DOCSLIB.ORG

LINC01106 Post-Transcriptionally Regulates ELK3 and HOXD8 to Promote Bladder Cancer Progression Liwei Meng1,Zhaoquanxing1, Zhaoxin Guo1 and Zhaoxu Liu1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
LINC01106 Post-Transcriptionally Regulates ELK3 and HOXD8 to Promote Bladder Cancer Progression Liwei Meng1,Zhaoquanxing1, Zhaoxin Guo1 and Zhaoxu Liu1 Meng et al. Cell Death and Disease (2020) 11:1063 https://doi.org/10.1038/s41419-020-03236-9 Cell Death & Disease ARTICLE Open Access LINC01106 post-transcriptionally regulates ELK3 and HOXD8 to promote bladder cancer progression Liwei Meng1,ZhaoquanXing1, Zhaoxin Guo1 and Zhaoxu Liu1 Abstract Bladder cancer (BCa) is a kind of common urogenital malignancy worldwide. Emerging evidence indicated that long noncoding RNAs (lncRNAs) play critical roles in the progression of BCa. In this study, we discovered a novel lncRNA LINC01116 whose expression increased with stages in BCa patients and closely related to the survival rate of BCa patients. However, the molecular mechanism dictating the role of LINC01116 in BCa has not been well elucidated so far. In our study, we detected that the expression of LINC01116 was boosted in BCa cells. Moreover, the results of a series of functional assays showed that LINC01116 knockdown suppressed the proliferation, migration, and invasion of BCa cells. Thereafter, GEPIA indicated the closest correlation of LINC01116 with two protein-coding genes, ELK3 and HOXD8. Interestingly, LINC01116 was mainly a cytoplasmic lncRNA in BCa cells, and it could modulate ELK3 and HOXD8 at post-transcriptional level. Mechanically, LINC01116 increased the expression of ELK3 by adsorbing miR-3612, and also stabilized HOXD8 mRNA by binding with DKC1. Rescue experiments further demonstrated that the restraining influence of LINC01116 knockdown on the progression of BCa, was partly rescued by ELK3 promotion, but absolutely reversed by the co-enhancement of ELK3 and HOXD8. More intriguingly, HOXD8 acted as a transcription factor to activate LINC01116 in BCa. In conclusion, HOXD8-enhanced LINC01116 contributes to the progression of BCa 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; via targeting ELK3 and HOXD8, which might provide new targets for treating patients with BCa. Introduction necessary to find more effective therapeutic targets for Bladder cancer (BCa) is one of the most prevalent BCa treatment. urogenital malignancies all over the world1,2. The high Long noncoding RNAs (lncRNAs) are a kind of RNAs recurrence and mortality of BCa showed an increasing with more than 200 nucleotides and lacking protein- trend year by year3,4. Many factors participate in the coding potential11. In recent years, accumulating evi- tumorigenesis and progression of BCa, such as smoking, dence has indicated that lncRNAs play vital roles in the chemicals, and abnormal expression of genes5. In spite of biological processes of cancer cells12, including cell pro- great advancements in the treatment of BCa, the overall liferation, migration, invasion, and apoptosis. For exam- survival of high-risk patients is still not optimistic6,7.As ple, lncRNA CDKN2BAS promotes metastasis via far as we know, an increasing number of evidence has suppressing miR-153-5p and its upregulation predicts reported the importance of abnormally expressed genes in poor prognosis in patients with hepatocellular carci- BCa progression8,9. On this basis, targeted therapy has noma13. Linc00472 suppresses cell proliferation and developed as a new road for treating patients with BCa, promotes cell apoptosis by sponging miR-196a to upre- especially those with advanced BCa10. Therefore, it is gulate PDCD4 expression in colorectal cancer14. B3GALT5-AS1 suppresses liver metastasis via inhibiting miRNA-203 in colon cancer15. Similarly, there are also a Correspondence: Zhaoxu Liu ([email protected]) 1Qilu Hospital of Shandong University, Jinan 250000 