State Subsets and Correlates with the Maturation Cells Is Restricted to the Nonplasmacytoid Prion Protein Expression by Mouse De

Prion Protein Expression by Mouse Dendritic Cells Is Restricted to the Nonplasmacytoid Subsets and Correlates with the Maturation State This information is current as of September 30, 2021. Gloria Martínez del Hoyo, María López-Bravo, Patraporn Metharom, Carlos Ardavín and Pierre Aucouturier J Immunol 2006; 177:6137-6142; ; doi: 10.4049/jimmunol.177.9.6137 http://www.jimmunol.org/content/177/9/6137 Downloaded from

References This article cites 43 articles, 18 of which you can access for free at:

http://www.jimmunol.org/content/177/9/6137.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 30, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Prion Protein Expression by Mouse Dendritic Cells Is Restricted to the Nonplasmacytoid Subsets and Correlates with the Maturation State1

Gloria Martıńez del Hoyo,* Marıá Lo´pez-Bravo,* Patraporn Metharom,2† Carlos Ardavıń,3,4* and Pierre Aucouturier3,4†

Expression of the physiological cellular prion protein (PrPC) is remarkably regulated during differentiation and activation of cells of the immune system. Among these, dendritic cells (DCs) display particularly high levels of membrane PrPC, which increase upon maturation, in parallel with that of molecules involved in Ag presentation to T cells. Freshly isolated mouse Langerhans cells, dermal DCs, and DCs from thymus, spleen, and mesenteric lymph nodes expressed low to intermediate levels of PrPC. Highest levels of both PrPC and MHC class II molecules were displayed by lymph node CD8␣int DCs, which represent fully mature cells having migrated from peripheral tissues. Maturation induced by overnight culture resulted in increased levels of surface PrPC, as did in vivo DC activation by bacterial Downloaded from LPS. Studies on Fms-like tyrosine kinase 3 ligand bone marrow-differentiated B220؊ DCs confirmed that PrPC expression followed that of MHC class II and costimulatory molecules, and correlated with IL-12 production in response to TLR-9 engagement by CpG. However, at variance with conventional DCs, B220؉ plasmacytoid DCs isolated from the spleen, or in vitro differentiated, did not significantly express PrPC, both before and after activation by TLR-9 engagement. PrP knockout mice displayed higher numbers of .spleen CD8␣؉ DCs, but no significant differences in their maturation response to stimulation through TLR-4 and TLR-9 were noticed http://www.jimmunol.org/ Results are discussed in relation to the functional relevance of PrPC expression by DCs in the induction of T cell responses, and to the pathophysiology of prion diseases. The Journal of Immunology, 2006, 177: 6137–6142.

he prion protein (PrP)5 was initially described as an es- (PRNP in humans), the structure of which is remarkably conserved sential component of the infectious agents responsible for between species (5). Its physiological product is expressed as a T transmissible spongiform encephalopathies (TSE) (1). GPI-anchored membrane protein termed cellular PrP (PrPC), in TSE are a group of neurodegenerative disorders that include many tissues at variable levels (6, 7). Because neurons generally Creutzfeldt-Jakob disease and kuru in humans, bovine spongiform display strong PrPC expression, and because the CNS is specifi- encephalopathy, sheep scrapie, and chronic wasting disease in deer cally involved during the clinical stages of TSEs, most studies by guest on September 30, 2021 and elk. Although the pathophysiology of TSE remains poorly were devoted to the potential functions of PrPC in the brain (8–11). understood (reviewed in Refs. 2 and 3), an almost invariable fea- Although PrP knockout (PrnpϪ/Ϫ) mice display no gross func- ture is the accumulation of an abnormal isoform of PrP (scrapie Sc tional anomaly, the structure of PrP and its regulated expression PrP, designated PrP ) in infected tissues of affected individuals. during development and cell differentiation suggest that its phys- PrP was found to be encoded by a unique gene of the host (4), Prnp iological role(s) might be more important than one would expect from observations in experimental animals (12). C *Department of Immunology and Oncology, Centro Nacional de Biotecnologıá/Con- Outside the nervous system, PrP is particularly expressed on sejo Superior de Investigaciones Cientificas, Universidad Autońoma, Madrid, Spain; the membrane of cells of hemopoietic lineages, including platelets, and †Universite´Pierre et Marie Curie, Unite´Mixte de Recherche S Institut National de la Santeét de la Recherche Me´dicale Unite´712, Paris, France lymphocytes, and mononuclear phagocytes (7, 13–15). Published C Received for publication May 16, 2006. Accepted for publication August 2, 2006. studies have shown that PrP expression is finely tuned during the The costs of publication of this article were defrayed in part by the payment of page differentiation, maturation, and activation processes of T cells (16, charges. This article must therefore be hereby marked advertisement in accordance 17) and dendritic cells (DC) (18). These observations are of par- with 18 U.S.C. Section 1734 solely to indicate this fact. ticular interest because of the following: 1) lymphoid tissues are 1 This work was supported in part by grants from the Ministerio de Educacioń y specifically involved in the early stages of TSEs (19, 20); 2) the Ciencia of Spain SAF-2003-07291, Groupement d’Inte´ret Scientifique Maladies a` C Prions, and European Union Contract QLK5-CT-2002-01044. P.M. was a recipient of expression of normal PrP is required for cells to support prion an Institut National de la Santeét de la Recherche Me´dicale Poste Vert fellowship. replication (21–23); and 3) PrPc might function as a receptor for 2 Current address: Centre for Research in Vascular Biology, BioSciences Institute, scrapie PrP (24). Although sites of prion accumulation during the University College, Cork, Ireland. incubation period are relatively well defined in different TSE mod- 3 C.A. and P.A. contributed equally to this work. els (reviewed in Refs. 19 and 25), the mechanisms responsible for 4 Address correspondence and reprint requests to Dr. Pierre Aucouturier, Universite´ prion penetration and transport remain unclear. Because after ex- Pierre et Marie Curie, Unite´Mixte de Recherche S Institut National de la Santeétde la Recherche Me´dicale Unite´712, 184 rue du Faubourg Saint-Antoine, 75571, Paris posure to pathogens and/or inflammatory compounds DCs migrate Cedex 12, France; E-mail address: [email protected] or Dr. Carlos Ar- from Ag capture areas to the T cell zones of organized lymphoid davıń, Department of Immunology and Oncology, Centro Nacional de Biotecnologıá/ Consejo Superior de Investigaciones Cientificas, Universidad Autońoma, 28049 Ma- tissues, these cells represent potential candidates as prion carriers. drid, Spain; E-mail address: [email protected] Indeed, DCs were shown to transport prions to the mesenteric 5 Abbreviations used in this paper: PrP, prion protein; DC, dendritic cell; DDC, der- lymph after oral inoculation (26), and to transfer prion infection to mal DC; int, intermediate; LC, Langerhans cell; LN, lymph node; MS-LN, mesenteric LN; pDC, plasmacytoid DC; PrPC, cellular PrP; Flt3L, Fms-like tyrosine kinase 3 the brain (27). Other studies suggest that DCs can degrade TSE ligand; TC, tricolor; TSE, transmissible spongiform encephalopathy. agents (28, 29), as do macrophages (30).

