DOCSLIB.ORG

Genetic Analysis of FBXO2, FBXO6, FBXO12, and FBXO41 Variants in Han Chinese Patients with Sporadic Parkinson’S Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Analysis of FBXO2, FBXO6, FBXO12, and FBXO41 Variants in Han Chinese Patients with Sporadic Parkinson’S Disease Neurosci. Bull. October, 2017, 33(5):510–514 www.neurosci.cn DOI 10.1007/s12264-017-0122-5 www.springer.com/12264 REPORT Genetic Analysis of FBXO2, FBXO6, FBXO12, and FBXO41 Variants in Han Chinese Patients with Sporadic Parkinson’s Disease 1,2 2 1 1 2 Lamei Yuan • Zhi Song • Xiong Deng • Zhijian Yang • Yan Yang • 3 1 1,2 Yi Guo • Hongwei Lu • Hao Deng Received: 24 October 2016 / Accepted: 22 January 2017 / Published online: 24 March 2017 Ó Shanghai Institutes for Biological Sciences, CAS and Springer Science+Business Media Singapore 2017 Abstract Parkinson’s disease (PD) is the second most Keywords Parkinson’s disease Á FBXO2 Á FBXO6 Á common neurodegenerative disorder and has an elusive FBXO12 Á FBXO41 Á Variant etiology. It is likely multifactorial, and genetic defects contribute to its pathogenesis. At least 25 genetic loci and 20 monogenic genes have been identified in monogenic Introduction PD. Recessive F-box protein 7 gene (FBXO7) mutations reportedly cause hereditary parkinsonism. To explore the Parkinson’s disease (PD, OMIM 168600) is a common, roles of four paralogs (FBXO2, FBXO6, FBXO12, and progressive, multifactorial, neurodegenerative disease FBXO41) in PD development, their variants (rs9614, caused by genetic and environmental risk factors [1–3]. It rs28924120, rs6442117, and rs61733550, respectively) is age-related, affecting *1% of the population over 60 were analyzed in 502 Han Chinese patients with PD and years of age, rising to 4% in people over 85 [4, 5]. Motor 556 age, gender, and ethnicity-matched normal participants parkinsonism, defined as bradykinesia plus rigidity or rest in mainland China. Statistically significant differences in tremor, is the cardinal clinical feature [6]. Other motor and genotypic and allelic frequencies were detected only in the non-motor symptoms are also frequently observed in PD FBXO2 variant rs9614 (P = 0.001 and 0.023, respectively; [7]. Pathologically, PD cases have dopaminergic neuronal odds ratio 0.819, 95% confidence interval 0.690–0.973) loss in the substantia nigra pars compacta. Lewy bodies, between patients and controls. These results suggest that which are substantial intracytoplasmic inclusions with the FBXO2 variant rs9614 C allele may decrease the PD ubiquitylated alpha-synuclein, form in surviving neurons risk in mainland Han Chinese and may be a biomarker for [7, 8]. Degeneration and death of dopaminergic neurons in PD. PD are postulated to result from pivotal cellular system impairments, including oxidative stress, mitochondrial dysfunction, disrupted proteolysis referring to the ubiqui- tin-proteasome system or lysosomal autophagy, neuroin- flammation, and/or excitotoxicity [9–11]. Although the & Hongwei Lu pathogenic mechanisms remain unclear, at least 25 loci and [email protected] 20 disease-linked genes have been identified to be & Hao Deng responsible for monogenic PD [7, 12–14]. It has been [email protected] reported that mutations in a critical domain of a gene such as leucine-rich repeat kinase 2 (LRRK2) can cause mono- 1 Center for Experimental Medicine, The Third Xiangya Hospital, Central South University, Changsha 410013, China genic PD, whereas variants in a non-crucial region may either increase the risk or play a protective role [15–17]. 