Shandong Province, China number of lncRNAs that have been identified as tumor Edited by B. Rotblat © The Author(s) 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a linktotheCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Official journal of the Cell Death Differentiation Association Meng et al. Cell Death and Disease (2020) 11:1063 Page 2 of 15 promoters or tumor suppressors in BCa, such as Total RNA isolation and quantitative real-time polymerase LINC0160516 and GAS517. Nonetheless, most other chain reaction (RT-qPCR) lncRNAs affecting the development of BCa have not been Total RNA was isolated from the cultured cells employing unveiled. In this research, we aim to explore potential the Trizol reagent (Invitrogen), and reverse transcribed into lncRNAs related to the progression of BCa. cDNA as instructed by the provider (Takara, Shiga, Japan). Accumulating reports have indicated that LINC01116 Gene expression was examined by qPCR using the Prism plays a vital part in many cancers. For all we know, 7900 HT Fast Real-Time PCR system (Applied Biosystems, LINC01116 promotes the development of breast cancer by Foster City, CA), and defined using the threshold cycle (Ct). −ΔΔ combining with miR-145 to upregulate the expression of The relative level was calculated by 2 CT after standar- ESR118. Besides, LINC01116 also accelerates the progres- dization with reference to GAPDH or U6 expression. sion of epithelial ovarian cancer by means of regulating cell apoptosis19. Moreover, LINC01116 knockdown inhi- Plasmid transfection bits the progression of oral squamous cell carcinoma by The designed shRNAs for LINC01116, DKC1, ELK3, regulating the expression of miR-13620. Such broad and HOXD8, as well as NC-shRNAs (sh-NC) were pro- oncogenic function of LINC01116 in different cancer types cured from Ribobio (Guangzhou, China) and transfected ™ aroused our interest in its role in BCa. More importantly, into J82 and T24 cells using Lipofectamine 3000 (Invi- according to data from GEPIA 2 database, we found that trogen). The miR-3612 mimics/inhibitor and NC mimics/ LINC01116 has overexpressed in patients with an inhibitor, as well as pcDNA3.1/ELK3, pcDNA3.1/ advanced stages of bladder urothelial carcinoma (BLCA), HOXD8, and NC-pcDNA3.1 were also produced by and the high expression of LINC01116 was associated with Ribobio. After 48 h, transfected cells were reaped. a low-survival rate in BLCA patients. Therefore, we planned to further explore the role of LINC01116 in BCa. Colony formation assay As is reported, lncRNAs can regulate the expression of Clonogenic J82 and T24 cells at the density of 500 cells protein-coding genes on the level of transcription or after were seeded into a 6-well plate for 14-day incubation. The transcription, which mainly depends on the interaction of clones were initially fixed by 4% paraformaldehyde and lncRNAs with microRNAs (miRNAs)21 or RNA-binding then counted manually after staining in 0.1% crystal violet. proteins22 in the cytoplasm or nucleus. In our study, we applied GEPIA 2 and figured out two protein-coding EdU assay genes (ELK3 and HOXD8) that were most significantly J82 and T24 cells at a density of 5 × 104 were planted correlated with LINC01116 in BLCA tumors. In addition, into the 96-well plate, and then cultured with EdU med- ELK323 and HOXD824 were also reported to be involved ium diluent for 2 h in light of the direction (Ribobio). in the progression of diverse cancer types. Hence, we After fixing and permeabilizing, cells were incubated in made an in-depth exploration of the relationship between DAPI solution, followed by observing by fluorescence LINC01116 and ELK3/HOXD8 in BCa. microscopy (Olympus, Tokyo, Japan). In summary, we aim to explore the biological role of LINC01116 in BCa and uncover its potential mechanisms JC-1 assay in regulating BCa progression. Meanwhile, we first mea- Cells in 96-well microplate were