sigma-Aldrich). When human serum, 100 U/ml puriﬁed human IL-2, and autologous mitomycin- 721.221 cells were used as targets for pulldown assays, these cells were treated (1 mg/ml, 90 min, 37˚C) PBL feeder cells (1:1). starved as above, ﬁxed with 4% paraformaldehyde to avoid activation of The following Abs were used: anti-RalA (BD Biosciences), anti-RalB endogenous Ral, and washed thoroughly with RPMI 1640. YTS and hu- (Upstate), anti-perforin (Kamiya Biomedical), anti–a-tubulin (DM1A; man NK cells were activated by coincubation with SC2 B7.1/ICAM-1 or Calbiochem), anti-Sec5 (Proteintech), anti-Sec8 (BD Biosciences), anti- 721.221 target cells at a 1:1 ratio for various times at 37˚C. After acti- Sec10 (Abcam), and anti-CD107a (BD Pharmingen). vation, cells were washed with cold PBS and lysed as described later. Short hairpin RNA Ral pulldown experiments and immunoprecipitation Short hairpin RNA (shRNA) lentiviral plasmids (pLKO.1-puro; Sigma- Cells were lysed (30 min) in PBS with 1% Triton X-100, 5 mM NaF, 1 mM Aldrich) were stably infected in YTS cells to downregulate RalA and sodium orthovanadate, 1 mM PMSF, and 1 mg/ml each aprotinin and RalB expression; we used the sequences RalA1 (59-CCGGCGAGCTAATG leupeptin. Lysates containing 500 mg protein were incubated with GST- TTGACAAGGTACTCGAGTACCTTGTCAACATTAGCTCGTTTTT-39), RalBP1 Ral binding domain (RBD)-conjugated glutathione–Sepharose RalA2 (59-CCGGCGATG AGTTTGTGGAGGACTACTCGAGTAGTCC- beads (17) (1 h). Beads were washed once with lysis buffer and twice with TCCACAAACTCATCGTTTTT-39), RalB1 (59-CCGG CAAGGTGTTC- 25 mM Tris (pH 7.2), boiled, and samples analyzed by Western blot using TTTGACCTAATCTCGAGATTAGGTCAAAGAACACCTTGTTTTTG- anti-RalA or anti-RalB Abs. 39), and RalB2 (59-CCGGCCTTTACAGCAACTGCCGAATCTCGAGA- For immunoprecipitation, cells were lysed with 20 mM Tris-HCl pH 7.5, TTCGGCAGTTGCTGTAAAGG TTTTTG-39). As a negative control, we 200 mM NaCl, 0.1 mM DTT, 1% Triton X-100, and 10% glycerol (30 min, used a short-hairpin sequence containing 5 bp mismatches to any known 4˚C). The resulting extract (500 mg) was incubated with the indicated Abs human gene (SHC002; Sigma-Aldrich). To silence Sec5, a synthethic (2 mg) and precipitated with protein A-coupled Sepharose beads. Beads

FIGURE 1. RalA and RalB are activated after induction of a cytotoxic response. A, YTS NK cells were coincubated with SC2 target cells expressing B7.1/ICAM-1 at a 1:1 ratio for the indicated times. RalA-GTP and RalB-GTP levels were analyzed by pulldown assay followed by Western blot using anti- RalA or anti-RalB Abs. Graphs show mean 6 SD of Ral signals in arbitrary units normalized for Ral levels at t =0(n = 4). *p , 0.05 (two-tailed Student t test). B, RalA-GTP and RalB-GTP levels were determined as above using the 721.221 cell line as target. (n = 3). *p , 0.05 (two-tailed Student t test). C, Primary IL-2–stimulated human NK cells were coincubated with 721.221 target cells for the indicated times. Levels of active RalA and RalB were determined as above. Data were quantitated as in A (n = 4). *p , 0.05 (two-tailed Student t test). AU, arbitrary units. The Journal of Immunology 2435 were washed once with lysis buffer and three times with 50 mM Tris-HCl Polarization assays pH 7.5, boiled, and analyzed by Western blot. YTS cells were incubated with 721.221 target cells at a 1:4 ratio (15 min, Immunofluorescence 37˚C), and cells were prepared on coverslips as above. Contacts were analyzed by confocal microscopy. Cells were plated on poly-L-lysine–pretreated coverslips and incubated for 10 min at 37˚C, then fixed with ice-cold 100% methanol (3 min) and Statistical analysis washed in PBS. Cells were blocked with PBS plus 0.1% Triton X-100, 10% heat-inactivated goat serum, and 0.5% BSA (30 min), then stained Two-tailed Student t test was calculated using GraphPad Prism 5.0 with primary Ab and incubated with fluorochrome-coupled secondary Abs. (GraphPad Software). Unless