2 Department of Neurology, The Third Xiangya Hospital, Central South University, Changsha 410013, China Known heritable components are responsible for 5%–10% of PD patients. Most cases are sporadic forms resulting 3 Department of Medical Information, Information Security and Big Data Research Institute, Central South University, from a combination of multiple factors [13, 18]. It has been Changsha 410013, China proposed that variants, particularly nucleotide alterations 123 L. Yuan et al.: FBXO2, FBXO6, FBXO12, and FBXO41 Variants in PD 511 causing amino-acid changes in disease-causing genes or F-box genes, including the FBXO7 gene. Four variants in their biologically relevant paralogous genes, play a role in the paralogs of the FBXO7 gene with a frequency [5%, the risk of sporadic PD [12, 19–21]. It has been reported rs9614 (c.353A[C, p.K118T), rs28924120 (c.840G[C, that homozygous or compound heterozygous mutations in p.E280D), rs6442117 (c.496T[C, p.W166R), and the F-box protein 7 gene (FBXO7, OMIM 605648) cause rs61733550 (c.1568G[A, p.R523H), were obtained from hereditary parkinsonism including parkinsonian-pyramidal the public database of single-nucleotide polymorphisms syndrome and typical PD (PARK15, OMIM 260300). This (http://www.ncbi.nlm.nih.gov/SNP/). They were described aroused our interest in evaluating the roles of the F-box as putatively damaging by the bioinformatics tools Sorting gene family [22–25]. In this study, four variants (rs9614, Intolerant from Tolerant (http://sift.jcvi.org/), Polymor- rs28924120, rs6442117, and rs61733550) in the paralogs of phism Phenotyping version 2 (http://genetics.bwh.harvard. FBXO7 (FBXO2, FBXO6, FBXO12, and FBXO41), which edu/pph2/), or MutationTaster (http://www.mutationtaster. putatively alter amino-acids and affect protein functions, org/). No FBXO7 gene variants matched the criteria. The were studied in Han Chinese PD patients. four variants were genotyped using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry following protocols in the iPLEXTM Gold Materials and Methods Application Guide (Agena Bioscience, San Diego, CA) to reveal any potential involvement in PD pathogenesis Participants [20, 29]. Genomic DNA was extracted from peripheral blood using standard protocols [30]. Primers amplifying We recruited 502 patients with sporadic PD (65.7 ± 10.2 short segments for mass spectrometry were designed using years; onset age, 62.3 ± 7.6 years, 63 cases with onset age Sequenom Assay Design 3.1 software (Sequenom Inc., San B50 years; disease duration, 1–26 years; male/female ratio, Diego, CA) and are shown in Table 1. Multiplex and sin- 302/200) and 556 age-, sex-, and ethnicity-matched healthy gle-base extension reactions generated allele-specific short individuals (65.9 ± 10.1 years, male/female ratio, 335/221) products for the MALDI-TOF mass spectrometry assay. from the Third Xiangya Hospital of Central South MassARRAY Typer 4.0 software (Sequenom) obtained the University, Changsha, China. All patients resided in south genotype of samples from spectral peaks [31]. Mass China and were not related. All were examined by expe- spectrometric genotyping concordance was tested by per- rienced neurologists, and the diagnosis of PD was estab- forming Sanger sequencing in 8% of randomized samples lished according to clinical criteria [6, 26]. Written with the Applied Biosystems 3500 Genetic Analyzer (Life informed consent was given by all participants prior to Technologies, Foster City, CA) [20, 30]. Primer pairs for enrollment. This study was approved by the Institutional locus-specific amplification and sequencing were designed Review Board of the Third Xiangya Hospital of Central using online Primer3 (http://primer3.ut.ee/, Table 1), and South University, Changsha, China. the specificity was checked using Primer-BLAST (http:// Some patients were negative for causative mutations in www.ncbi.nlm.nih.gov/tools/primer-blast). PD-associated genes. The following occurred in the fol- lowing percentages of patients: no vacuolar protein sorting Statistical Analysis 35 gene (VPS35) mutations in 24.1% (121/502), no F-box protein 48 gene (FBXO48) mutations in 65.7% (330/502), Statistical analysis was performed using Predictive Ana- or no mutations in the S100 calcium binding protein B gene lytics Software