centrifuged for 5 min sured the relative expression of LINC01116 in BCa cells. and then loaded with JC-1 dye for 30 min after removing Further, in vitro experiments were employed to elucidate the culture medium. A fluorescent plate reader was the function as well as the molecular mechanisms of applied for the detection of mitochondrial transmembrane LINC01116 in BCa cells. The findings might be favorable potential (ΔΨm). Images were acquired by using fluores- for providing a novel target for the treatment of BCa. cence microscopy. Materials and methods Flow cytometry assay Cell lines and reagent Totally, 2 × 105 J82 and T24 cells were washed in pre- Human bladder epithelial cell line (SV-HUC-1) and cooled PBS and then collected for detecting cell apoptosis human BCa cell lines (RT-4, 5637, J82, T24) were all using Annexin V-FITC/PI Apoptosis kit as per user available from ATCC Company (Manassas, VA). They manual (Life Technologies, Carlsbad, CA). Following were grown in DMEM (Invitrogen, Carlsbad, CA) under 15 min of incubation in dark, apoptotic cells were exam- 37 °C in 95% air/5% CO2 incubator, with 1% antibiotics ined by flow cytometer. mixture and 10% FBS as the medium supplements. Totally, 2 mg/ml of Actinomycin D (ActD; Sigma- Animal experiment Aldrich,St.Louis,MO)wasacquiredfortestingmRNA The 6-week-old male BALB/C nude mice were pur- stability. chased from Beijing Vital River Laboratory Animal Official journal of the Cell Death Differentiation Association Meng et al. Cell Death and Disease (2020) 11:1063 Page 3 of 15 Technology Co. Ltd. (Beijing, China), and used under the Subcellular fraction approval of the Animal Research Ethics Committee of After washing in precooled PBS, 1 × 106 J82, and T24 Qilu Hospital of Shandong University. For xenograft cells were centrifuged at 500 × g and then processed with ™ tumor assay, 1 × 106 transfected BCa cells were prepared PARIS Kit (Invitrogen) for subcellular fraction assay.
Load more

Recommended publications
  • Long Noncoding RNA and Cancer: a New Paradigm Arunoday Bhan, Milad Soleimani, and Subhrangsu S
    Published OnlineFirst July 12, 2017; DOI: 10.1158/0008-5472.CAN-16-2634 Cancer Review Research Long Noncoding RNA and Cancer: A New Paradigm Arunoday Bhan, Milad Soleimani, and Subhrangsu S. Mandal Abstract In addition to mutations or aberrant expression in the moting (oncogenic) functions. Because of their genome-wide protein-coding genes, mutations and misregulation of noncod- expression patterns in a variety of tissues and their tissue- ing RNAs, in particular long noncoding RNAs (lncRNA), appear specific expression characteristics, lncRNAs hold strong prom- to play major roles in cancer. Genome-wide association studies ise as novel biomarkers and therapeutic targets for cancer. In of tumor samples have identified a large number of lncRNAs this article, we have reviewed the emerging functions and associated with various types of cancer. Alterations in lncRNA association of lncRNAs in different types of cancer and dis- expression and their mutations promote tumorigenesis and cussed their potential implications in cancer diagnosis and metastasis. LncRNAs may exhibit tumor-suppressive and -pro- therapy. Cancer Res; 77(15); 1–17. Ó2017 AACR. Introduction lncRNAs (lincRNA) originate from the region between two pro- tein-coding genes; enhancer lncRNAs (elncRNA) originate from Cancer is a complex disease associated with a variety of genetic the promoter enhancer regions; bidirectional lncRNAs are local- mutations, epigenetic alterations, chromosomal translocations, ized within the vicinity of a coding transcript of the opposite deletions, and amplification (1). Noncoding RNAs (ncRNA) are strand; sense-overlapping lncRNAs overlap with one or more an emerging class of transcripts that are coded by the genome but introns and exons of different protein-coding genes in the sense are mostly not translated into proteins (2).
