Page 1of40 between this versionandtheVersionrecord. Pleasecitethis articleasdoi:10.1002/jnr.23920. through thecopyediting, typesetting, paginationandproofreadingprocess, whichmayleadtodifferences This istheauthormanuscript acceptedforpublicationandhasundergone full peerreviewbuthasnotbeen Running title: Running 21201Maryland, Baltimore, Medicine, of School
Submission editor: Submission FAX: 410 706 8341 410 706 8341 FAX: 410 706 2654 tel: 21201 USA MD Baltimore, St Baltimore 655 West 5 014 BRB Medicine of Maryland School of University Kight Katherine correspondence: Keywords: 1 E.Kight Katherine hippocampus. developing in the content, propeptide of regulation ge BDNF and differences estrogen Sex MMM.to NS050525 09 award 2R56 byNINDS Supported [email protected]
Program in Molecular Medicine, Molecular Medicine, in Program
Accepted Article BDNF hippocampus, estrogen, sexdifferences,
Estrogen regulation of BDNF in neonatal rathippoc neonatal in BDNF of regulation Estrogen
1 and Margaret M. McCarthy M. andMargaret LarryCahill This article isprotected by copyright. All rights reserved.
Journal ofNeuroscienceResearch
2 Department of Pharmacology, University of Maryland Maryland of University Pharmacology, Departmentof
1,2
ne expression, but notbut expression, ne
ampus ampus
had higher baseline baseline higher had rat neonatal and female male in (BDNF) neurotrophin ex gene bymeasuring cell proliferation hippocampal regulato downstream a wepotential examined report, th rats neonatal of the hippocampus in neurogenesis previouslyde have brain. the within We synthesized the aromatization from is that derived byestradiol endpoi cellular various life.rodents, In postnatal duringsens hormones steroid of the actions through Abstract resulted in opposite effects on effects in opposite resulted Neonataladminist to females. compared hippocampus, sex and region specific effects of estradiol on estradiol of effects region specific sex and pre in BDNF differences asoutput, no translational response to and sexdifference this Interestingly, hippocampus, such that that such hippocampus, neurogenesis. regulatingdevelopmental in factors relationsh complex functional suggest a hippocampus Bdnf byantagoni signaling estradiol endogenous Blocking expression in the dentate of males, but but not female males, of in the dentate expression
Accepted Article frequen are function brain in adult differences Sex Bdnf This article isprotected by copyright. All rights reserved. Bdnf gene expression in dentate gyrus and CA1 regions o regions CA1 ingyrus and dentate expression gene Journal ofNeuroscienceResearch Journal ofNeuroscience Research transcripts increased in CA1 but decreased in dent in decreased but CA1 in increased transcripts Bdnf expression in these areas of the neonatal the of neonatal areas these in expression 2 Bdnf nts of the developing brain are affected affected are brain developing the of nts estradiol was not mirrored by mirrored wasnot estradiol of circulating testosterone and/or and/or testosterone circulating of cursor peptide were observed. The The wereobserved. peptide cursor
expression in the neonatal the neonatal in expression scribed a sex difference in in asex difference scribed pression of brain derived brain derived of pression itive periods of prenatal and early and prenatal of itiveperiods at is modulated by estradiol. In thisIn byestradiol. isat modulated zing estrogen receptors decreased decreased receptors zingestrogen s in response to estradiol. Males Males estradiol. to response in s r of the effects of estradiol on estradiol of effects the ofr ip between these pleiotropic pleiotropic these between ip ration of exogenous estradiol estradiol exogenous of ration s, and had no effect in CA1. CA1. in no and had effect s, tly determined developmentally developmentally tlydetermined f the the f ate. ate. Page 2of40 Page 3of40
on on signaling ha estradiol of Manipulation hippocampus. responsible for brain the area an of ratsin female an estrogen between relationship the examined study Statement Significance already complicated picture of BDNF synthesis in re in synthesis BDNF of picture complicated already BDNF of levels on effect had no estradiol contrast, estof effects specific cell type of possiblity the
Bdnf Estrogen and BDNF have critical roles in sculpting sculpting in roles havecritical and BDNF Estrogen
Accepted Article hip the subregionsof in different gene expression
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 3 rogen on the developing hippocampus. In In hippocampus. developing the on rogen learning and stress responding, the the responding, stress and learning precursor peptide, adding to the to adding peptide, precursor sponse to developmental factors. factors. developmental to sponse d differing and sex specific effects effects sex specific and differing d d BDNF in neonatal male and and in male neonatal BDNF d the developing brain. This brain. This developing the pocampal formation, raising formation, pocampal
the hippocampus are rapid, occurring within hours, hours, within rapid, occurring are hippocampus the estra of effects The 2010). al.,et (Bowers females cell decreases males neonatal in signaling estrogen cell genesis increase not does estradiol exogenous in dent cells proliferating the number of increases adm estradiol Although cell rates death. of altered an females, to compared the hippocampus, of regions cells twiceproliferating as many have males week, e Zhang 2013; al.,et 2010; Waddell al., et (Bowers characteri have in laboratory our studies Previous th rats of hippocampus the neonatal in genesis cell known. not are mec the steroids, gonadal of effects organizational sec are differences these suggests of many evidence Schoenfel 2011; (McLeanal., et presentation and/or betwe differ schizophrenia, or anxiety, depression, dys hippocampal which in and disorders 2012) Gould, (Ma lifespan the across and females in males differ o 2004). Sweatt, Aspects Dong, 2010; and (Fenselow in both vitalrole a plays assuch and responding, Introduction
Accepted Articlecontextua in criticallyis involved hippocampus The
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 4 ate and CA1 to levels seen in males, levelsin males, seen to CA1 and ate complex and innate behaviors behaviors innate and complex inistration to neonatal females females neonatal to inistration diol on developmental cell genesis in in cell genesis developmental diol on en the sexes in terms of prevalence termsprevalence of in sexes the en hanisms by which this would occur would this bywhich hanisms at is modulated by gonadal steroids steroids byis gonadal modulated at t al., 2008). During the first postnatal postnatal Duringfirst the t 2008). al., hmoud et al., 2016; Schoenfeld and and Schoenfeld 2016; al., et hmoud in the dentate gyrus and CA1 gyrusCA1 and dentate the in and yet also persistent, as indicated indicated as persistent, also yet and proliferation, but has no effect in in effect no has but proliferation, in males. Conversely, disruption of of Conversely, disruption in males. d and Cameron, 2015). While Cameron, and 2015). d While ondary to the developmental developmental the to ondary function are implicated, such such as implicated, are function d this difference is not due to to not is due thisdifference d f learning and stress responding responding stress and learning f zed a robust sex difference in in sexdifference robust a zed l learning and stress and learning l Page 4of40 Page 5of40 A baseline sex difference in in sex difference baseline A
survival viap75 survival 201 al., et Taliaz 2009; al.,et (Lee proliferation conditional or BDNF whileknockdownof 2005), al., increas adult hippocampus to BDNF of administration regulating neur in role BDNF a indicate for studies M and (Scharfman TrKB receptor, BDNF cognate the of ademonstr have or byBDNF mirrored are hippocampus eff the of Many BDNF. is neurotrophin the candidate th thatmediate mechanisms cellular downstream The largel are hippocampus the neonatal in neurogenesis sex specific manner. a circuitry in hippocampal i an has thereby and neurons newof differentiation estra Thus 2010). al., (Bowers et females untreated n into will differentiate females estradiol treated the newofin 80% cells Up to 2008). al., et Zhang a survive that cells proliferating of number bythe hippocampal subregions of neonatal male and female and female male neonatal subregionsof hippocampal and transcript BDNF which study in a report here We hippocamp developing the in proliferation modulates 2001 Handa, and rats(Solum of hippocampus neonatal BDNF ain role for demonstrating studies on Based of expression the well as as hippocampus, adult the
Accepted Article NTR receptor signaling (Catts et al., 2008). 2008). al., et (Catts signaling receptor This article isprotected by copyright. All rights reserved. Bdnf Journal ofNeuroscienceResearch Journal ofNeuroscience Research gene expression was observed which mirrors the sex the mirrors which wasobserved gene expression 5 0). BDNF also negatively impacts cell cell negativelyimpacts also BDNF 0). eurons, whereas only 40% will do so in so will do onlywhereas 40% eurons, nd differentiate (Bowers et al., 2010; 2010; al., (Bowers differentiate et nd ogenesis. For example, For example, ogenesis. or males of hippocampus neonatal mportant role in organizing the in organizingthe role mportant diol promotes both proliferation and and proliferation both diol promotes BDNF and TrKB receptors in the the in receptors and TrKB BDNF deletion of TrKB reduces ofreduces deletion TrKB ects of estradiol in the the in estradiol ofects us by regulating BDNF expression. expression. BDNF us byregulating peptide levels were quantified in in levels peptide werequantified y unknown, although a likely a although yunknown, es cell proliferation (Scharfman et et (Scharfman cell proliferation es rats following estradiol treatment. treatment. estradiol rats following ), we hypothesized that estradiol estradiol that we ), hypothesized acLusky, 2006). Numerous Numerous 2006). acLusky, ated requirement for activation activation requirement for ated regulating cell proliferation in in proliferation cell regulating e effects of estradiol on estradiol of effects e
Animal Care and Use Committee of the University of University the of of Use and Committee Care Animal change in parallel with in parallel change B and hippocampus, the of subregions among differed
All procedures involving experimental were animals involvingexperimental procedures All pr tissue and treatments drug animals, Experimental Methods and Materials females. dev the sculpting in roles BDNF for region specific at 80 80 at dissec were formation hippocampal the of subregions (PN0). day 0 postnatal wasdesignated birth of day housed CareFacility and Medicine Animal of School mat dams from wereobtained pups rat Sprague Dawley proximal to CA3 were removed with fine foreceps. Am with foreceps. fine wereremoved CA3 to proximal Fiber fissure. the hippocampal of length the along b structure adiscrete as wasgyrusremoved dentate of surface ventricular the expose to removed tissue hippocampa the of subregions individual dissect To s phosphate buffered ice cold sagitally in bisected pup individual thean of brain of hemispheres both difference in hippocampal cell genesis. However, th genesis. cell in hippocampal difference o
Acceptedhippocampal For each processing. subsequent C until Article
Bdnf This article isprotected by copyright. All rights reserved. gene expression. Together, these observations indi observations these Together, gene expression. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 6 aline (pH 7.4; PBS) and thalamic thalamic and 7.4; PBS) (pH aline eloping hippocampus in males versus versus in males hippocampus eloping projections along the dentate axisdentate the along projections were combined. werecombined. the hippocampus. The entire entire The hippocampus. the On postnatal day 4 (PN4), (PN4), day 4 postnatal On e effects of estradiol onestradiol of effects e ocessing ocessing y inserting a fine guage needle needle a fine guage yinserting in a 12 hour light/dark cycle. The cycle. light/dark The a12 hour in Maryland School of Medicine. Medicine. ofSchool Maryland ted, frozen on dry ice and stored stored on and ted, dryice frozen mon’s horn was dissected from from wasdissected horn mon’s DNF peptide levels did not not levels peptide did DNF ed in the University of Maryland Maryland University of in ed the l formation, were brains l formation, approved by the Institutional Institutional bythe approved subregion, tissue from tissue subregion, Bdnf cate cate
Page 6of40 Page 7of40
method, according to the manufacturer’s instruction the manufacturer’s to according method, (un homogenates tissue from wasisolated RNA Total experiments) estradiol treated in (animals tissues PCR Quantitative =5 7/grou expression(n or gene protein of analyses werecoll animals treated of subregions Hippocampal 2 al., Bowers et 2004; al., et (Amateau hippocampus includi brain, rodent the of differentiation sexual and rat, the neonatal in present globulins binding ove is to necessary tamoxifen and estradiol of dose admin wassimilarly oil sesame of volume equivalent sesam 0.1 ml 100 in at g wereadministered (Sigma) were separated along the length of the hippocampus. the of length the along wereseparated f removed using and meninges tissue neocortical the 7 animals of each sex at PN4 and PN15. PN15. and sexPN4 each at of animals 7 ani untreated cohort of the same from wereobtained RNA.In total of isolation wasused for homogenate peptide BDNF analysissubsequent of for wasfrozen inhibitors(Sig phosphatase and protease containing P 40 Nonidet 1% NaCl, 150 mM 7.6, pH Tris•HCl mM 10 For pups receiving drug treatments, estradiol benzo estradiol treatments, receivingdrug pups For
Accepted Article in werehomogenized animals untreated from Tissues
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 7 ng sex specific effects in the developing developing the in effects sex specific ng has previously been shown to elicit elicit to shown previouslybeen has using a modified phenol extraction extraction phenol a modified using rcome circulating steroid hormone hormone circulatingsteroid rcome s (TriReagent RT, MRC Inc.). cDNA cDNA MRCInc.). RT, (TriReagent s this way, both protein and total RNA RNA and total protein way, this both p). p). ma). A portion of the homogenate homogenate the of portion A ma). istered as vehicle control. This vehicle control. This as istered 010; Mong et al., 1999). 1999). al.,et Mong 010; mals. Tissues were collected from from collected were mals. Tissues ine foreceps. CA1 and CA3 areas areas CA3 and CA1 ine foreceps. ected on PN4 and frozen for for and PN4frozen on ected content. The remaining The content.
