viruses

Article The Nucleoprotein and Phosphoprotein of Peste des Petits Ruminants Virus Inhibit Interferons Signaling by Blocking the JAK-STAT Pathway

1,2, 2, 2 2 2 2 Pengfei Li † , Zixiang Zhu †, Xiangle Zhang , Wen Dang , Linlin Li , Xiaoli Du , Miaotao Zhang 1, Chunyan Wu 1, Qinghong Xue 3, Xiangtao Liu 2, Haixue Zheng 2,* and Yuchen Nan 1,* 1 Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Northwest A&F University, Yangling 712100, China 2 State Key Laboratory of Veterinary Etiological Biology, National Foot and Mouth Diseases Reference Laboratory, Key Laboratory of Animal Virology of Ministry of Agriculture, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046, China 3 China Institute of Veterinary Drug Control, Beijing100081, China * Correspondence: [email protected] (H.Z.); [email protected] (Y.N.) These authors contributed equally to this work. †


Received: 17 June 2019; Accepted: 6 July 2019; Published: 8 July 2019


Abstract: Peste des petits ruminants virus (PPRV) is associated with global peste des petits ruminants resulting in severe economic loss. Peste des petits ruminants virus dampens host interferon-based signaling pathways through multiple mechanisms. Previous studies deciphered the role of V and C in abrogating IFN-β production. Moreover, V protein directly interacted with signal transducers and activators of transcription 1 (STAT1) and STAT2 resulting in the impairment of host IFN responses. In our present study, PPRV infection inhibited both IFN-β- and IFN-γ-induced activation of IFN-stimulated response element (ISRE) and IFN-γ-activated site (GAS) element, respectively. Both N and P proteins, functioning as novel IFN response antagonists, markedly suppressed IFN-β-induced ISRE and IFN-γ-induced GAS promoter activation to impair downstream upregulation of various interferon-stimulated genes (ISGs) and prevent STAT1 nuclear translocation. Specifically, P protein interacted with STAT1 and subsequently inhibited STAT1 phosphorylation, whereas N protein neither interacted with STAT1 nor inhibited STAT1 phosphorylation as well as dimerization, suggesting that the N and P protein antagonistic effects were different. Though they differed in their relationship to STAT1, both proteins blocked JAK-STAT signaling, severely negating the host antiviral immune response. Our study revealed a new mechanism employed by PPRV to evade host innate immune response, providing a platform to study the interaction of paramyxoviruses and host response.

Keywords: peste des petits ruminants virus; nucleoprotein; phosphoprotein; interferon; JAK/STAT

1. Introduction Peste des petits ruminants (PPR), a severe contagious viral disease of domestic and wild small ruminants, particularly affects goats and sheep [1]. The disease was first reported in the Ivory Coast area of West Africa in 1942 [2]. Since then, PPR has markedly spread from the Ivory Coast to numerous other regions, including countries in Africa, the Middle East, Asia, and Europe [3–6]. Currently, PPR represents a global threat to about 62.5% of goat and sheep populations and is considered by the goat and sheep industry to be an economically important infectious disease worldwide [7]. The causative agent of PPR, peste des petits ruminants virus (PPRV), belongs to the genus Morbillivirus within the family Paramyxoviridae [8]. Peste des petits ruminants virus is a non-segmented,