Statistics 18.0 (SPSS Inc., Chicago, IL). (S100B), the alpha-synuclein gene (SNCA), or the RAB39B Genotype and allele frequencies were calculated, and gene (RAB39B, member of RAS oncogene family) in Pearson’s v2 test was applied to genotypic and allelic fre- 74.9% (376/502) [27]. Of those tested, 59.2% (297/502) quency differences. A two-sided P value of 0.05 was set as were negative for point mutations (p.A502V and the threshold for statistical significance [20]. p.R1205H) in the eukaryotic translation initiation factor 4 gamma 1 gene (EIF4G1), and 97.6% (490/502) had no rs10788972 or rs12046178 variants in the transcription Results and Discussion elongation factor A N-terminal and central domain con- taining 2 gene (TCEANC2) [21, 28]. The genotypic and allelic frequencies are summarized in Table 2. No deviation from Hardy-Weinberg equilibrium Variant Genotyping was evident in the normal control cohort (P [0.05). Sta- tistically significant differences in genotypic and allelic The National Center for Biotechnology Information data- frequencies were identified in the FBXO2 variant rs9614 base (http://www.ncbi.nlm.nih.gov/) was used to search for between patients and controls (P = 0.001 and 0.023, 123 512 123 Table 1 Primer sequences for rs9614, rs28924120, rs6442117, and rs61733550. rs9614 rs28924120 rs6442117 rs61733550 Forward primer sequence for amplicon acgttggatgACTGGCA acgttggatgTCTGGACAA acgttggatgAGATGCATCT acgttggatgTGATGACCTCATTGGAGCGT 1a (50?30) GCAGTTCTACTTC CAGCTCGGTAG CGCCATCACT Reverse primer sequence for amplicon acgttggatgTTTCGGCC acgttggatgAACAGCAG acgttggatgATGCAATAAC acgttggatgTCCACGCTCACTTTTGAACC 1a (50?30) CATTTCGCAGCA CATTGTCGTCAG AGGGCTGTGG Amplicon 1 length (bp) 121 121 109 110 Extending primer sequencea (50?30) GTTCTACTTCCTGAGCA GCATGGACAGGAGGA CCACACTTTGATAGTTTTTTTCC cccgaCCACTGCCTCCCTCGGGG Forward primer for amplicon 2b (50?30) GTACCTGGACGAGCTGCC CCCGGCCTGAAAACA GGGCAGAATGAAAGCACAGT CCAGGTAGGTGAAGATGCAGA TTTATTAC
Load more

Recommended publications
  • ACE2 Interaction Networks in COVID-19: a Physiological Framework for Prediction of Outcome in Patients with Cardiovascular Risk Factors
    Journal of Clinical Medicine Article ACE2 Interaction Networks in COVID-19: A Physiological Framework for Prediction of Outcome in Patients with Cardiovascular Risk Factors Zofia Wicik 1,2 , Ceren Eyileten 2, Daniel Jakubik 2,Sérgio N. Simões 3, David C. Martins Jr. 1, Rodrigo Pavão 1, Jolanta M. Siller-Matula 2,4,* and Marek Postula 2 1 Centro de Matemática, Computação e Cognição, Universidade Federal do ABC, Santo Andre 09606-045, Brazil; zofi[email protected] (Z.W.); [email protected] (D.C.M.J.); [email protected] (R.P.) 2 Department of Experimental and Clinical Pharmacology, Medical University of Warsaw, Center for Preclinical Research and Technology CEPT, 02-091 Warsaw, Poland; [email protected] (C.E.); [email protected] (D.J.); [email protected] (M.P.) 3 Federal Institute of Education, Science and Technology of Espírito Santo, Serra, Espírito Santo 29056-264, Brazil; [email protected] 4 Department of Internal Medicine II, Division of Cardiology, Medical University of Vienna, 1090 Vienna, Austria * Correspondence: [email protected]; Tel.: +43-1-40400-46140; Fax: +43-1-40400-42160 Received: 9 October 2020; Accepted: 17 November 2020; Published: 21 November 2020 Abstract: Background: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection (coronavirus disease 2019; COVID-19) is associated with adverse outcomes in patients with cardiovascular disease (CVD). The aim of the study was to characterize the interaction between SARS-CoV-2 and Angiotensin-Converting Enzyme 2 (ACE2) functional networks with a focus on CVD. Methods: Using the network medicine approach and publicly available datasets, we investigated ACE2 tissue expression and described ACE2 interaction networks that could be affected by SARS-CoV-2 infection in the heart, lungs and nervous system.