e oil subcu. on PN0 and PN1. An PN1. and PN0 on subcu. oil e , 1% sodium deoxycholate, and and deoxycholate, sodium 1% , ate (Sigma) or tamoxifen tamoxifen or (Sigma) ate treated animals) or frozen frozen or animals) treated lysis buffer consisting of of consisting lysisbuffer
transcripts were normalized to to werenormalized transcripts expression among groups calculated using the ∆∆C using calculated groups among expression coding region of region coding
a ViiA a reactions PCR primers. and250nM (LifeTechnologies) PC SYBR©Green containing mixture reaction a in PCR fo wasused 5 l and 1:3 werediluted products cDNA random Kit and Transcription Reverse cDNA Capacity 1 from subregionswastranscribed hippocampal from expression. Mean C Mean expression. relative femal to expression fold as mean expressed using the E BDNF the using above. f Total described as inhibitors, phosphatase ELISA BDNF TCACAAGAGAAGGCAGCCCTGGT 3’. Gapdhrev: 3’, 5’ TGGTGAAGGTCGGTGTGAACGG Gapdhfwd: BDNFrev: 5’ CAGTTGGCCTTT 5’GCGGCAGATAAAAAGACTGC 3’; seque Primer regions. 3 hippocampal all for females for 15 minutes by the addition of 2N HCl, and and HCl,neutr 2N of addition by the minutes 15 for PB in 1:5 werediluted homogenates Tissue protocol. TM Frozen tissues were homogenized in lysis buffer co lysis in buffer werehomogenized tissues Frozen Accepted Article for PCR primers (ABI). PCR System Real Time 7
Bdnf max t values values for Immunoassay System (Promega), according to the man the to according (Promega), System Immunoassay Exon IX and were designed to quantify all transcri all quantify to weredesigned IXand Exon This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research Gapdh Gapdh as a proxy for total cellular RNA content, and and content, RNA cellular total a proxy as for differed by less than 0.2 C 0.2 than byless differed 8 alized with NaOH prior to dilution in dilution to prior withNaOH alized ree BDNF propeptide was measured wasmeasured propeptide BDNF ree t method (Pfaffl, 2001). Data were Data (Pfaffl, 2001). method nces were as wereas follows: BDNFfwd: nces es +/ standard error of mean fold fold mean of error esstandard +/ S (pH 7.4), acid treated at pH 3.5 3.5 pH at treated (pH acid 7.4), S r fluorescence based, real time real time r fluorescence based, g total RNA RNA High usingtotal a g were performed for 40 cycleson 40 for wereperformed hexamers (LifeTechnologies). (LifeTechnologies). hexamers R Master Mix Master R Bdnf ntaining protease and and protease ntaining expression targeted the the targeted expression 5’ 5’ t between males and males between TGATACCG 3’. TGATACCG 3’. pts. pts. Bdnf ufacturer’s ufacturer’s
Page 8of40 Page 9of40 Antibody characterization characterization Antibody
TBS) prior to incubation overnight at 4at overnight incubation to prior TBS) diluted Biosciences) (LiCor Buffer OdysseyBlocking Membr membrane. PVDF to and transferred conditions, wasresolv homogenates tissue g)(12 from Protein unde LifeTechnologies) (NuPage, gels polyacrylamide immunoblotting Western cross reactivi 3% than exhibits less and pg/ml 15.6 the to manufactu According Buffer. Sample and Block GAPDH band to obtain an integrated fluorescence val integrated obtainfluorescence an to band GAPDH inten fluorescence to wasnormalized band BDNF each (L Imaging System OdysseyCLxInfrared an on imaged 1:5000). diluted both Biosciences; IgG, LiCor mouse goat ant (IRDye©800 antibodies secondary containing Bufferdilu in incubated Blocking and (0.05%) Tween 1:5,000). Membranes diluted RRID:AB_307274; ab9484; m GAPDH (mouse and 1:800) diluted RRID:AB_10644597; Cat# Biology, Systems BDNF,Aviva human of portion BDNF against antibodies primary containing (0.05%) eliminated when the antiserum was preabsorbed with waspreabsorbed antiserum when the eliminated (s homogenate tissue rathippocampal of immunoblots appr of band single a recognized (RRID:AB_10644597) study.Th in this used antibodies the 1 lists Table
Accepted Article
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research o C in Blocking Buffer diluted 1:1 in TBS Tween 1:1 in TBS Tween diluted Buffer Blocking in C 9 e BDNF antiserum used used antiserum BDNF e ty to other neurotrophins. neurotrophins. other tyto 1:1 in Tris buffered saline (pH 7.4, 7.4, (pH saline in Tris buffered 1:1 After washing, membranes were membranes washing, After ted 1:1 in TBS Tween/0.02% SDS SDS in ted TBS Tween/0.02% 1:1 (rabbit IgG against the middle the middle IgG against (rabbit rer, this ELISA has a sensitivity of sensitivity a has of ELISA rer,this ue. ue. a 4 fold molar excess of the the of excess molar a 4 fold r reducing and denaturing denaturing and reducing r ee Figure 4). This band was band 4). This Figure ee i rabbit and IRDye©680 goat anti IRDye©680 and i rabbit ARP41970_P050; ARP41970_P050; sity of the corresponding corresponding sity the of oximately 27.5 KDa on Western on KDa 27.5 Western oximately anes were blocked with wereblocked anes iCor). Fluorescence intensity for intensity for Fluorescence iCor). were washed 3 times in times TBS 3 werewashed ed on 10 20% gradient gradient 10 20% on ed onoclonal, Abcam, Cat# Cat# Abcam, onoclonal,
the rat the CA1, CA3 in the werequantitated transcripts Bdnf rats using developing of formation hippocampal the week. the postnatal first during females Results at at homogenei test for Bartlett’s and normalcy for test weredatafirst All test. post comparisons multiple hi each for groups across ANOVA factor single using and treated from data immunoblotting ranks.Western wereanalysed tamoxifen and withestradiol treated independent factors and Bonferroni Bonferroni and factors independent wi ANOVA 2 factor using wereanalyzed tamoxifen and qPCR data correction. Bonferroni using comparisons with sex and region as independent variables, follo variables, as independent region withsexand
analyses Statistical tissu hippocampal rat of immunoblots on KDa Western 4 immuniziug 2 and (1 antibody ug peptide immunizing Bdnf gene expression differs among subr hippocampal among differs expression gene Bdnf O C. The Gapdh monoclonal antibody recognized a singl a antibodyrecognized monoclonal Gapdh C. The p <0.05 for all analyses. all <0.05 for qPCR and ELISA data from untreated animals wereana animals untreated from data ELISA and qPCR Bdnf
gene is expressed from multiple promoters and and alte promoters multiple from expressed is gene Accepted Article
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research post-hoc
10 comparisons. ELISA data from animals animals from data ELISA comparisons. analysed using Kolmogorov Smirnov Kolmogorov Smirnov using analysed ty of variances. Significance was set wasset Significance variances. tyof wed bypairwisewed using the Kruskal Wallis test of test Kruskal Wallis the using a real time qPCR assay. Because Because assay. qPCR real time a ppocampal region with Tukey’s region ppocampal ng peptide) in TBS overnight at at overnight in TBS peptide) ng from animals treated with estradiol withestradiol treated animals from untreated animals were analyzed wereanalyzed animals untreated e homogenate (Fig 4). e homogenate th sex and treatment as treatment sexand th egions and between males and and males between and egions e band of approximately 35 35 approximately of band e and dentate gyrus regions of of regions gyrus dentate and lyzed by 2 factor ANOVA ANOVA lyzedby2 factor rnatively spliced exons exons rnatively spliced post-hoc
Page 10of40 Page 11of40 Ammon’s horn (P <0.05), compared to females (Figure to females compared (P <0.05), horn Ammon’s hippocampal subregionon hippocampal males have more more have males
p On postnatal day 4, 2 factor ANOVA indicated a sig a indicated ANOVA 2 factor 4, day postnatal On Bdnf IX, whExon of region the targetto coding designed (Aidal., et transcripts in distinct result 12 that greatest in the dentate gyrus for both sexes (Figur sexes both the for gyrus dentate in greatest A significant regional effect on Bdnf expression w expression Bdnf on effect regional significant A n=7, [F(2,36)=40.65, 15 andCA1 the dentate in expression byhigher driven To determine if estrogen signaling influences influences signaling if estrogen determine To week. the postnatal first during expres gene Bdnf on different effects has Estradiol p thi regionsat 3 the among wasindicated expression benzoate, tamoxifen, or vehicle on the day of day the birth of on or vehicle tamoxifen, benzoate, wastreated animals of cohort second a hippocampus, [F(2,31)=13.42, n=5 6, n=5 6, [F(2,31)=13.42, asi indicated treatment sex ANOVA for and 2 factor regionso CA1 inand dentate quantified transcripts <0.0001], as well as an interaction of sex and regi sexofand interaction well as an as <0.0001], =0.1143]. =0.1143].