    [Show full text]
  • Genetic Characterization of Endometriosis Patients: Review of the Literature and a Prospective Cohort Study on a Mediterranean Population
    International Journal of Molecular Sciences Article Genetic Characterization of Endometriosis Patients: Review of the Literature and a Prospective Cohort Study on a Mediterranean Population Stefano Angioni 1,*, Maurizio Nicola D’Alterio 1,* , Alessandra Coiana 2, Franco Anni 3, Stefano Gessa 4 and Danilo Deiana 1 1 Department of Surgical Science, University of Cagliari, Cittadella Universitaria Blocco I, Asse Didattico Medicna P2, Monserrato, 09042 Cagliari, Italy; [email protected] 2 Department of Medical Science and Public Health, University of Cagliari, Laboratory of Genetics and Genomics, Pediatric Hospital Microcitemico “A. Cao”, Via Edward Jenner, 09121 Cagliari, Italy; [email protected] 3 Department of Medical Science and Public Health, University of Cagliari, Cittadella Universitaria di Monserrato, Asse Didattico E, Monserrato, 09042 Cagliari, Italy; [email protected] 4 Laboratory of Molecular Genetics, Service of Forensic Medicine, AOU Cagliari, Via Ospedale 54, 09124 Cagliari, Italy; [email protected] * Correspondence: [email protected] (S.A.); [email protected] (M.N.D.); Tel.: +39-07051093399 (S.A.) Received: 31 January 2020; Accepted: 2 March 2020; Published: 4 March 2020 Abstract: The pathogenesis of endometriosis is unknown, but some evidence supports a genetic predisposition. The purpose of this study was to evaluate the recent literature on the genetic characterization of women affected by endometriosis and to evaluate the influence of polymorphisms of the wingless-type mammalian mouse tumour virus integration
    [Show full text]
  • EXTENDED MATERIALS and METHODS Animal Experimentation. All Experiments Were Performed in Agreement with the Swiss Law on Animal
    EXTENDED MATERIALS AND METHODS Animal experimentation. All experiments were performed in agreement with the Swiss law on animal protection (LPA), under license No GE 81/14 (to DD). In situ hybridization. Whole mount in situ hybridizations were performed as described in (Woltering et al., 2014). Probes for the Hoxa11, Hoxa13, Hoxd8, Hoxd10, Hoxd12, Hoxd13 and Evx2 genes were synthetized and purified as previously reported (Herault et al., 1996; Woltering et al., 2014). Plasmids encoding the cDNAs of the Prrx2 and Dbx2 genes were purchased from Addgene and probes were synthetized as previously reported (Pierani et al., 1999; Stelnicki et al., 1998). Right or left forelimbs were dissected from stained embryos and photographied dorsally with a Leica MZ16 stereomicroscope. Pictures from left forelimbs are displayed inverted. RNA extraction. Total RNA was extracted from individual pairs of either wild type or double Hox13-/- mutant proximal and distal forelimb buds, using the RNeasy Micro Kit (Qiagen) following manufacturer instructions. A total of 100ng of pure total RNA was amplified following standard Illumina procedure for polyA-selected RNA. RNA-seq data generation. RNA sequencing (RNA-seq) libraries were prepared with the Illumina TruSeq Stranded mRNA protocol and sequenced on a HiSeq 2500 machine, as single-end, 100 base pairs (bp) reads. The preparation of libraries and sequencing were performed by the genomic platform of the University of Geneva. RNA-seq data analysis. A mutant version of the genome, encoding the Hoxd13/LacZ and the Hoxa13/Neo+ alleles (Fromental-Ramain et al., 1996; Kondo et al., 1998), was assembled and annotated and used as reference genome to map the Hoxa13-/- and Hoxd13-/- RNA-seq data.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • CDKN2A and CDKN2B Methylation in Coronary Heart Disease Cases and Controls
    EXPERIMENTAL AND THERAPEUTIC MEDICINE 14: 6093-6098, 2016 CDKN2A and CDKN2B methylation in coronary heart disease cases and controls JINYAN ZHONG1,2*, XIAOYING CHEN3*, HUADAN YE3, NAN WU1,3, XIAOMIN CHEN1 and SHIWEI DUAN3 1Cardiology Center, Ningbo First Hospital, Ningbo University; 2Department of Cardiology, Ningbo Second Hospital, Ningbo, Zhejiang 315010; 3Medical Genetics Center, School of Medicine, Ningbo University, Ningbo, Zhejiang 315211, P.R. China Received May 27, 2016; Accepted March 24, 2017 DOI: 10.3892/etm.2017.5310 Abstract. The aim of the present study was to investigate frequencies were significantly associated with age, and there the association between cyclin-dependent kinase inhibitor was a gender dimorphism in CDKN2B methylation. 