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • Human Lectins, Their Carbohydrate Affinities and Where to Find Them
    biomolecules Review Human Lectins, Their Carbohydrate Affinities and Where to Review HumanFind Them Lectins, Their Carbohydrate Affinities and Where to FindCláudia ThemD. Raposo 1,*, André B. Canelas 2 and M. Teresa Barros 1 1, 2 1 Cláudia D. Raposo * , Andr1 é LAQVB. Canelas‐Requimte,and Department M. Teresa of Chemistry, Barros NOVA School of Science and Technology, Universidade NOVA de Lisboa, 2829‐516 Caparica, Portugal; [email protected] 12 GlanbiaLAQV-Requimte,‐AgriChemWhey, Department Lisheen of Chemistry, Mine, Killoran, NOVA Moyne, School E41 of ScienceR622 Co. and Tipperary, Technology, Ireland; canelas‐ [email protected] NOVA de Lisboa, 2829-516 Caparica, Portugal; [email protected] 2* Correspondence:Glanbia-AgriChemWhey, [email protected]; Lisheen Mine, Tel.: Killoran, +351‐212948550 Moyne, E41 R622 Tipperary, Ireland; [email protected] * Correspondence: [email protected]; Tel.: +351-212948550 Abstract: Lectins are a class of proteins responsible for several biological roles such as cell‐cell in‐ Abstract:teractions,Lectins signaling are pathways, a class of and proteins several responsible innate immune for several responses biological against roles pathogens. such as Since cell-cell lec‐ interactions,tins are able signalingto bind to pathways, carbohydrates, and several they can innate be a immuneviable target responses for targeted against drug pathogens. delivery Since sys‐ lectinstems. In are fact, able several to bind lectins to carbohydrates, were approved they by canFood be and a viable Drug targetAdministration for targeted for drugthat purpose. delivery systems.Information In fact, about several specific lectins carbohydrate were approved recognition by Food by andlectin Drug receptors Administration was gathered for that herein, purpose. plus Informationthe specific organs about specific where those carbohydrate lectins can recognition be found by within lectin the receptors human was body.
    [Show full text]
  • Human Transcription Factor and Protein Kinase Gene Fusions in Human Cancer
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.09.033613; this version posted April 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Human Transcription Factor and Protein Kinase Gene Fusions in Human Cancer Kari Salokas1, Rigbe G. Weldatsadik1 and Varjosalo Markku1* 1Systems Pathology/Biology Research Group, Institute of Biotechnology, HiLIFE, University of Helsinki, Helsinki, Finland. * Correspondence: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.04.09.033613; this version posted April 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Oncogenic gene fusions are estimated to account for up-to 20 % of cancer morbidity. Originally, oncofusions were identified in blood cancer, but recently multiple sequence-level studies of cancer genomes have established oncofusions throughout all tissue types. However, the functional implications of the identified oncofusions have often not been investigated. In this study, the identified oncofusions from a fusion detection approach (DEEPEST) were analyzed in more detail. In total, DEEPEST contains 28863 unique fusions. From sequence analysis, we found that almost 30% of them (8225) are expected to produce functional fusion proteins with features from both parent genes. Kinases and transcription factors were found to be the main gene families of the protein producing fusions. Considering their role as initiators, actors, and termination points of cellular signaling pathways, we focused our in-depth analyses on them.