Accepted Article n=7, [F(1,36)=7.664, gene expression
Bdnf
transcripts in the dentate gyrus (P <0.01) andCA1 gyrus <0.01) (P dentate in the transcripts This article isprotected by copyright. All rights reserved. p p <0.0001]. <0.0001]. <0.0001], where mean relative expression levels wer expression relative where mean <0.0001], Bdnf Journal ofNeuroscienceResearch Journal ofNeuroscience Research expression was also indicated [F(2,36)=39.49, n=7, [F(2,36)=39.49, indicated expression wasalso Post-hoc 11 p pairwise comparisons confirmed that confirmed comparisons pairwise =0.0088]. =0.0088]. 2007), primers for this qPCR assay were this assay qPCR primers for 2007), e 1B). No effect of sex on sexof on effect No 1B). e and 24 hours later, and later, hours and 24 and sion among hippocampal subregions subregions hippocampal among sion n PN4 via qPCR. Within the dentate, dentate, the via qPCR. PN4 n Within on [F(2,36)=5.303, n=7, n=7, [F(2,36)=5.303, on ich is common to all transcripts. to transcripts. all common is ich of males. males. of s age [F(1,36)=2.619, n=7, n=7, [F(1,36)=2.619, age s gnificant main effect of treatment treatment of effect main gnificant Bdnf systemically with estradiol withestradiol systemically 1A). A significant main effect of effect significant main A 1A). Post-hoc as also seen at postnatal day day postnatalat seen also as expression in the developing in the developing expression nificant main effect of sex on sexofon main effect nificant analysis confirmed that analysis confirmed region of region of Bdnf p Bdnf =0.0096], =0.0096], e e
Bdnf
postnatal week.. postnatal
treatment also decreased decreased also treatment controls vehicle to (P<0.05), compared females and byestradiol increased wassignificantly expression n=5 6, n=5 6, in the dentat treatment sex between and interaction ineffect nofema had but estradiol, as degree same not differ between males and females (P>0.05). and females between males differ not p In CA1, a significant main effect of treatment treatment was of effect main significant a CA1, In treatmen estradiol here although p<0.0001], n=5 6, animals. in untreated observed difference (P<0 versus females males treated vehicle in higher tamoxifen (males only), or vehicle. Because hippoca Because vehicle. or only), (males tamoxifen peptide BDNF on estradiol effect the of examine To b withestradiol PN1 and PN0 on wastreated animals p sexofwas indic effect A main sex(P>0.05). either whileboth), t for (P<0.0001 and females males both Estradiol does not alter BDNF propeptide content in content propeptide BDNF alter not does Estradiol n=5 6, n=5 6, treatment sexand interactionbetween No (P<0.05). =0.0735], most likely because mean values for estra values for mean likely because most =0.0735], =0.0020], due to higherto due =0.0020], p p =0.4992].
Accepted Article[F(1,3 sexofwas not effect main =0040], a however
This article isprotected by copyright. All rights reserved. Bdnf Bdnf Journal ofNeuroscienceResearch Journal ofNeuroscience Research expression in vehicle treated males compared to fe to compared males treated in vehicle expression expression in the dentate of males (P<0.05), to th to (P<0.05), males of dentate in the expression 12 Bdnf ated [F(1,31)=11.79, n=5 6, n=5 6, [F(1,31)=11.79, ated treatment in both males (P<0.01) (P<0.01) both in males treatment e was indicated [F(2,31)=6.870, [F(2,31)=6.870, ewasindicated les (P>0.05). A significant significant (P>0.05). A les the hippocampus during the first first the during hippocampus the t greatly increased greatly t increased amoxifen treatment had no effect in effect no treatment had amoxifen .01), recapitulating the sex recapitulating the .01), mpal cell genesis is not altered by altered not is genesis cell mpal (Figure 2A). Surprisingly, tamoxifen tamoxifen Surprisingly, 2A). (Figure was indicated [F(2,31)=0.7136, [F(2,31)=0.7136, wasindicated expression was significantly wassignificantly expression enzoate (female pups only), pups (female enzoate diol and tamoxifen treatments did did treatments tamoxifen and diol also evident [F(2,30)=69.32, [F(2,30)=69.32, evident also levels, a third cohort of cohort third a levels, 1)=3.478, n=5 6, n=5 6, 1)=3.478, Bdnf signaling in in signaling e e males males Page 12of40 Page 13of40
within the dentate ( dentate the within ANOVA. non parametric subregionsusing hippocampal were so means dentate, the within groups treatment indicated test Bartlett’s 3). (Figure protein total reported and ELISA, commercially available a using hippocampal in determined were levels peptide BDNF limit tot effort an thiscohortin in included not treatment tamoxifen or in males treatment estrogen no differences among groups within the dentate C or dentate the within groups among differences no re ELISA withthe As 4A). Figure RRID:AB_10644597; antibody anti BDNF withthe wasobtained propeptide the predicte to corresponding KDa 28 at band single byco wereconfirmed assays ELISA the from Results using W homogenates sample same in the peptide BDNF Kruskal the using indicated were regions 3C) Figure differences in BDNF peptide content in hippocampal in hippocampal content peptide in BDNF differences levels d BDNF peptide 4, 3 and Figures in shown As wa immunoblotting on PN4. Western and females males content. prohormone BDNF in reflected t during expression in Bdnf gene sex difference The immunoblotting. p
Acceptedwasno respectively). C, CA3 and 4B Figure =0.4975; Article p =0.0508; Figure 3A), CA1 (CA1 3A), Figure =0.0508; This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 13 he number of experimental animals. animals. experimental of number he inhomogeneity of variance among among variance of inhomogeneity p =0.1463, Figure 3B) or CA3 ( Figure CA3 3B)or =0.1463, he first postnatal week is not not is week first he postnatal Wallis test by ranks. byranks. test Wallis in females, these two groups were twogroups these in females, d molecular weight of the BDNF BDNF the weightof d molecular A1 regions on PN4 ( PN4 regions on A1 as pg of BDNF peptide per mg of mg per BDNF peptide of as pg compared within the three three the within compared subregions during the first first duringthe subregions (Aviva Systems Biology, (AvivaSystems subregions collected on PN4 PN4 on collected subregions t assessed by Western by t assessed Western sults, one way ANOVA indicated indicated one way sults, ANOVA Nodifferences among groups groups among Nodifferences s used to test for baseline sex test baseline to for used s estern immunoblotting. A A esternimmunoblotting. id not differ in vehicle treated treated vehicle in differ not id mparing relative amounts of of relative amounts mparing p =0.7858, =0.7858, p =0.1598; =0.1598;
ANOVA, ANOVA, regional abundances for abundances regional CA to compared sexes, both of dentate the in higher BDNF peptide levels was indicated [F(1,26)=58.45, n [F(1,26)=58.45, indicated was levels peptide BDNF Discussion region ( region sexo of effect wasno there confirmed ANOVA factor byELISA assessed wasCA1additionally and dentate week. We used a qPCR assay targeted to the exon IX theto exon qPCR targeted a assay used week. We and fe in male formation the hippocampal of regions (2 factor ANOVA, ANOVA, (2 factor were content in propeptide BDNF No differences 5A). ( hippocampal three the content among propeptide BDNF ANOVA Two factor wasdetected. propeptide BDNF KDa sin tamoxifen, a and withestradiol treated animals gene to quantify total levels of all BDNF transcrip BDNF all of levels total quantify to gene
sex difference in in sexdifference P untreated of cohort same usingweek the postnatal p =0.9091), nor were there regional differences in pr in differences regional werenorthere =0.9091), In this study, we examined study,we examined this In To confirm the results from Western immunoblotting, results the from confirm Western To p =0.7120; Figure 6). A significant main effect of hi of effect significant main A Figure 6). =0.7120; p Accepted Article15 day postnatal at animals untreated from =0.0551)
Bdnf p =0.5086), or among the three hippocampal subregions hippocampal three the among or =0.5086), gene expression.As with the hippocampal homogenate hippocampal the with expression.As gene This article isprotected by copyright. All rights reserved. Bdnf Journal ofNeuroscienceResearch Journal ofNeuroscience Research transcript (Figure 1A). 1A). (Figure transcript Bdnf expression in the dentate gyrus, CA1 and CA3 and gyrus, inCA1 dentate the expression 14 ts, and found a baseline sex difference sexdifference a baseline and found ts, gle band corresponding to the 28 28 the to corresponding band gle male rats during the first postnatal postnatal first duringthe rats male opeptide content ( content opeptide 1, recapitulating the relative the recapitulating 1, N4 animals used to demonstrate a demonstrate to used N4animals =7, =7, n BDNF peptide content in either in either content peptide n BDNF seen between males and females and females betweenmales seen in the same samples, . . Two same in the samples, coding sequence of the the of sequence coding subregions at postnatal day 4 4 day postnatal subregionsat p ppocampal subregion on subregion ppocampal confirmed no effect of sex of on effect no confirmed <0.0001]. BDNF peptide was peptide BDNF <0.0001]. BDNF peptide content in peptide content BDNF (Figure 5B). p =0.9389; Figure Figure =0.9389; (2 factor (2 factor s s from Bdnf
Page 14of40 Page 15of40 al., 2008), but had opposite effects on effects opposite had but 2008), al., an dentate the in both proliferation cell regulates region spec and complex be likelyis to hippocampus c BDNF and between relationship However, the 2008). 20 al., (Bowers time et this atCA1 and dentate the rou produce males where the hippocampus, of regions difference in in difference postn at detected wasnot sex difference This week. the hippocam regions of not CA3, but CA1, and gyrus
and Winzer Serhan (2012) reported neonatal male rat male neonatal reported (2012) and Winzer Serhan develo the in expression BDNF examined have studies rolein the long standinginterest to contrast In regar with in particularly adults, neurogenesis and 2). study (Figure present the in in developing hippocampus determined determined hippocampus developing determine relative relative determine Damborsky and Winzer Serhan utilized and Winzer Serhan Damborsky due be may discrepancy This sexdifferences. detect e withthe observations withour consistent largely subregions CA3 and CA1 in dentate, expression gene qPCR in dissected subregions of the hippocampus. the hippocampus. of subregions dissected in qPCR Bdnf One of the first studies to examine the the ontogenyof examine to studies the first of One gene expression. Males had roughly 50% more more roughly 50% had Males expression. gene