Thus, although DCs are clearly involved in TSE pathogenesis, carefully titrated to ensure correct quantitative comparisons. After FcR their precise role in the etiology of this disease remains unclear. In blocking with mAb 2.4G2, DCs were analyzed by gating on CD11c-pos- this study, we have specifically analyzed the expression of PrPC by itive cells, after triple staining with FITC-conjugated anti-CD11c (clone N418); PE-conjugated anti-CD8␣ (clone CT-CD8␣); and biotin-conju- DC subpopulations from the skin, thymus, spleen, and lymph gated anti-MHC class II (MHC II; clone FD11-54.3), anti-CD40 (clone nodes (LNs) of the mouse, in an attempt to determine whether FGK45), anti-CD86 (B7-2, clone GL1), or anti-PrP (clone SAF83; pro- distinct DC subsets would be more prone to be differentially tar- vided by J. Grassi, Commissariat a`l’Energie Atomique, Saclay, France), geted by prions. In light of another recent study (31), our results on followed by streptavidin-tricolor (TC; Caltag Laboratories). All analyses, C including before and after overnight culture, were performed in comparison PrP expression by DCs should also help in understanding its with the same cells incubated with the corresponding isotype control Ig. physiological role in the immune system. Analysis of LCs and DDCs was performed by gating on CD11c-positive cells, after double staining with FITC-conjugated anti-CD11c (clone N418) Materials and Methods and biotin-conjugated anti-MHC class II (clone FD11-54.3) or anti-PrP (clone SAF83), followed by streptavidin-PE (Caltag Laboratories). Mice Analysis of plasmacytoid DCs (pDCs) was performed by gating on Five- to 6-wk-old C57BL/6 mice were purchased from IFFA Credo. PrP CD11c-positive cells, after triple staining with FITC-conjugated anti- knockout (PrnpϪ/Ϫ) mice (21) were provided by C. Weissmann (Imperial CD11c (clone N418), PE-conjugated anti-CD45R (B220, clone RA-6B2), College, London, U.K.), and backcrossed 10 times on the C57BL/6 back- and biotin-conjugated anti-MHC class II (clone FD11-54.3) or anti-PrP ground. Animals were bred under strict specific pathogen-free conditions (clone SAF83), followed by streptavidin-TC. following European recommendations on animal ethics. Phenotypic analysis of Flt3L-DCs was performed after triple staining with FITC-conjugated anti-CD45R (B220, clone RA3-6B2); PE-conju- Preparation of epidermal Langerhans cells (LCs) and dermal gated anti-CD11b (Mac1, clone MI/70); and biotin-conjugated anti-MHC DCs (DDCs) class II (clone FD11-54.3), anti-CD40 (clone FGK45), anti-CD86 (B7-2, Downloaded from clone GL1), or anti-PrP (clone SAF83), followed by streptavidin-TC. Ears were split into dorsal and ventral halves and incubated with 0.5% Analyses were performed on a FACSort flow cytometer (BD Biosciences). trypsin (Sigma-Aldrich) for 45 min at 37°C, to allow the separation of the epidermis from the dermis. The epidermal or dermal sheets were incubated ELISA for IL-12 at 37°C for 12 h in RPMI 1640, with 100 ng/ml murine rGM-CSF (Pep- Cryopreserved supernatants from day 9 Flt3L-DCs cultured at 1 ϫ 106 roTech). After this incubation period, LCs or DDCs were harvested from cells/ml in 24-well plates, in control conditions or in the presence of CpG the culture medium. for the last 24 h, were tested for the presence of IL-12, using a mouse IL-12 http://www.jimmunol.org/ DC-enriched cell fractions p70 ELISA kit (BD Pharmingen). Spleens and thymuses from both control and PrnpϪ/Ϫ mice were cut into Results small fragments and digested with collagenase A (0.5 mg/ml; Boehringer PrP expression by DC subpopulations isolated ex vivo Mannheim) and DNase I (40 ␮g/ml; Boehringer Mannheim) in RPMI 1640 supplemented with 5% FCS, for 10 min at 37°C with continuous agitation. Expression of PrP by the main DC subpopulations present in mouse Digested fragments were filtered through a stainless-steel sieve, and cell lymphoid organs was analyzed in DC-enriched cell preparations, after suspensions were washed twice in PBS solution, supplemented with 5% gating for CD11c-positive cells, as described in Materials