    [Show full text]
  • Plasma Cells in Vitro Generation of Long-Lived Human
    Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 is online at: average * The Journal of Immunology , 32 of which you can access for free at: 2012; 189:5773-5785; Prepublished online 16 from submission to initial decision 4 weeks from acceptance to publication November 2012; doi: 10.4049/jimmunol.1103720 http://www.jimmunol.org/content/189/12/5773 In Vitro Generation of Long-lived Human Plasma Cells Mario Cocco, Sophie Stephenson, Matthew A. Care, Darren Newton, Nicholas A. Barnes, Adam Davison, Andy Rawstron, David R. Westhead, Gina M. Doody and Reuben M. Tooze J Immunol cites 65 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/11/16/jimmunol.110372 0.DC1 This article http://www.jimmunol.org/content/189/12/5773.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 24, 2021. The Journal of Immunology In Vitro Generation of Long-lived Human Plasma Cells Mario Cocco,*,1 Sophie Stephenson,*,1 Matthew A.
    [Show full text]
  • Team Publications Diversity and Plasticity of Childhood Tumors (Depict)
    Team Publications Diversity and Plasticity of Childhood Tumors (DePiCT) Year of publication 2005 Franck Bourdeaut, Delphine Trochet, Isabelle Janoueix-Lerosey, Agnès Ribeiro, Anne Deville, Carole Coz, Jean-François Michiels, Stanislas Lyonnet, Jeanne Amiel, Olivier Delattre (2005 Jun 14) Germline mutations of the paired-like homeobox 2B (PHOX2B) gene in neuroblastoma. Cancer letters : 51-8 Summary Hereditary predisposition to neuroblastoma accounts for less than 5% of neuroblastomas and is probably heterogeneous. Recently, a predisposition gene has been mapped to 16p12-p13, but has not yet been identified. Occurrence of neuroblastoma in association with congenital central hypoventilation and Hirschsprung’s disease suggests that genes, involved in the development of neural-crest-derived cells, may be altered in these conditions. The recent identification of PHOX2B as the major disease-causing gene in congenital central hypoventilation prompted us to test it as a candidate gene in familial neuroblastoma. We report a family with three first-degree relatives with neuroblastic tumours (namely two ganglioneuromas and one neuroblastoma) in one branch and two siblings with Hirschsprung’s disease in another branch. A constitutional R100L PHOX2B mutation was identified in all three patients affected with tumours. We also report a germline PHOX2B mutation in one patient treated for Hirschsprung’s disease who subsequently developed a multifocal neuroblastoma in infancy. Both mutations disrupt the homeodomain of the PHOX2B protein. No loss of heterozygosity at the PHOX2B locus was observed in the tumour, suggesting that haplo-insufficiency, gain of function or dominant negative effects may account for the oncogenic effects of these mutations. These observations identify PHOX2B as the first predisposing gene to hereditary neuroblastic tumours.
    [Show full text]
  • Noncanonical Role of FBXO6 in Regulating Antiviral Immunity
    Noncanonical Role of FBXO6 in Regulating Antiviral Immunity Xiaohong Du, Fang Meng, Di Peng, Zining Wang, Wei Ouyang, Yu Han, Yayun Gu, Lingbo Fan, Fei Wu, Xiaodong This information is current as Jiang, Feng Xu and F. Xiao-Feng Qin of October 2, 2021. J Immunol published online 15 July 2019 http://www.jimmunol.org/content/early/2019/07/12/jimmun ol.1801557 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2019/07/12/jimmunol.180155 Material 7.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 2, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2019 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published July 15, 2019, doi:10.4049/jimmunol.1801557 The Journal of Immunology Noncanonical Role of FBXO6 in Regulating Antiviral Immunity Xiaohong Du,*,†,1 Fang Meng,*,†,1 Di Peng,*,†,1 Zining Wang,‡,1 Wei Ouyang,x Yu Han,x Yayun Gu,*,† Lingbo Fan,*,† Fei Wu,*,† Xiaodong Jiang,{ Feng Xu,x,2 and F.