otherwise indicated, data represent the 6 , After washing in PBS, coverslips were mounted with PBS plus 50% glyc- mean SD, and p 0.05 was considered significant. erol and analyzed with an Olympus FluoView confocal microscope. To quantify the percentage of NK–target cell conjugates that show Ral trans- Results location, we determined the extent of Ral and perforin colocalization by RalA and RalB are activated in cytotoxic cells computation of the Pearson correlation coefficient (r) in productive contacts (Olympus FluoView software). Conjugates showing r $ 0.5 were Initiation of NK cell cytotoxic function requires signaling through considered positive for translocation. several intracellular pathways, including activation of the Ras on- Conjugation, degranulation, and cytotoxicity assays cogene (20, 21). We used YTS cells, a thymic lymphoma-derived NK cell line, to determine whether Ral GTPases mediate some YTS cells were stained with PKH67 Green Fluorescent Cell Linker and 721.221 cells with PKH26 Red Fluorescent Cell Linker (both from Sigma- Ras functions in natural cytotoxicity. YTS-mediated cytolysis is de- Aldrich). YTS and 721.221 cells were coincubated at a 1:2 ratio for differ- pendent on CD28 and LFA-1 ligation (22, 23); we therefore stim- ent times, fixed in 4% paraformaldehyde, and analyzed by FACS. Events ulated YTS with SC2 Drosophila cells expressing B7.1 and ICAM- positive for red and green fluorescence were considered conjugates, and 1 (24) (Supplemental Fig. 1). Levels of GTP-loaded RalA and RalB the percentage of conjugation was calculated as (conjugated YTS cells/total were subsequently determined by pulldown assays using GST/ YTS cells) 3 100. For degranulation assays, YTS cells were stained with PKH26 and in- RalBP1 RBD as bait (17). RalA and RalB showed rapid, transient cubated with 721.221 cells at a 1:2 ratio with 4 nM monensin and FITC- activation with similar kinetics. Both isoforms exhibited biphasic labeled anti-human CD107a or an isotype control Ab (4 h, 37˚C), after activation, with a first peak of Ral activation at 3–5 min post-YTS which samples were analyzed by flow cytometry. stimulation; active Ral levels then decreased almost to basal lev- To assay cytotoxicity, target 721.221 cells (5 3 103) and various concentrations of effector YTS cells were cultured in RPMI 1640 with 10% els, and a second activation peak was observed at 15 min post- Alamar blue (overnight, 37˚C; Ref. 18). Samples were analyzed using a stimulation (Fig. 1A). Ral activation profiles were similar when the CytoFluor 2350 (Millipore) with an excitation wavelength of 530 nm and MHC class I-deficient B cell line 721.221 was used as target (Fig. reading at 590 nm. The specific percentage of cytotoxicity was calculated 1B). 3 2 2 as 100 {[AF target cells (AF experimental AF effector cells)]/AF To corroborate the biological relevance of the observations in target cells} (18), where AF represents (sample fluorescence 2 fluorescence of the culture medium). Complementary cytotoxicity assays were the YTS cell line, we examined Ral-GTP levels in primary human performed using the JAM test (19). Briefly, 721.221 cells (104 per ex- NK cells stimulated with 721.221 target cells. RalA-GTP levels perimental condition) were labeled with [3H]thymidine (5 mCi/ml; 16 h, showed a biphasic increase shortly after stimulation, similar to that 37˚C) and incubated with various concentrations of effector YTS cells of YTS cells; in contrast, RalB showed a single activation peak (4 h, 37˚C). Cells were harvested with a FilterMate harvester (Perkin- Elmer), and the [3H]thymidine signal was measured in a 1450 Microbeta at 0.5–1 min (Fig. 1C). These observations confirmed results in b-counter (PerkinElmer). Cytotoxicity was calculated as [1 2 (experi- the YTS cell line, suggesting that Ral activation is important mental signal/target cell signal) 3 100]. during cell-mediated cytotoxicity in NK cells.