and FCS and 5 mM EDTA, containing 5 ␮g/ml DNase I. Mesenteric LNs (MS-LNs) were mechanically disgregated and filtered through a stainless- Methods. ϩ Ϫ by guest on September 30, 2021 steel sieve, and cell suspensions were washed twice in PBS solution, sup- These included skin LCs and DDCs, CD8 and CD8 DCs plemented with 5% FCS and 5 mM EDTA, containing 5 ␮g/ml DNase I. (found in most lymphoid organs, including the thymus, spleen, and The cell suspensions were then resuspended in cold isosmotic Optiprep LNs), CD8int DCs (which constitute a LN-specific DC subset corre- 3 solution (Nyegaard; pH 7.2), density 1.061 g/cm , and a low-density fraction, sponding to epithelium-related DCs that have migrated to LNs via accounting for Ͻ1% of the starting cell population, was obtained by centrif- ϩ ugation at 1700 ϫ g for 10 min at 4°C. B cells were then removed magneti- afferent lymphatics), and B220 pDCs. These DC subpopulations are cally after incubation for 30 min at 4°C with sheep anti-mouse Ig-coated mag- endowed with specific functions and differ in their maturation state, netic beads (Dynabeads; Dynal Biotech) at a 6:1 bead:cell ratio. which correlates with their level of expression of MHC II and costimulatory molecules. Therefore, as shown in Fig. 1, the analysis of In vivo DC maturation assays PrP expression has been performed in parallel with that of MHC II Analysis of in vivo maturation of splenic DCs was performed 3 h after i.v. expression on conventional DC subpopulations and pDCs, from the ␮ injection of 25 g of the TLR-4 ligand LPS from Escherichia coli skin, thymus, spleen, and MS-LNs, after ex vivo isolation and after an (Sigma-Aldrich). additional overnight culture period that triggers DC maturation. In vitro differentiation of DCs with Fms-like tyrosine kinase 3 Regarding skin DCs, both freshly isolated LCs and DDCs ex- ligand (Flt3L; Flt3L-DCs) pressed low to intermediate levels of PrP, which were clearly up- Flt3L-DCs were generated from lysis buffer-treated bone marrow cells cul- regulated after overnight culture, in parallel with a significant in- tured at 1 ϫ 106 cells/ml in 24-well plates, in RPMI 1640 supplemented crease of MHC class II expression reflecting the induction of a with 10% FCS, 50 ␮M 2-ME, 100 U/ml penicillin-streptomycin, 1 mM maturation process. However, because the isolation procedure NaPyr, and 100 ng/ml human Flt3L (PeproTech), at 37°C and 5% CO2. used to obtain skin DCs involved a trypsin-mediated digestion Maturation of Flt3L-DCs step, and some surface molecules are known to be trypsin sensitive (this is not the case of MHC II molecules; see Ref. 32), the in- Day 8 Flt3L-DCs were cultured for additional 24 h in control conditions or creased PrP level observed for skin DCs after overnight culture in the presence of 6 ␮g/ml TLR-9 ligand CpG oligodeoxynucleotide-1826: TCCATGACGTTCCTGACGTT (CpG) or 1 mg/ml LPS from E. coli. In- could also reflect partial or total PrP re-expression after proteolysis hibition of p-38 MAPK kinase and ERK kinase was achieved by pretreat- caused by the isolation procedure. ϩ ment with the inhibitors SB203580 (Sigma-Aldrich) and UO126 (Sigma- CD8 DCs from the thymus, spleen, and LNs expressed low to Aldrich), respectively, for 30 min before addition of CpG. intermediate levels of PrP. In the spleen and MS-LNs, CD8Ϫ DCs ϩ Flow cytometry expressed similar PrP levels as their CD8 counterparts. PrP expression by both CD8ϩ and CD8Ϫ DC subsets slightly increased Analysis of DCs from the spleen, thymus, and MS-LNs was performed on upon overnight culture, this up-regulation being somewhat higher DC-enriched fractions freshly isolated or overnight cultured in RPMI 1640 Ϫ ␮ for CD8 DCs. This moderate PrP up-regulation undergone by supplemented with 10% FCS, 50 M 2-ME, 100 U/ml penicillin-strepto- ϩ Ϫ mycin, 1 mM Na Pyr, and 15% of a J558 cell line-conditioned medium, as CD8 and CD8 DCs after overnight culture was accompanied by a source of GM-CSF. Before staining the samples, all conjugated Abs were a limited increase in MHC II expression. The Journal of Immunology 6139