Viruses 2019, 11, 629; doi:10.3390/v11070629 www.mdpi.com/journal/viruses Viruses 2019, 11, 629 2 of 17 negative-sense, single-stranded RNA virus with a genome length of about 15 kb. The viral genome contains six genes encoding eight proteins that include nucleoprotein (N), phosphoprotein (P), matrix protein (M), fusion protein (F), hemagglutinin membrane glycoprotein (H), and large protein (L) structural proteins, as well as non-structural W and C/V proteins [7]. The V and W proteins are the co-transcripts of the P gene due to the one and double G insertion at the editing site, respectively, during the viral transcription. Meanwhile, mRNA coding for the C protein is also generated from the P protein-encoding gene, but through transcription that generates mRNA that encodes an alternate open reading frame [7]. Type I interferons (IFNs) (including IFN-α and IFN-β) and Type II IFN (IFN-γ) are induced during most viral infections and are responsible for restriction of viral replication in vivo [9]. Type I IFNs directly activate the antiviral response in infected or uninfected cells through upregulation of a series of IFN-stimulated genes (ISGs) that ultimately inhibit viral replication [10,11]. Type I IFNs (IFN-α and IFN-β) bind to IFN-α/β receptors, which are composed of interferon-α/β receptor 1 (IFNAR1) and IFNAR2 subunits, to induce autophosphorylation of janus kinase 1 (JAK1) and tyrosine kinase 2 (TYK2). Actions of these activated kinases further lead to phosphorylation of signal transducers and activators of transcription (STAT) that include STAT1 and STAT2 [12,13]. Subsequently, phosphorylated STAT1 and STAT2 form heterodimers that bind to IFN-regulatory factor 9 (IRF9) to form IFN-stimulated gene factor 3 (ISGF3) [14,15], which functions as a transcriptional factor and is imported into the nucleus to bind to IFN-stimulated response elements (ISREs), initiating expression of various ISGs [10,11]. Type II IFN (IFN-γ) is mainly secreted by natural killer (NK) cells and activated T cells and plays important roles in regulation of host antiviral responses [16]. Type II IFN induces phosphorylation and activation of JAK1 and JAK2 by interacting with the IFN-γ receptor, which is composed of IFNGR1 and IFNGR2 subunits [17]. The activated JAK1 and JAK2 further phosphorylate STAT1 to form homodimers naming gamma activated factor (GAF), which is transported into the nucleus and binds to the gamma interferon activated site (GAS) elements to initiate transcription of IFN-γ-regulated antiviral genes which play a significant role in host innate immune response against pathogen infection [9,11,18]. Paramyxoviruses have evolved multiple strategies to counteract IFN-meditated antiviral effect through different viral proteins. The P gene products of paramyxoviruses have been implicated in blocking host IFN response, such as the V protein degrades STATs and inhibits the phosphorylation of STATs, blocking STATs’ nuclear translocation [19–23]. The PPRV V protein blocks STAT1 and STAT2 nuclear translocation through interacting with STAT1 and STAT2 [24]. Recently, it has been described that the N proteins of the measles virus (MeV), nipah virus (NiV), and hendra virus (HeV) inhibit IFN responses through different mechanisms [25,26]. In this study, N and P proteins were identified as two novel IFN antagonistic proteins of PPRV. Both N and P protein showed inhibitory effects on the ISRE and GAS promoter activation induced by IFN-β and IFN-γ, respectively. The expression of antiviral genes induced by IFN-β or IFN-γ was also considerably suppressed by N and P proteins. Further investigation indicated that the nuclear translocation of STAT1 was blocked by N and P protein suppression that, in turn, impaired the expression of various antiviral genes.

2. Materials and Methods

2.1. Cells, Virus, and Antibodies Human embryonic kidney 293T cells (HEK-293T) and human epithelial carcinoma cells (Hela) were grown in DMEM/high glucose medium (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; Biological Industries, Israel) and 1% penicillin–streptomycin (Gibco) at 37 ◦C in 5% CO2. The PPRV strain Nigeria 75/1 (GenBank: X74443) was used in this study. The HEK-293T cells were grown to ~50% confluency and then infected with 0.1 MOI of PPRV and maintained in the DMEM medium supplemented with 1% FBS for different times. The infected cells were treated with IFN and subjected to subsequent analysis. The commercial antibodies used in this study were as follows: anti-Flag mouse monoclonal antibody (Sigma–Aldrich, St. Louis, Viruses 2019, 11, 629 3 of 17

MO, USA), anti-Myc mouse monoclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-STAT1 antibody (Santa Cruz Biotechnology), and anti-β-Actin antibody (Thermo Fisher Scientific, USA); rabbit antibodies including anti-DDDDK (FLAG equivalent) (Proteintech, Rosemont, IL, USA), anti-STAT1 rabbit polyclonal antibody (Cell Signaling Technology, Danvers, MA, USA), anti-STAT2 rabbit polyclonal antibody (Cell Signaling Technology), anti-p–STAT1 rabbit polyclonal antibody (Cell Signaling Technology), and anti-p–STAT2 rabbit polyclonal antibody (Cell Signaling Technology). Alexa Fluor®488-conjugated goat anti-rabbit and Alexa Fluor®594-conjugated goat anti-mouse IgG (H+L) secondary antibodies were purchased from Thermo Fisher Scientific. HRP-conjugated goat anti-rabbit IgG (H+L) and goat anti-mouse IgG (L chain) were obtained from Thermo Scientific and Abbkine Scientific (Wuhan, China).

