EFFECTS of POSTTRANSLATIONAL MODIFICATION of TRANSCRIPTION FACTOR GLI-SIMILAR 3 by SUMOYLATION on INSULIN TRANSCRIPTION in PANCREATIC Β CELLS Tyler M

Murray State's Digital Commons

Murray State Theses and Dissertations Graduate School

2017 EFFECTS OF POSTTRANSLATIONAL MODIFICATION OF TRANSCRIPTION FACTOR GLI-SIMILAR 3 BY SUMOYLATION ON INSULIN TRANSCRIPTION IN PANCREATIC β CELLS Tyler M. Hoard Murray State University

Follow this and additional works at: https://digitalcommons.murraystate.edu/etd Part of the Cell Biology Commons, and the Molecular Genetics Commons

Recommended Citation Hoard, Tyler M., "EFFECTS OF POSTTRANSLATIONAL MODIFICATION OF TRANSCRIPTION FACTOR GLI-SIMILAR 3 BY SUMOYLATION ON INSULIN TRANSCRIPTION IN PANCREATIC β CELLS" (2017). Murray State Theses and Dissertations. 56. https://digitalcommons.murraystate.edu/etd/56

This Thesis is brought to you for free and open access by the Graduate School at Murray State's Digital Commons. It has been accepted for inclusion in Murray State Theses and Dissertations by an authorized administrator of Murray State's Digital Commons. For more information, please contact [email protected].

EFFECTS OF SUMOYLATION OF TRANSCRIPTION FACTOR GLI-SIMILAR 3 ON INSULIN TRANSCRIPTION IN PANCREATIC β CELLS

A Thesis Presented to The Faculty of the Department of Biological Sciences Murray State University Murray, Kentucky

In Partial Fulfillment of the Requirements for the Degree of Master of Science in Biology

By Tyler Matthew Hoard December 2017

iii

Acknowledgements There are so many people to whom I am thankful for the roles that they have played in the completion of this project. I would first like to thank my thesis advisor, Dr.

Gary ZeRuth. His guidance, patience, troubleshooting suggestions, and devotion to carrying out impactful research have contributed significantly to preparing me for a future in biomedical research. I would also like to thank my thesis committee members,

Dr. Ed Zimmerer, Dr. Chris Trzepacz, Dr. David Canning, and Dr. J. Ricky Cox for dedicating their time and providing additional guidance and suggestions. Dr. Dayle Saar has been a valuable source of advice and support, and for that I am grateful. Additionally,

I am thankful for the opportunities that have been provided to me by the Murray State

Department of Biological Sciences. My appreciation for my fellow ZeRuth lab researchers, Dylan Hammrich, Katie Alexander, Fumi Nakamura, and Erin Clayton, whom I have been able to depend on to be a constant source of lively company that has proven to be particularly valuable on long days of work and to help with experiments, cannot be overstated. I am also thankful for all of the staff in the Biology Department

Office for being a dependable source for whimsical conversation and unlimited coffee on particularly stressful days.

This effort would have been virtually impossible without the unwavering support of my family. They have always taken a significant interest in my aspirations, and I owe a large portion of my success in this journey to them. Finally, I would like to thank my friends Jon Dunning, Jordan Osman, and Ashley Munie for providing countless instances of enjoyment and relaxation as well as providing feedback on much of this work.

This research was supported by NSF-KY EPSCoR grant [RSF-042-14] and the

Intramural Research Program of the National Institute of Environmental Health Sciences, the National Institutes of Health [Z01-ES-100485] with additional support from a competitive research grant sponsored by the Committee for Institutional Studies and

Research at Murray State University

Abstract

The ability to control blood glucose levels is a fundamental component of vertebrates. In these organisms, blood glucose homeostasis is achieved through a fine- tuned mechanism that largely involves the secretion of hormones from the endocrine pancreas into the bloodstream. These hormones include glucagon, which is secreted by the α cells of the pancreas and initiates the release of glucose into the bloodstream through gluconeogenesis in the liver, and insulin, which is secreted from the β cells and signals the uptake of excess blood glucose by the peripheral tissue. Gli-similar 3 (Glis3) is a transcription factor that has previously been shown to play a critical role in both the development of β cells and transcriptional activation of the insulin gene. The mechanism by which the activity of Glis3 is modulated is still largely enigmatic.

The posttranslational modification of proteins by covalent attachment of the small ubiquitin-like modifier protein (SUMO) has become an interest of many labs in recent years. This is largely because of the multiple identified substrates for SUMOylation as well as the wide variety of effects that modification by SUMOylation can have on these substrates. A yeast two-hybrid assay using the Glis3 N-terminal conserved region as bait and a murine pancreatic β cell library identified enzymes that play an important role in the process of SUMOylation as potential Glis3 interactors. Subsequently, potential

SUMOylation sites were identified within a phylogenetically conserved N-terminal region of Glis3.

We found that Glis3 was SUMOylated by PIAS-family proteins (PIAS1 and

PIASy) at two conserved lysine residues within the N-terminal region of Glis3.

Additionally, it was found that posttranslational modification of Glis3 by SUMOylation regulated the transactivational activity of Glis3 in a tissue-dependent manner: down- regulating target genes in a β cell environment, and up-regulating genes in a non-β cell environment. These observed effects were due to mechanisms both dependent and independent of Glis3 SUMOylation as effects were observed after the mutation of the modified conserved lysine residues.

The transactivation activity of MafA, another transcription factor that plays a major role in activating target genes in β cells has previously been shown to be modulated by SUMOylation. It has also been demonstrated previously that MafA and

Glis3 work synergistically to activate target genes. We found that PIASy promoted MafA

SUMOylation which disrupts synergism between MafA and Glis3 at the insulin promoter.

Finally, we found that chronic exposure of β cells to hyperglycemic conditions promoted Glis3 and MafA SUMOylation which was coincident with a sharp decrease in insulin transcription. These data suggest a potential mechanism that could underlie β cell dysfunction preceding type 2 diabetes and could potentially explain one mechanism by which insulin secretion is negatively affected in individuals that are incapable of regulating their blood glucose levels.

Collectively, the results of this project provided novel information regarding transcriptional control of the insulin gene that is modulated by a combination of blood glucose levels and posttranslational modification.

vii

Table of Contents

Signature Page...... ii Acknowledgements...... iii Abstract...... v Table of Contents...... vii Chapter 1: Introduction...... 1 1A: The Pancreas...... 1 1B: Blood Glucose Homeostasis...... 4 1C: GLIS3, The Gene...... 5 1D: GLIS3, The Protein...... 5 1E: Glis3 Localization...... 6 1F: Glis3-Associated Pathologies...... 7 1G: Glis3-Mediated Gene Regulation...... 8 1H: MafA...... 9 1I: Posttranslational Modifications...... 10 1J: SUMOylation...... 12 1K: Pathologies Associated with SUMOylation...... 14 Chapter 2: Materials and Methods...... 16 2A: Cells and Growth Conditions...... 16 2B: Generation of Plasmids and Constructs...... 16 2C: Reporter Assays...... 18 2D: Co-Immunoprecipitation Assays...... 19 2E: Western Blot Analysis and Protein Quantification...... 20 2F: Quantitative Reverse Transcriptase Real-Time PCR Analysis...... 20 2G: Immunocytochemistry and Microscopy...... 21 Chapter 3: Results...... 23 3A: Glis3 Interacts with PIAS-Family Proteins...... 23 3B: PIAS-Family Proteins SUMOylate Glis3 at Lys224 and Lys430...... 25 3C: Glis3 is SUMOylated by SUMO1-3...... 29 3D: The Glis3 N-Terminal Conserved Region is Required for Glis3 SUMOylation...... 31 3E: SUMOylation of Glis3 Decreases its Transcriptional Activity...... 32 3F: PIASy and Ubc9 Negatively Regulate Insulin Transcription Through Glis3 Dependent and Glis3-Independent Mechanisms...... 36 3G: SUMOylation of MafA by PIASy and Ubc9 Neutralizes Synergism with Glis3...... 40 3H: Glis3 is SUMOylated Under Conditions of Chronic Hyperglycemia in BRIN-BD11 Cells...... 43 Chapter 4: Discussion and Future Direction...... 46 Chapter 5: Literature Cited...... 52 Chapter 6: Appendix...... 63

viii

List of Tables

Table 1: List of primers used for OES cloning...... 17 Table 2: List of primers used for RT-PCR...... 21

List of Figures

Figure 1: Schematic of Glis3...... 6 Figure 2: Glis3 weakly interacts with PIASy and PIAS1...... 24 Figure 3: Glis3 is SUMOylated by PIAS-family proteins at Lys224 and Lys430...... 27 Figure 4: PIASy and Ubc9 can modify Glis3 with SUMO1, SUMO2, and SUMO3...... 30 Figure 5: The NCR of Glis3 is required for SUMOylation...... 32 Figure 6: SUMOylation of Glis3 inhibits its ability to activate insulin transcription...... 34 Figure 7: PIASy and Ubc9 repress Glis3-mediated insulin transcription in BRIN-BD11 cells...... 38 Figure 8: SUMOylation of MafA disrupts synergism with Glis3 at the insulin promoter...... 42 Figure 9: Glis3 is SUMOylated under conditions of chronic hyperglycemia in BRIN- BD11 cells...... 44

Introduction

The Pancreas

The pancreas is a complex glandular organ composed of three distinct cellular populations that each perform several important roles in vertebrate physiology. The differentiated cells rising from these populations include the acinar cells, ductal cells, and endocrine cells. The acinar cells secrete enzymes into the duodenum that play a major role in the process of digestion. The ductal cells line the ducts through which these digestive enzymes travel when they are secreted. The ductal cells also secrete some products such as bicarbonate and mucins into the digestive tract (Hegyi et al. 2011). The endocrine cells secrete hormones into the blood stream. This endocrine cell population contains five different cell types: glucagon-secreting α cells, insulin-secreting β cells, ghrelin-secreting ε cells, somatostatin-secreting δ cells, and pancreatic polypeptide- secreting PP cells. These endocrine cells are arranged in small groups within the pancreas called the islets of Langerhans. These islets are closely associated with vasculature and neurons to facilitate a rapid response to ever-changing physiological conditions. These islets are largely composed of α and β cells, reflecting the significant role that insulin and glucagon play in maintaining strict control of blood glucose.

Pancreatic development depends on a complex combination of permissive and inductive molecular signals from multiple surrounding structures that guide the differentiation of gut endoderm. Multiple signals are responsible for the initial anterior- posterior patterning of the endoderm. Fibroblast growth factor (FGF) 4, retinoic acid

(RA) and Wnt/β-catenin are largely responsible for posteriorizing the gut endoderm

(Dessimoz et al. 2006, McLin et al. 2007, Bayha et al. 2009). RA from overlying mesoderm promotes pancreas specification of the gut endoderm. In zebrafish, it has been found that one of the most important components of anterior specification of the endoderm is the degradation of RA by Cyp26a1, which significantly contributes to defining the pancreatic field (Kinkel et al. 2009). Bone morphogenic protein (BMP) 2 under control of notch signaling is also an important component in specifying the anterior-posterior axis in zebrafish gut endoderm (Tiso et al. 2002). Although several of these mechanisms of anterior-posterior axis determination have not been thoroughly investigated in other organisms, it is likely that these mechanisms are conserved.

In addition to establishing the anterior-posterior field for pancreatic specification, dorsal-ventral specification of the pancreatic field is also critical. Some of the first signals that lead to dorsal-ventral patterning of the prospective pancreas are delivered to what will become the dorsal pancreatic bud. This area of gut endoderm is first within close proximity to the notochord until the fusion of the paired dorsal aortae displaces the notochord, leaving the prospective dorsal pancreas associated with cardiac endothelium

(Wessells and Cohen 1967, Spooner et al. 1970, Pictet et al. 1972). Signals from the notochord include activin-βB and FGF2 (Hebrok et al. 1998). Expression of hedgehog in the prospective dorsal pancreas ablates dorsal pancreatic development, suggesting that blockage of sonic hedgehog signaling is critical for dorsal pancreatic development

(Hebrok et al. 1998, 2000). The precise signals coming from the endothelium after displacement of the notochord during development are not clear. It does appear, however, that these signals are required for the expression of duodenal homeobox protein 1 (Pdx1),

3 a transcription factor that is an early molecular marker of pancreatic fate (Jacquemin et al. 2009).

The lateral plate mesoderm (LPM) is within close proximity to the prospective ventral pancreas during early development (Spooner et al. 1970). The specific signals coming from this tissue are not currently understood, but it has previously been speculated that ventral pancreatic development mirrors other common developmental schemes that depend on activin, BMP, and RA. One component of ventral pancreatic development that sets it apart from dorsal pancreatic development, is the necessity to block signals coming from the cardiac mesoderm. A major signal that has been determined to be particularly important in defining the border between the ventral pancreas and liver by blocking these signals is transforming growth factor (TGF) β

(Wandzioch and Zarat 2009).

After these induction events, cellular proliferation will take place, giving rise to a dorsal and ventral pancreatic bud. The dorsal pancreatic bud will give rise almost exclusively to endocrine cells and will form the primary islets. The ventral pancreatic bud will give rise primarily to acinar and ductal cells in addition to a small number of endocrine cells. After budding takes place, a stage of rapid cellular growth, division, and differentiation called primary transition takes place. The ventral and dorsal pancreatic buds will eventually fuse (Golosow and Grobstein 1962). After this fusion, branching morphogenesis takes place, forming the ducts through which digestive enzymes will be transported. The tips of the extending branches express pancreas transcription factor 1

(Ptf1a) and will become acinar cells (Zecchin et al. 2003). The cells directly behind the

Ptf1a-positive tip cells are bipotent trunk progenitors that are capable of developing into

4 ductal cells or endocrine cells, depending on what downstream signals the cells will be exposed to (Zhou et al. 2007). A stage of development referred to as secondary transition takes place following branching morphogenesis. This involves rapid and widespread terminal differentiation of pancreatic progenitor cells into acinar, ductal, or endocrine cells (Wang et al. 2005).

Blood Glucose Homeostasis

A critical component of physiology is the ability of an organism to maintain a constant healthy level of blood glucose. Multiple systems are involved in this precise control of blood glucose. One of the most important components of this process revolves around the hormones secreted from pancreatic α and β cells. In the event that blood glucose is high, insulin is secreted into the bloodstream from the β cells. This stimulates the uptake of excess blood glucose by the peripheral tissue. This glucose is then either used for energy or stored as fat. When blood glucose is low, glucagon is released into the bloodstream from the α cells. This stimulates gluconeogenesis in the liver. The glucose that is released from this process then enters the bloodstream. Diabetes mellitus is characterized by a disruption in this process, leading to an inability to regulate blood glucose. This condition is associated with multiple health problems including, blood vessel damage, neuropathy, and an increased risk of heart disease, strokes, and kidney failure. Diabetes is a chronic disease, and the cost of managing the symptoms of the disease has a significant economic impact on the economy of the United States and the world. In 2012, the cost of treating diabetes in the United States was 245 billion US dollars (Yang et al. 2013).

GLIS3, The Gene

Gli-similar (Glis) proteins belong to a subfamily of Krüppel-like zinc finger transcription factors that are closely related to the Gli and Zic subfamilies (Kinzler et al.

1988, Aruga et al. 1994, Kim et al. 2003, 2005). This family contains three members,

Glis1, Glis2, and Glis3 (Kim et al. 2003, 2005). Within the human genome, the GLIS3 gene is located on chromosome 9p24.2 and spans about 495kb (Kim et al. 2003). GLIS3 contains nine exons and eight introns (Kim et al. 2003). There is about 80% conservation between mouse and human Glis3 (Kim et al. 2003), as well as other model organisms such as Xenopus, chicken, and zebrafish. A Glis3 homolog, referred to as both gleeful

(gfl) and lame duck (lmd), has also been identified in Drosophila (Furlong et al. 2001,

Duan et al. 2001).