2A (CDKN2A) and cyclin-dependent kinase inhibitor 2B (CDKN2B) methylation, and coronary heart disease (CHD), Introduction and to explore the interaction between methylation status and CHD clinical characteristics in Han Chinese patients. A total Coronary heart disease (CHD) is a complex chronic disease of 189 CHD (96 males, 93 females) and 190 well-matched that is caused by an imbalance between blood supply and non-CHD controls (96 males, 94 females) were recruited for demand in myocardium. Various environmental and genetic the study. Methylation-specific polymerase chain reaction factors are known to contribute to onset and development of technology was used to examine gene promoter methylation CHD (1). As of 2010, CHD was the leading cause of mortality status. Comparisons of methylation frequencies between CHD globally, resulting in over 7 million cases of mortality (2). and non-CHD patients were carried out using the Chi-square Therefore, association studies for CHD biomarkers have been test.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Hoxd Cluster Scanning Deletions Identify Multiple Defects Leading to Paralysis in the Mouse Mutant Ironside
    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press HoxD cluster scanning deletions identify multiple defects leading to paralysis in the mouse mutant Ironside Basile Tarchini,1 Thi Hanh Nguyen Huynh,1 Greg A. Cox,2 and Denis Duboule1,3 1National Research Centre ‘Frontiers in Genetics’ and Department of Zoology and Animal Biology, University of Geneva, 1211 Geneva 4, Switzerland; 2The Jackson Laboratory, Bar Harbor, Maine 04609, USA A spontaneous semidominant mutation (Ironside, Irn) was isolated in mice, leading to severe hindlimb paralysis following multiple deletions in cis at the HoxD locus. To understand its cellular and molecular etiology, we embarked on a comparative analysis using systematic HoxD cluster deletions, produced via targeted meiotic recombination (TAMERE). Different lines of mice were classified according to the severity of their paralyses, and subsequent analyses revealed that multiple causative factors were involved, alone or in combination, in the occurrence of this pathology. Among them are the loss of Hoxd10 function, the sum of remaining Hoxd gene activity, and the ectopic gain of function of the neighboring gene Evx2, all contributing to the mispositioning, the absence, or misidentification of specific lumbo-sacral pools of motoneurons, nerve root homeosis, and hindlimb innervation defects. These results highlight the importance of a systematic approach when studying such clustered gene families, and give insights into the function and regulation of Hox and Evx2 genes during early spinal cord development. [Keywords: Homeosis; peroneal nerve; chromosome engineering; motoneuron] Supplemental material is available at http://www.genesdev.org. Received May 11, 2005; revised version accepted October 3, 2005.
    [Show full text]
  • With Coronary Heart Disease: a Case-Control Study and a Meta-Analysis
    Int. J. Mol. Sci. 2014, 15, 17478-17492; doi:10.3390/ijms151017478 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422–0067 www.mdpi.com/journal/ijms Article Association of CDKN2BAS Polymorphism rs4977574 with Coronary Heart Disease: A Case-Control Study and a Meta-Analysis Yi Huang 1, Huadan Ye 2, Qingxiao Hong 2, Xuting Xu 2, Danjie Jiang 2, Limin Xu 2, Dongjun Dai 2, Jie Sun 1, Xiang Gao 1,* and Shiwei Duan 2,* 1 Department of Neurosurgery, Ningbo First Hospital, Ningbo 315010, China; E-Mails: [email protected] (Y.H.); [email protected] (J.S.) 2 Zhejiang Provincial Key Laboratory of Pathophysiology, School of Medicine, Ningbo University, Ningbo 315211, China; E-Mails: [email protected] (H.Y.); [email protected] (Q.H.); [email protected] (X.X.); [email protected] (D.J.); [email protected] (L.X.); [email protected] (D.D.) * Authors to whom correspondence should be addressed; E-Mails: [email protected] (X.G.); [email protected] (S.D.); Tel./Fax: +86-574-8708-5517 (X.G.); +86-574-8760-9950 (S.D.). External Editor: Camile S. Farah Received: 22 July 2014; in revised form: 12 September2014 / Accepted: 17 September 2014 / Published: 29 September 2014 Abstract: The goal of our study was to explore the significant association between a non-protein coding single nucleotide polymorphism (SNP) rs4977574 of CDKN2BAS gene and coronary heart disease (CHD). A total of 590 CHD cases and 482 non-CHD controls were involved in the present association study. A strong association of rs4977574 with CHD was observed in females (genotype: p = 0.002; allele: p = 0.002, odd ratio (OR) = 1.57, 95% confidential interval (CI) = 1.18–2.08).