FIGURE 1. PrP expression by ex vivo isolated DC subpopulations. Histograms show the expression of MHC II and PrP by mouse conventional and pDC subpopulations from the skin, MS-LN, spleen, and thymus, directly after ex vivo isolation (gray profiles), and after 12-h culture in the absence of exogenous cytokines (bold line profiles). Open profiles represent biotin-conjugated isotype control Ab staining. Percentages of cells above background staining are indicated for ex vivo isolated DCs (upper figures) and 12-h cultured DCs (lower bold figures), except for the histograms corresponding to MHC II expression by LCs and DDCs. In these cases, the mean fluorescence intensity values are indicated, to better evaluate the variations in MHC II expression. Expression profiles are represented on a logarithmic scale in the x-axis. Results are representative of five experiments for cells analyzed directly ex vivo, and of three experiments for cells analyzed after 12-h culture. Downloaded from

Interestingly, the LN-associated CD8int DC subset expressed ter LPS treatment, PrP expression was only slightly increased on higher levels of PrP than CD8ϩ and CD8Ϫ DCs, as well as higher CD8ϩ DCs, but was strongly up-regulated on the CD8Ϫ DC sub-

MHC II levels. In contrast to other DC subsets found in lymphoid set, as observed after overnight culture of these splenic DC subsets http://www.jimmunol.org/ organs, CD8int DCs have been demonstrated to represent fully ma- (see Fig. 1). These data further support the view that PrP expres- ture DCs, with high levels of membrane MHC II and costimulatory sion is regulated during conventional DC maturation, this process molecules (33). As a result of their maturation status, overnight being differentially regulated in different DC subsets. culture did not promote a signiﬁcant up-regulation of PrP or MHC II by CD8int DCs. PrP protein expression by DCs differentiated in vitro Finally, B220ϩ pDCs did not express signiﬁcant levels of PrP ir- To obtain further insights into the regulation of PrP expression by respective of their MHC II expression and location, and interestingly, mouse DCs, DCs derived from bone marrow precursors driven by overnight culture proved unable to induce PrP expression on pDCs. the cytokine Flt3L were analyzed for the expression of MHC II,

In conclusion, PrP expression appears to be restricted to con- CD40, CD86, and PrP. Interestingly, in contrast to DC cultures by guest on September 30, 2021 ventional, nonplasmacytoid, DC subpopulations, and among these, generated from bone marrow precursors in the presence of GM- the LN-associated CD8int DC subset displayed the highest level of CSF that generate non-pDCs, Flt3L-driven bone marrow cultures expression of PrP, in correlation with its maturation state. In ad- have been shown to generate both conventional B220Ϫ DCs dition, overnight culture, which induced a marked increase in the (equivalent to splenic conventional DCs) and B220ϩ pDCs (34). expression of MHC II, determined a strong up-regulation of PrP by Therefore, Flt3L-driven DC cultures represent a more physiolog- skin DCs and, to a lesser extent, by CD8Ϫ DCs. Globally, these ical approach for the in vitro analysis of DC subsets present in data suggest that PrP expression level correlates with the matura- lymphoid organs, considering that monocyte-derived DCs have tion status of conventional DC subpopulations. been claimed to correspond to inflammatory DCs. To confirm this hypothesis, PrP expression was further analyzed Analysis of DCs from day 10 Flt3L-driven cultures confirmed on splenic non-pDCs after in vivo maturation induced by LPS, a that, concurring with our data on ex vivo splenic B220ϩ pDCs, in TLR-4 ligand known to induce conventional DC activation and vitro generated B220ϩ pDCs did not express PrP, nor did CpG maturation (Fig. 2). Six hours after i.v. injection of LPS, both treatment (that caused B220ϩ pDCs maturation) induce the ex- CD8Ϫ and CD8ϩ DCs displayed a mature phenotype, as indicated pression of PrP on these cells (Fig. 3). With regard to in vitro by the up-regulation of MHC II, CD40, and CD86 molecules. Af- generated B220Ϫ DCs, ϳ30% of them expressed PrP, and in

FIGURE 2. Effect of in vivo LPS-induced DC maturation on PrP expression. Histograms illustrate the expression of MHC II, costimulatory molecules CD40 and CD86, and PrP by splenic CD8ϩ and CD8Ϫ DCs 6 h before and 6 h after i.v. injection of LPS. Open proﬁles in upper histograms represent biotin-conjugated isotype control Ab staining. Per- centages of cells above background staining are indicated. Expression proﬁles are represented on a logarithmic scale in the x-axis. Results are representative of two experiments with similar results. 6140 PrP EXPRESSION ON DC SUBSETS

FIGURE 3. PrP expression by DCs generated in vitro from bone marrow precursors. Histograms show the expression of MHC II, costimulatory molecules, and PrP by conventional B220Ϫ DCs and B220ϩ pDCs derived from Flt3L-driven bone marrow cultures, before and after LPS- or CpG-induced maturation. Percentages of cells above background staining are indicated. Expression proﬁles are represented on a logarithmic scale in the x-axis. Results are representative of four experiments with similar results.