GLIS3, The Protein

The GLIS3 protein is 90kDa in size. Human GLIS3 contains a domain spanning exons 2-4 comprised of 5 tandem Cys2-His2 zinc fingers that are separated by a conserved

T/SGEKPY/F amino acid sequence (Kim et al. 2003). This domain is used for interacting with DNA (Kim et al. 2003). Indeed, previous analyses suggest that all of the zinc fingers with the exception of ZF1 bind to the major groove of target DNA (Pavletich and Pabo

1993). These interactions between DNA and Glis proteins are strongest at an identified consensus sequence for a Glis binding site (Fig. 1). Glis proteins will associate with the consensus sequence for Gli proteins as well, albeit with a lower affinity (Lamar et al.

2001, Nakashima et al. 2002, Kim et al. 2003, Zhang et al. 2002). The consensus sequence for Glis3 is 5’-(G/C)TGGGGGG(A/C)-3’ (Beak et al. 2008). In addition to the zinc finger domain, Glis3 also contains a C-terminal transactivation domain that is

6 critical in activating the transcription of target genes (Kim et al. 2003, Beak et al. 2008).

Glis3 also contains a large, conserved N-terminal domain. The function of this region is largely enigmatic, but it appears as though it serves a role in protein-protein interactions

(Kim et al. 2003, ZeRuth et al. 2015).

288 388

Figure 1. Schematic of Glis3 showing the N-terminal conserved region (NCR), zinc finger domain (ZFD), C-terminal activation domain (CTD), and the Glis binding site (GlisBS). Numbers indicate amino acid positions. (Adapted from Lichti-Kaiser et al. 2012).

Glis3 Localization

During development, Glis3 is expressed in the kidney, testes, lung, eyes, the nervous system, limb mesenchyme, pancreas, and osteoblasts (Kim et al. 2003, Beak et al. 2007). In adult mice, Glis3 is expressed in multiple tissues including the pancreas, thyroid gland, skeletal muscle, thymus, uterus, ovary, brain, lung, and liver (Kim et al.

2003). Subcellularly, previous studies suggest that Glis3 primarily localizes to the nucleus and the primary cilium, much like Gli proteins (Kim et al. 2003, Beak et al. 2008,

Hashimoto et al. 2009, Kang et al. 2009a, Haycraft et al. 2005). Disruption or removal of

ZF4 significantly reduces the amount of nuclear localization of Glis3, suggesting that

ZF4 plays an important role in subcellular localization. The primary cilium is important

7 in Sonic hedgehog (Shh-) and Wnt-mediated signaling, and dysfunctions in the cilia have been linked to several pathologies, referred to as ciliopathies (Oro 2007, Rohatgi et al.

2007, Corbit et al. 2008, Veland et al. 2009, Bisgrove and Yost 2006, Hildebrandt et al.

2009). Glis3 plays an important role in both developing and adult cells. One target gene that Glis3 plays a major role in activating is the insulin gene (Senee et al. 2006, Watanabe et al. 2009, Kang et al. 2009b, Yang et al. 2009, Beak et al. 2007, Kim et al. 2003).

Glis3-Associated Pathologies

Multiple diseases have been linked to dysfunctional Glis3. Human GLIS3 mutations have been implicated in a syndrome referred to as neonatal diabetes and hypothyroidism (NDH), characterized by hyperglycemia, hypoinsulemia, neonatal diabetes, as well as elevated thyroid stimulating hormone (TSH) (Senee et al. 2006).

NDH can be accompanied by facial abnormalities, cholestasis, progressive hepatic fibrosis, and congenital glaucoma (Taha et al. 2003, Senee et al. 2006). GLIS3 mutations also result in polycystic kidney disease, a syndrome characterized by the progressive development of massive kidney cysts capable of leading to kidney failure (Taha et al.

2003, Senee et al. 2006). The mechanism behind the development of these cysts is currently unknown, but it could involve a developmental role of the planar cell polarity pathway due to the finding the Glis3 is expressed in the metanephric mesenchyme during development (Kim et al. 2003). Glis3 null mice display a similar phenotype to human

NDH patients, including polycystic kidneys, dilated pancreatic ducts, and smaller, misshapen pancreatic islets containing significantly fewer β cells than wild-type mice

(Kang et al. 2009b, Watanabe et al. 2009). This suggests that Glis3 could play an important role in endocrine pancreatic development, particularly in directing the

8 differentiation of β cells. A human genome-wide association study has identified GLIS3 as a risk locus for both type 1 and type 2 diabetes (Barrett et al. 2009, Boesgaard et al.

2010, Dupuis et al. 2010).

Glis3-Mediated Gene Regulation

The observation that Glis3 localizes to the primary cilium contributed to constructing the current hypothetical model of how Glis3-mediated activation or repression of target genes is modulated (Kang et al. 2009a, Haycraft et al. 2005). The primary cilium is a cellular organelle surrounded by a membrane that is continuous with the phospholipid bilayer of the cell with an axoneme formed by nine pairs of microtubules extending its length (Bisgrove and Yost 2006, Berbari et al. 2009).

Transport proteins are important for moving proteins in and out of the cilium, a process referred to as intraflagellar transport (IFT) (Rosenbaum and Witman 2002, Bisgrove and

Yost 2006, Berbari et al. 2009). This hypothetical model proposes a mechanism that is similar to the Shh/Gli3 protein pathway. In this pathway, the Patched (Ptch) transmembrane protein is the receptor for the Shh ligand (Rohatgi et al. 2007). When no

Shh is present in an environment, Ptch represses another transmembrane protein,

Smoothened (Smo) (Rohatgi et al. 2007). This leads to Gli3 being cleaved, which removes the transactivation domain but leaves the ZF domain, generating an inhibitor

(Haycraft et al. 2005). When Shh is present in an environment, it will bind to Ptch. Ptch will then no longer repress Smo, so Smo will build up and prevent the cleaving of Gli3.

This leads to an accumulation of an uncleaved, activator form of Gli3. This hypothetical model is supported by data that suggest that Glis3 is capable of acting as an activator or a repressor (Kim et al. 2003). In the Shh/Gli3 pathway, IFT is critical in transporting Gli3

9 into the cilia, where it can be processed and can then relocate to the nucleus to repress or activate target genes (Haycraft et al. 2005).

The mechanism by which Glis3 activates or represses the activity of target genes is currently not completely understood. It has previously been shown that Glis3 interacts with various coactivators that modify chromatin at the site of a target gene to activate or repress the target (ZeRuth et al. 2013). Indeed, various protein-protein interactions appear to play a significant role in the activity of Glis3 as an activator or a repressor. ZeRuth et al. (2013) showed that the ability of Glis3 to recruit Creb-Binding Protein (CBP/p300) to the insulin promotor is critical for the synergistic activity of Pdx1, neurogenic differentiation 1 (NeuroD1), and v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (MafA) in activating the insulin gene (Pashavaria et al. 1997, Ohneda et al.

2000, Qiu et al. 1998, Zhao et al. 2005, Naya et al. 1997). Glis3 has also been shown to interact with WW domain-containing transcription regulator 1 (Wwtr1) (Kang et al.

2009a). Wwtr1 can interact with various other transcription factors to act as a coactivator or corepressor of target genes (Hong et al. 2005, Hong and Yaffe 2006).

MafA

MafA is a member of the large Maf family of transcription factors, all of which contain an N-terminal transactivation domain and a C-terminal basic leucine-zipper DNA binding domain (Matsuoka et al. 2003). Much like Glis3, MafA is highly conserved across species, presumably because of the important role that it plays in regulating the transcription of target genes (Olbrot et al. 2002). MafA is almost exclusively expressed in hormone-producing cells, a characteristic not observed in many other transcription factors that play a major role in insulin transcription (Nishimura et al. 2006). Another

10 distinction that sets MafA apart from related β cell transcription factors is the apparent lack of importance of MafA in the development of the pancreas. Complete knockout as well as conditional pancreatic knockout of MafA in mice does not affect pancreatic development, but these mice do display a severe reduction in expression of key β cell genes and develop diabetes by 12 weeks after birth (Artner et al. 2010, Zhang et al.

2005). These knockouts, as well as other studies, suggest that MafA becomes more important as organisms advance towards adulthood (Aguayo-Mazzucato et al. 2011).

Posttranslational Modifications

Post-translational modification (PTM) involves the changes made to a protein following or during translation. Some of the most common PTMs include phosphorylation, acetylation, N-linked glycosylation, amidation, hydroxylation, and methylation (Khoury et al. 2011). Cleavage of particular functional domains of proteins by proteinases is another common PTM. These PTMs can have a vast array of effects on their target protein. The multitude of potential modifications and their dynamic nature allows for extreme fine tuning of protein function, adding an entire layer of complexity to the proteome of virtually every living organism. PTMs can affect protein stability, subcellular localization, regulatory activity, interactions with DNA, and protein folding by the addition or removal of functional groups (Kleinsmith et al. 1966, Wilkinson et al.

1980, McNabb and Courtney 1992, Allfrey et al. 1964, Agnetti et al. 2013). Various characteristics of proteins can also be altered by PTM via precise cleaving by proteasomes. This type of effect is observed in the Shh/Gli pathway where the transactivation domain of Gli transcription factors is removed in the absence of Shh. The

DNA-binding domain remains on the Gli protein, effectively turning the transcription factor into a repressor.

A field that is only recently being truly recognized for the important role that it plays in gene regulation is epigenetic control of gene regulation. This process depends on the PTM of histone proteins within chromatin. Some of the most common modifications made to these histone proteins are acetylation and methylation, which are able to allow a gene to be activated or repressed respectively by altering the binding efficiency of the histone to the DNA (Allfrey et al. 1964). Adding an additional degree of complexity to the concept of PTM, the activity of many enzymes responsible for performing the PTMs is modulated by PTMs of the enzymes themselves (Chuah and Pallen 1989, Chan et al.

2010, Bhattacharyya et al. 2016).

PTMs are an area of interest that continue to show a potential to elucidate the transcriptional regulatory activity of both Glis3 and MafA, as well as the enzymes that facilitate these modifications. Zeruth et al. (2015) have found that HECT E3 ubiquitin ligase plays a role in the poly-ubiquitination and subsequent destabilization of Glis3, negatively regulating the transcriptional activity of Glis3 target genes. Additionally,

MafA has been shown to undergo posttranslational modification by phosphorylation, affecting its transactivational potential and protein stability (Rocques et al. 2007, Guo et al. 2008, Han et al. 2007, Zhao et al. 2005). It is likely that additional post-translational modifications and associations also take place in order to control the activity of these proteins and that these posttranslational modifications could provide further insights into multiple common diseases.

SUMOylation

Post-translational modifications of specific lysine residues on protein substrates by the small ubiquitin-like modifying protein (SUMO) are essential to multiple cellular processes, including critical steps of the cell cycle such as chromosome segregation

(Nacerddine et al. 2005). There are three members of the SUMO family, denoted

SUMO1, SUMO2, and SUMO3.

The process of conjugating SUMO to substrates is analogous to that of ubiquitination, and this process involves several steps (Desterro et al. 1997). The initial step of SUMOylation depends on the activation of pro-SUMO by a protease belonging to the sentrin-like protease (SENP) family (Cheng et al. 2007). There are seven members of the SENP family, but SENP1 appears to be the most important enzyme for activating

SUMO by proteolytically processing its C-terminus (Cheng et al. 2007). The next step of the SUMOylation process involves activation of SUMO by an E1 SAE1/SAE2 homodimer enzyme by its formation of a disulfide bridge with SUMO (Johnson et al.

1997, Desterro et al. 1999). The next step of SUMOylation in vertebrates is dependent on a single E2 conjugase, Ubc9 (Desterro et al. 1997). Ubc9 displaces SAE1/SAE2, forming a new disulfide bridge with SUMO (Desteroo et al. 1997). SUMOylation also often relies on an E3 ligase which will conjugate SUMO to the substrate protein. In mammals, this

E3 ligase belongs to a family that is the homolog to the Siz family of proteins found in yeast, the protein inhibitor of activated STAT (PIAS) family (Nishida and Yasuda 2002,

Johnson and Gupta 2001, Sachdev et al. 2001, Kahyo et al. 2001, Kotaja et al. 2002,

Schmidt and Muller 2002, Mabb et al. 2006, Shalizi et al. 2007, Dawlaty et al. 2008,

Parker et al. 2008). The process of SUMOylation is dynamic. SUMO can be

13 deconjugated from its substrate by SENPs and recycled in the conjugation to a different substrate (Gong et al. 1999, 2000, Hang and Dasso 2002, Bailey and O’Hare 2004).

While it has been discovered that many proteins are SUMOylated, the effect that this process has on the substrate is largely unknown in most cases. SUMOylation has been observed affecting protein stability as well as initiating specific subcellular localization, protein-protein interactions, protein-DNA interactions, and both enhancing and repressing the activity of target substrates (Matunis et al. 1998, Goodson et al. 2001, Bies et al. 2002, Pichler and Melchoir 2002, Pichler et al. 2002, Abdel-Hafiz et al. 2002, Ross et al. 2002, Ihara et al. 2005). Additionally, SUMOylation has been implicated in both the enhanced and repressed activity of transcription factors (Bies et al. 2002, Abdel-Hafiz et al. 2002, Ihara et al. 2005, Muller et al. 2000, Hofmann et al. 2000, Eloranta and Hurst

2002, Bossis et al. 2005, Cheng et al. 2007). There also appears to be complex interplay between SUMOylation and other substrate modifications such as ubiquitination, phosphorylation, and acetylation (Desterro et al. 1998, Muller et al. 1998, Hoege et al.

2002, Sapetschnig et al. 2002, Hietakangas et al. 2003, Pichler et al. 2005, Stankovic-

Valentin et al. 2007). Phosphorylation is one of the most studied in its affect in relation to

SUMOylation. Phosphorylation appears to be yet another level of regulation for the process of SUMOylation due to the fact that it can either positively or negatively regulate

SUMOylation, depending on the substrate (Muller et al. 1998, Gupta et al. 2008, Gresko et al. 2009). Previous studies suggest that the effect of phosphorylation-dependent

SUMOylation is particularly important in the case of transcription factors (Gregoire et al.

2006, Hietakangas et al. 2006). Post-translational modification by SUMO is further complicated by the ability of the E3 ligase enzymes themselves to be SUMOylated,

14 which can modulate their function and specificity in ligating SUMO to substrates (Ihara et al. 2005).

Pathologies Associated with SUMOylation

Dysfunctions in the SUMO pathway have been linked to physiological disruptions that can lead to the development of diabetes (Kishi et al. 2002, Shao and Cobb 2009,

Kanai et al. 2010, Belaguli et al. 2012). It has been shown that the function of certain key transcription factors important in regulating insulin transcription and β cell development, including Pdx1, MafA, and forkhead box protein A2 (FoxA2), are dependent on

SUMOylation (Kishi et al. 2002, Shao and Cobb 2009, Kanai et al. 2010, Belaguli et al.

2012). These studies have shown the variable effects that SUMOylation can have on a substrate protein. SUMOylation of MafA has been shown to negatively regulate its transcriptional activity (Shao and Cobb 2009, Kanai et al. 2010). SUMOylation of

FoxA2, however, stabilizes the protein and leads to increased transactivational activity of the protein and higher levels of Pdx1, a key transcription factor and target gene of FoxA2

(Belaguli et al. 2012). Furthermore, SUMOylation of Pdx1 has shown to be essential for its proper subcellular localization (Kishi et al. 2002).

Two sites within the Glis3 N-terminal conserved region that conform to the established SUMOylation motif, (ψKxE), where ψ is a hydrophobic residue and x is any amino acid, were found starting at amino acids 223 and 429 (Rodriguez et al. 2001,

Sampson et al. 2001). This led to the formation of the hypothesis that Glis3 is being

SUMOylated, and this posttranslational modification modulates the activity of Glis3 and a transcription factor in pancreatic β cells. If it is found that Glis3 activity is regulated by

SUMOylation, this would give further insight into the complex mechanism of insulin

15 secretion and blood glucose homeostasis and could serve as a potential target for future therapeutic efforts to treat individuals incapable of maintaining healthy blood glucose levels.