Accepted ArticleBdnf
transcripts on postnatal day 4 mirrored cell proli cell mirrored day 4 postnatal transcriptson Bdnf
This article isprotected by copyright. All rights reserved. transcript levels, and the present study measured study measured present the levels, and transcript Journal ofNeuroscienceResearch Journal ofNeuroscience Research Bdnf Bdnf in situ in transcript and peptide levels in neonatal neonatal in levels peptide and transcript 15 expression between these two regions in in tworegions these between expression hybridization autoradiography to to autoradiography hybridization d CA1 (Bowers et al., 2010; Zhang et et Zhang 2010; al., et (Bowers CA1 d d to effects of estrogen, far estrogen, offewer effects to d xception of CA3, where we did not not CA3, ofwe did xception where 10; Lima et al., 2014; Zhang et al., al., et Zhang 2014; al., et Lima 10; atal day 15. Intriguingly, the sex Intriguingly,the 15. day atal to methodological differences, as as differences, methodological to ific, as estradiol positivelyestradiol ific, as of BDNF in hippocampal plasticity in hippocampal BDNF of pus during the first postnatal postnatal the first during pus s have higher hippocampal higher hippocampal s have ghly twice as many new cells in in cells new ghlymany twiceas at PN5, but not PN8. This is PN8. not This but PN5, at ell genesis in the neonatal neonatal in the genesis ell ping hippocampus. Damborsky Damborsky hippocampus. ping Bdnf
Bdnf transcripts in the dentate the dentate in transcripts expression in the expression feration in these in these feration transcripts via transcripts Bdnf
2004)Using a masculinizing dose of estradiol, weestradiol, ofob dose masculinizing a 2004)Using endogenous that mimic in females effects achieve to e exogenous of dose relatively withhigh a overcome of effects sequestering The 2006). al., et (Bakker byα fetopro estradiol of the maternal effects from al., 2006) et Mukai 2011; (Hojoal., et hippocampus al et sexes (Amateau both areas of brain various in in males (Naftolin et al.,1971, 1975), although although 1975), al.,1971, et (Naftolin males in ar the is rodents of brain neonatal in the estrogen antagon receptor estrogen the or benzoate estradiol a paradi ratsusing neonatal in signaling estradiol steroids. gonadal in surge perinatal bythe primed opposite effect of estradiol, where where estradiol, ofeffect opposite denta Interestingly,the in (2002). Handa and Solum sim neonates, and female in CA1 male in transcripts
explained by regional differences in estrogen recep in estrogen bydifferences regional explained tworegio the between estradiol of effects opposing male rats in relation to gonadal steroids. Castrati steroids. relationgonadal to ratsin male and Handa 2002). This demonstrates that not not do only that This2002). demonstrates Handa and effect of estradiol suggests that that suggests estradiol of effect the hippoc developing of horn Ammon’s in expression estradiol on the day of birth in castrated animals animals castrated in the birth of day on estradiol i weeks twopostnatal the first for expression gene
Accepted Article
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research Bdnf Bdnf expression during the first two weeks can be can twoweeks first duringthe expression gene expression was decreased. These These wasdecreased. gene expression 16 de novode on on the day of birth decreases decreases birth the of on day on restores restores gm of systemic administration of administration systemic of gm omatization of circulating testosterone circulatingtestosterone of omatization teinpresent in the neonatal circulation circulation in the neonatal teinpresent this steroid binding globulin can be can globulin binding thissteroid n CA1 and CA3, yet a single dose of of single dose a yet CA3, and CA1 n In the present study, we manipulated study,we manipulated present the In ns of the hippocampus may be may be the hippocampus of ns ., 2004), and in particular the the in particular and ., 2004), The developing brain is shielded shielded is brain developing The tor subtype and cellular localization. localization. and cellular torsubtype te of both sexes we observed the the we observed sexes both of te ist tamoxifen. The main source of source of main The ist tamoxifen. served an upregulation of of upregulation an served ilar to what was seen in males by in males wasseen what to ilar estradiol in males (Amateau et al.,et in (Amateau males estradiol stradiol, and this has been titrated titrated this been and has stradiol, es estradiol upregulate upregulate estradiol es ampus, but the duration of the the of duration the ampus, but synthesis of estradiol does occur does occur estradiol of synthesis Bdnf transcript levels (Solum (Solum levels transcript Bdnf Bdnf Bdnf
Page 16of40 Page 17of40 this suggests the observed upregulation of of observed upregulation the suggests this Tamoxifen had no effect on on effect no had Tamoxifen effe sex specific havetoa appeared withtamoxifen e endogenous antagonizing contrast, In females. and eff opposite elicited estradiol exogenous Although th werenevertheless effects these CA1, and dentate dentate. the in types cell effe nongenomic have may estradiol that possibility glia andalso neurons granule immature of membrane i ERβ extranuclear however, gyrus, dentate neonatal action genomic via occurs classical CA1 neonatal of
system which metabolize tamoxifen are present from present from are tamoxifen metabolize which system e the However, metabolism. in tamoxifen differences in males neonatal tamoxifen of effects differential 1981) al., et (Fabian drug itself the than receptor significa has tamoxifen of metabolite 4 hydroxy the sam the to expression gene Bdnf decreased tamoxifen estrogen response element is found in the the in is found element response estrogen (Zhou activation within CREB parallel byestradiol s its CA1, the of neurons in pyramidal expressed is 1990; Handa, and O’Keefe Beyer,2000; and (Ivanova ERα localizes immunocytochemistry and postnatally, CA in upregulated are andprotein ERα mRNA rats, In
Accepted Article
This article isprotected by copyright. All rights reserved. Bdnf Journal ofNeuroscienceResearch Journal ofNeuroscience Research transcript levels in female dentate, but in males in males but dentate, levels female transcript in Bdnf 17 Bdnf gene (Sohrabji et al.,1995). Together Together al.,1995). et (Sohrabji gene gene expression in pyramidal neurons neurons in pyramidal expression gene , the possibility is raised that the the that possibilityraised is the , and females may be due to sex due to be may and females et al., 2005), and a functional anda 2005), al.,functional et ntly more affinity for the estrogen the affinity for ntlymore ynthesis and secretion is promoted is promoted secretion and ynthesis cts on Bdnf expression from these from ctsBdnf expression on ct in the dentate gyrus, but not CA1. CA1. not but the gyrus, ct dentate in of estrogen receptors. In the the In receptors. estrogen of e same between neonatal males males neonatal between same e nzymes of the cytochrome P450 P450 cytochrome the of nzymes s localized to the plasma plasma the to localized s stradiol signaling at ERα and ERβ ERβ ERα and at signaling stradiol to nuclei of pyramidal neurons neurons pyramidal of nuclei to birth in the rodent liver, and liver,rodent and the in birth 1 during the twoweeks first duringthe 1 (Herrick et al., 2006), raising the the raising 2006), al., (Herricket Solum and Handa, 2001). BDNF BDNF 2001). Handa, and Solum e level as in females. Because Because in levelas females. e ects on Bdnf expression in Bdnfexpression on ects
(Auger et al., 2001; Perrot Sinal et al., 2003). Mo 2003). al., et Perrot Sinal 2001; al., et (Auger activated have more also and 2009), 2007; McCarthy, (Gala population neuronal the of percentage greater
the transcription factor CREB. Depolarizing GABA up Depolarizing GABA CREB. transcription factor the females, and the effects observed in this study in this on observed effects the and females, recep estrogen antagonize to able is tamoxifen that Hiltoal., (Gonzalez et tamoxifen of administration ne of the female brains in administration estradiol Hart2009). al., et 2012; al., (Cui et females and simshowperiod, a neonatal the low during although Males respond to GABAto respond Males in t are GABA offound actions depolarizing the and 199 al., et Shieh 2002; al.,et Obrietan 1995; al., in CREB a neurons contentin developing peptide and response to GABAto response i but inhibitoryneurotransmitter, is main the GABA downstream of estradiol signaling that mediate this mediate that signaling estradiol of downstream b theremust 2011), and Konkle McCarthy, 2004; al., is age equivalen this at hippocampus in the content How by estradiol. promoted is dentate in expression thatt suggests this glance first At sexspecific. developing brain, proximally mediated by an influx byan mediated proximally brain, developing
Accepted o action depolarizing the is mechanism possible One Article A receptor activation. This results in numerous trop numerous in results This receptor activation. This article isprotected by copyright. All rights reserved. A receptor activation with a longer duration of calc of duration longer witha activation receptor Journal ofNeuroscienceResearch Journal ofNeuroscience Research 18 he baseline sex difference in Bdnf in Bdnf sexdifference baseline he 8). Sex differences in CREB content content in CREB differences 8). Sex In addition, the effects of exogenous exogenous of effects the addition, In reover, both the depolarizing actions of of depolarizing the actions both reover, n et al., 2004). Together these indicate these Together 2004). al., et n onatal rodents is blocked bysystemic blocked is rodents onatal mmature neurons are depolarized in in depolarized neurons are mmature Bdnf of Ca of dfeec. difference. t in males and females (Amateau et et (Amateau and females in males t tors similarly in neonatal males and and males similarly neonatal tors in he neonatal hippocampus of rats. of hippocampus neonatal he ever, since estradiol and androgen androgen and estradiol since ever, nopoulou, 2008; Nuňez and and Nuňez 2008; nopoulou, ilar pattern of expression in males males in expression of pattern ilar e sex specific mechanisms mechanisms esex specific regulates regulates CREB compared to females to females compared CREB dependent manner (Berninger et (Berninger manner dependent expression in the dentae are dentae in the expression 2+ , which results in activation of of activation in results which , f GABA. In the adult brain brain the In GABA. adult f Bdnf gene expression expression gene hic effects in the effects hic ium influx in a influxa ium in Page 18of40 Page 19of40