agreement with the data from ex vivo isolated conventional DCs, whether PrP could in turn be involved in the regulation of the expres- treatment with the maturation stimuli LPS or CpG promoted a sion of MHC II and costimulatory molecules. For this purpose, ex

strong PrP up-regulation, paralleled by a significant increase in the vivo isolated, as well as in vitro differentiated DCs from PrP-deficient Downloaded from expression of MHC II, CD40, and CD86. Cultures in strictly sim- (PrnpϪ/Ϫ) mice were analyzed and compared with those obtained ilar conditions, but without TLR ligands, ruled out the possibility from wild-type C57BL/6 control mice. No significant difference was that other factors would increase PrP levels. found between survivals of cultured PrnpϪ/Ϫ and wild-type DCs. These data further support the concept that PrP expression by As shown in Fig. 5, a slightly higher proportion of CD11cϩ conventional, non-pDCs correlates with the maturation process. To spleen DCs from PrnpϪ/Ϫ mice was CD8␣ positive as compared reinforce this concept, PrP expression was analyzed on conven- with wild-type C57BL/6 mice. A further comparison of six indi- http://www.jimmunol.org/ tional B220Ϫ DCs from Flt3L-driven DC cultures after maturation vidual mice of each group confirmed that the proportions and ab- induced by the TLR-9 ligand CpG, in the presence of an inhibitor solute numbers of splenic CD8ϩ DCs were higher in PrnpϪ/Ϫ of p38 MAPK (SB203508), which is involved in the TLR-9 sig- mice. The mean percentage of CD8ϩ among CD11cϩ B220Ϫ naling pathway leading to the production of IL-12 by DCs. As spleen cells was 29.9 (SD ϭ 8.8) in control C57BL/6, vs 44.0 shown in Fig. 4, treatment with SB203508 blocked CpG-induced (SD ϭ 13.3) in PrnpϪ/Ϫ mice ( p Ͻ 0.05, Mann-Whitney U test). IL-12 production by in vitro generated B220Ϫ DCs, and inhibited No significant differences were observed in the expression of MHC the up-regulation of PrP, strongly suggesting that the latter was II, CD40, and CD86 by ex vivo isolated CD8Ϫ or CD8ϩ splenic related to TLR-9 triggering. In contrast, treatment with UO126, an DCs, before or after overnight culture (Fig. 5). Ϫ inhibitor of ERK kinase, acted synergistically with CpG on the Similarly, when conventional B220 DCs generated in Flt3L- by guest on September 30, 2021 induction of PrP expression and IL-12 production, as expected, driven bone marrow cultures from PrnpϪ/Ϫ mice were compared because ERK has been proposed to exert an inhibitory effect on the with those derived from C57BL/6 control mice, no significant dif- p38 signaling pathway initiated after TLR engagement. ferences in the expression of MHC II, CD40, and CD86 were Globally, B220Ϫ DC activation and maturation induced by observed, neither before nor after incubation with the maturation TLR-4 and TLR-9 ligands resulted in the up-regulation of PrP. stimuli LPS or CpG (Fig. 6). Therefore, PrP did not appear to play a role in the regulation of Analysis of MHC II and costimulatory molecule expression in the expression of MHC II and costimulatory molecules during DC PrP-deficient mice maturation, but may influence the development of CD8Ϫ DCs. The finding that PrP expression by conventional B220Ϫ DCs was correlated with their maturation status prompted us to investigate Discussion DCs are essential elements of the immune system due to their capacity to induce and regulate Ag-specific immune responses, allowing them to control infections caused by microbial pathogens; to block tumor growth; to exert a complex regulation of T, B, and NK cell responses; and, in addition, to play a pivotal role in the induction and maintenance of T cell tolerance. The remark- able functional diversity of the DC system relies on the plasticity and complexity of the DC differentiation process, which leads to the generation of a large collection of DC subpopulations, endowed with specific functions. DCs can be classified in two major categories: conventional DCs, which in turn include different DC subsets, and pDCs, characterized by their capacity to produce large amounts of type I IFNs during viral infections. In the present study, we have investigated the expression of PrP by different DC subpopulations endowed with specific phenotypic FIGURE 4. Effect of p38 MAPK inhibition on CpG-induced PrP up- regulation. PrP expression and IL-12 production after CpG-induced mat- and functional characteristics. In particular, we have analyzed DCs uration by conventional B220Ϫ DCs, derived from Flt3L-driven bone mar- isolated from different tissues (skin, thymus, spleen, and LNs), row cultures, in the presence of the p38 MAPK kinase inhibitor SB203508, before and after overnight culture, or after in vivo induction of DC or the ERK kinase inhibitor UO126. Results are representative of three maturation by LPS treatment. PrP expression was also analyzed on experiments with similar results. DCs differentiated in vitro from bone marrow precursors in the The Journal of Immunology 6141

FIGURE 5. MHC II and costimulatory molecule expression by ex vivo isolated DCs from PrP-deficient mice. Histograms show the proportion of CD8ϩ DCs among spleen DCs in control C57BL/6 and PrP-deficient mice (PrnpϪ/Ϫ) in one representative experiment of six, and the expression level of MHC II and costimulatory molecules CD40 and CD86 by CD8ϩ and CD8Ϫ splenic DCs directly after ex vivo isolation, or after overnight culture. Open profiles represent biotin-conjugated isotype control Ab staining. The percentage of cells above background staining is indicated. Expression profiles are represented on a logarithmic scale in the x-axis. Re- sults are representative of three experiments with similar results. Downloaded from presence of the cytokine Flt3L, to extend our study to in vitro On conventional DCs, PrPC expression was strongly up-regu- generated DCs, extensively used both as research tools and for lated after maturation by TLR ligands, such as bacterial LPS and immunotherapeutical purposes. CpG-oligodeoxynucleotides, in parallel with molecules involved Previous studies have shown that, outside the nervous system, in Ag presentation and T cell activation. Interestingly, a recent study C DCs display the highest expression levels of PrP , in both humans showed that membrane PrP on Ag-presenting DCs enhances the http://www.jimmunol.org/ C and mice (7, 17, 18). PrP was found to be present on murine stimulation of specific naive T cells, both in vitro and in vivo (31). epidermis LCs (35), on DCs in extrafollicular areas, including T On the membrane of T cells, PrPC molecules were found to cell zones, of the gut mucosa (7, 36), and DCs of the splenic white associate with the TCR/CD3 complex upon engagement with pulp (18). PrP was found on the surface of bone marrow-derived MHC II/Ag peptide or anti-CD3 Abs, as shown by confocal mi- human and mouse DCs generated in vitro in the presence of GM- croscopy and coimmunoprecipitation (31, 38). Similar colocaliza- CSF, at levels that increased with LPS stimulation and correlated tion of PrPC and CD3␧ was demonstrated on Jurkat T cells after a with that of MHC II and costimulatory molecule CD86 (18, 31). nonspecific stimulation through hypothermal treatment, mimick- The present study confirms and extends these results, by demon-