Materials and Methods

Cells and Growth Conditions

Rat insulinoma INS-1832/13 cells, a generous gift from Dr. H. Hohmeier (Duke

University), were maintained in RPMI 1640 supplemented with 10% fetal calf serum,

10mM HEPES, 2mM glutamine, 1mM sodium pyruvate, 100 units/ml penicillin, 100

µg/ml streptomycin, and 50 µM 2-mercaptoethanol. HEK293T cells were purchased from

ATCC and cultured in DMEM containing 100 units/ml penicillin, 100 µg/ml streptomycin, and 10% FBS. BRIN-BD11 cells were purchased from the European

Collection of Authenticated Cell Cultures (ECACC) and were maintained in RPMI 1640 supplemented with 100 units/ml penicillin, 100 µg/ml streptomycin, and 10% FBS.

Generation of Plasmids and Constructs

The generation of p3xFLAG-CMV10-Glis3, ΔC480, ΔN222, ΔN288, ΔN333,

ΔN355, ΔN388, ΔN496, ΔC653, and ZF3 mut were described previously (Kang et al.

2009b, ZeRuth et al. 2011, 2015). The luciferase reporter constructs p-mIP-696-Luc, p- hINS-700-Luc, p-mIP-UAS-Luc, p-mIP-696(C-box), p-(UAS)5-Luc, pM-Glis3(1-653), pM-Glis3(653-935), and VP16-Glis3(480-653) were also described previously (ZeRuth et al. 2013, Kang et al. 2009b, ZeRuth et al. 2015, 2011). pCMV-Myc-PIAS1, PIASy, and

Ubc9 were generated by PCR amplifying the full length cDNA and directionally cloning into pCMV-Myc (Clontech) using EcoRI and XhoI restriction enzymes. pM and VP16

PIAS1 and PIASy constructs were made by PCR amplifying the indicated regions and cloning into pM or VP16 vector (Clontech) using EcoRI and BamHI restriction enzymes.

17 p3xFLAG-CMV10-MafA was described previously (ZeRuth et al. 2013). pcDNA3 HA-

Sumo1 WT was a gift from Guy Salvesen (Addgene plasmid # 48966) and Flag-SENP1 was a gift from Edward Yeh (Addgene plasmid # 17357) and were described previously

(Bekes et al. 2011, Cheng et al. 2007). 3xFLAG-Glis3 S305A/D, S3057A/D, S310A/D, and S343A as well as 3xFLAG-Glis3 K224R and K430R mutants were generated by site- directed in vitro mutagenesis using p3xFLAG-CMV10-Glis3 as template. All mutants were verified by sequencing. FLAG-Glis3:SUMO fusion constructs were generated by overlap-extension-synthesis PCR (OES-PCR) using primer sets shown in Table 1.

Briefly, the region encoding Glis3 amino acids 1-223 or 1-429 were amplified by PCR with a 5’ EcoRI overhang and 3’ overhangs overlapping the 5’ portion of SUMO1 using primers: Glis3 EcoRI F, SUMO224R, and 430-SUMO-R.

Primer Name Primer Sequence (5’ to 3’) Glis3 EcoRI F ATGCGAATTCAAATGGAAGGTCATGT 224-SUMO-R TGCCTCCTGGTCAGACACACTCAAGGCTGA 430-SUMO-R TGCCTCCTGGTCAGAGAGCATGTTGGCTGT SUMO1-224 F TCAGCCTTGAGTGTGTCTGACCAGGAGGCA SUMO1-224R CTGAGACCACTCTTGTTGTTCCTGATAAAC SUMO1-430F ACAGCCAACATGCTCTCTGACCAGGAGGCA SUMO1-430R CTCCAGGCGCTCTGTTTGTTCCTGATAAAC 224-SUMO F GTTTATCAGGAACAACAAGAGTGGTCTCAG 430-SUMO F GTTTATCAGGAACAAACAGAGCGCCTGGAG Glis3-BamHI R ATGCGGATCCTCAGCCTTCGGTATA Table 1. List of primers used for OES cloning.

SUMO1 was PCR amplified with a 5’ and a 3’ overhang overlapping Glis3 at the indicated regions using primers: SUMO1-224 F and SUMO1-224R or SUMO1-430F and

SUMO1-430R. The 3’ portion of Glis3 encoding amino acids 225-935 or 431-935 was

18 amplified with a 5’ overhang overlapping the 3’ portion of SUMO1 and a 3’ BamHI overhang using primers: 224-SUMO F or 430-SUMO F and Glis3-BamHI R.

PCR products were cleaned up using a GenElute PCR Cleanup Kit (Sigma Aldrich) and added in equimolar concentrations along with dNTPs and Pfu TURBO (Agilent

Technologies) and run in a thermal cycler under programmed 95° C 2 min, followed by

20 cycles of 95° C 30 sec; 60° C 30 sec; 72° C 3 min. 5 µl of the resulting product was removed and used as template for a subsequent PCR reaction this time including 0.4 µM

FLAG Glis3 EcoRI F primer and Glis3-BamHI R primer using conditions 95° C 2 min followed by 40 cycles of 95° C 30 sec; 55° C 30 sec; 72° C 3 min. The correct sized bands were gel purified in a 1% agarose gel and subsequently digested with EcoRI and

BamHI. Digested inserts were directionally cloned into p3xFLAG-CMV10 plasmid

(Sigma Aldrich) cut with identical enzymes. Positive clones were analyzed by restriction analysis and verified by sequencing.

Reporter Assays

Cells were plated in 12-well dishes at 1 x 105 cells/well and incubated for 24 h at

37 °C. Cells were subsequently transfected with the indicated reporter, pCMV-β- galactosidase, and the indicated expression vector in serum-free medium without antibiotic using Lipofectamine 3000 (Invitrogen) per the manufacturer’s instructions.

Each transfection was carried out in triplicate. Cells were harvested after 48 h by scraping them directly into 125 ul of reporter lysis buffer, and luciferase activity was measured using a luciferase assay kit (Promega). β-Galactosidase levels were measured using a luminometric β-galactosidase detection kit (Clontech) following the manufacturer’s protocol. Each data point was assayed in triplicate, and each experiment was performed

19 at least twice. Relative luciferase activity was calculated. All values underwent analysis of variance and Tukey-Kramer comparison tests using InStat software (GraphPad

Software Inc.), and data are presented as mean +/- S.E. Mammalian two-hybrid assays were performed with HEK293T cells plated in 12-well dishes at 1 x 105 cells/well and incubated for 24 h at 37 °C. Cells were subsequently transfected with pM or VP16 empty vector (Clontech) or the indicated chimera, pFR-Luc, and pCMV-β-gal diluted in serum- free media lacking antibiotic and incubated with Lipofectamine 3000 reagent according to the manufacturer’s protocol (Invitrogen). Cells were harvested, and luciferase assays were conducted and analyzed as reported above.

Co-Immunoprecipitation Assays

Cells were transiently transfected with the specified plasmids using

Lipofectamine 3000 reagent (Invitrogen) following the manufacturer’s protocol. 48 h after transfection, cells were harvested by scraping in radioimmune precipitation assay

(RIPA) buffer (25 mM Tris, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 20 mM sodium molybdate, and 0.5% Nonidet P-40) containing protease inhibitor cocktails I and II

(Sigma). Cell lysates were centrifuged at 16,000 x g for 10 min at 4 °C, and a fraction of the supernatant was stored at -80 °C for the input fractions. The remaining supernatant was incubated at RT for 15 min with DynaBeads (Invitrogen) conjugated to the indicated antibody. Beads were washed three times with 200 µl of ice-cold PBS containing protease inhibitor and proteins were released from the beads by boiling for 5 min in the presence of 1x Laemmli buffer supplemented with 2.5% 2-Mercaptoethanol. Input and immunoprecipitated proteins were examined by Western blot analysis using mouse anti-

M2 FLAG (Sigma Aldrich), mouse anti-Myc antibody (Invitrogen), rat anti HA antibody

(Roche), rabbit anti-PIAS4 (PIASy) antibody (Cell Signaling Technologies), rabbit anti-

SUMO1 (Cell Signaling Technologies), or mouse anti-SUMO2/3 antibody

(Cytoskeleton) and the appropriate HRP-conjugated secondary antibodies. Blots were processed and analyzed using an Amersham Imager 600 digital imager (GE Life

Sciences).

Western Blot Analysis and Protein Quantification

Proteins were resolved by SDS-PAGE and then transferred to PVDF membrane

(Invitrogen) by electrophoresis. Immunostaining was performed with the indicated antibody at either 4 °C for 18 h or 22 °C for 1 h in BLOTTO reagent (5% nonfat dry milk dissolved in 50 mM Tris, 0.2% Tween 20, and 150 mM NaCl). Blots were subjected to three 10-min washes in TTBS (50 mM Tris, 0.2% Tween 20, and 150 mM NaCl), and bands were detected by enhanced chemiluminescence following the manufacturer’s protocol (GE Healthcare). Proteins were quantified using ImageQuantTL software (GE

Life Sciences) The mean intensity and pixel count of experimental bands were multiplied and divided by the mean intensity multiplied by the pixel count of GAPDH bands used for normalization. All samples were run in duplicate and all experiments performed at least twice. Data shown are the average of duplicate samples +/- S.E.

Quantitative Reverse Transcriptase Real-Time PCR Analysis

INS1 832/13 or BRIN-BD11 cells were transiently transfected with the indicated constructs using Lipofectamine 3000 reagent following the manufacturer’s protocol

(Invitrogen). RNA was isolated from the cells after 48 h using a GenElute Mammalian

Total RNA miniprep kit (Sigma Aldrich) according to the manufacturer’s specifications.

Equal amounts of RNA were used to generate cDNA using a high capacity cDNA kit

(Applied Biosystems), and cDNA was analyzed by quantitative real-time PCR using

PowerUP SYBR green master mix (ThermoFisher Scientific). All qRT-PCR was performed in triplicate using an Applied Biosystems 7500 real time PCR system. Primers used are listed in Table 2. The average Ct from triplicate samples was normalized against the average Ct of 18S rRNA.

Gene target Primer sequence (5’ to 3’)

rIns1 F – CCTGCTCGTCCTCTGGGAGCCCAAG R - CTCCAGTGCCAAGGTCTGAAGATCC rIns2 F – CCTGCTCATCCTCTGGGAGCCCCGC R - CTCCAGTGCCAAGGTCTGAAGGTCA rPIAS1 F- CTACCAGCCTACGGGTTTCG R - GAACAGGTAAGTGCCCGACA rPIASy F – ATAGATGGGCTGCTGTCGAAGA R - ATTGGGCGCCATGAACCTT rGlis3 F – GTGAAGGCACATTCTTCCAAAGA R - GGAGATCTGGATGGAGCTCAGT FLAG-Glis3 F – TGGACTACAAAGACCATGACGG R - GGGCTCTGATGGGAGGGATA 18s rRNA F – GTAACCCGTTGAACCCCATT R - CCATCCAATCGGTAGTAGCG Table 2. List of primers used for RT-PCR.

Immunocytochemistry and Microscopy

BRIN-BD11 cells were grown on 22 mm poly-L-lysine coated glass coverslips in

35 mm culture dishes for 48 h until cells were 70-80% confluent. The coverslips were washed in PBS and fixed for 15 min in 4% p-formaldehyde before being permeabilized in

0.2% Triton-X-100 for 7 min. Cells were blocked in Superblock (ThermoFisher

Scientific) for 15 min and then stained with the indicated antibody overnight at 4° C.

Cells were stained with anti-mouse AlexaFluor 594 secondary antibody (ThermoFisher

Scientific) for 30 min and mounted on glass microscope slides using Prolong Diamond anti-fade with DAPI (Life Technologies) and sealed with clear nail polish. Coverslips were observed on a Leica DMi8 fluorescence inverted microscope (Leica Microsystems) and images were captured using a DFC7000T cooled fluorescence camera and LAS X

Expert software (Leica Microsystems).

Results

Glis3 Interacts with PIAS-Family Proteins

In order to identify proteins that interact with the Glis3 N-terminus, tandem- affinity-pulldown (TAP) of the Glis3 N-terminus followed by GelC-MS/MS analysis was performed previously in HEK293F cells. In addition, a yeast-two-hybrid analysis was conducted using the Glis3 N-terminus as bait to identify interacting proteins from a murine pancreatic beta cell prey library (ZeRuth et al. 2015). These studies identified several proteins implicated in the SUMO conjugation pathway including the SUMO- conjugating protein Ubc9 (UBE2I) and members of the protein inhibitor of activated

STAT (PIAS)-family, which have been shown to act as E3 SUMO-ligases (Rytinki et al.

2009) as putative Glis3-interacting proteins. Co-immunoprecipitation experiments performed in HEK293T cells co-expressing FLAG-Glis3 and Myc-tagged Ubc9, PIAS1, or PIASy, however, showed only a weak interaction between Glis3 and the PIAS-family proteins (Fig. 2A). Similar results were obtained when a mammalian 2-hybrid assay was performed in HEK293T cells using the N-terminus of Glis3 (aa 1-653) fused to the Gal4

DBD and full length PIASy fused to the Gal4 AD to drive luciferase expression under control of the Gal4-responsive UAS region. These experiments showed a modest 1.5-fold increase in luciferase expression when the chimeric proteins were co-expressed (Fig 2B).

FLAG-Glis3 was additionally immunoprecipitated in HEK293T cells as well as the pancreatic hybridoma cell line BRIN-BD11 and immunoblots were stained with antibodies targeting endogenous PIAS proteins. In this context, no endogenous PIAS

24 proteins could be detected in the immunoprecipitated fractions (Fig 2C-D), likely due to a limited amount of endogenous PIAS proteins. Collectively, these data indicate that Glis3 may form weak or unstable interactions with PIAS-family proteins.

Figure 2. Glis3 weakly interacts with PIASy and PIAS1. A. HEK293T cells were transfected with FLAG-Glis3 and either Myc-Ubc9, Myc-PIAS1, or Myc-PIASy as indicated. Co-immunoprecipitation was performed using a mouse anti-Myc antibody and immunoprecipitated proteins were examined by Western blot analysis using anti-M2 FLAG or anti-Myc primary and goat anti-mouse-HRP secondary antibodies. B. HEK293T cells were co-transfected with the pFR-Luc reporter and the indicated pM and VP16 plasmid DNA. 48 h later cells were assayed for luciferase and β-galactosidase activities, and the relative Luc activity was calculated and plotted. Each bar represents mean +/- S.E. *, statistically different from pM or VP16 empty vector controls p < 0.05. nRLU, normalized relative luc units. C-D. HEK293T (C.) or BRIN-BD11 (D.) cells were

25 transfected with FLAG empty vector or FLAG-Glis3 as indicated. Co- immunoprecipitation was performed using an anti-M2 FLAG antibody. Immunoprecipitated and input fractions were analyzed by Western blotting using a rabbit anti-PIASy antibody, rabbit anti-PIAS1 antibody or mouse anti-M2 FLAG antibody and the appropriate HRP-conjugated secondary antibodies.

PIAS-Family Proteins SUMOylate Glis3 at Lys224 and Lys430

Given the role of PIAS proteins in mediating SUMOylation of target proteins, co- immunoprecipitation assays were performed in HEK293T cells expressing FLAG-Glis3 and HA-SUMO1 in the presence or absence of PIAS1 or PIASy. Protein complexes were pulled down using an anti-HA antibody and SUMOylation of Glis3 was analyzed by

Western blotting using anti-M2 FLAG antibody. As seen in Fig. 3A, both members of the

PIAS family promoted SUMOylation of exogenous Glis3 with relatively similar efficacy.