depolarizing GABA and CREB suggest a mechanism thro a mechanism suggest CREB and GABA depolarizing 2009) McCarthy, Nuňezand 2005; al., Nuňezet 2012; positivelyare regu content CREB activated and GABA insufficient sensitivity in our Western immunoblots our sensitivity in Western insufficient inability to our therefore and 2014), al., (Yanget 1 first duringthe mice of hippocampus in the found 200 al., et Yang 2004; al., (Panget peptide mature pr the of activation zymogen for essential is which expressio regulated developmentally to due animals, the hippin greatest is form the mature to relative abundanc The immunoblots, our in Western propeptide ba wedetecteda only although output, translational wer and BDNF, of mature form the and propeptide KDa immunobl for antibodywe used Western anti BDNF the (MowlaKDa 14 of peptide yielda mature to cleaved approximatelyof propeptide precursor glycosylated BDNFsynt is immunoblotting. with confirmed Western re in or and females, males content between peptide qPCR results the from that regions CA1 mirrored and rel captured the ELISA levels. Although peptide and estradiol content between the sexes. sexes. the content between estradiol hippocampus neonatal the in achieved is expression
Accepted Articlediscorda study wasthe this of outcome surprising A
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 19 quantify mature BDNF is likely due to to BDNFlikely is due quantify mature ocampus of neonatal and juvenile juvenile and neonatal of ocampus otease which cleaves proBDNF to the the to cleaveswhichproBDNF otease . Previous studies have noted noted have Previousstudies . 5 days postnatally is extremely low daysextremely is postnatally 5 9). The amount of mature BDNF mature of amount 9). The nd corresponding to the 28 KDa the 28 to corresponding nd 28 KDa, which is proteolytically proteolytically is which KDa, 28 ative differences between dentate dentate between ativedifferences et al., 2001). Both the ELISA and and ELISA the Both 2001). al., et sponse to estradiol, and thiswas and estradiol, to sponse n of tissue plasminogen activator, activator, plasminogen tissue n of of males in spite of equivalent equivalent of in spite of males , it did not detect any differences in in any detect differences not did it , hesized and secreted as as a secreted and hesized . The baseline sex differences in sexdifferences . baseline The lated by estradiol (Nugent et al.,et (Nugent byestradiol lated e of BDNF precursor peptide peptide precursor BDNF e of e intended to measure total total measure to intended e 28 the detect to able are otting ugh which greater greater which ugh nce between between nce Bdnf Bdnf transcript transcript
promote apoptosis through preferential activation o activation preferential through apoptosis promote asnoted genesis, cell increases BDNF 2006). While includi development, neuronal of aspects several on matur and propeptide BDNF levels. The transcript or hippocam in the peptide mature BDNF of lowerlevels separation maternal undergoing Females propeptide. whileno peptide, BDNF mature the of levels higher hippocampal subregions, as well as a more detailed detailed awellmore as as subregions, hippocampal relationship this how which examine studies Further levels of hippocampal hippocampal of levels experienced thathad rats male stressed adolescent More recentl 2002). and(Solum Handa, transcripts in BD increase significant a castrationinduces rat, in levels peptide on effect no but had transcripts
future study. future BDNF and mature proBDNF of effects opposing the and sex spec for potential given the study,but this in 2005) al., et (Teng cell genesis decreasing thereby relationship between between relationship differences between between differences
(1999) found that estradiol treatment of ovariectom of treatment that estradiol found (1999)
Acceptedd region specific sexand found wesummary, have In Article Bdnf Bdnf Bdnf This article isprotected by copyright. All rights reserved. transcript levels and peptide content. For For example content. peptide and levels transcript gene expression and estradiol in the neonatal hipp neonatal in the estradiol and expression gene gene expression compared to unstressed animals, bu animals, unstressed to gene compared expression Journal ofNeuroscienceResearch Journal ofNeuroscience Research 20 ific regulation of proBDNF cleavage, cleavage, regulation proBDNF of ific the hippocampus. In the neonatal male neonatal the In hippocampus. the NF mature peptide, in opposition to to in opposition peptide, mature NF . We did not quantify mature BDNF BDNF quantify mature not did . We ized female rats increased ratsincreased ized female f p75 f changes are observed in the BDNF BDNF the observed in changes are is differentially mediated among the the among mediated differentially is ng cell proliferation (Hempstead, (Hempstead, proliferation cell ng y, Hill et al (2014) found that (2014) al y,found Hill et e form can have opposing effects effects opposing have can e form maternal deprivation have lower have deprivation maternal analysis of the effects of sex and sex of and the effects analysisof above, BDNF propeptide can can propeptide BDNF above, pus, but no changes in propeptide propeptide in changes no but pus, and adolescent stress also exhibit exhibit also stress and adolescent NTR on cell genesis, this is worth is this genesis, cell on , rather than TrKB receptors, receptors, than rather TrKB , ifferences in the in ifferences , Gibbs , Gibbs ocampus. ocampus. Bdnf t
Page 20of40 Page 21of40 All authors had access to the data and take respons take and the data access to had authors All study co and of Acquisition MM. funding manuscript: manus Draftingthe of KK. statistical analyses: and des and concept Study the analyses. of accuracy and
Role of Authors of Role interest. of conflicts no declare authors The Interest of Conflict to 040726B1 award byNINDS work wassupported This Acknowledgements developing the hippocampus. of differentiation processing, may identi BDNF propeptide on estradiol
Accepted Article
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 21 cript: KK. Critical revision of the Critical of revision cript: KK. ibility for the integrity of the data data integritythe the of ibilityfor ordination: MM. ordination: fy BDNF as a key factor in sexual sexual in a key factor as BDNF fy ign: MM and KK. Data acquisition acquisition Data KK. MMand ign: MMM.
Aid, T, A Kazantseva, M Piirsoo, K Palm and T PalmTimmu and T K Piirsoo, Kazantseva, M A T, Aid, Auger, A P, T S Perrot Sinal and M M McCarthy (2001 McCarthy MM and S P,Perrot Sinal A T Auger, Amateau, S K, J J Alt, C L Stamps and M MM and McCarthy JStamps Alt, J S K, L C Amateau, Cui, J Y, H J Renaud and C D Klaassen (2012). "Onto (2012). Klaassen D C and Renaud J Y,H J Cui,
Catts, V S, N Al Menhali, T H Burne, M J Colditz J M an H Burne, T N VAl Menhali, S, Catts, Berninger, B, S Marty, F Zafra, M da Penha Berzaghi Penha da M Zafra, F Marty, B,S Berninger,
Bakker, J, C De Mees, Q Douhard, J Balthazart, P Ga P J Balthazart, Douhard, Mees, J,Q De C Bakker, Bowers, J M, J Waddell and M M McCarthy (2010). "A "A (2010). McCarthy MM and J M, J Bowers, Waddell Gene Isoforms during Postnatal Liver Maturation in in LiverMaturation during Postnatal Isoforms Gene Differ behaviours." behaviours." neuroge hippocampal regulates receptor neurotrophin Disposition gene structure and expression revisited." revisited." and expression structure gene expression in rat hippocampal neurons duringmatura neurons rat hippocampal in expression enhanc switches from stimulation "GABAergic (1995). brain." brain." sexu steroid mediated in point a divergence as GABA masculinization and defeminization by estrogens." byestrogens." defeminization and masculinization the developing protects "Alpha fetoprotein (2006). 121(8): 2327 2335. 2327 2335. 121(8): synthesis by the female telencephalon." telencephalon." female bythe synthesis heteroge regional sexdifferences, rats: newborn in hippocampal neurogenesis is mediated by endogenous byendogenous mediated is neurogenesis hippocampal
Accepted8. 1(1): Article Proc Natl Acad Sci U S A S U Natl Acad Sci Proc
40(6): 1226 1237. 40(6): Eur J Neurosci J Eur This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 28(5): 883 892. 28(5): 98(14): 8059 8064. 8059 8064. 98(14): 22 Endocrinology JRes Neurosci d E J Coulson (2008). "The p75 p75 "The (2008). J Coulson E d , H Thoenen and D Lindholm andLindholm D Thoenen H , bant, J Szpirer and C Szpirer and Szpirer J bant, geny of Novel Cytochrome P450 P450 Novel genyCytochrome of sk (2007). "Mouse and rat rat BDNF and "Mouse (2007). sk ). "Excitatory versus inhibitory "Excitatoryinhibitory ). versus developmental sex difference in in sexdifference developmental (2004). "Brain estradiol content content estradiol "Brain (2004). female mouse brain from mouse female Nat Neurosci Nat neity, and possible de novo de possible and neity, Mice." Mice." tion in vitro." vitro." in tion al differentiation of the of differentiation al ing to repressing BDNF BDNF repressing toing nesis and related and nesis 145(6): 2906 2917. 145(6): oestradiol." oestradiol." 85(3): 525 535. 85(3): Drug Metabolism and DrugMetabolismand 9: 220 226. 9: 220 226. Development Biol Sex Sex Biol
Page 22of40 Page 23of40 Galanopoulou, A (2008). "Dissociated gender specifi "Dissociated (2008). A Galanopoulou, Gibbs, R (1999). "Treatment with estrogen and proge and withestrogen "Treatment (1999).R Gibbs, Fanselow, M S and H W Dong (2010). "Are dorsal the Dong"Are (2010). H and W S M Fanselow, Gonzales, K L, P Quadros Mennella, M J Tetel and C J Mand Tetel Quadros Mennella, K P L, Gonzales, Hart, S N, Y Cui, C D Klaassen and X b Zhong (2009) X bZhong and D C YKlaassen Cui, N, S Hart,
Damborsky, J C and U H Winzer Serhan (2012). "Effec (2012). U H and C J Winzer Serhan Damborsky, Fabian, C, Tilzer, L and Sternson, L (1981). "Compa (1981). L Sternson, and L C, Tilzer, Fabian, GABA signaling in CA1 pyramidal neurons: roleGA of neurons: pyramidal CA1 in signaling GABA adult brain." brain." adult and protein mRNA factor neurotrophic brain derived of Neuroscience of metastatic breast cancer." cancer." breast metastatic withblood correlation carcinoma: breast human from estr for desmethyltamoxifen and 4 hydroxytamoxifen, Disposition functionally distinct structures?" structures?" distinct functionally Receptor Expression." Expression." Receptor Recep Oestrogen Selective and Oestradiol of Effects Devel in the Receptor Oestrogen of Actions Specific P450 Gene Expression during Liver Maturation in Mic in LiverMaturation during Expression Gene P450