FIGURE 2. RalA and RalB localize to lytic granules. A, YTS cells were incubated alone or with 721.221 target cells at a 1:4 ratio (20 min), ﬁxed, stained with anti-RalA (left panel) or anti-RalB (right panel) (both green) and anti-perforin (red), and analyzed by confocal microscopy. B and C, Freshly isolated human NK cells (B) and IL-2–activated NK cells (C) were processed as above. Asterisk denotes 721.221 target cells. Original magniﬁcation 360, zoom 63. 2436 Ral FUNCTION IN LYTIC GRANULE-MEDIATED CYTOTOXICITY

RalA and RalB localize to the lytic granules To get insight into Ral function during cytotoxicity, we determined Ral subcellular localization in YTS cells by confocal microscopy. Ral GTPases are geranyl-geranylated and associate to the plasma membrane and vesicular structures (25). In several cell types with secretory function such as platelets, endothelial cells, and neurons, Ral localizes to secreted granules (26–28). We costained YTS cells with anti-RalA or anti-RalB and anti-perforin Ab as a marker of lytic granules. Both Ral isoforms colocalized with perforin in resting YTS cells (Fig. 2A, upper panels). Stimulation of YTS cells with the MHC class I-deficient B cell line 721.221 led to Ral translocation to the effector–target interphase, where it continued to colocalize with perforin-containing granules (Fig. 2A, lower panels). Ral translocation was observed in the majority of conjugates (98%) in which perforin polarized to the cell–cell contact zone. We also analyzed Ral localization in human NK cells freshly isolated from peripheral blood (Fig. 2B) and in IL-2–activated NK cells (Fig. 2C). In both cases, RalA and RalB colocalized with lytic granules, confirming observations in the YTS cell line. The percentage of conjugates showing Ral translocation to the immunological synapse was slightly lower than in YTS cells (RalA, 76% translocation; RalB, 87%); these results could be explained by the heterogeneity of cell activation in primary NK cell culture. In conjunction with the Ral activation observed after cytotoxicity induction, these data suggest a role for Ral in cell-mediated cytotoxicity. Interference with Ral impairs YTS cytotoxic response To examine the role of Ral GTPases in NK cell function, we generated stable YTS cell lines expressing lentiviral vector-driven shRNA for RalA and RalB. Two independent stable cell lines were generated using two distinct shRNA sequences for RalA and two for RalB. These cell lines were used in Alamar blue cytotoxicity assays with 721.221 as target cells. Despite partial RalA knockdown, the shRNA reduced YTS cell killing of target cells (Fig. 3A); FIGURE 3. RalA and RalB regulate cytotoxicity in YTS cells. A and B, interference with RalB also impaired cytotoxicity, although to a The percentage of specific cytotoxicity to 721.221 target cells of YTS cell lesser extent than interference with RalA (Fig. 3B). Both RalA and lines stably expressing control or RalA shRNA (A) and control or RalB RalB shRNA were specific and reduced expression of the cor- shRNA (B) was determined by Alamar blue assay at different E:T cell responding isoform by ∼80% (Fig. 3E). A complementary as- ratios. Two independent RalA (shRalA1, shRalA2) and RalB (shRalB1, 6 sessment of the cytotoxic activity of RalA shRNA- and RalB shRalB2) shRNA sequences were used. Data are shown as mean SEM of triplicates from one representative experiment of three performed. C and shRNA-expressing YTS cells using the JAM test (see Materials D, JAM test to measure specific cytotoxicity of control, RalA (C), and and Methods) also showed reduced cytotoxicity in both RalA RalB (D) shRNA-expressing cells. Data are shown as mean 6 SEM of shRNA and RalB shRNA cells compared with that in controls triplicates from one representative experiment of three performed. E, (Fig. 3C,3D). The differences between controls and cells with Western blot analysis of RalA and RalB levels in YTS cells stably reduced Ral levels were higher in the JAM test than in the Alamar expressing lentiviral vector-driven RalA, RalB, or control shRNA, as in- blue assay. dicated. F, Western blot analysis of perforin levels in control, RalA, and To confirm that the impaired cytotoxic response was not due to RalB shRNA-expressing cells. a reduction in the amount of lytic proteins contained in the lytic granules in silenced YTS cells, we measured perforin levels: RalA shRNA- and RalB shRNA-expressing YTS cells and controls Ral is linked to various polarized secretion events that require showed similar perforin levels (Fig. 3F). Reduction of RalB and, vesicle targeting to specific membrane domains; these include more clearly, of RalA thus resulted in reduced cell-mediated cy- basolateral secretion in epithelia (16), synaptic vesicle release in totoxicity. neurons (29), and secretion of Weibel–Palade bodies in endothelial cells (30). Ral might thus be involved in lytic granule polar- Ral GTPases regulate granule polarization and secretion ization during cell-mediated cytotoxicity. To analyze the effects of Efficient