To date, Ubc9 is the only SUMO-conjugating enzyme that has been identified in mammals and appears to be the sole E2 enzyme used in the SUMO-conjugation pathway

(Gareau and Lima 2010). Co-expression of Ubc9 with HA-SUMO and FLAG-Glis3 in

HEK293T cells modestly increased Glis3 SUMOylation compared to HA-SUMO and

FLAG Glis3 alone (Fig. 3B). This was in stark contrast to the role PIAS1 and PIASy played in mediating Glis3 SUMOylation when co-expressed with HA-SUMO and FLAG-

Glis3 (Fig. 3A-B). These results were not surprising as PIAS-family proteins are more likely to be limiting factors in regulating Glis3-SUMOylation than Ubc9, which is ubiquitously expressed (Kovalenko et al. 1996). Intriguingly, while simultaneous co- expression of Ubc9 and PIASy significantly increased the observed level of Glis3

SUMOylation compared to either protein alone, coincident expression of Ubc9 and

PIAS1 virtually eliminated all detectable Glis3 SUMOylation. Nearly identical results were obtained when the experiment was repeated in the pancreatic hybridoma cell line,

BRIN-BD11 (Fig. 3B), suggesting the observation is not cell- or tissue-specific. The lack of Glis3 SUMOylation under these conditions appears to be the result of a significant decrease in PIAS1 expression in the presence of both exogenous Ubc9 and HA-SUMO

(Fig. 3B-C). PIAS1 degradation did not appear to require Glis3 as the protein was degraded in its presence or absence (Fig. 3C) and therefore the underlying mechanism of

PIAS1 degradation was not investigated further. However, for further experiments requiring co-expression of Ubc9, SUMO, and PIAS proteins, we used PIASy to simplify data analysis. The SUMO-specific protease SENP1 was capable of effectively deconjugating SUMO from Glis3 as demonstrated in Fig. 3D when SENP1 was co- expressed with FLAG-Glis3, HA-SUMO1, Ubc9, and PIASy. Together, these data suggest that the E2 SUMO conjugase, Ubc9 along with the E3 SUMO ligases, PIAS1 and

PIASy are capable of reversibly modifying Glis3 with SUMO.

SUMO modification typically occurs at a lysine residue within the target substrate that conforms to the consensus sequence ψKxE where ψ is a hydrophobic residue and x is any amino acid (Duprez et al. 1999, Rodriguez et al. 2001, Sterndorf et al. 1999,

Sampson et al. 2001). Analysis of Glis3 using SUMOplot software (www.abgent.com) revealed two high probability consensus SUMO motifs located at Lys224 and Lys430, both located within the N-terminus of the protein and conserved between murine and human

Glis3 (Fig. 3E). In order to determine whether SUMO was attached to these residues within Glis3, each of the lysines was mutated to arginine either alone or in combination.

While co-expression of HA-SUMO and PIASy resulted in two distinct bands representing SUMOylated Glis3, mutation of Lys224 to Arg resulted in a decrease of the higher molecular weight band (Fig. 3F). Mutation of Lys430 to Arg similarly resulted in

27 the elimination of the higher molecular weight band and additionally dramatically reduced the lower weight band representing SUMOylated Glis3. Simultaneous mutation of both lysine residues abolished all detectable Glis3 SUMOylation. These results indicate that PIAS family proteins can mediate the attachment of SUMO1 to Glis3 at either Lys224, Lys430, or both simultaneously; however, SUMOylation of Glis3 at Lys430 may promote subsequent SUMOylation of full-length Glis3 at Lys224. Indeed, it has previously been demonstrated that SUMOylation of a target protein at one motif can subsequently influence SUMO-Ubc9 interactions at additional motifs (Gareau and Lima

2010, Brozovic et al. 2006).

The Glis3 SUMOylation motifs are conserved between human and mouse Glis3 but are absent in zebrafish glis3. To verify that human GLIS3 can also be modified by

SUMO, co-IP was performed using murine, human, or Danio Glis3 in HEK293T cells.

As expected, both human and mouse Glis3 were SUMOylated by PIASy and Ubc9 while no modification of zebrafish glis3 was observed (Fig. 3G). These results demonstrate that modification of Glis3 by SUMO appears to be conserved among mammals and may have evolved following the split that would give rise to tetrapods and teleost fishes.

Figure 3. Glis3 is SUMOylated by PIAS-family proteins at Lys224 and Lys430. A-B. HEK293T or BRIN-BD11 cells were transfected with FLAG empty vector or FLAG Glis3 along with HA-SUMO1, Myc Ubc9, Myc PIAS1, or Myc PIASy as indicated. After 48 h, co-immunoprecipitation was performed using a rat anti-HA antibody and immunoprecipitated proteins were examined by Western blot analysis using mouse anti- M2 FLAG or anti-Myc primary and goat anti-mouse-HRP secondary antibodies. C. HEK293T cells were transfected with the indicated plasmids. Cells were treated with 10 ug/ml cycloheximide for 5 h prior to harvest. Proteins were separated by SDS-PAGE and analyzed by Western blotting using the specified antibodies. GAPDH is shown as an internal control. D. HEK293T cells were transfected with the indicated plasmids. After 48 h, co-immunoprecipitation was performed using a rat anti-HA antibody and immunoprecipitated proteins were examined by Western blot analysis using mouse anti- Myc primary and goat anti-mouse-HRP secondary antibodies. E. Schematic representation of Glis3. Relative position and sequence of putative SUMOylation motifs are shown. NCR, N-terminal conserved region; ZFD, zinc finger domain; TAD, transactivation domain. F-G. HEK293T cells were transfected with the indicated plasmids. Co-immunoprecipitation was carried out using a mouse anti-M2 FLAG antibody. Proteins were analyzed by Western blotting using a rat anti-HA antibody, mouse anti-M2 FLAG, or anti-Myc antibodies as indicated.

Glis3 is SUMOylated by SUMO1, SUMO2, and SUMO3

To investigate whether PIAS proteins preferentially modify Glis3 with SUMO 1,

2, or 3, co-IP was performed in HEK293T cells expressing FLAG-Glis3 and Myc-PIASy along with GFP-tagged SUMO1, SUMO2, or SUMO3. While Glis3 appeared to be mono- or di-SUMOylated by SUMO1, polySUMOylation was evident when Glis3 was co-expressed with PIASy and SUMO2 or SUMO3 (Fig. 4A). PolySUMOylation of Glis3 appeared to target the protein for proteasomal degradation because Glis3 SUMOylated by

SUMO 2 or SUMO3 was stabilized by the proteasome inhibitor, MG132. MG132 treatment had little or no effect on Glis3 modified by SUMO1. In order to determine whether SUMOylation of Glis3 could be detected endogenously, FLAG-Glis3 or the

Lys224/Lys430 double mutant was stably expressed in BRIN-BD11 cells and pulled down using an anti- FLAG M2 antibody. Immunoprecipitated fractions were then analyzed by

Western blotting using an antibody specific to SUMO1. Glis3 was not found to be modified by endogenous SUMO1 in the cells (Fig. 4B). SUMO1 modified Glis3 was also not detected in HEK293T cells in the presence or absence of exogenous PIASy and Ubc9

(Fig 4C, lanes 2 and 3). SUMOylated Glis3 was evident, however, when exogenous HA-

SUMO1 was co-expressed along with PIASy and Ubc9 and could be detected in the immunoprecipitated fractions by antibodies targeting the HA tag or SUMO1 (Fig 4C, lane 4). These data suggest that only a small proportion, if any of exogenous Glis3 is modified by SUMO1 under normal conditions in HEK293T or BRIN-BD11 cells.

However, SUMO2/3 modified Glis3 could be observed in MG132-treated BRIN-BD11 cells stably expressing FLAG-Glis3 in the presence or absence of exogenous PIAS1 or

PIASy (Fig. 4D). No SUMO2/3 modified Glis3 could be detected in BRIN-BD11 cells stably overexpressing the Lys224/Lys430 double mutant. These results indicate that the

PIAS-family proteins are capable of modifying Glis3 with SUMO1-3 and that polySUMOylated Glis3 may be the target of proteasomal degradation.

Figure 4. PIASy and Ubc9 can modify Glis3 with SUMO1, SUMO2, and SUMO3. A. HEK293T cells were transfected with FLAG Glis3 and Myc PIAS1 along with the indicated GFP-tagged SUMO construct. Coimmunoprecipitations were performed using mouse anti-GFP antibody and proteins were analyzed by Western blotting using mouse anti-M2 FLAG antibody. B. BRIN-BD11 cells were transfected with FLAG empty vector, FLAG Glis3, or a FLAG Glis3 Lys224/Lys430 double mutant and treated with 10 uM MG132 for 5 h prior to harvest. Co-immunoprecipitation was conducted using an anti-M2 FLAG antibody and proteins were analyzed by Western blotting using a mouse anti-SUMO1 or anti-M2 FLAG. C. HEK293T cells were transfected with the indicated plasmids. Co-immunoprecipitation was performed using an anti-M2 FLAG antibody. Immunoprecipitated and input fractions were analyzed by Western blotting using a rabbit anti-SUMO1 antibody, rat anti-HA antibody, or mouse anti-M2 FLAG antibody and the appropriate HRP-conjugated secondary antibodies. D. BRIN-BD11 cells were transfected with FLAG empty vector, FLAG Glis3, or a FLAG

224 430 Glis3 Lys /Lys double mutant and treated with 10 uM MG132 for 5 h prior to harvest. Co-IP was conducted as described in C.

The Glis3 N-Terminal Conserved Region is Required for Glis3 SUMOylation

To better understand what other regions of Glis3 might be required for PIAS- mediated SUMOylation, serial deletions of the Glis3 N-terminus were used in co-IP experiments along with HA-SUMO and PIAS proteins. Deletion of the first 222 amino acids of Glis3 had very little effect on Glis3 SUMOylation and both mono- and diSUMOylated forms could be observed, similar to full-length Glis3 (Fig. 5A). Deletion of the amino acids 1-388, including the previously described N-terminal conserved region

(NCR) located between amino acids 288-388 (ZeRuth et al., 2011) however resulted in a complete loss of Glis3 SUMOylation despite the continued presence of Lys430. These results suggested that the NCR might be required for SUMO modification of Glis3 by

PIAS-family proteins. Further deletion analyses showed that Lys430 could be

SUMOylated by PIAS1 despite deletions going all the way to the beginning of the NCR at aa 288 (Fig. 5B) However, any subsequent deletions resulting in a loss of the N- terminal portion of the NCR resulted in a loss of Glis3 SUMOylation. These data suggest

SUMOylation of Glis3 by PIAS proteins might require the region of Glis3 between aa

288 and 333. GelC-MS/MS analysis had previously identified several phosphorylated residues within the NCR (ZeRuth et al., 2015). To determine whether the phosphorylation status of these residues influenced Glis3 SUMOylation Ser305, Ser307,

Ser310, and Ser343 were mutated to alanine either alone or in combination and the ability of the mutants to be SUMOylated was assessed. Preventing phosphorylation did not appear to significantly affect Glis3 SUMOylation (Fig. 5C). Likewise, phosphomimetic mutation of Ser305, Ser307, and Ser310 to Asp did not appear to influence Glis3

SUMOylation by PIASy (Fig. 5D). These findings strongly suggest the requirement of the Glis3 NCR for modification by SUMO through a mechanism that does not rely on phosphorylation of Ser305, Ser307, Ser310, or Ser343.

Figure 5. The NCR of Glis3 is required for SUMOylation. A-D. HEK293T cells were transfected with the indicated plasmids. Co-immunoprecipitation was carried out using a mouse anti-M2 FLAG antibody. Proteins were analyzed by Western blotting using a rat anti-HA antibody or mouse anti-M2 FLAG or anti-Myc antibodies as indicated.

SUMOylation of Glis3 Decreases its Transcriptional Activity

Because the overall proportion of SUMOylated Glis3 to total Glis3 in the samples was extremely low, measuring the effect of the modification on Glis3 function was virtually impossible. To overcome this obstacle, OES cloning was performed to generate chimeric proteins comprised of SUMO1 fused in-frame with Glis3 following amino acids

224 or 430 (Fig. 6A). To prevent the SUMO fusion constructs from being able to interact

33 with other proteins targeted for SUMO modification, the SUMO insert was truncated immediately prior to the C-terminal di-glycine motif. This truncation was performed because this part of the protein plays an important role in associating with SUMOylation substrates. Western blot analysis using an M2 FLAG antibody showed that both SUMO fusion constructs produced a single band migrating slightly slower than unmodified Glis3

(Fig. 6B). To test the transactivation function of the SUMO fusion chimeras, they were co-expressed in HEK293T cells along with a mIns2 reporter. As seen in Fig. 6C, similar levels of activation were achieved using either of the SUMO fusion constructs relative to unmodified Glis3. These results suggest that the fusion of SUMO within the N-terminus of Glis3 does not appear to adversely affect protein folding, DNA binding, or the recruitment of requisite co-activators. In contrast, when expressed in BRIN-BD11 cells, both SUMO fusion chimeras were significantly less capable of activating the insulin promoter suggesting that Glis3 SUMOylation may inhibit its function within the beta cell environment (Fig. 6C). The reduced activity could not be attributed to defective nuclear localization as both chimeric proteins were localized exclusively to the nucleus in BRIN-

BD11 cells (Fig. 6D). To further examine the effect SUMO modification has on Glis3 in beta cells, BRIN-BD11 cells were transfected with FLAG empty vector, FLAG Glis3, or the Lys224/Lys430 double mutant, which is incapable of being modified by SUMO and rIns2 expression was analyzed by RT-PCR. Remarkably, insulin message was > 100- times higher in cells expressing the Glis3 mutant versus wild type Glis3 (Fig. 6E). The expression of endogenous Glis3 was not significantly different between the samples and using primers specific to FLAG-Glis3 it was demonstrated that expression of exogenous

Glis3 was also similar. The stability of Glis3 protein was also similar between the wild

34 type and Lys mutant (Fig. 4B). Given the much higher activation capacity of the Glis3

Lys double mutant, it was expected that the SUMO-fusion constructs should have a powerful negative influence on endogenous Ins2 activation. To test this idea, BRIN-

BD11 cells were transfected with Glis3224:SUMO, Glis3430:SUMO, unmodified Glis3, or empty vector and rIns2 was once again measured by RT-PCR. As expected, in-frame insertion of SUMO1 in place of Lys224 resulted in an 80% reduction in Ins2 transcription relative to cells expressing unmodified Glis3 while fusion of SUMO1 at Lys430 resulted in a dramatic 99% reduction in activity (Fig. 6F). Glis3 transcripts were quantified and found to be expressed at roughly equal levels between samples. These data establish that

SUMOylation may serve as a mechanism to negatively regulate insulin transcription by

Glis3.

Figure 6. SUMOylation of Glis3 inhibits its ability to activate insulin transcription. A. Schematic diagram of Glis3 and Glis3:SUMO fusion proteins generated by OES cloning. The conserved SUMOylation motifs within the Glis3 N-terminus are indicated. B. FLAG-stained Western blot of cell lysates from HEK293T cells expressing FLAG Glis3 or the indicated Glis3:SUMO fusion protein. Molecular weight marker is indicated on the left. C. HEK293T cells were transfected with p-mIP-696-Luc, pCMV-β-Gal, FLAG empty vector, p3xFLAG-CMV10-Glis3, or the indicated Glis3:SUMO fusion construct. After 48 h, cells were harvested and assayed. * indicates statistically different from FLAG Glis3, p < 0.01. D. BRIN-BD11 cells were grown on poly- L-lysine coated glass coverslips for 48 h. The coverslips were stained with the indicated antibody overnight at 4° C. Cells were stained with anti-mouse AlexaFluor 594 secondary antibody and mounted on glass microscope slides using Prolong Diamond anti-fade with DAPI. E-F. BRIN-BD11 cells were transfected with the indicated FLAG empty vector or FLAG-Glis3 construct. After 48 h, RNA was collected and the specified mRNA was measured by qRT-PCR analysis. Each bar represents relative mRNA levels normalized to 18s rRNA +/- SEM. * indicates statistically different value compared to empty vector control p < 0.01. # indicates statistically different value from both empty vector control and wild type Glis3, p < 0.01.