ing an immunological synapse-like structure (39). In contrast, ac- by guest on September 30, 2021 strating important differences between different DC subsets either tivation of T cells by either mitogens or anti-CD3 Ab enhances analyzed after ex vivo isolation or differentiated in vitro. their PrPC expression (16, 17), and human T cells with an activated A ﬁrst striking observation is the absence of PrP expression on phenotype, based on their CD56 expression, display higher PrPC pDCs, even after maturation, in contrast to conventional DCs. levels than their resting counterparts (15). Altogether, these data pDCs are featured by their ability to secrete type I IFNs in re- C sponse to viral infections. Neither ex vivo isolated, nor in vitro suggest that T cell activation may implicate PrP on the surface of differentiated B220ϩ pDCs expressed detectable PrP, even after both partners, i.e., the APC and the T cell. C overnight culture or stimulation with CpG. This difference with Higher PrP levels were found on the surface of spleen DCs that ␣ϩ conventional DCs could relate to their developmental origin be- are also CD8 . Expression of this marker has been correlated cause pDCs have been proposed to derive, under physiological with the secretion of IL-12 and IFN-␣ (40, 41). In LNs, the highest C int conditions, from bone marrow lymphoid precursors, based on data PrP levels are displayed by the CD8 subset that was shown to obtained both in humans and mice, demonstrating that pDCs ex- originate from skin DCs, and which are strong stimulators of Ag- press molecules related to the lymphoid lineage, such as pT␣, dependent delayed-type hypersensitivity (42). Thus, our data point spi-B, IL-7R, and PIII CIITA, and have IgH gene rearrangements to a possible involvement of PrPC in T cell activation leading to (reviewed in Ref. 37). Whether pDCs can express PrP during in Th1 responses. The mechanisms involved in T cell activation re- vivo viral infections remain to be determined. lated to PrPC expressed on DC remain to be explored.

FIGURE 6. LPS- or CpG-induced maturation of DCs differentiated in vitro from wild-type or PrP-deficient mice. Histograms show the expression of MHC II and costimulatory molecules CD40 and CD86 by conventional B220Ϫ DCs, derived from Flt3L-driven bone marrow from C57BL/6 or PrP- deficient mice, before and after LPS- or CpG-induced maturation. The percentage of cells above background staining is indicated. Expression profiles are represented on a logarithmic scale in the x-axis. Results are representative of three experiments with similar results. 6142 PrP EXPRESSION ON DC SUBSETS