Accepted ArticleNeuroscience pos the in expression mRNA 2B subunit receptor NMDA N factor, neurotrophic brain derived 2, transporter co transp Na(2)(+)/K(+)/Cl( ) on treatment nicotine
37(1): 116 121. 37(1): Brain ResearchBrain 225: 105 117. 105 117. 225: This article isprotected by copyright. All rights reserved. 28: 1557 1567. 28: Journal ofNeuroscienceResearch Journal ofNeuroscience Research Journal of Neuroendocrinology of Journal Biopharm Drug DisposBiopharm Drug 844: 20 27. 844: Neuron 23 65(1): 7 19. 7 19. 65(1): rative binding affinities of tamoxifen, tamoxifen, of affinities binding rative c effects of recurrent seizures on seizures recurrent of c effects sterone affects relative levels of of levels relative affects sterone . "Three Patterns of Cytochrome of Patterns . "Three K Wagner (2012). "Anatomically (2012). K Wagner and ventral hippocampus ventral hippocampus and ts of sex and chronic neonatal neonatal sex chronic tsof and
MDA receptor subunit 2A and 2A subunit receptor MDA 2 orter 1, K(+)/Cl( ) co K(+)/Cl( ) 1, orter : 381 390. : oping Female Rat Brain: Brain: Rat Female oping in different regions o the othe regions in different levels in patients with in levels tor Modulators on Progestin Progestin on Modulators tor ogen receptors isolated isolated receptors ogen e." e." 24(2): 285 291. 24(2): BA(A) receptors." receptors." BA(A) tnatal rat hippocampus." rathippocampus." tnatal Drug Metabolism and DrugMetabolismand Journal Journal
Hempstead, B (2006). "Dissecting the Diverse Action Diverse the B "Dissecting (2006). Hempstead, Herrick, S P, E M Waters, C T Drake, B S McEwen and S B Drake, M T C E P, S Herrick, Waters, Konkle, A T and M M McCarthy (2011). "Developmental (2011). McCarthy MM and A T Konkle, Lee, E and H Son (2009). "Adult hippocampal neuroge hippocampal H "Adult (2009). and Son E Lee, Hill, R A, M Klug, S Kiss Von Soly, M D Binder, A J A Binder, D M Soly, Kiss Von S Klug, M A, Hill,R Hilton, G D, A N Ndubuizu and M M McCarthy (2004). McCarthyMM (2004). Ndubuizu N D, and A G Hilton, Ivanova, T and C Beyer (2000). "Ontogenetic express "Ontogenetic BeyerC (2000). and T Ivanova, Hojo, Y, S Higo, S Kawato, Y Hatanaka, Y Ooishi, G G Y Ooishi, Y Hatanaka, S Higo, Kawato, Y,S Hojo, Neurotrophins." Neurotrophins." adult and neonatal rat dentate gyrus."rat dentate neonatal and adult doubl on is immunoreactivity betareceptor estrogen female rat brain." ratbrain." female levels dis in and dihydrotestosterone testosterone, Cell Tissue Res Tissue Cell in mRNA receptor alpha/beta estrogen and aromatase factor expression and signaling." and signaling." expression factor in hippocampa correspond with alterations model rat memory in spatial disruptions "Sex specific (2014). 150(2): 191 198. 150(2): estradiol in newborn female rat hippocampus." rathippocampus." infemale newborn estradiol
AcceptedEndocrinology in Frontiers Modulat for Essential Corticosteroids: and Steroids "Hippoc (2011). Kimoto and MukaiHT Ogiue Ikeda, M Article
300(2): 231 237. 300(2): This article isprotected by copyright. All rights reserved. Current Alzheimer Current Research Endocrinology Journal ofNeuroscienceResearch Journal ofNeuroscience Research 2: 43.2: 152(1): 223 235. 223 235. 152(1): Hippocampus 24 Brain ResBrain Hannan and M van den Buuse den Buuse van M and Hannan 3(1): 19 24. 3(1): Murakami, H Ishii, Y Komatsuzaki, YIshii,H Komatsuzaki, Murakami, s of Pro and Mature and Mature Pro of s ion and sex differences of of sexdifferences and ion Developmental Brain ResearchDevelopmental 1197 1211. 24(10): "Neuroprotective effects of of effects "Neuroprotective nesis and related neurotrophic related and neurotrophic nesis 1121(1): 46 58. 1121(1): T A Milner (2006). "Extranuclear "Extranuclear Milner (2006). A T time course of estradiol, course estradiol, of time crete regions of male and regionsmale of crete and anhedonia in a "two hit" in "two hit" a anhedonia and ion of Synaptic Plasticity." Plasticity." Synaptic of ion ecortin containing cells in the the in cells ecortin containing l brain derived neurotrophic lneurotrophic brain derived ampal Synthesis of Sex Sex of Synthesis ampal the mouse hippocampus." hippocampus." mouse the
Page 24of40 Page 25of40
Mahmoud, R, S R Wainwright and L A M Galea"SexMhor A L R and S R, Wainwright Mahmoud, Lima, M, J Malheiros, A Negrigo, F Tescarollo, M MeM Tescarollo, F Negrigo, Malheiros, A J M, Lima, Mukai, H, T Tsurugizawa, M Ogiue Ikeda, G Murakami, Ogiue Ikeda, M H, Tsurugizawa, T Mukai, McLean, C P, A Asnaani, B T Litz and S G Hofmann (2 Hofmann S G LitzB and T Asnaani, P, A C McLean, Mong, J A, E Glaser and M M McCarthy (1999). "Gonad (1999). McCarthy MM Eand Glaser A, J Mong, Mowla, S J, H F Farhadi, S Pareek, J K Atwal, S J M J S K Atwal, J Pareek, S Farhadi, F H J, S Mowla, Naftolin, F, K Ryan, I Davies, V Reddy, F Flores, Z Flores, F Reddy, IV Davies, Ryan, F, K Naftolin,
factors." factors." postnatal development in rats." rats." in development postnatal nociceptive after alterations cellular hippocampal long t "Sex related (2014). Covolan L and Guinsburg neurogenesis: Regulation, implications, and potenti and implications, Regulation, neurogenesis: Synaptic Plasticity of Memory." Memory." of Plasticity Synaptic th in Production "Local Neurosteroid (2006). Kawato Neuroendocrinology a regionally specific manner." manner." specific regionally a th in morphology and neuronal alter differentiation illness." illness." c illness,of course Prevalence, disorders: anxiety derived neurotrophic factor." factor." neurotrophic derived proces post translational and "Biosynthesis (2001).
tissues." tissues." by estrogens of "The (1975). formation L and Wolin Accepted Article Journal of Psychiatric Research Psychiatric Journal of BMB Rep BMB Recent Progress in Hormone Research Hormone in Progress Recent
This article isprotected by copyright. All rights reserved. 42(5): 239 244. . Journal ofNeuroscienceResearch Journal ofNeuroscience Research J Biol Chem J Biol J Neurosci J Neuropharmacology Neuroendocrinology 25 45(8): 1027 1035. 1027 1035. 45(8): 19(4): 1464 1472. 1464 1472. 19(4): 276(16): 12660 12666. 12660 12666. 276(16): Petro, M Kuhn, R White, Y Takaoka Y Takaoka R M Kuhn, Petro, White, orris, N G Seidah and R A Murphy A R and G N Seidah orris, deiros, D Suchecki, A Tannus, R A Tannus, Suchecki, D deiros, 011). "Gender differences in "Genderdifferences 011). Y Hojo, H Ishii, T Kimoto and S S and Kimoto T Ishii,YH Hojo, 31: 295 319. 31: al steroids promote glial steroids promote al stimulation throughout throughout stimulation omorbidity and burden of of burden and omorbidity e developing hypothalamus in hypothalamus developing e mones and adult hippocampal hippocampal andadult mones sing of the precursor to brain to precursor the of sing al mechanisms." mechanisms." al 84(4): 255 263. 84(4): central neuroendocrine neuroendocrine central 77: 268 276. 77: e Hippocampus: Influence on on Influence Hippocampus: e erm behavioral and and behavioral erm Frontiers in in Frontiers
Pang, P T, H K Teng, E Zaitsev, N T Woo, K Sakata, K Sakata, N T Zaitsev, K HWoo, E Teng, P T, Pang, Nunez, J L and M M McCarthy (2007). "Evidence for a for "Evidence (2007). McCarthy MM L and J Nunez, Nunez, J L and M M McCarthy (2009). "Resting intrac (2009). McCarthy MM L and J Nunez, Obrietan, K, X B Gao and A N Van Den Pol (2002). "E (2002). Pol N Den A Van and Gao K,X B Obrietan, Nunez, J L, L L Bambrick, B K Krueger and M and McCar M K Krueger B L Bambrick, L L, J Nunez,
Naftolin, F, K Ryan and Z Petro (1971). "Aromatizat (1971). Petro and Z Ryan F, K Naftolin, O'Keefe, J A and R J Handa (1990). "Transient "Transient eleva (1990). J R Handa and J A O'Keefe, Nugent, B M, C V Valenzuela, T J Simons andMcC MM Simons J Valenzuela, M,T V C B Nugent, for long term hippocampal plasticity." plasticity." hippocampal long term for by proBDNF of "Cleavage B(2004). Lu and Hempstead Neurosci mediated excitation in the developing male versus f versus male developing the in excitation mediated Neurobiol synthesis in the developing male and female hippoca and female male developing the in synthesis r possible and Acid Gamma Aminobutyric depolarizing neonatal rat hippocampus." rathippocampus." neonatal hypothalamus." hypothalamus." activate and byestradiol upregulated are OSR1 and 158(2): 623 634. 158(2): feedback circuit in developing neurons." neurons." in developing circuit feedback MAPK CREB dependent via a expression BDNF increase chronic treatment with estradiol in developing rat in developing withestradiol treatment chronic med receptor acid gamma aminobutyric of enhancement
Accepted Article foetuses." human from tissue system
21(12): 3251 3261. 21(12): 67(14): 1879 1890. 1879 1890. 67(14):
J Neurosci J This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 32(2): 593 598. 32(2): Brain Res Dev Brain ResBrain ResDev Brain 26 Science Journal of Endocrinology Journalof J Neurophysiol J ion of androstenedione by limbic bylimbic androstenedione of ion 306(5695): 487 491. 306(5695): tion of estrogen receptors in the receptors estrogen of tion S Zhen, K K Teng, W H Yung, B L L Yung, H B K K Teng, SZhen, W ellular calcium concentration, calciumconcentration, ellular xcitatory actions of GABA of xcitatoryactions n extended duration of GABA of duration n extended thy (2005). "Prolongation and and "Prolongation (2005). thy hippocampal neurons." neurons." hippocampal arthy (2012). "Kinases SPAK SPAK "Kinases (2012). arthy emale hippocampus." hippocampus." emale NKCC1 in the developing developing the in NKCC1 mpus." mpus." 57(1): 119 127. 57(1): ole of local estradiol localestradiol of ole 88(2): 1005 1015. 1005 1015. 88(2): tPA/plasmin is essential essential is tPA/plasmin iated excitation by excitation iated mechanism a positive positive mechanism a Neuroscience 795 796. 51: Eur J J Eur Dev Dev
Page 26of40 Page 27of40 Sohrabji, F, R C Miranda and C D Toran Allerand (19 D C Toran Allerand and Miranda C R F, Sohrabji, Shieh, P B, S C Hu, K Bobb, T Timmusk and A Ghosh ( Ghosh and A Timmusk T Hu,K C Bobb, B,S P Shieh, Schoenfeld, T J and E Gould (2012). "Stress, stress "Stress, (2012). E J Gould and T Schoenfeld, Schoenfeld, T J and H A Cameron (2015). "Adult Neur "Adult (2015). H J Cameron and A T Schoenfeld, Represa, A and Y Ben Ari (2005). "Trophic actions o actions "Trophic Y Ben Ari and (2005). A Represa, Pfaffl, M W (2001). "A new mathematical model for r for model "A (2001). mathematical new M Pfaffl, W Scharfman, H E and N J MacLusky (2006). "Estrogen a "Estrogen (2006). MacLusky J N E H and Scharfman,