PIASy and Ubc9 Negatively Regulate Insulin Transcription Through Glis3-

Dependent and Glis3-Independent Mechanisms

To determine whether PIASy and Ubc9 similarly affected Glis3-mediated gene activation in pancreatic beta cells, the mIns2 reporter was co-expressed in BRIN-BD11 cells along with Glis3, Ubc9, and PIASy. In complete contrast to what was observed in

HEK293T cells, in the BRIN-BD11 environment, Ubc9 and PIASy had a >70% decrease in the activation of the insulin reporter by Glis3 when compared to Glis3 alone (Fig. 7A).

Moreover, reporter activity increased roughly two-fold compared to the wild type Glis3 when the Lys224/Lys430 double mutant was expressed in BRIN-BD11 cells indicating that

SUMOylation of Glis3 negatively affects its transactivation function. Unexpectedly however, PIASy and Ubc9 similarly repressed activation of the reporter driven by the

Lys224/Lys430 double mutant or of Glis3 lacking its N-terminus indicating that the repression was independent of Glis3 SUMOylation. Glis3 lacking its transactivation domain (TAD)-containing C-terminus is capable of activating the mIns2 reporter roughly

7-fold in BRIN-BD11 cells (compared to > 30-fold activation observed using full-length

Glis3). Co-expression of Ubc9 and PIASy along with the C-terminal deletion mutant similarly reduced reporter activity to baseline levels suggesting that the mechanism by which the proteins reduce transcriptional activation might act on the Glis3 DNA-binding domain (DBD). In order to test this hypothesis, reporter assays were conducted with chimeric proteins containing the Glis3 TAD fused in-frame with the GAL4 DBD or the

Glis3 DBD fused in-frame with the GAL4-AD. The former was co-expressed in the presence or absence of Ubc9 and PIASy with a modified mIns2 reporter in which the

GlisBS were mutated to GAL4-responsive UAS motifs. While the chimeric protein was

37 capable of activating the reporter, Ubc9 and PIASy did not significantly affect activation relative to empty vector controls (Fig. 7B). The chimera containing the Glis3 DBD and the GAL4-AD was also capable of activating the mIns2 reporter but in contrast to the former construct, Ubc9 and PIASy co-expression had a significant negative effect and reduced reporter activity > 90%. As seen in HEK293T cells, the mechanism by which

Ubc9 and PIASy influence Glis3 activity appeared to be dependent on the transfer of

SUMO to substrate because co-expression of SENP1 virtually eliminated the repression of activity (Fig. 7C). To examine whether decreased Glis3 transactivation function was due to destabilization of Glis3 protein levels, BRIN-BD11 cells were transfected with

FLAG Glis3, Ubc9, PIAS1, or PIASy, alone or in combination and treated with cycloheximide for 6 h before harvesting. Counterintuitively, co-expression of PIASy, with or without Ubc9 appeared to stabilize Glis3 expression (Fig. 7D). In agreement with the reporter assays, this stabilizing effect seemed to require the Glis3 DBD as it was observed with Glis3 lacking its N-terminus but not when the N-terminus of Glis3 was expressed alone (Fig. 7E). The increased stability to Glis3 provided by Ubc9 and PIASy however did not appear to require Glis3 binding to DNA because the two proteins also stabilized a Glis3 zinc finger mutant that cannot bind GlisBS (ZeRuth et al. 2015, Beak et al. 2008). These data provide evidence that Ubc9 and PIASy negatively regulate Glis3- mediated insulin activation while promoting stability of the Glis3 protein. When reporter assays were performed in HEK293T cells using either the mIns2 promoter or an artificial promoter driven by three tandem copies of the GlisBS (p3xGlisBS-Luc), co-expression of

PIASy and Ubc9 resulted in a sharp increase in Glis3-mediated reporter activation (Fig.

7F). Additionally, the mechanism by which Ubc9 and PIASy enhance Glis3

38 transactivation function did not require Glis3 SUMOylation because the effect was still observed when both Lys224 and Lys430 of Glis3 were mutated to Arg or when the entire

Glis3 N-terminus was deleted (Fig. 7G). The increased activity provided by Ubc9 and

PIASy did require Glis3 binding to DNA however because the proteins had essentially no effect on reporter activity when co-expressed with a Glis3 ZFD mutant that is incapable of binding DNA. These data are consistent with Glis3 stabilization in the presence of

PIASy and Ubc9 and suggest that inhibition of Glis3 transactivation function is specific to the insulin promoter in the β-cell environment.

G. F. .

Figure 7. PIASy and Ubc9 repress Glis3-mediated insulin transcription in BRIN-BD11 cells. A. BRIN-BD11 cells were transfected with p-mIP-696-Luc, pCMV-β-Gal, FLAG empty vector or the indicated FLAG Glis3 construct along with Myc empty vector or MYC PIASy and Ubc9. After 48 h, cells were harvested and assayed. * indicates statistically different than corresponding Myc empty vector controls. p < 0.01. B. BRIN- BD11 cells were transfected with p-mIP-696-Luc or p-mIP(UAS)-Luc as indicated along with pCMV-β-Gal. Cells were also transfected with the indicated Gal4:Glis3 chimeric fusion protein and either Myc empty vector or Myc PIASy and Myc Ubc9. After 48 h, cells were harvested and assayed for luciferase and b-galactosidase activity and the normalized relative luciferase activity (nRLU) was calculated. Black bars represent relative proportion of luciferase expression from cells expressing Myc PIASy and Myc Ubc9 compared to corresponding samples expressing Myc empty vector (grey bars) +/- SEM. * indicates statistically different from mIP-696 and mIP(UAS) empty vector controls. p < 0.01. C. BRIN-BD11 cells were transfected with p-mIP-696-Luc, pCMV-β- Gal, and the indicated plasmids. After 48 h, cells were harvested and assayed. D-E. BRIN-BD11 cells were transfected with the indicated plasmids and treated with 10 ug/ml cycloheximide for 5 h prior to harvest. Proteins were separated by SDS-PAGE and analyzed by Western blotting using the specified antibodies. GAPDH is shown as an internal control. F. HEK293T cells were transfected with p-3xGlisBS-Luc, pCMV-β-Gal, FLAG empty vector, p3xFLAG-CMV10-Glis3, Myc-Ubc9, or Myc-PIASy as indicated. After 48 h, cells were assayed for luciferase and -galactosidase activity and the normalized relative luciferase activity (nRLU) was calculated and plotted. G. HEK293T cells were transfected with the indicated FLAG empty vector or FLAG Glis3 construct along with Myc empty vector, MYC PIAS1 and Ubc9, or MYC PIASy and Ubc9. After 48 h, cells were harvested and assayed.

SUMOylation of MafA by PIASy and Ubc9 Neutralizes Synergism with Glis3

To see if the repressive effect of Ubc9 and PIASy was unique to the mIns2 promoter, a luciferase reporter driven by three tandem copies of the GlisBS was transfected in BRIN-BD11 cells along with Glis3, Ubc9, and PIASy. In contrast to what was observed using the mIns2 reporter, 3xGlisBS-Luc activity was modestly enhanced by

Ubc9 and PIASy indicating that the inhibitory effect requires additional features specific to the insulin promoter (Fig. 8A). It has previously been demonstrated that Glis3 acts synergistically at the insulin promoter with several other key insulin regulatory factors including MafA (ZeRuth et al., 2013; Yang et al., 2009). Additionally, preceding studies have shown that SUMOylation of MafA negatively affects its transactivation function at the insulin promoter (Kanai et al., 2010; Shao and Cobb, 2009). In order to determine whether Ubc9 and PIASy were capable of transferring SUMO to MafA, FLAG-MafA was immunoprecipitated in HEK293T cells in the presence or absence of exogenous

Ubc9 and PIASy and blots were stained with an antibody targeting SUMO1. While

SUMOylated MafA was not detected with the addition of Ubc9 and PIASy alone, the co- expression of the proteins along with exogenous HA-SUMO1 significantly enhanced

MafA SUMOylation (Fig. 8B) similar to what was seen with Glis3. MafA was further found to be SUMOylated by endogenous SUMO2/3 in BRIN-BD11 cells when co- expressed with PIASy (Fig. 8C). To assess the effect of Ubc9 and PIASy on Glis3:MafA synergism, reporter assays were conducted in HEK293T cells co-expressing a mIns2 reporter along with Glis3 and MafA in the presence or absence of Ubc9 and PIASy. Ubc9 and PIASy had opposite effects on the transcription factors in HEK293T cells resulting in a > 50% decrease in MafA-mediated activation and a significant enhancement of

41 activation by Glis3, as shown previously (Fig. 8D). The positive effect of Ubc9 and

PIASy on Glis3 transactivation function was essentially lost however when Glis3 was co- expressed with MafA. In BRIN-BD11 cells, Ubc9 and PIASy similarly reduced activation of the mIns2 reporter by Glis3 or MafA approximately 75%. Overexpression of Ubc9 and PIASy reduced activity of the mIns2 reporter by roughly 50% when co- expressed with empty FLAG vector implicating negative regulation of endogenous transcription factors in the beta cells, presumably Glis3 and MafA. To determine if the negative influence of Ubc9 and PIASy on Glis3 function in BD11 cells was due to negative regulation of endogenous MafA, reporter assays were conducted in which the ability of Glis3 to activate the mIns2 promoter in the presence of exogenous Ubc9 and

PIASy was assessed with two different concentrations of FLAG-MafA. While Ubc9 and

PIASy significantly reduced Glis3-mediated activation of the insulin promoter, increasing

MafA expression was able to rescue activity (Fig. 8E). Increasing MafA expression also restored diminished reporter levels when Ubc9 and PIASy were co-expressed with FLAG empty vector (data not shown). Finally, mutation of the MafA enhancer element (C-box) within the mIns2 reporter had a similar repressive effect on Glis3-mediated transactivation (Fig. 8F). Co-expression of Ubc9 and PIASy led to an additional decrease in activity suggesting the decreased levels of activation likely do not function exclusively through disrupting Glis3:MafA synergism.

Figure 8. SUMOylation of MafA disrupts synergism with Glis3 at the insulin promoter. A. BRIN-BD11 cells were transfected with p-3xGlisBS-Luc, pCMV-β-Gal, FLAG empty vector, p3xFLAG-CMV10-Glis3, Myc-Ubc9, or Myc-PIASy as indicated. After 48 h, cells were harvested and assayed. B. HEK293T cells were transfected with the indicated plasmids and harvested after 48 h. Co-immunoprecipitation was performed using an anti-M2 FLAG antibody. Immunoprecipitated and input fractions were analyzed by Western blotting using a rabbit anti- SUMO1 antibody, mouse anti-Myc antibody, or mouse anti-M2 FLAG antibody and the appropriate HRP-conjugated secondary antibodies. C. BRIN-BD11 cells were transfected with the indicated plasmids and harvested after 48h. Co-immunoprecipitation was performed using anti-M2 FLAG antibody. Immunoprecipitated fractions were analyzed by Western blot using rabbit anti-SUMO1 antibody, mouse anti-M2 FLAG antibody, or mouse anti-SUMO2/3 antibody. D. HEK293T (Left) or BRIN-BD11 (Right) cells were transfected with p-mIP-696-Luc, pCMV- β-Gal, and the indicated FLAG empty vector, Glis3, or MafA plasmids. Cells were additionally transfected with either Myc empty vector or Myc PIASy and Myc Ubc9. After 48 h, cells were harvested and assayed for luciferase and -galactosidase activity and the normalized relative luciferase activity (nRLU) was calculated. Black bars represent relative proportion of luciferase

43 expression from cells expressing Myc PIASy and Myc Ubc9 compared to corresponding samples expressing Myc empty vector (grey bars) +/- SEM.. E. BRIN-BD11 cells were transfected with p-mIP-696-Luc, pCMV-β-Gal, and FLAG empty vector, FLAG-Glis3, and Myc-PIASy and Ubc9 as indicated. Cells were transfected with an increasing concentration of FLAG-MafA where indicated by the shaded triangle. After 48 h, cells were harvested and assayed F. BRIN-BD11 cells were transfected with p-mIP-696-Luc or a mutant with the C-box mutated, pCMV-β-Gal, and FLAG empty vector, FLAG-Glis3, and Myc-PIASy and Ubc9 as indicated. After 48 h, cells were harvested and assayed. * indicates statistically different than Myc empty vector controls. p < 0.01.

Glis3 is SUMOylated Under Conditions of Chronic Hyperglycemia in BRIN-BD11 Cells Chronic exposure of β cells to high levels of glucose has previously been associated with decreased levels of insulin transcription mediated in part by decreased binding of MafA and Pdx1 to the insulin promoter (Harmon et al. 2005, Park et al. 2007,

Lee et al. 2012). This so-called glucose toxicity is also accompanied by decreased levels of MafA transcription (Olson et al. 1993, Sharma et al. 1995, Poitout et al. 1996). BRIN-

BD11 cells were exposed to either 3 mM glucose, corresponding to normal physiological blood glucose levels, or 25 mM glucose, corresponding to hyperglycemic conditions, for

48 hours and gene expression was analyzed by RT-PCR. As shown previously in other β cell lines, under conditions of chronic hyperglycemia insulin transcription was severely reduced (Fig. 9A). Interestingly, while MafA transcription was reduced by approximately

40% under hyperglycemic conditions, Glis3 transcripts were reduced nearly 70% suggesting that Glis3 is also affected by glucose toxicity. No statistically significant change in either PIAS1 or PIASy expression was observed in response to glucose levels.

To determine whether PIAS-proteins were regulated posttranslationally in response to glucose, Western blots were performed from BRIN-BD11 cells grown under high or low glucose conditions. While PIAS1 expression was similar under both conditions, a higher molecular weight band corresponding to a previously identified SUMOylated form of

PIASy (Ihara et al. 2005) was significantly increased following exposure to 25 mM glucose (Fig. 9B). Glis3 expression was also examined at the protein level using BRIN-

BD11 cells stably expressing FLAG Glis3 grown under low or high glucose concentrations. The results indicate that Glis3 protein expression is stabilized under chronically high glucose conditions (Fig. 9C). Importantly, under high glucose conditions, several higher molecular weight bands were observed that might represent

SUMOylated Glis3. MafA SUMOylation was reported in β cells exposed to oxidative stress suggesting that modification of MafA by SUMO may serve as a mechanism to reduce insulin transcription under hyperglycemic conditions (Shao and Cobb 2009). To determine whether Glis3 is SUMOylated under conditions of glucose toxicity, anti-M2

FLAG antibody was used to immunoprecipitate proteins in BRIN-BD11 cells stably expressing FLAG Glis3 or empty vector grown under different glucose concentrations.

The results indicated that SUMO2/3 modified Glis3 increased under high glucose conditions in agreement with the Western blot data (Fig. 9D).

Figure 9. Glis3 is SUMOylated under conditions of chronic hyperglycemia in BRIN- BD11 cells. A. BRIN-BD11 cells were exposed to either 3 mM or 25 mM glucose for 48 hours. RNA was collected from cell lysates, and cDNA was generated. RT-PCR was used to analyze the relative amounts of indicated transcripts. B. BRIN-BD11 cells were grown as described in A. Proteins were separated by SDS-PAGE and analyzed by Western blot using rat anti-PIAS1 antibody or rabbit anti-PIASy antibody. GAPDH is shown as an internal control. C. BRIN-BD11 cells stably expressing Glis3 were grown under conditions described in A. Proteins were separated by SDS-PAGE and analyzed by Western blot using mouse anti-M2 FLAG antibody. GAPDH is shown as an internal control. D. BRIN-BD11 cells were grown as described in A. Proteins were separated by SDS-PAGE and analyzed by Western blot using mouse anti-M2 FLAG, rabbit anti- SUMO1 antibody, or mouse anti-SUMO2/3 antibody.

Discussion and Future Direction

These studies have shown that PIAS-family proteins are capable of modifying the transcription factor, Glis3 with the small ubiquitin-like modifier, SUMO1, SUMOL2, and

SUMO3. Overexpression of PIASy in combination with Ubc9 had a significant negative influence on the transactivation function of Glis3 and greatly diminished its ability to activate Ins2 expression in BRIN-BD11 cells. Data demonstrating that mutation of both

SUMO targeted lysine residues to arginine resulted in a 100-fold increase in insulin transcription compared to wild type Glis3 is consistent with the idea that SUMOylation has an inhibitory effect on Glis3-mediated transactivation of insulin. The increased level of insulin transcription is not likely attributable to the creation of novel methylation sites that might subsequently affect transactivation function because similar observations were made when the Lys residues were mutated to Ala (data not shown).