Besides the contribution of our results in clarifying PrPC func- 17. Li, R. L., D. C. Liu, G. Zanusso, T. Liu, J. D. Fayen, J. H. Huang, R. B. Petersen, tions in the immune system, they may help in understanding cer- P. Gambetti, and M. S. Sy. 2001. The expression and potential function of cellular prion protein in human lymphocytes. Cell. Immunol. 207: 49–58. C tain aspects of TSE pathogenesis. Indeed, expression of PrP by 18. Burthem, J., B. Urban, A. Pain, and D. J. Roberts. 2001. The normal cellular cells of the lymphoreticular system is required for prions to prop- prion protein is strongly expressed by myeloid dendritic cells. Blood 98: 3733–3738. agate and invade the CNS after peripheral inoculation (23). This 19. Aucouturier, P., and C. Carnaud. 2002. The immune system and prion diseases: C may relate to a possible role of membrane PrP as a receptor for a relationship of complicity and blindness. J. Leukocyte Biol. 72: 1075–1083. prions, and to the ability of replicating prions at the periphery 20. Aguzzi, A. 2003. Prions and the immune system: a journey through gut, spleen, and nerves. Adv. Immunol. 81: 123–171. through PrP neosynthesis. Immunohistochemical studies revealed 21. Bueler, H., A. Aguzzi, A. Sailer, R. A. Greiner, P. Autenried, M. Aguet, and expression of PrPC by several cell types of the skin, including LCs C. Weissmann. 1993. Mice devoid of PrP are resistant to scrapie. Cell 73: and DCs, suggesting that they could be initial targets for prion 1339–1347. 22. Bla¨ttler, T., S. Brandner, A. J. Raeber, M. A. Klein, T. Voigtla¨nder, infection (35). Upon activation and maturation, peripheral DCs C. Weissmann, and A. Aguzzi. 1997. PrP-expressing tissue required for transfer increase PrP expression, which could help prion replication. In- of scrapie infectivity from spleen to brain. Nature 389: 69–73. C 23. Kaeser, P. S., M. A. Klein, P. Schwarz, and A. Aguzzi. 2001. Efficient lymphore- deed, we found that highest PrP levels in LN DCs are displayed ticular prion propagation requires PrPc in stromal and hematopoietic cells. J. Vi- int by a CD8 subset that originates from the skin. In contrast, recent rol. 75: 7097–7106. studies suggest that, although DCs can capture prions shortly after 24. Horiuchi, M., and B. Caughey. 1999. Specific binding of normal prion protein to the scrapie form via a localized domain initiates its conversion to the protease- oral inoculation and migrate to draining LNs (26), their role in resistant state. EMBO J. 18: 3193–3203. early pathogenesis might not be essential (43) (our unpublished 25. Weissmann, C., A. J. Raeber, F. Montrasio, R. Frigg, M. A. Klein, and A. Aguzzi. personal data). However, the increased PrP expression by mature 2001. Prions and the lymphoreticular system. Philos. Trans. R. Soc. London B 356: 177–184. DCs present in secondary lymphoid organs might facilitate their 26. Huang, F. P., C. F. Farquhar, N. A. Mabbott, M. E. Bruce, and G. G. MacPherson. Downloaded from involvement in the transfer of prions to sites of neuroinvasion. 2002. Migrating intestinal dendritic cells transport PrPsc from the gut. J. Gen. Virol. 83: 267–271. 27. Aucouturier, P., F. Geissmann, D. Damotte, G. P. Saborio, H. C. Meeker, Acknowledgments R. Kascsak, R. Kascsak, R. I. Carp, and T. Wisniewski. 2001. Infected splenic We thank Jacques Grassi for the gift of SAF83 Ab, Charles Weissmann for dendritic cells are sufficient for prion transmission to the CNS in mouse scrapie. PrnpϪ/Ϫ breeders, and Claude Carnaud and Martine Bruley Rosset for J. Clin. Invest. 108: 703–708. 28. Luhr, K. M., R. P. A. Wallin, H. G. Ljunggren, P. Low, A. Taraboulos, and helpful discussions and critical reading of the manuscript. K. Kristensson. 2002. Processing and degradation of exogenous prion protein by http://www.jimmunol.org/ CD11cϩ myeloid dendritic cells in vitro. J. Virol. 76: 12259–12264. Disclosures 29. Rybner-Barnier, C., C. Jacquemot, C. Cuche, G. Dore, L. Majlessi, The authors have no financial conflict of interest. M. M. Gabellec, A. Moris, O. Schwartz, J. Di Santo, A. Cumano, et al. 2006. Processing of the bovine spongiform encephalopathy-specific prion protein by dendritic cells. J. Virol. 80: 4656–4663. References 30. Maignien, T., M. Shakweh, P. Calvo, D. Marce, N. Sales, E. Fattal, J. P. Deslys, 1. Bolton, D. C., M. P. McKinley, and S. B. Prusiner. 1982. Identification of a P. Couvreur, and C. I. Lasmezas. 2005. Role of gut macrophages in mice orally protein that purifies with the scrapie prion. Science 218: 1309–1311. contaminated with scrapie or BSE. Int. J. Pharm. 298: 293–304. 2. Prusiner, S. B., M. R. Scott, S. J. DeArmond, and F. E. Cohen. 1998. Prion 31. Ballerini, C., P. Gourdain, V. Bachy, N. Blanchard, E. Levavasseur, S. Gre´goire, protein biology. Cell 93: 337–348. P. Fontes, P. Aucouturier, C. Hivroz, and C. Carnaud. 2006. Functional impli- 3. Aguzzi, A., M. Heikenwalder, and G. Miele. 2004. Progress and problems in the cation of cellular prion protein in antigen-driven interactions between T cells and biology, diagnostics, and therapeutics of prion diseases. J. Clin. Invest. 114: dendritic cells. J. Immunol. 176: 7254–7262. by guest on September 30, 2021 153–160. 32. Anjuere, F., P. Martin, I. Ferrero, M. L. Fraga, G. M. del Hoyo, N. Wright, and 4. Oesch, B., D. Westaway, M. Walchli, M. P. McKinley, S. B. Kent, R. Aebersold, C. Ardavin. 