cell-mediated killing requires the completion of three Ral silencing on granule polarization, we induced conjugate for- steps: formation of a stable conjugate with target cells, polarization mation between YTS cells stably expressing RalA shRNA and of the secretory machinery, and finally, granule secretion. To de- RalB shRNA and target 721.221 cells, then stained for perforin termine which of these processes is regulated by activation of Ral and tubulin as markers of lytic granules and the MTOC, re- GTPases, we first analyzed the effect of Ral silencing on YTS spectively (Fig. 4B). Incubation with target cells led to MTOC conjugate formation with 721.221 target cells by two-color FACS reorientation and perforin polarization to the contact zone in analysis. Interference with neither RalA nor RalB affected YTS control YTS cells; however, in cells expressing RalA shRNA, we cell conjugation with target cells (Fig. 4A). observed aberrant localization of both MTOC and lytic granules The Journal of Immunology 2437

FIGURE 4. Effect of Ral GTPases in conjugate formation, polarization, and degranulation. A, YTS cells stably expressing control or RalA shRNA (left panel) or control or RalB shRNA (right panel) were labeled with PKH67 and coincubated with PKH26-labeled 721.221 target cells at a 1:2 E:T ratio. The percentage of conjugation was calculated as (conjugated YTS cells/total YTS cells) 3 100. The mean 6 SD of three independent experiments is shown. Differences between groups were not significant. n.s., not significant. B, YTS cells stably expressing control, RalA, or RalB shRNA were incubated alone or with 721.221 target cells, fixed, stained with anti–a-tubulin and anti-perforin Abs, and analyzed by confocal microscopy. Asterisk denotes 721.221 target cells. C and D, Quantification of MTOC and lytic granule polarization frequencies in control- versus RalA-silenced (C) or control- versus RalB-silenced (D) YTS cells. Data show mean 6 SD of three independent experiments; at least 50 conjugates were scored in each experiment. *p , 0.01 (two-tailed Student t test). E, YTS cells stably expressing control, RalA (left panel), or RalB (right panel) shRNA were labeled with PKH26 and incubated with 721.221 target cells at a 1:2 ratio. The assay was performed in the presence of Ab to the degranulation marker CD107a; cells were then harvested and analyzed by flow cytometry. Graphs show the percentage of CD107a+ (degranulating) cells within the PKH26-labeled population (mean 6 SD, n = 3). Statistical differences were determined using a two-tailed Student t test: *p , 0.05. 2438 Ral FUNCTION IN LYTIC GRANULE-MEDIATED CYTOTOXICITY

FIGURE 5. Ral GTPases regulate exocyst assembly during the cytotoxic response. A, YTS cells were stimulated with SC2 target cells expressing B7/ ICAM-1 for the indicated times. Lysates were immunoprecipitated with anti-RalA or anti-RalB Abs and analyzed by Western blot with anti-Sec8 Ab. Two internal controls were used, a sample containing cell lysate and protein A but no Ab (“NoAb”) and a sample containing Ab and protein A but no cell lysate (“NoLys”). As a protein loading control, Sec8 levels were tested in whole-cell lysates including the NoAb sample (middle panel). Graph shows mean 6 SD of Sec8 signals in arbitrary units normalized for Sec8 levels at t =0(n = 4). *p , 0.05 (two-tailed Student t test). B, YTS cells were stimulated as in A and lysates incubated with GST-RalBP1 RBD-conjugated beads to pull down active Ral GTPases. Levels of GTP-bound RalA, RalB, and associated Sec5 or Sec8 were determined by Western blot; as controls, whole-cell lysates were tested with anti-RalA, anti-RalB, anti-Sec5, and anti-Sec8 Abs (middle panel). Graphs show mean 6 SD of RalA-GTP, RalB-GTP, Sec5, and Sec8 signals in arbitrary units normalized for the levels at t =0(n = 4). *p , 0.05 (two-tailed Student t test). C, Confocal microscopy of YTS cells alone or incubated with 721.221 target cells, then stained with anti-perforin (red) and anti-Sec5 The Journal of Immunology 2439

(Fig. 4B). Quantification of conjugates showing MTOC reorientation and perforin polarization to the contact zone showed that RalA knockdown led to a significant decrease in the percentage of cells in which the secretory machinery was polarized (Fig. 4C); in contrast, RalB silencing did not affect polarization (Fig. 4D). We determined whether, in addition to regulating lytic granule polarization, Ral is implicated in their secretion. To assess possi- ble degranulation defects, we measured levels of anti-CD107a (lysosome-associated membrane protein 1) in YTS cells activated with target 721.221 cells. CD107a is located at the lytic granule membrane and forms part of the cell membrane after granule fusion; cell surface CD107a expression is therefore considered a degranulation marker (31). Incubation with target cells induced a significant increase in membrane CD107a levels in control cells, as predicted, but did not notably increase degranulation of YTS cells in the absence of RalA or RalB (Fig. 4E). The results show that