Despite the magnitude of the increase in insulin transcription when the Glis3

SUMOylation motifs were mutated, only a very small proportion of immunoprecipitated

Glis3 was SUMOylated in cells overexpressing Glis3. It is not currently clear why such a small fraction of Glis3 is SUMOylated but it may be due to a requirement for factors that are too limited to handle the amount of Glis3 present in an overexpression system. It is additionally possible that Glis3 must first be posttranslationally modified prior to

SUMOylation or that SUMOylation of Glis3 is dynamic and deSUMOylating factors such as SENPs are rapidly reversing SUMOylation. Finally, the low proportion of

SUMOylated Glis3 may be due to the fact that SUMOylated Glis3 is rapidly turned over.

Indeed, we found that Glis3 SUMOylation could be reversed by overexpression of

SENP1 and that Glis3 SUMOylated by SUMO2/3 was the target of proteolytic degradation.

In order to better understand the effect of SUMOylation on Glis3 function,

Glis3:SUMO fusion chimeras, which should approximate SUMOylated Glis3, were created and analyzed. These experiments demonstrated a profound negative regulatory consequence of Glis3 SUMOylation that appeared to be specific to Glis3-mediated activation of the preproinsulin (Ins2) promoter in a pancreatic β cell environment. The mechanism by which SUMOylation regulates Glis3 function is not clear at this time. The

SUMO fusion with Glis3 was unlikely to have affected Glis3 function by causing improper folding or inhibiting binding to GlisBS because the constructs activated a mIns2 reporter in HEK293T cells similarly to full-length, wild type Glis3. The Glis3:SUMO chimeras additionally did not exhibit any defect in their ability to localize to the nucleus nor were protein expression levels significantly different. This suggests that the addition of SUMO moieties to the Glis3 N-terminus may compete with other posttranslational modifications such as phosphorylation or acetylation that may be associated with positive transcriptional regulation specifically within β-cells. It is also probable that SUMOylation of Glis3 interferes with Glis3 recruitment of pancreatic β-cell-specific co-activators.

Indeed, previous reports have shown that the ability of Glis3 to activate insulin transcription was severely compromised when binding by Pdx1, NeuroD1, and MafA to the Ins2 promoter was abrogated (ZeRuth et al. 2013).

Other than negatively regulating Glis3 function by the direct attachment of

SUMO to lysine residues within the Glis3 N-terminus, PIASy and Ubc9 had an additional

48 indirect role in regulating Glis3 independent of Glis3 SUMOylation. While the inhibitory effect of the proteins on Glis3 did not require modification of Glis3 with SUMO, it did appear to require SUMOylation of other unknown targets because the inhibition was reversed by the overexpression of the SUMO protease, SENP1. As seen with Glis3

SUMOylation, the indirect inhibition afforded by PIASy and Ubc9 was specific to β cells and was not observed in HEK293T cells. This suggested that PIASy and Ubc9 were likely modifying a β cell specific target. Previous studies have shown that the transcription factor, Pdx1, was SUMOylated in pancreatic β cells; however, the modification resulted in increased nuclear localization and positive regulation of insulin transcription (Kishi et al., 2003). In contrast, SUMOylation negatively regulated the transcriptional activity of the β cell transcription factor, MafA through an unknown mechanism (Kanai et al. 2010, Shao and Cobb 2009). In this report, evidence was provided demonstrating that PIASy and Ubc9 were capable of modifying MafA with

SUMO1 as well as SUMO 2/3. In addition, excess MafA was able to reverse the negative effect of PIASy and Ubc9 on Glis3-mediated insulin transcription and mutation of the

MafA binding site within the insulin promoter had an inhibitory effect on transcriptional activation by Glis3 to a similar extent as observed with overexpression of PIASy and

Ubc9. Collectively, these data make it tempting to speculate that PIASy and Ubc9 may inhibit synergism between MafA and Glis3 by SUMOylating each protein respectively. A previous report suggested a direct or indirect interaction between Glis3 and MafA (Yang et al. 2009), while another showed that Glis3 may form a complex with MafA, Pdx1, and

NeuroD1 through co-recruitment of CBP/p300 (ZeRuth et al. 2013). It is possible that

SUMOylation of Glis3 and MafA interferes with these events and prevents synergistic

49 activation of target genes such as insulin. Future studies are required to test these and other mechanisms by which SUMOylation could be affecting synergism between transcription factors.

Chronic exposure of β cells to high levels of glucose has previously been associated with decreased levels of insulin transcription mediated in part by decreased binding of MafA and Pdx1 to the insulin promoter (Harmon et al. 2005, Park et al. 2007,

Lee et al. 2012). Much of the decrease in insulin transcription was likely due to the observed transcriptional downregulation of Pdx1 and MafA. Glis3 was also seen to be transcriptionally downregulated in BRIN-BD11 cells grown under conditions of chronic hyperglycemia (GTZ unpublished data). However, MafA SUMOylation was reported in β cells exposed to oxidative stress suggesting that modification of MafA by SUMO may additionally serve as a mechanism to reduce insulin transcription under hyperglycemic conditions (Shao and Cobb 2009). Under conditions of chronically elevated glucose in

BRIN-BD11 cells, we observed increased expression of a high molecular weight species of PIASy that correlated with increased SUMOylation of exogenous Glis3 by SUMO2/3.

The absence of a reliable Glis3 antibody restricts the ability to determine whether Glis3 is

SUMOylated under conditions of chronic hyperglycemia but further studies will be required to examine whether oxidative stress promotes SUMOylation of PIASy or Glis3 and the subsequent downregulation of insulin transcription.

In HEK293T cells as well as in BRIN-BD11 cells expressing a generic reporter controlled by tandem copies of the GlisBS, PIASy and Ubc9 had a positive effect on

Glis3-directed transcription that was again independent of Glis3 SUMOylation. The mechanism underlying this positive effect is not currently understood. PIASy and Ubc9

50 may promote SUMOylation of the general transcriptional machinery that consequently increases Glis3-mediated gene activation. Indeed, SUMO has been previously shown to positively influence RNA polII-associated GTFs through several different mechanisms

(Chymkowitch et al. 2015). Moreover, SUMOylation of Sp1 has been shown to both positively and negatively regulate its recruitment of CBP/p300 at different times during development demonstrating dual roles of SUMO modification within the same protein target (Gong et al. 2014). There may also be a positive effect from PIASy and Ubc9 co- expression with Glis3 due to a general increase in protein stability. Previously, the tumor suppressor, SUFU, has been shown to have a similar effect on Glis3 in that it repressed insulin activation by Glis3 in INS1 cells while simultaneously stabilizing Glis3 protein levels (ZeRuth et al. 2011). Together, these studies suggest that Glis3 protein turnover may be linked to target gene activation.

Interaction with SUFU required a region of the N-terminus of Glis3 termed the N- terminal conserved region (NCR) due to its high levels of homology with the N-termini of Gli1, Gli2, and Gli3, the downstream effectors of hedgehog signaling that are specifically responsible for activating or repressing target genes (ZeRuth et al. 2011).

Interestingly, modification of Glis3 with SUMO by PIAS-family proteins also required this region, which is located in-between the two SUMOylated lysine residues of Glis3. It is not clear whether the region is utilized in mediating interaction between Glis3 and

PIAS proteins or whether posttranslational modifications within the region are required prior to SUMO modification. Others have reported that the N-terminus of Gli-family proteins can be SUMOylated by PIAS1 (Cox et al. 2010). Additional studies would be

51 required to determine whether the NCR of Gli1-3 is required for their modification by

SUMO and whether PIASy and Ubc9 influence Glis3 interaction with SUFU.

Collectively, these studies implicate SUMOylation as a mechanism that may be used to negatively regulate insulin transcription through inhibition of Glis3 and MafA transactivation function. Reversible posttranslational modifications of transcription factors could serve as an effective means to rapidly respond to environmental cues such as serum glucose levels. These modifications might also be a source of dysfunction in instances such as oxidative stress where their negative influence on insulin transcription can contribute to disease states such as diabetes. Investigation of Glis3 expression and posttranslational modifications under conditions of chronic hyperglycemia and oxidative stress will be a continued focus of research into the future.

Literature Cited

1. Abdel-Hafiz H, Takimoto GS, Tung L, Horwitz KB (2002) The inhibitory function in human progesterone receptor N termini binds SUMO-1 protein to regulate autoinhibition and transrepression. J Biol Chem 277(37): 33950-33956. 2. Agnetti G, Halperin VL, Kirk JA, Chakir K, Guo Y, Lund L, Nicolini F, Gherli T, Guarnieri C, Caldarera CM, Tomaselli GF, Kass DA, Van Eyk JE (2013) Desmin modifications associate with amyloid-like oligomers deposition in heart failure. Cardiovasc Res 102: 24-34. 3. Aguayo-Mazzucato C, Koh A, El Khattabi I, Li WC, Toschi E, Jermendy A, Juhl K, Mao K, Weir GC, Sharma A, Bonner-Weir S (2011) Mafa expression enhances glucose-responsive insulin secretion in neonatal rat beta cells. Diabetologia 54(3): 583-593. 4. Allfrey VG, Faulkner R, Mirsky (1964) Acetylation and methylation of histones and their possible role in the regulation of RNA synthesis. Proc Natl Acad Sci USA 51: 786-794. 5. Artner I, Hang Y, Mazur M, Yamamoto T, Guo M, Linder J, Magnuson MA, Stein R (2010) MafA and MafB regulate genes critical to β-cells in a unique temporal manner. Diabetes 59(10): 2530-2539. 6. Aruga J, Yokota N, Hashimoto M, Furuichi T, Fukuda M, Mikoshiba K (1994) A novel zinc finger protein, zic, is involved in neurogenesis, especially in the cell lineage of cerebellar granule cells. J Neurochem 63(5): 1880-1890. 7. Bailey D, O’Hare P (2004) Characterization of the localization and proteolytic activity of the SUMO-specific protease, SENP1. J Biol Chem 279(1): 692-703. 8. Barrett JC, Clayton DG, Concannon P, Akolkar B, Cooper JD, Erlich HA, Julier C, Morahan G, Nerup J, Nierras C, Plagnol V, Pociot F, Schuilenburg H, Smyth DJ, Stevens H, Todd JA, Walker NM, Rich SS, et al (2009) Genome-wide association study and meta-analysis find that over 40 loci affect risk of type 1 diabetes. Nat Genet 41(6): 703-707. 9. Bayha E, Jorgensen MC, Serup P, Grapin-Botton A (2009) Retinoic acid signaling organizes endodermal organ specification along the entire anteroposterior axis. PLoS ONE 4(6): e5845. 10. Beak JY, Kang HS, Kim Y, Jetten AM (2007) Kruppel-like zinc finger protein Glis3 promotes osteoblast differentiation by regulating FGF18 expression. J Bone Miner Res 22(8): 1234-1244. 11. Beak JY, Kang HS, Kim Y, Jetten AM (2008) Functional analysis of the zinc finger and activation domains of Glis3 and mutant Glis3(NDH1). Nucleic Acids Res 36(5): 1690-1702.

12. Bekes M, Prudden J, Srikumar T, Raught B, Boddy MN, Salvesen GS (2011) The dynamics and mechanism of SUMO chain deconjugation by SUMO-specific proteases. J Biol Chem 286(12): 10238-10247. 13. Belaguli NS, Zhang M, Brunicardi FC, Berger DH (2012) Forkhead box protein A2 (FOXA2) protein stability and activity are regulated by sumoylation. PLoS ONE 7(10): e48019. 14. Berbari NF, O’Connor AK, Haycraft CJ, Yoder BK (2009) The primary cilium as a complex signaling center. Curr Biol 19(13): R526-535. 15. Bhattacharyya S, Feferman L, Tobacman JK (2015) Inhibition of phosphatase activity follows decline in sulfatase activity and leads to transcriptional effects through sustained phosphorylation of transcription factor MITF. PLoS ONE 11(4): e0153463. 16. Bies J, Markus J, Wolff L (2002) Covalent attachment of the SUMO-1 protein to the negative regulatory domain of the c-Myb transcription factor modifies its stability and transactivation capacity. J Biol Chem 277(11): 89999-9009. 17. Bisgrove BW and Yost HJ (2006) The roles of cilia in developmental disorders and disease. Development 133(21): 4131-4143. 18. Boesgaard TW, Jorgenson GT, Borch-Johnsen K, MAGIC, Hansen T, Pederson O (2010) Variants at DGKB/TMEM195, ADRA2A, GLIS3 and C2CD4B loci are associated with reduced glucose-stimulated beta cell function in middle-aged Danish people. Diabetologia 53: 1647-1655. 19. Bossis G, Malnou CE, Farras R, Andermarcher E, Hipskind R, Rodriguez M, Schmidt D, Muller S, Jariel-Encontre I, Piechaczyk M (2005) Down-regulation of c-Fos/c-Jun AP-1 dimer activity by sumoylation. Mol Cell Biol 25(16): 6964- 6979. 20. Brzovic PS, Lissounov A, Christensen DE, Hoyt DW, Klevit RE (2006) A UbcH5/Ubiquitin noncovalent complex is required for processive BRCA1- directed ubiquitination. Mol Cell 21: 873-880. 21. Chan C, Mak T, Chin K, Ng IO, Jin D (2010) N-linked glycosylation is required for optimal proteolytic activation of membrane-bound transcription factor CREB- H. J Cell Sci 123: 1438-1448. 22. Cheng J, Kang X, Zhang S, Yeh ETH (2007) SUMO-specific protease 1 is essential for stabilization of hypoxia-inducible factor-1α during hypoxia. Cell 131(3): 584-595. 23. Chuah SY, Pallen CJ (1989) Calcium-dependent and phosphorylation-stimulated proteolysis of lipocortin I by an endogenous A431 cell membrane protease. J Biol Chem 264(35): 21160-21166. 24. Corbit KC, Shyer AE, Dowdle WE, Gaulden J, Singla V, Chen MH, Chuang PT, Reiter JF (2008) Kifa constrains beta-catenin-dependent Wnt signalling through dual ciliary and non-ciliary mechanisms. Nat Cell Biol 10(1): 70-76. 25. Dawlaty MM, Malureanu L, Jeganathan KB, Kao E, Sustmann C, Tahk S, Shuai K, Grosschedl R, van Deursen JM (2008) Resolution of sister centromeres

requires RanBP2-mediated SUMOylation of topoisomerase IIalpha. Cell 133(1): 103-115. 26. Dessimoz J, Opoka R, Kordich JJ, Grapin-Botton A, Wells JM (2006) FGF signaling is necessary for establishing gut tube domains along the anterior- posterior axis in vivo. Mech Dev 123(1): 42-55. 27. Desterro JM, Rodriguez MS, Hay RT (1998) SUMO-1 modification of IkappaBalpha inhibits NF-kappaB activation. Mol Cell 2(2): 233-239. 28. Desterro JMP, Rodriguez MS, Kemp GD, Hays RT (1999) Identification of the enzyme required for activation of small ubiquitin-like protein SUMO-1. J Biol Chem 274(15): 10618-10624. 29. Desterro JMP, Thomson J, Hay RT (1997) Ubch9 conjugates SUMO but not ubiquitin. FEBS Letters 417: 297-300. 30. Duan H, Skeath JB, Nguyen HT (2001) Drosophila Lame duck, a novel member of the Gli superfamily, acts as a key regulator of myogenesis by controlling fusion-competent myoblast development. Development 128: 4489-4500. 31. Duprez E, Saurin AJ, Desterro JM, Lallemand-Breitenbach V, Howe K, Boddy MN, Solomon E, The H, Hay RT, Freemont PS (1999) SUMO-1 modification of the acute promyelocytic leukemia protein PLM: implications for nuclear localisation. J Cell Sci 112: 381-393. 32. Dupuis J et al. (2010) New genetic loci implicated in fasting glucose homeostasis and their impact on type 2 diabetes risk. Nat Genet 42(2): 105-116. 33. Eloranta JJ, Hurst HC (2002) Transcription factor AP-2 interacts with the SUMO- conjugating enzyme UBC9 and is sumoylated in vivo. J Biol Chem 277(34): 30798-30804. 34. Furlong EEM, Andersen EC, Null B, White KP, Scott MP (2001) Patterns of gene expression during Drosophila mesoderm development. Science 293(5535): 1629- 1633. 35. Gareau JR, Lima CD (2010) The SUMO pathway: emerging mechanisms that shape specificity, conjugation and recognition. Nat Rev Mol Cell Biol 11(12): 861-871. 36. Golosow N, Grobstein C (1962) Epitheliomesenchymal interactions in pancreatic morphogenesis. Dev Biol 4: 242-255. 37. Gong L, Li B, Millas S, Yeh ET (1999) Molecular cloning and characterization of human AOS1 and UBA2, components of the sentrin-activating enzyme complex. FEBS Lett 448(1): 185-189. 38. Gong L, Millas S, Maul GG, Yeh ET (2000) Differential regulation of sentrinized proteins by a novel sentrin-specific protease. J Biol Chem 275(5): 3355-3359. 39. Goodson ML, Hong Y, Rogers R, Matunis MJ, Park-Sarge OK, Sarge KD (2001) Sumo-1 modification regulates the DNA binding activity of heat shock transcription factor 2, a promyelocytic leukemia nuclear body associated transcription factor. J Biol Chem 276(21): 18513-18518.