    [Show full text]
  • Comparative Analysis of the Ubiquitin-Proteasome System in Homo Sapiens and Saccharomyces Cerevisiae
    Comparative Analysis of the Ubiquitin-proteasome system in Homo sapiens and Saccharomyces cerevisiae Inaugural-Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Universität zu Köln vorgelegt von Hartmut Scheel aus Rheinbach Köln, 2005 Berichterstatter: Prof. Dr. R. Jürgen Dohmen Prof. Dr. Thomas Langer Dr. Kay Hofmann Tag der mündlichen Prüfung: 18.07.2005 Zusammenfassung I Zusammenfassung Das Ubiquitin-Proteasom System (UPS) stellt den wichtigsten Abbauweg für intrazelluläre Proteine in eukaryotischen Zellen dar. Das abzubauende Protein wird zunächst über eine Enzym-Kaskade mit einer kovalent gebundenen Ubiquitinkette markiert. Anschließend wird das konjugierte Substrat vom Proteasom erkannt und proteolytisch gespalten. Ubiquitin besitzt eine Reihe von Homologen, die ebenfalls posttranslational an Proteine gekoppelt werden können, wie z.B. SUMO und NEDD8. Die hierbei verwendeten Aktivierungs- und Konjugations-Kaskaden sind vollständig analog zu der des Ubiquitin- Systems. Es ist charakteristisch für das UPS, daß sich die Vielzahl der daran beteiligten Proteine aus nur wenigen Proteinfamilien rekrutiert, die durch gemeinsame, funktionale Homologiedomänen gekennzeichnet sind. Einige dieser funktionalen Domänen sind auch in den Modifikations-Systemen der Ubiquitin-Homologen zu finden, jedoch verfügen diese Systeme zusätzlich über spezifische Domänentypen. Homologiedomänen lassen sich als mathematische Modelle in Form von Domänen- deskriptoren (Profile) beschreiben. Diese Deskriptoren können wiederum dazu verwendet werden, mit Hilfe geeigneter Verfahren eine gegebene Proteinsequenz auf das Vorliegen von entsprechenden Homologiedomänen zu untersuchen. Da die im UPS involvierten Homologie- domänen fast ausschließlich auf dieses System und seine Analoga beschränkt sind, können domänen-spezifische Profile zur Katalogisierung der UPS-relevanten Proteine einer Spezies verwendet werden. Auf dieser Basis können dann die entsprechenden UPS-Repertoires verschiedener Spezies miteinander verglichen werden.
    [Show full text]
  • Specific, Gene Expression Signatures in HIV-1 Infection1
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Qingsheng Li Publications Papers in the Biological Sciences 2009 Microarray Analysis of Lymphatic Tissue Reveals Stage- Specific, Gene Expression Signatures in HIV-1 Infection1 Qingsheng Li University of Minnesota, [email protected] Anthony J. Smith University of Minnesota Timothy W. Schacker University of Minnesota John V. Carlis University of Minnesota Lijie Duan University of Minnesota See next page for additional authors Follow this and additional works at: https://digitalcommons.unl.edu/biosciqingshengli Li, Qingsheng; Smith, Anthony J.; Schacker, Timothy W.; Carlis, John V.; Duan, Lijie; Reilly, Cavan S.; and Haase, Ashley T., "Microarray Analysis of Lymphatic Tissue Reveals Stage- Specific, Gene Expression Signatures in HIV-1 Infection1" (2009). Qingsheng Li Publications. 8. https://digitalcommons.unl.edu/biosciqingshengli/8 This Article is brought to you for free and open access by the Papers in the Biological Sciences at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Qingsheng Li Publications by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors Qingsheng Li, Anthony J. Smith, Timothy W. Schacker, John V. Carlis, Lijie Duan, Cavan S. Reilly, and Ashley T. Haase This article is available at DigitalCommons@University of Nebraska - Lincoln: https://digitalcommons.unl.edu/ biosciqingshengli/8 NIH Public Access Author Manuscript J Immunol. Author manuscript; available in PMC 2013 January 23. Published in final edited form as: J Immunol. 2009 August 1; 183(3): 1975–1982. doi:10.4049/jimmunol.0803222. Microarray Analysis of Lymphatic Tissue Reveals Stage- Specific, Gene Expression Signatures in HIV-1 Infection1 $watermark-text $watermark-text $watermark-text Qingsheng Li2,*, Anthony J.