both RalA and RalB participate in cell- mediated cytotoxicity; RalA regulates granule polarization and secretion, whereas RalB mediates only the latter step. Interaction with target cells induces exocyst assembly Ral GTPases interact with several effector proteins, including the exocyst components Sec5 and Exo84 (7, 8). Assembly of the exocyst complex is necessary for a large number of cell functions involving targeted membrane delivery, and Ral activation is essential for the assembly and localization of the octameric exocyst complex (7, 8). To determine whether the cytotoxic response in YTS cells requires exocyst assembly, we immunoprecipitated RalA and RalB and tested for associated Sec8. After CD28/LFA-1 stimulation, both RalA and RalB coimmunoprecipitated with Sec8 FIGURE 6. Sec5 regulates cytotoxicity in YTS cells. A, YTS cells were with kinetics resembling those of Ral activation (Fig. 5A). Be- transfected with control or Sec5 siRNA as indicated, and Sec5, RalA, and cause Ral GTPases do not bind directly to the Sec8 exocyst RalB levels were determined by Western blot. B, The percentage of spe- subunit, these results indicate that triggering of the cytotoxic re- cific cytotoxicity against 721.221 target cells of control or Sec5 siRNA- expressing YTS cells was determined by Alamar blue assay. Data show sponse induces exocyst assembly. To determine whether Ral/Sec8 mean 6 SEM of triplicates of one representative experiment of three interaction was dependent on Ral activation, we performed a performed. C, Conjugate formation between 721.221 target cells and YTS pulldown assay and analyzed the exocyst proteins associated with cells transiently transfected with control or Sec5 siRNA as indicated active Ral. Sec5, one of the exocyst components that binds di- (mean 6 SD, n = 3). D, Quantification of MTOC and lytic granule po- rectly to Ral GTPases, interacted with active RalA and RalB; Sec8 larization frequencies in control- and Sec5-silenced YTS cells. Data show levels also paralleled those of active RalA and RalB, suggesting mean 6 SD of three independent experiments; at least 50 conjugates were that exocyst assembly depends on Ral activation (Fig. 5B). scored in each experiment. E, The percentage of CD107a+ (degranulating) The unassembled exocyst exists as hemicomplexes distributed cells is shown in control and Sec5 siRNA-transfected YTS cells after in distinct cell locations; these hemicomplexes interact to form coincubation with 721.221 target cells (mean 6 SD, n = 3). Statistical , the functional octameric complex (8). We used immunofluorescence differences were determined using a two-tailed Student t test: *p 0.005. and confocal imaging to examine the subcellular localization of different exocyst subunits in YTS cells. Staining for Sec5 showed data for exocyst assembly (Fig. 5A). These findings show exocyst a punctate pattern compatible with vesicular localization. These assembly at the contact zone during cytotoxicity, suggesting a role vesicles differ from lytic granules, however, as Sec5 did not co- for this complex in lytic granule polarization and secretion. localize with perforin (Fig. 5C). After YTS cells were incubated with 721.221 target cells, Sec5-containing vesicles colocalized Sec5 knockdown reduces cytotoxicity and degranulation in partially with lytic granules (Fig. 5C). YTS cells Analysis of the cellular location of other exocyst proteins before To test whether impaired cytotoxicity in Ral-deficient cells was stimulation of YTS cells showed that a fraction of Sec8 colocalizes due to defective exocyst assembly, we silenced Sec5 in YTS cells with perforin, indicating that some exocyst components are found using siRNA (Fig. 6A) and tested their ability to kill 721.221 tar- in lytic granules in unstimulated cells (Fig. 5D). In contrast, Sec10 get cells in an Alamar blue assay. Interference with Sec5 impaired localized more diffusely in cytoplasm and did not colocalize with YTS cytolytic capacity, similar to results obtained after RalA perforin or Sec8 (Fig. 5D). Incubation of YTS with target cells silencing (Fig. 6B). Analysis of the mechanism involved indicated confirmed fusion of perforin-positive lytic granules with vesicles that Sec5 silencing did not affect YTS cell capacity to form containing exocyst components. Indeed, YTS conjugate formation stable conjugates with target cells (Fig. 6C). Differing from with 721.221 cells led to Sec8 and perforin translocation to the RalA interference, MTOC reorganization and lytic granule po- contact zone, where they colocalized with a large fraction of larization to the immunological synapse were also unaffected in Sec10 (Fig. 5D); this result is in agreement with the biochemical Sec5-silenced cells (Fig. 6D). Nonetheless, interference with

(green). D, Cells were treated as in C and stained with anti-perforin (green), anti-Sec8 (red), and anti-Sec10 (blue). Asterisk denotes 721.221 target cells. Original magniﬁcation 360, zoom 63. AU, arbitrary units. 2440 Ral FUNCTION IN LYTIC GRANULE-MEDIATED CYTOTOXICITY