2.2. Plasmids Transfection and Luciferase Reporter Assays The cDNA encoding for viral proteins of PPRV strain Nigeria 75/1 was reverse transcribed from PPRV RNA using M-MLV (Invitrogen, Grand Island, NY, USA) and cloned into p3xFLAG-CMV-7.1 mammalian expression vector (Sigma–Aldrich). The cDNAs of JAK1, JAK2, TYK2, STAT1, STAT2, and IRF9 were obtained from inserts previously cloned in pcDNA3.1/myc-His(-) vector (Thermo Fisher Scientific). P mutants were constructed by site-directed mutagenesis PCR. The region of amino acids 1–375 of PPRV N protein was defined as the N-core domain, and the 376–525 region was defined as N-tail domain. N-core domain and N-tail domains of PPRV N gene were synthesized and cloned into p3xFLAG-CMV-7.1 vector using GenScript (Nanjing, China). Inserts of plasmid constructs were confirmed by DNA sequencing. The pISRE-Luc, pGAS-Luc, and pRL-TK control plasmids were purchased from Promega (Madison, WI, USA). Primers used for plasmids construction and their corresponding sequences are listed in Table1.

Table 1. The primers used for plasmids construction.

Gene Primers (5 3 ) 0 → 0 Forward: ATTTGCGGCCGCATGGCTTTCTGTGCTAAAATG JAK1 Reverse: CGCGATATCTTTTAAAAGTGCTTCAAATCCTTC Forward: ATTTGCGGCCGCATGGGGATGGCTTGCCTTACG JAK2 Reverse: GCGGATATCTCCAGCCATGTTATCCCTTACTTG Forward: ATTTGCGGCCGCATGTCTCAGTGGTACGAACTT STAT1 Reverse: GCGGATATCTACTGTGTTCATCATACTGTC Forward: ATTTGCGGCCGCATGGCGCAGTGGGAAATGCTGC STAT2 Reverse: GCGGATATCGAAGTCAGAAGGCATCAAGGGTCC Forward: ATTTGCGGCCGCATGCCTCTGCGCCACTGGGG TYK2 Reverse: GCGGATATCGCACACGCTGAACACTGAAGGGGC Forward: ATTTGCGGCCGCATGGCATCAGGCAGGGCACGCT IRF9 Reverse: GCGGATATCCACCAGGGACAGAATGGCTGCCTG Forward: TTGCGGCCGCGATGGCGACTCTCCTTAAAAGCT N Reverse: TTGTCGACTCAGCCGAGGAGATCCTTGTCGTT Forward: TTGCGGCCGCGATGGCAGAAGAACAAGCATACCAT P Reverse: GCGATATCTTACGGCTGCTTGGCAAGAATGGCTGTTA Forward: CTGAATTCAATGTCAACAAGGGACTGGAA C Reverse: GCCTCTAGACTAATTTTTCGACATCTGTTGACCT Forward: GCAAGCTTATGACCGAGATCTACGA M Reverse: TGGATCCTTACAGGATCTTGAACAGGCCTTGAT Forward: TTGCGGCCGCGATGTCCGCACAAAGGGAAAGGAT H Reverse: GCTGGTACCTCAGACTGGATTACATGTTACCTCTATACC Forward: TTGCGGCCGCGATGACACGGGTCGCAACCTTAGTATTT F Reverse: TGGATCCCTACAGTGATCTCACGTACGACT Forward: AACTCTCAAGTACAGCGTCACTATGTTTATAGCCACGGG P-Y110H Reverse: CCCGTGGCTATAAACATAGTGACGCTGTACTTGAGAGTT Viruses 2019, 11, 629 4 of 17

Table 1. Cont.

Gene Primers (5 3 ) 0 → 0 Forward: AACTCTCAAGTACAGCGTTTCTATGTTTATAGCCACGGG P-Y110F Reverse: CCCGTGGCTATAAACATAGAAACGCTGTACTTGAGAGTT Forward: TTGCGGCCGCGATGGCGACTCTCCTTAAAAGCT N-core Reverse: GCGGATATCCTACTTTCCTGCAGATCTTCTG Forward: ATTTGCGGCCGCGTCAGCTCTGTAATCGCGGC N-tail Reverse: TTGTCGACTCAGCCGAGGAGATCCTTGTCGTT

The HEK-293T cells were transfected with reporter plasmids along with indicated plasmids coding for viral proteins using Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. At 24 h post-transfection, cells were treated with IFN-β (1000 U/mL) (R&D Systems, Minneapolis, MN, USA) or IFN-γ (100 ng/mL) (PeproTech, Rocky Hill, NJ, USA) for 12 h. Next, the treated cells were lysed using passive cell lysis buffer (Promega) and luciferase activities were evaluated using a Dual-Luciferase® Reporter Assay System (Promega). The pRL-TK plasmids were co-transfected as controls.