Scharfman, H, J Goodman, A Macleod, S Phani, C Anto C S Macleod, Phani, A Goodman, J H, Scharfman, Perrot Sinal, T S, A P Auger and M M McCarthy (2003 McCarthy MM and P Auger S, A T Perrot Sinal, signaling pathway involved in calcium regulation of regulation calcium in involved pathway signaling 20(4): 727 740. 20(4): factor." factor." brai gene the encoding in element response estrogen Neuropsychopharmacology neurogenesis." neurogenesis." Trends Neurosci Trends RT PCR." RT PCR." interactions in the adult CNS." CNS." the adult in interactions complexitysteroid of hippocampus: in (BDNF) factor BDNF infusion in adult rats." in adult rats." infusion BDNF cel granule ectopic the and neurogenesis "Increased
Accepted Articleregion." brain and sex, Ca2+bychanne l type mediated are brain developing Proc Natl Acad Sci U S A S U Natl AcadSci Proc
Nucleic ResNucleic Acids
Experimental Neurology Experimental This article isprotected by copyright. All rights reserved. 28(6): 278 283. 278 283. 28(6): Journal ofNeuroscienceResearch Journal ofNeuroscience Research Neuroscience 40(1): 113 128. 40(1): 29(9): e45. 29(9): Exp Neurol Exp Front Neuroendocrinol Front 92(24): 11110 11114. 92(24): 27 116(4): 995 1003. 116(4): 233(1): 12 21. 233(1): 192(2): 348 356. 192(2): hormones, and adult and adult hormones, elative quantification in real time in real time elativequantification f GABA on neuronal development." development." neuronal on GABA f 95). "Identification of a a ofputative "Identification 95). ogenesis and Mental Illness." andMental ogenesis ). "Excitatory actions of GABA in GABA of ). actions "Excitatory nd brain derived neurotrophic neurotrophic brain derived nd 1998). "Identification of a of "Identification 1998). nelli and S Croll (2005). S (2005). Croll and nelli BDNF expression." expression." BDNF hormone growth factor factor hormone growth ls after intrahippocampal intrahippocampal after ls 27(4): 415 435. 27(4): n derived neurotrophic neurotrophic n derived ls and dependent on age, age, on and lsdependent Neuron
Waddell, J, J M Bowers, N S Edwards, C L Jordan and Jordan L C Edwards, S N Bowers, MJ, J Waddell, Teng, H K, K K Teng, R Lee, S Wright, S Tevar, R D R S Tevar, S K K Lee, R Teng, K, H Wright, Teng, Yang, J, Lauren C Harte Hargrove, C J Siao, T Marin T Siao, C J Harte Hargrove, C Lauren J, Yang, Eff in the Differences "Gender (2007). M Weinstock,
Taliaz, D, N Stall, D E Dar and A Zangen (2010). "K (2010). Zangen A and E D Dar Stall, N D, Taliaz, Solum, D T and R J Handa (2002). "Estrogen regulate "Estrogen (2002). JR Handa and D T Solum, Solum, D T and R J Handa (2001). "Localization of e of "Localization (2001). JR Handa and D T Solum, Sweatt, J D (2004). "Hippocampal function in in cognit function "Hippocampal (2004). D J Sweatt, Tfm rat." rat." Tfm genesis cell hippocampal neonatal of "Dysregulation sortilin." sortilin." aof rece via activation apoptosis neuronal induces Hemps L Nykjaerand B A Kraemer, T RLee,F S Chen, Development and Behaviour." and Behaviour." Development Remodeling, Synaptic Transmission, and Synaptic Pla Synaptic and Transmission, Synaptic Remodeling, "proBDNF (2014).Negatively Hempstead L Barbara and D Francis Mark, Ballon, Bath, G Kevin W LaFrancois, depression and reduces neurogenesis." reduces and neurogenesis." depression precipi sites brain in specific factor neurotrophic 174(1): 99 110. 174(1): Res Neurosci derived neurotrophic factor mRNA and protein in the in protein and mRNA factor neurotrophic derived in pyramidal neurons of the developing rathippocam developing the of neurons pyramidal in
Accepted Article165 175. 128(2): J Neurosci J 22(7): 2650 2659. 2650 2659. 22(7): HormBehav
This article isprotected by copyright. All rights reserved. 25(22): 5455 5463.25(22): 64(1): 144 152. 64(1): Journal ofNeuroscienceResearch Journal ofNeuroscience Research Neurochemical Research Neurochemical 28 Mol Mol Psychiatry ion." ion." nockdown of brain derived brain derived of nockdown ects of Prenatal Stress on Brain on Stress Prenatal ofects strogen receptor alpha (ER alpha) alpha) (ER alpha receptor strogen Almeida, P Kermani, R Torkin, Z Y Z R Torkin, Kermani, P Almeida, ic, R Clarke, Q Ma, D Jing, John J J John Jing, D Q Clarke, RMa, ic, s the development of brain of s development the tates behaviors associated with associated behaviors tates M M McCarthy (2013). (2013). McCarthy MM Psychopharmacology (Berl) Psychopharmacology ptor complex of p75NTR and p75NTR of complex ptor rat hippocampus." rat hippocampus." in the androgen insensitive insensitive androgen in the pus." S Lee, Helen E Scharfman Scharfman Helen Lee, E S sticity in Hippocampus." sticityHippocampus." in 15(1): 80 92. 15(1): 32(10): 1730 1740. 32(10): tead (2005). "ProBDNF "ProBDNF (2005). tead Regulates Neuronal Neuronal Regulates Brain Res Dev Brain Res Brain Dev Brain J J
Page 28of40 Page 29of40
Yang, J, C J Siao, G Nagappan, T Marinic, D K Jing, Marinic, Nagappan, T G Siao, J C J, Yang, Figure 1: Relative abundance of abundance Relative 1: Figure Legends Figure Zhou, J, H Zhang, R S Cohen and S C Pandey (2005). C S Pandey (2005). and S R Cohen J,Zhang, H Zhou, normalized to to normalized byreal tim as determined (PN15), day postnatal and Daw Sprague of formation the hippocampal of regions Zhang, J M, A T Konkle, S L Zup and M M McCarthyMM (2 and Zup S L Konkle, A M, J T Zhang, B) No sex differences in sexdifferences No B) bot @p<0.0001, dentate; male to compared only males to compared in dentate, wereseen transcripts Bdnf w in Bdnf expression differences Regional *p<0.05). to f compared CA1, gyrus and in dentate transcripts PN4 gyrus.On A) dentate relative female to s.e.m., Cell Reports Cell proBDNF." proBDNF." Hempstead(2009). L and B B Lee, F Lu S Tessarollo, hippocampal structures." structures." hippocampal r in phosphorylation and expression protein binding factor neurotrophic brain derived of expression on Accepted Article dimorphism?" hippoca rat developing the in cells new on hormones
Gapdh
NatNeurosci 7(3): 796 806. 796 806. 7(3): transcripts and expressed as mean transcript transcript abund asmean and expressed transcripts Eur J Neurosci J Eur This article isprotected by copyright. All rights reserved. Bdnf Journal ofNeuroscienceResearch Journal ofNeuroscience Research transcripts seen at PN15. Greatest regional expres regional Greatest PN15. seenat transcripts 12(2): 113 115. 12(2): Neuroendocrinology Bdnf 27(4): 791 800. 27(4): transcripts in the dentate gyrus, CA1, and CA3 CA3 and CA1, gyrus, the dentate in transcripts 29 , males have higher levels of Bdnf Bdnf of levels havehigher , males emales (ANOVA, **p<0.01, **p<0.01, (ANOVA, emales CA1 or CA3 (ANOVA, #p<0.01, (ANOVA, #p<0.01, CA3 or CA1 ere also seen at PN4, where more more where seen PN4, at also ere e qPCR. Transcript levels are are levels qPCR. Transcript e 81(5): 294 310. 294 310. 81(5): McGrath, Z Y Chen, W Mark, L Z Y Chen, McGrath, W ley rats at postnatal day 4 (PN4) (PN4) 4 day postnatal at rats ley 008). "Impact of sex and sex of and "Impact 008). h sexes, compared to dentate. dentate. to compared hsexes, "Effects of estrogen treatment treatment estrogen of "Effects and cAMP response element cAMP and at amygdaloid and and amygdaloid at mpus: a novel source of sexof novel source a mpus: "Neuronal releaseof "Neuronal ance +/ ance sion in in sion
demonstrating a single band at 28 KDa was detected wasdetected KDa 28 at single band a demonstrating immunoblotti by determined as Western tamoxifen, or in hippocampus BDNFof propeptide Levels 4: Figure (non parametric ANOVA, ANOVA, (non parametric parametric ANOVA, ANOVA, parametric anim treated drug or control vehicle among detected No byELISA. determined as tamoxifen, or estradiol hippocampus in the BDNFof peptide Levels 3: Figure sex. each treatment group for per animals r in both females treated vehicle to compared males Bdnf express control). sexvehicle same to compared has efno whiletamoxifen sexes, both in expression e B) CA1, In control). sexvehicle same to compared each region. A) In dentate, estradiol decreases decreases estradiol dentate, In A) region. each
tamoxifen decreases decreases tamoxifen Bdnf were normalized to to werenormalized q byreal time determined as hippocampus, postnatal Figure 2: Regional effects of estradiol and tamoxif and estradiol of effects Regional 2: Figure sex. per animals 7 n=
Accepted Article #p<0.01, @p<0.00 gyrus (ANOVA, in dentate was seen Gapdh p Bdnf =0.0508), CA1 (B) (non parametric ANOVA, ANOVA, (non parametric (B) CA1 =0.0508), This article isprotected by copyright. All rights reserved. p transcripts in males only (ANOVA, *p<0.05, **p<0. *p<0.05, in(ANOVA, onlymales transcripts and expressed relative to vehicle treated females females treated vehicle to relative expressed and =0.1598). n= 5 6 animals per group for each sex. each group for per animals n= 5 6 =0.1598). Journal ofNeuroscienceResearch Journal ofNeuroscience Research 30 Bdnf en on en fect. (ANOVA, ***p<0.0001, ***p<0.0001, (ANOVA, fect. egions (ANOVA, #p<0.05). n= 5 6 5 6 n= (ANOVA,#p<0.05). egions differences in BDNF content were in BDNFcontent differences transcripts in both sexes, while sexes, both in transcripts als in the dentate gyrusdentate in (non the (A) als gene Bdnf increases stradiol ion was higher in vehicle treated treated vehicle in washigher ion PCR at PN4. Transcript levels Transcript PN4. at PCR ng. A) Representative blot Representativeblot A) ng. of PN4 animals treated with treated animals PN4 of with the BDNF antibody. No No antibody. BDNF withthe of PN4 rats treated with estradiol withestradiol treated rats PN4of Bdnf gene expression in in expression gene 01, compared to dentate). dentate). to compared 01, p =0.1463) or CA3 (C)CA3 or =0.1463) within 01 Page 30of40 Page 31of40
animals in the dentate gyrus (B) (ANOVA, (ANOVA, the (B) gyrus dentate in animals vehi among weredetected levelsin BDNF differences were noted among hippocampal subregions at PN4 (ANO PN4 subregions at hippocampal among werenoted im byWestern determined as (B), (A)PN15 and PN4 at inand dentate BDNFof propeptide Levels 5: Figure sex. each for treatment per animals 5 6 n= indicated at either PN4 (ANOVA, (ANOVA, PN4 either at indicated (ANOVA, (ANOVA,
(ANOVA, (ANOVA, wasde and females males between No difference CA1. BDNF wasmeasu More byELISA. as determined PN4, at inand dentate BDNFof propeptide Levels 6: Figure
p p =0.5086). Regional differences in BDNF propeptide c propeptide in BDNF differences Regional =0.5086).