Sec5 reduced CD107a translocation to the YTS cell plasma mem- YTS cells, interaction with target cells promoted Ral-mediated brane after activation with target cells (Fig. 6E), supporting a exocyst assembly concomitantly with Sec5 and Sec10 relocali- role for exocyst assembly during granule secretion. zation to the lytic granules (Fig. 5C,5D); Ral-mediated exocyst assembly might thus trigger heterotypic vesicle fusion, leading Discussion to granule maturation. Patients with deficiencies in Rab27 and In this study, we show that Ral GTPases regulate cell-mediated Munc13-4, the proteins responsible for heterotypic vesicle as- cytotoxicity in NK cells. Both RalA and RalB are activated sembly during cytotoxicity (37, 38), show impaired cytotoxicity rapidly in YTS cells and primary NK cells after interaction with and defects in granule secretion (2, 3) similar to the alterations target cells, and interference with either Ral isoform impaired YTS observed in Ral-silenced cells. capacity to kill target cells. Analysis of the essential stages involved Ral GTPases bind to PLD1 and are necessary to activate this in cytotoxicity indicated that RalA regulates polarization of the protein (10). Ral is nonetheless insufficient for PLD1 activation lytic machinery to the immunological synapse as well as the de- and must cooperate with the small GTPase Arf6 (39). PLD is ac- granulation step; in contrast, RalB regulates only the latter step in tivated in response to cytotoxic receptor triggering in NK cells cytotoxicity. Study of the molecular mechanism underlying Ral (40–42); this activation is Arf6-dependent and necessary for de- modulation of cytotoxicity showed that RalA and RalB regulated granulation. We therefore cannot rule out that PLD is partially exocyst assembly and that this complex is needed for YTS de- responsible for cytotoxic defects in YTS cells expressing RalA or granulation and efficient killing of target cells. RalB shRNA. Ral GTPases are associated with the plasma membrane and with In addition to regulation of granule secretion, RalA also con- vesicular structures within the cell. In epithelial cells, RalA and trols polarization of the secretory machinery in a Sec5-indepen- RalB are found in the endosomal compartment (16, 32); we ob- dent manner (Figs. 4C,6C). Polarization is dependent on microtu- served no RalA or RalB colocalization with endosomal markers in bules and the actin cytoskeleton (43), and Ral GTPases modu- YTS cells (data not shown), suggesting that these GTPases have late cytoskeleton dynamics though interaction with RalBP1 and a different location in NK cells. In some secretory cells, Ral filamin (44, 45). Further study is required to determine whether localizes to secreted vesicles (26–28). In NK cells, we found that these effectors are downstream of Ral in cell-mediated cytotoxicity. both RalA and RalB associated with lytic granules, which con- stitute a specialized type of lysosome called secretory lysosomes Acknowledgments (33); Ral GTPases associate with other secretory lysosomes such We thank G. Romera and H.T. Reyburn for help with culture of primary NK as the dense granules in platelets (28). This lysosome association cells, R. Spada for help with SC2 cell culture, A.C. Carrera for valuable is restricted to secretory lysosomes, as we did not detect coloc- discussion, and C. Mark for editorial assistance. alization of Ral GTPases and the lysosomal marker LAMP2 in Disclosures 293T cells (data not shown). The authors have no financial conflicts of interest. NK cells can use several mechanisms to lyse target cells, including release of cytotoxic proteins (perforin, granzyme) contained in lytic granules, and death receptor-mediated apoptosis of References arget cells via FasL upregulation and secretion of cytokines such 1. Stinchcombe, J. C., and G. M. Griffiths. 2007. Secretory mechanisms in cell- as TNF-a (34). Silencing of RalA and RalB resulted in deficient mediated cytotoxicity. Annu. Rev. Cell Dev. Biol. 23: 495–517. 2. Feldmann, J., I. Callebaut, G. Raposo, S. Certain, D. Bacq, C. Dumont, lytic granule release and impaired YTS cell cytotoxicity. These de- N. Lambert, M. Ouacheé-Chardin, G. Chedeville, H. Tamary, et al. 2003. fects in cytotoxic capacity were readily observed in short-term as- Munc13-4 is essential for cytolytic granules fusion and is mutated in a form of says; they were also visible, although less evident in the longer familial hemophagocytic lymphohistiocytosis (FHL3). Cell 115: 461–473. 3. Meńasche´, G., E. Pastural, J. Feldmann, S. Certain, F. Ersoy, S. Dupuis, term (compare JAM test to Alamar blue assay, Fig. 3A–D). These N. Wulffraat, D. Bianchi, A. Fischer, F. Le Deist, and G. de Saint Basile. 2000. results suggest either that the death receptor pathway compensates Mutations in RAB27A cause Griscelli syndrome associated with haemophago- cytic syndrome. Nat. Genet. 25: 173–176. the defective granule release in these cells or, more likely, that 4. zur Stadt, U., S. Schmidt, B. Kasper, K. Beutel, A. S. Diler, J. I. Henter, some degranulation takes place with slower kinetics in Ral- H. Kabisch, R. Schneppenheim, P. Nu¨rnberg, G. Janka, and H. C. Hennies. 