    [Show full text]
  • Nanoscale Spatial Organization of the Hoxd Gene Cluster in Distinct Transcriptional States
    Nanoscale spatial organization of the HoxD gene cluster in distinct transcriptional states Pierre J. Fabrea, Alexander Benkeb, Elisabeth Joyea, Thi Hanh Nguyen Huynhc, Suliana Manleyb,1, and Denis Duboulea,c,1 aSchool of Life Sciences, Ecole Polytechnique Fédérale de Lausanne, 1015 Lausanne, Switzerland; bLaboratory of Experimental Biophysics, Ecole Polytechnique Fédérale de Lausanne, 1015 Lausanne, Switzerland; and cDepartment of Genetics and Evolution, University of Geneva, 1211 Geneva 4, Switzerland Contributed by Denis Duboule, September 14, 2015 (sent for review July 21, 2015; reviewed by Victor Corces and Luca Giorgetti) Chromatin condensation plays an important role in the regulation 2-megabase large DNA interval (18). Recently, this gene cluster, of gene expression. Recently, it was shown that the transcriptional similar to its HoxA relative (14, 15), was shown to reside at activation of Hoxd genes during vertebrate digit development in- a boundary between two TADs (located ca. between Hoxd11 volves modifications in 3D interactions within and around the and Hoxd12), with each TAD containing enhancers required to HoxD gene cluster. This reorganization follows a global transition regulate different subgroups of genes in developing organs or from one set of regulatory contacts to another, between two to- structures (9, 16, 19) such as distal limbs, proximal limbs, geni- pologically associating domains (TADs) located on either side of tals, or the cecum. Interestingly, all enhancers sharing a partic- the HoxD locus. Here, we use 3D DNA FISH to assess the spatial ular specificity are found within the same TAD, and thus far, no organization of chromatin at and around the HoxD gene cluster cell type or tissue was reported where these two opposite regu- and report that although the two TADs are tightly associated, they latory landscapes would operate concomitantly (8, 16, 17, 19), appear as spatially distinct units.
    [Show full text]
  • Common Variants at 9P21 and 8Q22 Are Associated with Increased Susceptibility to Optic Nerve Degeneration in Glaucoma
    Common Variants at 9p21 and 8q22 Are Associated with Increased Susceptibility to Optic Nerve Degeneration in Glaucoma The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Wiggs, Janey L. et al. “Common Variants at 9p21 and 8q22 Are Associated with Increased Susceptibility to Optic Nerve Degeneration in Glaucoma.” Ed. Gregory S. Barsh. PLoS Genetics 8.4 (2012): e1002654. Web. As Published http://dx.doi.org/10.1371/journal.pgen.1002654 Publisher Public Library of Science Version Final published version Citable link http://hdl.handle.net/1721.1/71760 Terms of Use Creative Commons Attribution Detailed Terms http://creativecommons.org/licenses/by/2.5/ Common Variants at 9p21 and 8q22 Are Associated with Increased Susceptibility to Optic Nerve Degeneration in Glaucoma Janey L. Wiggs1.*, Brian L. Yaspan2., Michael A. Hauser3, Jae H. Kang4, R. Rand Allingham3, Lana M. Olson2, Wael Abdrabou1, Bao J. Fan1, Dan Y. Wang1, Wendy Brodeur5, Donald L. Budenz6, Joseph Caprioli7, Andrew Crenshaw5, Kristy Crooks3, Elizabeth DelBono1, Kimberly F. Doheny8, David S. Friedman9, Douglas Gaasterland10, Terry Gaasterland11, Cathy Laurie12, Richard K. Lee13, Paul R. Lichter14, Stephanie Loomis1,4, Yutao Liu3, Felipe A. Medeiros15, Cathy McCarty16, Daniel Mirel5, Sayoko E. Moroi14, David C. Musch14,17, Anthony Realini18, Frank W. Rozsa14, Joel S. Schuman19, Kathleen Scott14, Kuldev Singh20, Joshua D. Stein14, Edward H. Trager14, Paul VanVeldhuisen21, Douglas Vollrath22, Gadi Wollstein19, Sachiko Yoneyama14,17, Kang Zhang15, Robert N. Weinreb15, Jason Ernst5,23, Manolis Kellis5,23, Tomohiro Masuda9, Don Zack9, Julia E. Richards14,17, Margaret Pericak- Vance24, Louis R. Pasquale1,4", Jonathan L.