40. Gregoire S, Tremblay AM, Xiao L, Yang Q, Ma K, Nie J, Mao Z, Wu Z, Giguere V, Yang XJ (2006) Control of MEF2 transcriptional activity by coordinated phosphorylation and sumoylation. J Biol Chem 281(7): 4423-4433. 41. Gresko E, Ritterhoff S, Sevilla-Perez J, Roscic A, Frobius K, Kotevic I, Vichalkovski A, Hess D, Hemmings BA, Schmitz ML (2009) PML tumor suppressor is regulated by HIPK2-mediated phosphorylation in response to DNA damage. Oncogene 28(5): 698-708. 42. Guo S, Burnette R, Zhao L, Vanderford NL, Poitout V, Hagman DK, Henderson E, Ozcan S, Wadzinski BE, Stein R (2009) The stability and transactivation potential of mammalian MafA transcription factor are regulated by serine 65 phosphorylation. J Biol Chem 284(2): 759-765. 43. Gupta P, Ho PC, Hug MM, Ha SG, Park SW, Khan AA, Tsai NP, Wei LN (2008) Retinoic acid-stimulated sequential phosphorylation, PML recruitment, and SUMOylation of nuclear receptor TR2 to suppress Oct4 expression. Proc Natl Acad Sci USA 105(32): 11424-11429. 44. Han S, Aramata S, Yasuda K, Kataoka K (2007) MafA stability in pancreatic β cells is regulated by glucose and is dependent on its constitutive phosphorylation at multiple sites by glycogen synthase kinase. Mol Cell Biol 27(19): 6593-6605. 45. Hang J, Dasso M (2002) Association of the human SUMO-1 protease SENP2 with the nuclear pore. J Biol Chem 277(22): 19961-19966. 46. Harmon JS, Stein R, Robertson RP (2005) Oxidative stress-mediated, posttranslational loss of MafA protein as a contributing mechanism to loss of insulin gene expression in glucotoxic beta cells. J Biol Chem 280(12): 11107-11113. 47. Hashimoto H, Miyamoto R, Watanabe N, Shiba D, Ozato K, Inoue C, Kubo Y, Koga A, Jindo T, Narita T, Naruse K, Ohishi K, Nogata K, Shin-I T, Asakawa S, Shimizo N, Miyamoto T, Mochizuki T, Yokoyama T, Hori H, Takeda H, Kohara Y, Wakamatsu Y (2009) Polycystic kidney disease in the medaka (Oryzias latipes) pc mutant caused by a mutation in the Gli-Similar3 (glis3) gene. PLoS ONE 4(7): e6299. 48. Haycraft CJ, Banizs B, Aydin-Son Y, Zhang Q, Michaud EJ, Yoder BK (2005) Gli2 and Gli3 localize to cilia and require the intraflagellar transport protein Polaris for processing and function. PLoS Genet 1(4): e53. 49. Hebrok M, Kim SK, Melton DA (1998) Notochord repression of endodermal Sonic hedgehog permits pancreatic development. Genes Dev 12: 1705-1713. 50. Hebrok M, Kim SK, St Jacques B, McMahon AP, Melton DA (2000) Regulation of pancreas development by hedgehod signaling. Development 127(22): 4905- 4913. 51. Hegyi P, Maleth J, Venglovecz V, Rakonczay Jr Z (2011) Pancreatic ductal bicarbonate secretion: challenge of the acinar acid load. Front Physio 2(36). 52. Hietakangas V, Ahlskog JK, Jakobsson AM, Hellesuo M, Sahlberg NM, Holmberg CI, Mikhailov A, Palvimo JJ, Pirkkala L, Sistonen L (2003) Phosphorylation of serine 303 is a prerequisite for the stress-inducible SUMO modification of heat shock factor 1. Mol Cell Biol 23(8): 2953-2968.

53. Hietakangas V, Anckar J, Blomster HA, Fujimoto M, Palvimo JJ, Nakai A, Sistonen L (2006) PDSM, a motif for phosphorylation-dependent SUMO modification. Proc Natl Acad Sci USA 103(1): 45-50. 54. Hildebrandt F, Attansio M, Otto E (2009) Nephronophthisis: disease mechanisms of a ciliopathy. J Am Soc Nephrol 20(1): 23-35. 55. Hoege C, Pfander B, Moldovan GL, Pyrowolakis G, Jentsch S (2002) RAD6- dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature 419(6903): 135-141. 56. Hoffmann H, Floss S, Stamminger T (2000) Covalent modification of the transactivator protein IE2-p86 of human cytomegalovirus by conjugation to the ubiquitin-homologous proteins SUMO-1 and hSMT3b. J Virol 74(6): 2510-2524. 57. Hong JH, Hwang ES, McManus MT, Amsterdam A, Tian Y, Kalmukova R, Mueller E, Benjamin T, Spiegelman BM, Sharp PA, Hopkins N, Yaffe MB (2005) TAZ, a transcriptional modulator of mesenchymal stem cell differentiation. Science 309(5737): 1074-1078. 58. Hong JH, Yaffe MB (2006) TAZ: a beta-catenin-like molecule that regulates mesenchymal stem cell differentiation. Cell Cycle 5(2): 176-179. 59. Ihara M, Yamamoto H, Kikuchi A (2005) SUMO-1 modification of PIASy, and E3 ligase, is necessary for PIASy-dependent activation of Tcf-4. Mol Cell Biol 25(9): 3506-3518. 60. Jacquemin P, Yoshimoto H, Kashima Y, Rousseau GG, Lemaigre FP, Zaret KS (2009) An endothelial-mesenchymal relay pathway regulates early phases of pancreatic development. Dev Biol 290(1): 189-199. 61. Johnson ES, Gupta AA (2001) An E3-like factor that promotes SUMO conjugation to the yeast septins. Cell 106(6): 735-744. 62. Johnson ES, Schwienhorst I, Dohmen RJ, Blobel G (1997) The ubiquitin-like protein Smt3p is activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer. EMBO J 16(18): 5509-5519. 63. Kahyo T, Nishida T, Yasuda H (2001) Involvement of PIAS1 in the sumoylation of tumor suppressor p53. Mol Cell 8(3): 713-718. 64. Kanai K, Reza HM, Kamitani A, Hamazaki Y, Han S, Yasuda K, Kataoka K (2010) SUMOylation negatively regulates transcriptional and oncogenic activities of MafA. Genes Cells 15: 971-982. 65. Kang HS, Beak JY, Kim YS, Herbert R, Jetten AM (2009a) Glis3 is associated with primary cilia Wwtr1/TAZ and implicated in polycystic kidney disease. Mol Cell Biol 29(10): 2556-2569. 66. Kang HS, Kim Y, ZeRuth G, Beak JY, Gerrish K, Kilie G, Sosa-Pineda B, Jensen J, Foley J, Jetten AM (2009b) Transcription factor Glis3, a novel critical player in the regulation of pancreatic β-cell development and insulin gene expression. Mol Cell Biol 29(24): 6366-6379. 67. Khoury GA, Baliban RC, Floudas CA (2011) Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database. Sci Rep 1: 90.

68. Kim SC, Kim YS, Jetten AM (2005) Kruppel-like zinc finger protein Gli-similar 2 (Glis2) represses transcription through interaction with C-terminal binding protein 1 (CtBP1). Nucleic Acids Res 33(21): 6805-6815. 69. Kim Y, Nakanishi G, Lewandoski M, Jetten AM (2003) GLIS3, a novel member of the GLIS subfamily of Kruppel-like zinc finger proteins with repressor and activation functions. Nucleic Acids Res 31(19): 5513-5525. 70. Kinkel MD, Sefton EM, Kikuchi Y, Mizoguchi T, Ward AB, Prince VE (2009) Cyp26 enzymes function in endoderm to regulate pancreatic field size. Proc Natl Acad Scie USA 106(19): 7864-7869. 71. Kinzler KW, Ruppert JM, Bigner SH, Vogelstein B (1988) The GLI gene is a member of the Kruppel family of zinc finger proteins. Nature 332(6162): 371- 374. 72. Kishi A, Nakamura T, Nishio Y, Maegawa H, Kashiwagi A (2003) Sumoylation of Pdx1 is associated with its nuclear localization and insulin gene activation. Am J Physiol Endocrinal Metab 284(4): E830-40. 73. Kleinsmith LJ, Allfrey VG, Mirsky AE (1966) Phosphorylation of nuclear protein early in the course of gene activation in lymphocytes. Science 154(3750): 780- 781. 74. Kotaja N, Karvonen U, Janne OA, Palvimo JJ (2002) PIAS proteins modulate transcription factors by functioning as SUMO-1 ligases. Mol Cell Biol 22(14): 5222-5234. 75. Kovalenko OV, Plug AW, Haaf T, Gonda DK, Ashley T, Ward DC, Radding CM, Golub EI (1996) Mammalian ubiquitin-conjugating enzyme Ubc9 interacts with Rad51 recombination protein and localizes in synaptonemal complexes. Proc Natl Acad Sci 93: 2958-2963. 76. Lamar E, Kintner C, Goulding M (2001) Identification of NKL, a novel Gli- Kruppel zinc-finger protein that promotes neuronal differentiation. Development 128(8): 1335-1346. 77. Lichti-Kaiser K, ZeRuth G, Kang HS, Vasanth S, Jetten AM (2012) Gli-similar (Glis) proteins: their mechanisms of action, physiological functions, and roles in disease. Vitam Horm 88: 141-171. 78. Lee KM, Seo YM, Kim MK, Seo HA, Jeong JY, Choi HS, Lee IK, Park KG (2012) Mediation of glucolipotoxicity in INS-1 rat insulinoma cells by small heterodimer partner interacting leucine zipper protein (SMILE). Biochem Biophys Res Commun 419(4): 768-773. 79. Mabb AM, Wuerzberger-Davis SM, Miyamoto S (2006) PIASy mediates NEMO sumoylation and NF-kappaB activation in response to genotoxic stress. Nat Cell Biol 8(9): 986-993. 80. Matsuoka T, Zhao L, Artner I, Jarrett HW, Friedman D, Means A, Stein R (2003) Members of the large Maf transcription family regulate insulin gene transcription in islet β cells. Mol Cell Biol 23(17): 6049-6062.

81. Matunis MJ, Wu J, Blobel G (1998) SUMO-1 modification and its role in targeting the Ran GTPase-activating protein, RanGAP1, to the nucleat pore complex. J Cell Biol 140(3): 499-509. 82. McLin VA, Rankin SA, Zorn AM (2007) Repression of Wnt/beta-catenin signaling in the anterior endoderm is essential for liver and pancreas development. Development 134(12): 2207-2217. 83. McNabb DS, Courtney RJ (1992) Posttranslational modification and subcellular localization of the p12 capsid protein of herpes simplex virus type 1. J Virol 66(8): 4839-4847. 84. Muller S, Berger M, Lehembre F, Seeler JS, Haupt Y, Dejean A (2000) c-Jun and p53 activity is modulated by SUMO-1 modification. J Biol Chem 275(18): 13321- 13329. 85. Muller S, Matunis MJ, Dejean A (1998) Conjugation with the ubiquitin-related modifier SUMO-1 regulates the partitioning of PML within the nucleus. EMBO J 17(1): 61-70. 86. Nacerddine K, Lehembre F, Bhaumik M, Artus J, Cohen-Tannoudji M, Babinet C, Pandolfi P, Dejean A (2005) The SUMO pathway is essential for nuclear integrity and chromosome segregation in mice. Dev Cell 9(6): 769-779. 87. Nakashima M, Tanese N, Ito M, Auerbach W, Bai C, Furukawa T, Toyono T, Akamine A, Joyner AL (2002) A novel gene, GliH1, with homology to the Gli zinc finger domain not required for mouse development. Mech Dev 119(1): 21- 34. 88. Naya FJ, Huang H, Qiu Y, Mutoh H, DeMayo FJ, Leiter AB, Tsai M (1997) Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/NeuroD-deficient mice. Genes Dev 11: 2323-2334. 89. Nishida T, Yasuda H (2002) PIAS1 and PIASxalpha function as SUMO-E3 ligases toward androgen receptor and repress androgen-dependent transcription. J Biol Chem 277(44): 41311-41317. 90. Nishimura W, Kondo T, Salameh T, Khattabi IE, Dodge R, Bonner-Weir S, Sharma A (2006) A switch from MafB to MafA expression accompanies differentiation to pancreatic β-cells. Dev Biol 293: 526-539. 91. Ohneda K, Mirmira RG, Wang J, Johnson JD, German MS (2000) The homeodomain of PDX-1 mediates multiple protein-protein interactions in the formation of a transcriptional activation complex on the insulin promotor. Mol Cell Biol 20(3): 900-911. 92. Olbrot M, Rud J, Moss LG, Sharma A (2002) Identification of β-cell-specific insulin gene transcription factor RIPE3b1 as mammalian MafA. Proc Natl Acad Sci USA 99(10): 6737-6742. 93. Olson LK, Redmon JB, Towle HC, Robertson RP (1993) Chronic exposure of HIT cells to high glucose concentrations paradoxically decreases insulin gene transcription and alters binding of insulin gene regulatory protein. J Clin Invest 92: 514-519.