2005. deficient cells. RalA and RalB share 85% amino acid sequence Linkage of familial hemophagocytic lymphohistiocytosis (FHL) type-4 to chromo- some 6q24 and identification of mutations in syntaxin 11. Hum. Mol. Genet. identity; despite this similarity, RalA and RalB are reported to 14: 827–834. have some specific, non-overlapping functions (35, 36). We found 5. Feig, L. A. 2003. Ral-GTPases: approaching their 15 minutes of fame. Trends that both isoforms contributed to cell-mediated cytotoxicity, al- Cell Biol. 13: 419–425. 6. Cantor, S. B., T. Urano, and L. A. Feig. 1995. Identification and characterization though our results suggest distinct functions for RalA and RalB. of Ral-binding protein 1, a potential downstream target of Ral GTPases. Mol. Interference with RalA impaired granule polarization and secre- Cell. Biol. 15: 4578–4584. 7. Moskalenko, S., D. O. Henry, C. Rosse, G. Mirey, J. H. Camonis, and M. A. White. tion, whereas RalB knockdown affected granule secretion but not 2002. The exocyst is a Ral effector complex. Nat. Cell Biol. 4: 66–72. polarization of the cytotoxic machinery. RalA involvement in two 8. Moskalenko, S., C. Tong, C. Rosse, G. Mirey, E. Formstecher, L. Daviet, separate cytotoxic steps could explain why killing efficiency in J. Camonis, and M. A. White. 2003. Ral GTPases regulate exocyst assembly through dual subunit interactions. J. Biol. Chem. 278: 51743–51748. long-term assays is lower for RalA- than for RalB-silenced cells 9. Frankel, P., A. Aronheim, E. Kavanagh, M. S. Balda, K. Matter, T. D. Bunney, (Fig. 3A). and C. J. Marshall. 2005. RalA interacts with ZONAB in a cell density- A critical step in cell-mediated cytotoxicity is the directed se- dependent manner and regulates its transcriptional activity. EMBO J. 24: 54–62. 10. Jiang, H., J. Q. Luo, T. Urano, P. Frankel, Z. Lu, D. A. Foster, and L. A. Feig. cretion of lytic granules at the immunological synapse, by which 1995. Involvement of Ral GTPase in v-Src-induced phospholipase D activation. lytic molecules are delivered specifically to the target cell and Nature 378: 409–412. 11. Luo, J. Q., X. Liu, S. M. Hammond, W. C. Colley, L. A. Feig, M. A. Frohman, neighboring cells are protected from damage. The octameric A. J. Morris, and D. A. Foster. 1997. RalA interacts directly with the Arf- exocyst complex regulates polarized vesicle secretion in several responsive, PIP2-dependent phospholipase D1. Biochem. Biophys. Res. Com- cell types. In basal conditions, exocyst hemicomplexes are located mun. 235: 854–859. 12. Sidhu, R. S., R. R. Clough, and R. P. Bhullar. 2005. Regulation of phospholipase in distinct vesicle compartments (8). We observed Sec8 mainly in C-delta1 through direct interactions with the small GTPase Ral and calmodulin. lytic granules, whereas Sec5 and Sec10 localized to other vesicles. J. Biol. Chem. 280: 21933–21941. Prior to their secretion at the immunological synapse, lytic gran- 13. TerBush, D. R., T. Maurice, D. Roth, and P. Novick. 1996. The exocyst is a multiprotein complex required for exocytosis in Saccharomyces cerevisiae. ules must mature through heterotypic vesicle fusion (37, 38). In EMBO J. 15: 6483–6494. The Journal of Immunology 2441

14. He, B., and W. Guo. 2009. The exocyst complex in polarized exocytosis. Curr. 31. Alter, G., J. M. Malenfant, and M. Altfeld. 2004. CD107a as a functional marker for Opin. Cell Biol. 21: 537–542. the identification of natural killer cell activity. J. Immunol. Methods 294: 15–22. 15. Sugihara, K., S. Asano, K. Tanaka, A. Iwamatsu, K. Okawa, and Y. Ohta. 2002. 32. Takaya, A., T. Kamio, M. Masuda, N. Mochizuki, H. Sawa, M. Sato, The exocyst complex binds the small GTPase RalA to mediate filopodia for- K. Nagashima, A. Mizutani, A. Matsuno, E. Kiyokawa, and M. Matsuda. 2007. mation. Nat. Cell Biol. 4: 73–78. R-Ras regulates exocytosis by Rgl2/Rlf-mediated activation of RalA on endo- 16. Shipitsin, M., and L. A. Feig. 2004. RalA but not RalB enhances polarized somes. Mol. Biol. Cell 18: 1850–1860. delivery of membrane proteins to the basolateral surface of epithelial cells. Mol. 33. Blott, E. J., and G. M. Griffiths. 2002. Secretory lysosomes. Nat. Rev. Mol. Cell Cell. Biol. 24: 5746–5756. Biol. 3: 122–131. 17. Wolthuis, R. M., B. Franke, M. van Triest, B. Bauer, R. H. Cool, J. H. Camonis, 34. Russell, J. H., and T. J. Ley. 2002. Lymphocyte-mediated cytotoxicity. Annu. J. W. Akkerman, and J. L. Bos. 1998. Activation of the small GTPase Ral in Rev. Immunol. 20: 323–370. platelets. Mol. Cell. Biol. 18: 2486–2491. 35. Cascone, I., R. Selimoglu, C. Ozdemir, E. Del Nery, C. Yeaman, M. White, and 18. Nociari, M. M., A. Shalev, P. Benias, and C. Russo. 1998. A novel one-step, J. Camonis. 2008. Distinct roles of RalA and RalB in the progression of cyto- highly sensitive fluorometric assay to evaluate cell-mediated cytotoxicity. J. kinesis are supported by distinct RalGEFs. EMBO J. 27: 2375–2387. Immunol. Methods 213: 157–167. 