    [Show full text]
  • HOXD8 Exerts a Tumor-Suppressing Role in Colorectal Cancer As an Apoptotic Inducer
    HOXD8 exerts a tumor-suppressing role in colorectal cancer as an apoptotic inducer Mohammed A. Mansour1, Takeshi Senga2 1Biochemistry Division, Department of Chemistry, Faculty of Science, Tanta University, Tanta 31527, Egypt 2Division of Cancer Biology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa, Nagoya, 466-8550 Japan Address correspondence to: Mohammed A. Mansour; Biochemistry division, Department of Chemistry, Faculty of Science, Tanta University, Tanta 31527, Egypt; E-mail: [email protected] Running title: HOXD8 suppresses colorectal cancer progression Keywords: Colorectal Cancer; HOXD8; homology modeling; TCGA; STK38; MYC; Apoptosis Conflict-of-interest statement: The authors declare that they have no conflict of interest. The data sharing statement: No additional data are available. Abstract Homeobox (HOX) genes are conserved transcription factors which determine the anterior- posterior body axis patterning. HOXD8 is a member of HOX genes deregulated in several tumors such as lung carcinoma, neuroblastoma, glioma and colorectal cancer (CRC) in a context-dependent manner. In CRC, HOXD8 is downregulated in cancer tissues and metastatic foci as compared to normal tissues. Whether HOXD8 acts as a tumor suppressor of malignant progression and metastasis is still unclear. Also, the underlying mechanism of its function including the downstream targets is totally unknown. Here, we clarified the lower expression of HOXD8 in clinical colorectal cancer vs. normal colon tissues. Also, we showed that stable expression of HOXD8 in colorectal cancer cells significantly reduced the cell proliferation, anchorage-independent growth and invasion. Further, using The Cancer Genome Atlas (TCGA), we identified the genes associated with HOXD8 in order to demonstrate its function as a suppressor or a promoter of colorectal carcinoma.
    [Show full text]
  • Comprehensive Epigenome Characterization Reveals Diverse Transcriptional Regulation Across Human Vascular Endothelial Cells
    Nakato et al. Epigenetics & Chromatin (2019) 12:77 https://doi.org/10.1186/s13072-019-0319-0 Epigenetics & Chromatin RESEARCH Open Access Comprehensive epigenome characterization reveals diverse transcriptional regulation across human vascular endothelial cells Ryuichiro Nakato1,2† , Youichiro Wada2,3*†, Ryo Nakaki4, Genta Nagae2,4, Yuki Katou5, Shuichi Tsutsumi4, Natsu Nakajima1, Hiroshi Fukuhara6, Atsushi Iguchi7, Takahide Kohro8, Yasuharu Kanki2,3, Yutaka Saito2,9,10, Mika Kobayashi3, Akashi Izumi‑Taguchi3, Naoki Osato2,4, Kenji Tatsuno4, Asuka Kamio4, Yoko Hayashi‑Takanaka2,11, Hiromi Wada3,12, Shinzo Ohta12, Masanori Aikawa13, Hiroyuki Nakajima7, Masaki Nakamura6, Rebecca C. McGee14, Kyle W. Heppner14, Tatsuo Kawakatsu15, Michiru Genno15, Hiroshi Yanase15, Haruki Kume6, Takaaki Senbonmatsu16, Yukio Homma6, Shigeyuki Nishimura16, Toutai Mitsuyama2,9, Hiroyuki Aburatani2,4, Hiroshi Kimura2,11,17* and Katsuhiko Shirahige2,5* Abstract Background: Endothelial cells (ECs) make up the innermost layer throughout the entire vasculature. Their phe‑ notypes and physiological functions are initially regulated by developmental signals and extracellular stimuli. The underlying molecular mechanisms responsible for the diverse phenotypes of ECs from diferent organs are not well understood. Results: To characterize the transcriptomic and epigenomic landscape in the vascular system, we cataloged gene expression and active histone marks in nine types of human ECs (generating 148 genome‑wide datasets) and carried out a comprehensive analysis with chromatin interaction data. We developed a robust procedure for comparative epigenome analysis that circumvents variations at the level of the individual and technical noise derived from sample preparation under various conditions. Through this approach, we identifed 3765 EC‑specifc enhancers, some of which were associated with disease‑associated genetic variations.
    [Show full text]