94. Oro AE (2007) The primary cilia, a ‘Rab-id’ transit system for hedgehog signaling. Curr Opin Cell Biol 19(6): 691-696. 95. Park KG, Lee K, Seo H, Suh J, Kim H, Wang L, Won K, Lee H, Park J, Lee K, Kim J, Kim B, Choi H, Lee I (2007) Glucotoxicity in the INS-1 rat insulinoma cell line is mediated by the orphan nuclear receptor small heterodimer partner. Diabetes 56: 431-437. 96. Parker JL, Bucceri A, Davies AA, Heidrich K, Windecker H, Ulrich HD (2008) SUMO modification of PCNA is controlled by DNA. EMBO J 27(18): 2422- 2431. 97. Pashavaria M, Henderson E, Sharma A, Wright CV, Stein R (1997) Functional characterization of the transactivation properties of the PDX-1 homoedomain protein. Mol Cell Biol 17(7): 3987-3996. 98. Pavletich NP, Pabo CO (1993) Crystal structure of a five-finger GLI-DNA complex: new perspectives on zinc fingers. Science 261(5129): 1701-1707. 99. Pichler A, Gast A, Seeler JS, Dejean A, Melchior F (2002) The nucleoporin RanBP2 has SUMO1 E3 ligase activity. Cell 108(1): 109-120. 100. Pichler A, Knipscheer P, Oberhofer E, van Dijk WJ, Korner R, Olsen JV, Jentsch S, Melchior F, Sixma TK (2005) SUMO modification of the ubiquitin- conjugating enzyme E2-25K. Nat Struc Mol Biol 12(3): 264-269. 101. Pichler A, Melchior F (2002) Ubiquitin-related modifier SUMO1 and nucleocytoplasmic transport. Traffic 3(6): 381-387. 102. Pictet RL, Clark WR, Willams RH, Rutter WJ (1972) An ultrastructural analysis of the developing embryonic pancreas. Dev Biol 29: 436-467. 103. Poitout V, Olson LK, Robertson RP (1996) Chronic exposure of βTC-6 cells to supraphysiologic concentrations of glucose decreses binding of the RIPE3b1 insulin gene transcription activator. J Clin Invest 94(4): 1041-1046. 104. Qiu Y, Sharma A, Stein R (1998) p300 mediates transcriptional stimulation by the basic helix-loop-helix activators of the insulin gene. Mol Cell Biol 18(5): 2957-2964. 105. Rocques N, Zeid NA, Sii-Felice K, Lecoin L, Felder-Schmittbuhl M, Eychene A, Pouponnot C (2007) GSK-3-mediated phosphorylation enhances Maf-transforming activity. Mol Cell 28: 584-597. 106. Rodriguez MS, Dargemont C, Hay RT (2001) SUMO-1 conjugation in vivo requires both a consensus modification motif and nuclear targeting. J Biol Chem 276(16): 12654-12659. 107. Rohatgi R, Milenkovic L, Scott MP (2007) Patched1 regulates hedgehog signaling at the primary cilium. Science 317(5836): 372-376. 108. Rosenbaum JL and Witman GB (2002) Intraflagellar transport. Nat Rev Cell Biol 3(11): 813-825. 109. Ross S, Best JL, Zon LI, Gill G (2002) SUMO-1 modification represses Sp3 transcriptional activation and modulates its subnuclear localization. Mol Cell 10(4): 831-842.

110. Rytinki MM, Kaikkonen S, Pehkonen P, Jaaskelainen T, Palvimo JJ (2009) PIAS proteins: pleiotropic interactors associated with SUMO. Cell Mol Life Sci 66: 3029-3041. 111. Sachdev S, Bruhn L, Sieber H, Pichler A, Melchior F, Grosscheldl R (2001) PIASy, a nuclear matrix-associated SUMO E3 ligase, represses LEF1 activity by sequestering into nuclear bodies. Genes Dev 15(23): 3088-3103. 112. Sampson DA, Wang M, Matunis MJ (2001) The small ubiquitin-like modifier-1 (SUMO-1) consensus sequence medites Ubc9 binding and is essential for SUMO-1 modification. J Biol Chem 276(24): 21664-21669. 113. Sapetschnig A, Rischitor G, Braun H, Doll A, Schergaut M, Melchior F, Suske G (2002) Transcription factor Sp3 is silenced through SUMO modification by PIAS1. EMBO J 21(19): 5206-5215. 114. Schmidt D, Muller S (2002) Members of the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53 activity. Proc Natl Acad Sci USA 99(5): 2872-2877. 115. Senee V, Chelala C, Duchatelet S, Feng D, Blanc H, Cossec J, Charon C, Nicolino M, Boileau P, Cavener DR, Bougneres P, Taha D, Julier C (2006) Mutations in GLIS3 are responsible for a rare syndrome with neonatal diabetes mellitus and congenital hypothyroidism. Nat Genet 38(6): 682-687. 116. Shalizi A, Bilimoria PM, Stegmuller J, Gaudilliere B, Yang Y, Shuai K, Bonni A (2007) PIASx is a MEF2 SUMO E3 ligase that promotes postsynaptic dendritic morphogenesis. J Neurosci 27(37): 10037-10046. 117. Shao C, Cobb MH (2009) Sumoylation regulates the transcriptional activity of MafA in pancreatic β cells. J Biol Chem 284(5): 3117-3124. 118. Sharma A, Olson LK, Robertson RP, Stein R (1995) The reduction of insulin gene transcription in HIT-T15 β cells chronically exposed to high glucose concentration is associated with the loss of RIPE3b1 and STF-1 transcription factor expression. Mol Endocrinol 9: 1127-1134. 119. Spooner BS, Walther BT, Rutter WJ (1970) The development of the dorsal and ventral mammalian pancreas in vivo and in vitro. J Cell Biol 47: 235- 246. 120. Stankovic-Valentin N, Deltour S, Seeler J, Pinte S, Vergoten G, Guerardel C, Dejean A, Leprince D (2007) An acetylation/deacetylation-SUMOylation switch through a phylogenetically conserved psiKXEP motif in the tumor suppressor HIC1 regulates transcriptional repression activity. Mol Cell Biol 27(7): 2661-2675. 121. Taha D, Barbar M, Kanaan H, Williamson J (2003) Neonatal diabetes mellitus, congenital hypothyroidism, hepatic fibrosis, polycystic kidneys, and congenital glaucoma: a new autosomal recessive syndrome? Am J Med Genet A 122A(3): 269-273. 122. Tiso N, Filippi A, Pauls S, Bortolussi M, Argenton F (2002) BMP signalling regulates anteroposterior endoderm patterning in zebrafish. Mech Dev 118(1-2): 29-37.

123. Veland IR, Awan A, Pedersen LB, Yoder BK, Christensen ST (2009) Primary cilia and signaling in pathways in mammalian development, health and disease. Nephron Physiol 111(3): p39-53. 124. Wandzioch E, Zaret KS (2009) Dynamic signaling network for the specification of embryonic pancreas and liver progenitors. Science 324(5935): 1707-0710. 125. Wang H, Zhou Q, Kesinger JW, Norris C, Valdez C (2007) Heme regulates exocrine peptidase precursor genes in zebrafish. Exp Biol Med 232: 1170-1180. 126. Watanabe N, Hiramatsu K, Miyamoto R, Yasuda K, Suzuki N, Oshima N, Kiyonari H, Shiba D, Nishio S, Mochizuki T, Yokoyama T, Maruyama S, Matsuo S, Wakamatsu Y, Hashimoto H (2009) A murine model of neonatal diabetes mellitus in Glis3-deficient mice. FEBS Lett 583: 2108-2113. 127. Wessells NK, Cohen JH (1967) Early pancreas organogenesis: morphogenic, tissue interactions, and mass effects. Dev Biol 15: 237-270. 128. Wilkinson KD, Urban MK, Haas AL (1980) Ubiquitin is the ATP- dependent proteolysis factor I of rabbit reticulocytes. J Biol Chem 255(16): 7529- 7532. 129. Yang W, Dall TM, Halder P, Gallo P, Kowal SL, Hogan PF (2013) Economic costs of diabetes in the U.S. in 2012. Diabetes Care 36(4): 1033-1046. 130. Yang Y, Chang BH, Samson SL, Li MV, Chan L (2009) The Kruppel-like zinc finger protein Glis3 directly and indirectly activates insulin gene transcription. Nucleic Acids Res 37(8): 2529-2538. 131. Zecchin E, Mavropoulos A, Devos N, Filippi A, Tiso N, Meyer D, Peers B, Bortolussi M, Argenton F (2003) Evolutionary conserved role of pft1a in the specification of exocrine pancreatic fates. Dev Biol 268: 174-184. 132. ZeRuth GT, Takeda Y, Jetten AM (2013) The Kruppel-like protein Gli- Similar 3 (Glis3) functions as a key regulator of insulin transcription. Mol Endocrinol 27(10): 1692-1705. 133. ZeRuth GT, Williams JG, Cole YC, Jetten AM (2015) HECT E3 ubiquitin ligase Itch functions as a novel negative regulator or Glis-Similar 3 (Glis3) transcriptional activity. PLoS One 10(7): e0131303. 134. ZeRuth GT, Yang X, Jetten AM (2011) Modulation of the transactivation function and stability of Kruppel-like zinc finger protein Gli-similar 3 (Glis3) by suppressor of fused. J Biol Chem 286(25): 22077-22089. 135. Zhang C, Moriguchi T, Kajihara M, Esaki R, Harada A, Shimohata H, Oishi H, Hamada M, Morito N, Hasegawa K, Kudo T, Engel JD, Yamamoto M, Takahashi S (2005) MafA is a key regulator of glucose-stimulated insulin secretion. Mol Cell Biol 25(12): 4969-4976. 136. Zhang F, Nakanishi G, Kurebayashi S, Yoshino K, Perantoni A, Kim YS, Jetten AM (2002) Characterization of Glis3, a novel gene encoding a Gli-related, Kruppel-like transcription factor with transactivation and repressor functions.

Roles in kidney development and neurogenesis. J Biol Chem 277(12): 10139- 10149. 137. Zhao L, Guo M, Matsuoka T, Hagman DK, Parazzoli D, Poitout V, Stein R (2005) The islet β cell-enriched MafA activator is a key regulator of insulin gene transcription. J Biol Chem280(12): 11887-11894. 138. Zhou Q, Law AC, Rajagopal J, Anderson WJ, Gray PA, Melton DA (2007) A multipotent progenitor domain guides pancreatic organogenesis. Dev Cell 13: 103-114.

Appendix Recipes: 10X Phosphate Buffered Saline (PBS)

For 500 ml

NaCl – 1.37 M 40 g

KCl – 27 mM 1 g

Na2HPO4 – 100 mM 7.2 g

KH2PO4 – 18 mM 1.2 g

Dissolve reagents in 400 ml of ddH2O. Adjust pH to 7.4 with HCl. q.s to 500 ml with ddH2O. Sterilize by autoclaving. Store at RT.

RIPA Buffer

For 100 ml

Tris – 25 mM 2.5 ml (1M)

NaCl – 150 mM 3 ml (5M)

EDTA - 1 mM 200 ul (0.5M)

EGTA – 1 mM 200 ul (0.5M)

NaMolybdate – 20 mM 2 ml (1M)

Nonidet P-40 – 0.5% 5 ml (10%) ddH2O 87.1 ml

Mix together ingredients. Store at RT. Add protease inhibitor cocktail immediately before use. NP-40 and NaCl concentrations can be adjusted to reduce/increase stringency. 1%

SDS can be added before use.

LB Medium

For 500 ml

Tryptone – 5 g

Yeast extract – 2.5 g

NaCl – 5 g

Agar (if for plates) – 7.5 g

Mix ingredients in 300 ml of water by stirring. Sterilize by autoclaving. Cool to ~55° C

(cool enough to touch) before adding antibiotic.

Protocols

Co-IP

1. Ensure that cells are at 70-80% confluency

2. Begin with 4 sets of microcentrifuge tubes

a. The number of tubes in a set will correspond to the number of samples

3. Also begin with two 25 ml conical tubes

a. One will have 500 μl of RIPA buffer per sample (round up to next largest

measurement)

i. It will also have 10 μl/ml of protease inhibitor cocktail

b. The other will have 700 μl of PBS per sample + 100μl

i. Also add protease inhibitor cocktail at 10 μl/ml

4. Set centrifuge to 4°C

5. Set heat block to 70°C

6. Have small beaker with regular PBS placed in ice

7. Gently pour media out of tray

8. Gently wash cells with ice cold PBS (from beaker)

a. Pour down side of each well

b. Repeat

c. Pour out in sink

9. Aspirate excess PBS

10. Add 500 μl RIPA buffer to each well

a. Suck up and wash down to the corner of well held to an angle

b. Add each lysate to a pre-chilled microcentrifuge tube

c. Leave on ice for about 10 minutes

11. Get metal beads out of 4°C

a. Rock on cradle to get in solution

12. Prepare antibody

a. Dilute appropriately in 0.01% PBST

13. Place 30 μl of bead solution in a new tube for each sample

14. Place tubes on the magnet rack

15. Suck out clear liquid

16. Add 200 μl of diluted antibody solution to each tube

a. Suck in and out of pipette to get beads back in solution

17. Place in rotator for 15-30 minutes

18. Place lysate tubes in refrigerated centrifuge

a. 10 minutes at 4°C at about 1600 rcf

19. Add 12.5 μl of 4x buffer and 37.5 μl of lysate in each of what will be the input

tubes

a. Pump up and down with pipette to mix

b. Poke hole in top of each tube

20. Place input tubes in heat block for 10 minutes (70°C)

21. Place bead tubes back on magnet tray and suck out clear liquid

22. Wash these tubes to get rid of excess antibody with 200 μl 0.01% PBST

a. Pump up and down to get back into solution

b. Place back on magnet and suck out of tube

23. Use about 410 μl of lysate for each tube

24. Incubate IP tubes on the rotator for about 30 minutes

25. Take inputs out of the heat block

a. Place in -20°C freezer

26. Set heat block to 95˚C

27. Make new buffer for IP tubes

a. Dilute 4x buffer to 1x with RIPA + Protease inhibitor (1:3 ratio

respectively)

28. Set up polyacrylamide gel

29. Take IP tubes off of rotator

a. Place on magnet

b. Suck out clear liquid

30. Wash beads back into solution with 200 μl PBS + Protease inhibitor

a. Place back on magnet

b. Suck out PBS

c. Repeat 2 more times

31. Add 100 μl of PBS to each tube

a. Get beads in solution and transfer to new tubes

b. Put on magnet and suck out PBS

32. Load 40 μl of the prepared 1x buffer to each tube with beads

a. Poke hole in lids

b. Place in heat block (95°C for 5 minutes)

33. Place tubes on magnet

34. Load gel(s) (30 μl)

a. Use 5 µl molecular weight marker

35. Run gel until blue gets to the bottom (165 volts until blue reaches bottom)

36. Transfer gel to membrane (20 volts for one hour)

37. Block using 5% dry milk in 1x TTBS

a. Use about 10 ml per block usually

b. 30 min to an hour

38. Follow block up with primary and secondary antibody staining

a. Primary staining

i. Overnight in fridge or 1 hour room temp

b. Wash 3x 10 min with 1x TTBS next day

c. Secondary stain one hour at room temp

d. Wash 3x 10 min with 1x TTBS

39. Use 1:1 ratio of developing solutions (1500 μl per blot)

a. Allow to develop for 1 minute

Luciferase Assay 1. Triplicate sample tubes

2. Make lysis buffer

a. 125 μl/well for HK293 cells

b. Round to next hundred

c. Dilute 5x  1x (1:4)

3. Get PBS to wash

4. Thaw luciferase assay substrate

5. Get plate (96 wells) ready

6. Wash

a. Dump off media

b. Draw 1 ml PBS

i. Use about 300 μl to wash each well

c. Perform total of 2 washes and aspirate

7. Add 125 μl of lysis buffer to each well

a. Use backwards pipet tip to scrape cells to bottom of well

8. Transfer the lysate to tubes

9. Centrifuge 2 minutes at max speed

10. Add 20 μl of lysate per sample

a. Each loaded in duplicate for luciferase and β-gal

11. β-gal solution

a. Use 50 μl per well for half of the wells

i. Round up amount collected

b. Use β-galactosidase to substrate in a (49:1) ratio respectively

i. Allow to incubate for about 30 minutes

12. Add 50 μl per well of luciferase assay substrate

13. Open Lumate manager on computer

14. Go to test  read plate (rlu) type last well to read

15. Graph data and use t-test to analyze significance

OES Cloning

1. First reaction is set up using 100ng of the largest piece and equimolar rations of

all other pieces. A proofreading polymerase should be used. The total reaction

volume is 50µl.

2. The reaction involves a 95º initial denaturation step, then 95º for 30 seconds,

annealing for 30 seconds, and elongation for the appropriate amount of time

repeated 30 times with a final 10 minute elongation step.

3. The second reaction is set up using primers for either end of the entire desired

clone and 5µl of the first reaction. A standard Taq should be used if this is to be

followed by TOPO-TA cloning.

4. The reaction parameters for the second reaction will be the same as the first

reaction.

Plasmids Generated

PIASy/PIAS1/Ubc9

pCMV-Myc

Glis3-SUMO Fusion

pCRii-TOPO