36. Chien, Y., and M. A. White. 2003. RAL GTPases are linchpin modulators of 19. Matzinger, P. 1991. The JAM test. A simple assay for DNA fragmentation and human tumour-cell proliferation and survival. EMBO Rep. 4: 800–806. cell death. J. Immunol. Methods 145: 185–192. 37. Meńager, M. M., G. Meńasche´, M. Romao, P. Knapnougel, C. H. Ho, M. Garfa, 20. Lee, S. H., S. Yun, J. Lee, M. J. Kim, Z. H. Piao, M. Jeong, J. W. Chung, G. Raposo, J. Feldmann, A. Fischer, and G. de Saint Basile. 2007. Secretory T. D. Kim, S. R. Yoon, P. D. Greenberg, and I. Choi. 2009. RasGRP1 is required cytotoxic granule maturation and exocytosis require the effector protein for human NK cell function. J. Immunol. 183: 7931–7938. hMunc13-4. Nat. Immunol. 8: 257–267. 21. Purdy, A. K., and K. S. Campbell. 2009. SHP-2 expression negatively regulates 38. Wood, S. M., M. Meeths, S. C. Chiang, A. G. Bechensteen, J. J. Boelens, NK cell function. J. Immunol. 183: 7234–7243. C. Heilmann, H. Horiuchi, S. Rosthøj, O. Rutynowska, J. Winiarski, et al. 2009. 22. Azuma, M., M. Cayabyab, D. Buck, J. H. Phillips, and L. L. Lanier. 1992. In- Different NK cell-activating receptors preferentially recruit Rab27a or Munc13- volvement of CD28 in MHC-unrestricted cytotoxicity mediated by a human 4 to perforin-containing granules for cytotoxicity. Blood 114: 4117–4127. natural killer leukemia cell line. J. Immunol. 149: 1115–1123. 39. Xu, L., P. Frankel, D. Jackson, T. Rotunda, R. L. Boshans, C. D’Souza-Schorey, 23. Chen, X., D. S. Allan, K. Krzewski, B. Ge, H. Kopcow, and J. L. Strominger. and D. A. Foster. 2003. Elevated phospholipase D activity in H-Ras- but not K- 2006. CD28-stimulated ERK2 phosphorylation is required for polarization of the Ras-transformed cells by the synergistic action of RalA and ARF6. Mol. Cell. microtubule organizing center and granules in YTS NK cells. Proc. Natl. Acad. Biol. 23: 645–654. Sci. USA 103: 10346–10351. 40. Balboa, M. A., J. Balsinde, J. Aramburu, F. Mollinedo, and M. Lo´pez-Botet. 24. Bryceson, Y. T., M. E. March, D. F. Barber, H. G. Ljunggren, and E. O. Long. 1992. Phospholipase D activation in human natural killer cells through the Kp43 2005. Cytolytic granule polarization and degranulation controlled by different and CD16 surface antigens takes place by different mechanisms. Involvement of receptors in resting NK cells. J. Exp. Med. 202: 1001–1012. the phospholipase D pathway in tumor necrosis factor alpha synthesis. J. Exp. 25. Kinsella, B. T., R. A. Erdman, and W. A. Maltese. 1991. Carboxyl-terminal Med. 176: 9–17. isoprenylation of ras-related GTP-binding proteins encoded by rac1, rac2, and 41. Galandrini, R., F. Micucci, I. Tassi, M. G. Cifone, B. Cinque, M. Piccoli, L. Frati, ralA. J. Biol. Chem. 266: 9786–9794. and A. Santoni. 2005. Arf6: a new player in FcgammaRIIIA lymphocyte- 26. Bielinski, D. F., H. Y. Pyun, K. Linko-Stentz, I. G. Macara, and R. E. Fine. 1993. mediated cytotoxicity. Blood 106: 577–583. Ral and Rab3a are major GTP-binding proteins of axonal rapid transport and 42. Milella, M., A. Gismondi, P. Roncaioli, G. Palmieri, S. Morrone, M. Piccoli, synaptic vesicles and do not redistribute following depolarization stimulated L. Frati, M. G. Cifone, and A. Santoni. 1999. Beta 1 integrin cross-linking synaptosomal exocytosis. Biochim. Biophys. Acta 1151: 246–256. inhibits CD16-induced phospholipase D and secretory phospholipase A2 activ- 27. de Leeuw, H. P., P. M. Wijers-Koster, J. A. van Mourik, and J. Voorberg. 1999. ity and granule exocytosis in human NK cells: role of phospholipase D in CD16- Small GTP-binding protein RalA associates with Weibel-Palade bodies in en- triggered degranulation. J. Immunol. 162: 2064–2072. dothelial cells. Thromb. Haemost. 82: 1177–1181. 43. Banerjee, P. P., R. Pandey, R. Zheng, M. M. Suhoski, L. Monaco-Shawver, and 28. Mark, B. L., O. Jilkina, and R. P. Bhullar. 1996. Association of Ral GTP-binding J. S. Orange. 2007. Cdc42-interacting protein-4 functionally links actin and protein with human platelet dense granules. Biochem. Biophys. Res. Commun. microtubule networks at the cytolytic NK cell immunological synapse. J. Exp. 225: 40–46. Med. 204: 2305–2320. 29. Polzin, A., M. Shipitsin, T. Goi, L. A. Feig, and T. J. Turner. 2002. Ral-GTPase 44. Boissel, L., N. Houssin, A. Chikh, A. Rynditch, L. Van Hove, and J. Moreau. influences the regulation of the readily releasable pool of synaptic vesicles. Mol. 2007. Recruitment of Cdc42 through the GAP domain of RLIP participates in Cell. Biol. 22: 1714–1722. remodeling of the actin cytoskeleton and is involved in Xenopus gastrulation. 30. Rondaij, M. G., R. Bierings, E. L. van Agtmaal, K. A. Gijzen, E. Sellink, Dev. Biol. 312: 331–343. A. Kragt, S. S. Ferguson, K. Mertens, M. J. Hannah, J. A. van Mourik, et al. 45. Ohta, Y., N. Suzuki, S. Nakamura, J. H. Hartwig, and T. P. Stossel. 1999. The 2008. Guanine exchange factor RalGDS mediates exocytosis of Weibel-Palade small GTPase RalA targets filamin to induce filopodia. Proc. Natl. Acad. Sci. bodies from endothelial cells. Blood 112: 56–63. USA 96: 2122–2128.