1999. Definition of dendritic cell subpopulations present in the R. A. Barry, P. Tempst, D. B. Teplow, and L. E. Hood. 1985. A cellular gene spleen, Peyer’s patches, lymph nodes, and skin of the mouse. Blood 93: 590–598. encodes scrapie PrP 27–30 protein. Cell 40: 735–746. 33. Wilson, N. S., D. El-Sukkari, and J. A. Villadangos. 2004. Dendritic cells con- 5. Van Rheede, T., M. M. Smolenaars, O. Madsen, and W. W. De Jong. 2003. stitutively present self antigens in their immature state in vivo and regulate an- Molecular evolution of the mammalian prion protein. Mol. Biol. Evol. 20: tigen presentation by controlling the rates of MHC class II synthesis and endo- 111–121. cytosis. Blood 103: 2187–2195. 6. Bendheim, P. E., H. R. Brown, R. D. Rudelli, L. J. Scala, N. L. Goller, 34. Brawand, P., D. R. Fitzpatrick, B. W. Greenfield, K. Brasel, C. R. Maliszewski, G. Y. Wen, R. J. Kascsak, N. R. Cashman, and D. C. Bolton. 1992. Nearly and T. De Smedt. 2002. Murine plasmacytoid pre-dendritic cells generated from ubiquitous tissue distribution of the scrapie agent precursor protein. Neurology Flt3 ligand-supplemented bone marrow cultures are immature APCs. J. Immunol. 42: 149–156. 169: 6711–6719. 7. Ford, M. J., L. J. Burton, R. J. Morris, and S. M. Hall. 2002. Selective expression 35. Sugaya, M., K. Nakamura, T. Watanabe, A. Asahina, N. Yasaka, Y. Koyama, of prion protein in peripheral tissues of the adult mouse. Neuroscience 113: M. Kusubata, Y. Ushiki, K. Kimura, A. Morooka, et al. 2002. Expression of 177–192. cellular prion-related protein by murine Langerhans cells and keratinocytes. 8. Herms, J., T. Tings, S. Gall, A. Madlung, A. Giese, H. Siebert, P. Schurmann, J. Dermatol. Sci. 28: 126–134. O. Windl, N. Brose, and H. Kretzschmar. 1999. Evidence of presynaptic location 36. Defaweux, V., G. Dorban, C. Demonceau, J. Piret, O. Jolois, O. Thellin, and function of the prion protein. J. Neurosci. 19: 8866–8875. C. Thielen, E. Heinen, and N. Antoine. 2005. Interfaces between dendritic cells, 9. Brown, D. R., B. S. Wong, F. Hafiz, C. Clive, S. J. Haswell, and I. M. Jones. other immune cells, and nerve fibres in mouse Peyer’s patches: potential sites for 1999. Normal prion protein has an activity like that of superoxide dismutase. neuroinvasion in prion diseases. Microsc. Res. Tech. 66: 1–9. Biochem. J. 344: 1–5. 37. Colonna, M., G. Trinchieri, and Y. J. Liu. 2004. Plasmacytoid dendritic cells in 10. Mouillet-Richard, S., M. Ermonval, C. Chebassier, J. L. Laplanche, S. Lehmann, immunity. Nat. Immunol. 5: 1219–1226. J. M. Launay, and O. Kellermann. 2000. Signal transduction through prion pro- 38. Mattei, V., T. Garofalo, R. Misasi, A. Circella, V. Manganelli, G. Lucania, tein. Science 289: 1925–1928. A. Pavan, and M. Sorice. 2004. Prion protein is a component of the multimo- 11. Chiarini, L. B., A. R. O. Freitas, S. M. Zanata, R. R. Brentani, V. R. Martins, and lecular signaling complex involved in T cell activation. FEBS Lett. 560: 14–18. R. Linden. 2002. Cellular prion protein transduces neuroprotective signals. 39. Wurm, S., C. Paar, A. Sonnleitner, M. Sonnleitner, O. Hoglinger, C. Romanin, EMBO J. 21: 3317–3326. and C. Wechselberger. 2004. Co-localization of CD3 and prion protein in Jurkat 12. Miele, G., A. R. Alejo Blanco, H. Baybutt, S. Horvat, J. Manson, and M. Clinton. lymphocytes after hypothermal stimulation. FEBS Lett. 566: 121–125. 2003. Embryonic activation and developmental expression of the murine prion 40. Martinez del Hoyo, G., P. Martin, C. Fernandez Arias, A. Rodriguez Marin, and protein gene. Gene Expr. 11: 1–12. C. Ardavin. 2002. CD8␣ϩ dendritic cells originate from the CD8␣Ϫ dendritic cell 13. Dodelet, V. C., and N. R. Cashman. 1998. Prion protein expression in human subset by a maturation process involving CD8␣, DEC-205, and CD24 up-regu- leukocyte differentiation. Blood 91: 1556–1561. lation. Blood 99: 999–1004. 14. Barclay, G. R., J. Hope, C. R. Birkett, and M. L. Turner. 1999. Distribution of 41. Hochrein, H., K. Shortman, D. Vremec, B. Scott, P. Hertzog, and M. O’Keeffe. cell-associated prion protein in normal adult blood determined by flow cytometry. 2001. Differential production of IL-12, IFN-␣, and IFN-␥ by mouse dendritic cell Br. J. Haematol. 107: 804–814. subsets. J. Immunol. 166: 5448–5455. 15. Durig, J., A. Giese, W. SchulzSchaeffer, C. Rosenthal, U. Schmucker, 42. Itano, A. A., S. J. McSorley, R. L. Reinhardt, B. D. Ehst, E. Ingulli, J. Bieschke, U. Duhrsen, and H. A. Kretzschmar. 2000. Differential constitutive A. Y. Rudensky, and M. K. Jenkins. 2003. Distinct dendritic cell populations and activation-dependent expression of prion protein in human peripheral blood sequentially present antigen to CD4 T cells and stimulate different aspects of leukocytes. Br. J. Haematol. 108: 488–496. cell-mediated immunity. Immunity 19: 47–57. 16. Cashman, N. R., R. Loertscher, J. Nalbantoglu, I. Shaw, R. J. Kascsak, 43. Mohan, J., M. E. Bruce, and N. A. Mabbott. 2002. Neuroinvasion by scrapie D. C. Bolton, and P.E. Bendheim. 1990. Cellular isoform of the scrapie agent following inoculation via the skin is independent of migratory Langerhans cells. protein participates in lymphocyte activation. Cell 61: 185–192. J. Virol. 79: 1888–1897.