Acceptedsex.per =0.7120). animals n= 7 Article
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research p =0.9689) or PN15 (ANOVA, (ANOVA, or=0.9689) PN15 p 31 =0.7858) or CA1 (C) (ANOVA, (C)CA1 (ANOVA, or =0.7858) CA1 regions of untreated animals animals of regions untreated CA1 CA1 regions of untreated animals animals of regions untreated CA1 cle, estradiol, or tamoxifen treated treated tamoxifen or estradiol, cle, munoblotting. No sex differences sexdifferences No munoblotting. tected in either dentate or CA1 or either dentate in tected VA, VA, red in dentate, compared to compared in red dentate, p p =0.9091) or PN15 PN15 or =0.9091) ontent were also not werealso ontent =0.0551). p =0.4975). =0.4975).
BDNF Aviva Systems Biology, Aviva Systems Cat# BDNF antigen 1:Primary Table antibodies used Cat# Abcam,ab9484; mouse GAPDH
Accepted Article ARP41970_P050; RRID species; host antibody source; RRID:AB_10644597 polyclonal; rabbit RRID:AB_307274 monoclonal;
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research
immunogen CNPMGYTKEG TVLEKPVSKGQLKQFYETK EWVTAADKKTAVDMSGGTV BDNF; human to the middleportionof peptidesynthetic homologous native human GAPDH 0.2 µg/ml 0.2 native human GAPDH
used concentration working 1.25 µg/ml 1.25 Page 32of40 Page 33of40
Accepted Article
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research
determined by real-time qPCR. determinedbyreal-timeqPCR. expression in Bdnf was seengyrus(ANOVA in expressiondentate was in Bdnf transcript abundance +/- s.e.m.,relative transcriptabundance female to Bdnf transcripts in dentate gyrusintranscripts compared dentate CA1, Bdnf and differencesPN were expression seen at also in Bdnf compared to CA1 or(ANOVA, males #p<0.01, CA1 CA3 compared to only hippocampal formation of Sprague Dawley rats at Sprague posof rats hippocampalformation Dawley sexes, compared to dentate.compared differencessexto sexes, No B) i
Accepted Articleintranscripts FigureBdnf 1:of Relative abundance
This article isprotected by copyright. All rights reserved. Transcriptlevels transcrip Gapdh to normalized are Journal ofNeuroscienceResearch Journal ofNeuroscience Research 81x29mm (300 x 300 DPI) (300 30081x29mm DPI) x animals per animals sex. dentate gyrus. A) higherA) PN4, gyrus. dentate have On males levels 4, where 4, weretranscripts more seenBdnf in dentate
, , compared @p<0.0001, 7 #p<0.01, n= dentate). to to females (ANOVA, **p<0.01, Regional*p<0.05).females (ANOVA, to n Bdnf transcripts seen at PN15. seentranscripts at Bdnf n regional Greatest the dentate the CA1, CA3 gyrus, and regions the of tnatal day 4 (PN4)4 astnatal (PN15), day postnatal day and compared to male dentate; @p<0.0001, both both @p<0.0001, maledentate; compared to ts and expressed as mean expressed mean and ts as
of of , , Page 34of40 Page 35of40
vehicletreate determinedbyreal- sex vehicle control). B) In CA1, estradiol CA1, increasevehicle sex In control). B) Figureestradiol of effects2: tamoxif Regional and whileintranscripts male decreases Bdnf tamoxifen no effect. (ANOVA, ***p<0.0001,(ANOVA, effect. no se same compared to vehicle treated males compared to vehiclevehicle to treatedtreated f compared males
Accepted Articledentate, region. estrad each A) dfemalesIn within
time qPCR at PN4. Transcript at levelswere timenormalized qPCR
This article isprotected by copyright. All rights reserved. animals per treatment group for each sex. persex. group animals fortreatment each Journal ofNeuroscienceResearch Journal ofNeuroscience Research 97x38mm (300 x 300 DPI) (300 30097x38mm DPI) x s Bdnf Bdnf s en on on en gene expression hippocampus Bdnf in postnatal s only (ANOVA, *p<0.05, **p<0.01same onlycompared to (ANOVA, s
emales in both regions (ANOVA, 5-6 n= #p<0.05). emalesinregions both (ANOVA, gene expression in both sexes, while tamoxifen has genewhile expression has tamoxifen insexes, both x vehicle control). Bdnf expression was higher vehicle x was in expression control). Bdnf iolintranscripts sexes, both decreases Bdnf to Gapdh and expressed and relative Gapdh to to
, , as
Figure 3: Levels of BDNF peptide Figure3:BDNF Levels of in hippocampus the determined by ELISA. No differencesNo content determinedin BDNF byELISA. animals in the dentate gyrus in dentate the animals (non-parametric AN (A)
Acceptedp=0.159(non-parametric (C) p=0.1463)ANOVA, or CA3 Article
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 254x487mm(300 300DPI) x of PN4 animals treated with estradiol animals PN4 of or tamoxifen
were controldetectedvehicle or drug among treate OVA,(non-parametric (B) p=0.0508), CA1 ANOVA, 8). n= 5-6 animals per 5-6 sex. animals n= group8). foreach
, as as , d Page 36of40 Page 37of40
tamoxifen treated animals in the dentate gyrus (B) gyrus(B) in dentate the treated animals tamoxifen determined by Western immunoblotting. A) Representa determinedA) immunoblotting. byWestern detected with the BDNF antibody. detecteddifferencesNo withBDNF the in
Acceptedpropeptide Figure4:BDNF Levels of in hippocampus Article
This article isprotected by copyright. All rights reserved. 5-6 animals per treatment for each sex. sex. per 5-6foreach animals treatment Journal ofNeuroscienceResearch Journal ofNeuroscience Research 250x172mm(300 300DPI) x (ANOVA, p=0.7858)(ANOVA,p=0.4975).n= or(C) CA1 (ANOVA, BDNF levels vehicle, wereBDNF among estradiol, detected
tive blot demonstrating a single band at 28 KDa was tive28KDa singleblot demonstratinga at band of PN4 rats treated with estradiol rats PN4 of as or tamoxifen,
or
propeptidewereeithe indicated content not also at Figure 5: Levels of BDNF propeptide Figure 5:BDNF Levels of and in dentate (B), as determined as (B), byWestern immunoblotting. se No
Accepted Article(ANOVA, subregionsPN4 at p=0.9091) (ANOVA,or PN15
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 91x33mm (300 x 300 DPI) (300 30091x33mm DPI) x r PN4 (ANOVA, p=0.9689) p=0.0551). or PN15 (ANOVA, r(ANOVA, PN4 CA1 regions of untreated animals at PN4 (A)CA1 PN1 PN4 and regionsat animals untreated of
x differences were noted among hippocampaldifferences x were notedamong p=0.5086). Regional differences in BDNF p=0.5086).Regional in differences BDNF
5
Page 38of40 Page 39of40
Figure 6: Levels of BDNF propeptide Figure 6:BDNF Levels of and in dentate by ELISA. was Morecompar BDNF inmeasuredbyELISA. dentate,
Accepteddetected (ANOV femaleswas in either or CA1 dentate Article
This article isprotected by copyright. All rights reserved. Journal ofNeuroscienceResearch Journal ofNeuroscience Research 75x48mm (300 x 300 DPI) (300 30075x48mm DPI) x CA1 regions of untreated animals at PN4, CA1determi PN4, as regionsat animals untreated of
ed to CA1. No differenceNo edCA1. to between and males A, per animals 7 A, p=0.7120).n= sex.
ned
In males neonatalmor of rats, hippocampus the have In
Accepted horn. Manipulation Ammon’s estradiol of signaling h Article
This article isprotected by copyright. All rights reserved. expression during the early postnatal period. expressionpostnatal during early the Journal ofNeuroscienceResearch Journal ofNeuroscience Research 240x123mm(100 100DPI) x
as region- and sex-specific effects on Bdnf gene Bdnf sex-specificon and region- effects as e gene intranscripts the Bdnf gyrusand dentate
Page 40of