    [Show full text]
  • FBXO6 Mouse Monoclonal Antibody [Clone ID: OTI6A4] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for CF810363 FBXO6 Mouse Monoclonal Antibody [Clone ID: OTI6A4] Product data: Product Type: Primary Antibodies Clone Name: OTI6A4 Applications: WB Recommended Dilution: WB 1:500~2000 Reactivity: Human Host: Mouse Isotype: IgG2b Clonality: Monoclonal Immunogen: Full length human recombiant protein of human FBXO6 (NP_060908) produced in E.coli. Formulation: Lyophilized powder (original buffer 1X PBS, pH 7.3, 8% trehalose) Reconstitution Method: For reconstitution, we recommend adding 100uL distilled water to a final antibody concentration of about 1 mg/mL. To use this carrier-free antibody for conjugation experiment, we strongly recommend performing another round of desalting process. (OriGene recommends Zeba Spin Desalting Columns, 7KMWCO from Thermo Scientific) Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 33.8 kDa Gene Name: Homo sapiens F-box protein 6 (FBXO6), mRNA. Database Link: NP_060908 Entrez Gene 26270 Human Q9NRD1 Synonyms: FBG2; FBS2; FBX6; Fbx6b Protein Families: Druggable Genome This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 FBXO6 Mouse Monoclonal Antibody [Clone ID: OTI6A4] – CF810363 Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY FBXO6 ([RC205063], Right lane) cDNA for 48 hrs and lysed.
    [Show full text]
  • FBXO6 (NM 018438) Human Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP305063 FBXO6 (NM_018438) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human F-box protein 6 (FBXO6) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 33.8 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_060908 Locus ID: 26270 UniProt ID: Q9NRD1 RefSeq Size: 1565 Cytogenetics: 1p36.22 RefSeq ORF: 879 Synonyms: FBG2; FBS2; FBX6; Fbx6b This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 FBXO6 (NM_018438) Human Recombinant Protein – TP305063 Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination.
    [Show full text]
  • Aberrant Expression of FBXO2 Disrupts Glucose Homeostasis Through
    Page 1 of 48 Diabetes 1 Aberrant expression of FBXO2 disrupts glucose homeostasis through ubiquitin-mediated degradation of insulin receptor in obese mice Bin Liu1 *, Han Lu2 *, Duanzhuo Li1, Xuelian Xiong3, Lu Gao4, 5, Zhixiang Wu6, and Yan Lu1, 3 1 Hubei Key Laboratory for Kidney Disease Pathogenesis and Intervention, Huangshi Cental Hospital of Edong Healthcare Group, Hubei Polytechnic University School of Medicine, Huangshi, Hubei 435003, PR China. 2 Department of Anesthesiology, Ruijin Hospital, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025, PR China. 3 Department of Endocrinology and Metabolism, Zhongshan Hospital, Fudan University, Shanghai 200032, PR China. 4 College of Life Sciences, Northeast Agricultural University, No.59 Mucai street, Harbin 150030, Heilongjiang, PR China. 5 Department of Pathology, University of Maryland School of Medicine, 655W. Baltimore Street, Baltimore, MD, 21202-1192,USA. 6 Department of Pediatric Surgery, Xinhua Hospital, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200092, PR China. * Co-first author 1 Diabetes Publish Ahead of Print, published online December 8, 2016 Diabetes Page 2 of 48 2 Corresponding authors Dr. Lu Gao, College of Life Sciences, Northeast Agricultural University, No.59 Mucai street, Harbin 150030, Heilongjiang, PR China. Tel: +86-045155191257 Fax: +86-045155191257 E-mail: [email protected] Dr. Zhixiang Wu, Department of Pediatric Surgery, Xinhua Hospital, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), 1665 Kongjiang Road, Shanghai 200092, PR China. Tel: +86-21-25078413, Fax: +86-21-65791316, E-mail: [email protected] Dr. Yan Lu, Department of Endocrinology and Metabolism, Zhongshan Hospital, Fudan University, 180 Fenglin Road, Shanghai 200032, PR China.
    [Show full text]