2.3. Co-Immunoprecipitation Assays and Western Blotting Analysis Cells were washed with phosphate-buffered saline (PBS) and lysed using NP40 cell lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40) supplemented with a protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific) for 30 min at 4 ◦C. Supernatants of cell lysates were incubated with anti-Flag antibody (Sigma–Aldrich) at 4 ◦C overnight. Protein G-Sepharose beads (GE HealthCare, Chicago, IL, USA) were added and incubated for 1.5 h. Immunoprecipitates were subjected to Western blotting analysis. For Western blotting analysis, the protein samples were separated via 10% SDS-PAGE and transferred to nitrocellulose membranes (Merck Millipore, Burlington, MA, USA). Membranes were blocked by 5% skimmed milk for 1 h and followed by incubation with appropriate antibodies at 4 ◦C overnight. The membranes were exposed by chemiluminescence reagents (Thermo Fisher Scientific) as described previously [27].

2.4. Indirect Immunofluorescence Assays Cells were seeded into NuncTM glass bottom dishes and transfected with various plasmids using LipofectamineTM2000 according to the manufacturer’s instruction. At 24 h post-transfection, the cells were stimulated with IFN-β (2000 U/mL) or IFN-γ (200 ng/mL) for 30 min. The cells were fixed and permeabilized as previously described [28]. After blocking with 5% bovine serum, the cells were incubated with appropriate primary antibodies and fluorochrome-conjugated secondary antibodies, respectively. Nuclei were visualized after addition of ProLong® Gold Antifade Reagent containing 40,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific), and the cells were then observed using confocal microscopy (Leica Microsystems, Wetzlar, Germany). All images were captured and processed by Leica Application Suite X (Version 1.0. Leica Microsystems).

2.5. RNA Isolation and Quantitative Real-Time PCR (qPCR) Total RNA was extracted from cells using TRIzol Reagent (Thermo Fisher Scientific) following the manufacturer’s protocol. The cDNA was reverse transcribed using M-MLV (Thermo Fisher Scientific) and random hexamers, and TB Green Premix ExTaq Reagent (Takara, Dalian, China) were used for real-time quantitative PCR using a QuantStudio 5 Real-Time QPCR System (Applied Biosystems, Waltham, MA, USA) as described previously [29]. Transcript levels of the gene for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were determined to normalize total - CT RNA input. Relative gene expression was evaluated using the 2 44 method. All specific primers in this study were listed in Table2. Viruses 2019, 11, 629 5 of 17

Table 2. The qPCR primers used in present study.

Gene Primers (5 3 ) 0→ 0 Forward: CGGGAAGCTTGTGATCAATGG GAPDH Reverse: GGCAGTGATGGCATGGACTG Forward: GGTCTCTTCAGCATTTATTGGTG ISG54 Reverse: TGCCGTAGGCTGCTCTCCA Forward: TGGACAAATGCGACGAACC ISG15 Reverse: CCCGCTCACTTGCTGCTT Forward: TCTTCATGCTCCAGACGTAC MXA Reverse: CCAGCTGTAGGTGTCCTTG Forward: TGTCCAAGGTGGTAAAGGGTG OAS1 Reverse: CCGGCGATTTAACTGATCCTG Forward: GAGGAGGTGAAAGACCAGAGCA IRF1 Reverse: TAGCATCTCGGCTGGACTTCGA Forward: ATGGCAGTCTGGCGGCTGAATT STAT1 Reverse: CCAAACCAGGCTGGCACAATTG

2.6. Statistical Analysis All data are presented as mean SEM with an error bar that represents at least three independent ± experiments. Statistical analysis was performed using GraphPad Prism version 5.0 (GraphPad Software, San Diego, CA, USA). Differences in indicators between treatment groups and controls were assessed using the Student’s t-test. A two-tailed p-value < 0.05 was considered statistically significant and are marked as “*” in the legend. p < 0.01 and p < 0.001 values are marked as “**” and “***” to indicate corresponding results were highly significant.

3. Results

3.1. PPRV N and P Proteins Inhibit Both IFN-β- and IFN-γ-Induced IFN Response The PPRV infection resulted in acute immune suppression [30]. Toinvestigate whether PPRV infection inhibits IFN-β or IFN-γ responses, IFN-β- or IFN-γ-induced ISRE and GAS promoter activation status in PPRV-infected cells was evaluated. The IFN-β-induced ISRE promoter activation and IFN-γ-induced GAS promoter activation were both significantly inhibited by PPRV infection (Figure1A). To identify the viral proteins that were responsible for the PPRV-mediated antagonistic role against IFN-β- and IFN-γ-induced response, the plasmids expressing various viral proteins were co-transfected with ISRE or GAS reporter plasmids, and the cells were then mock-treated or treated with IFN-β and IFN-γ. The results showed that IFN-β incubation considerably activated ISRE promoter activation and IFN-γ treatment highly activated GAS promoter activation. However, PPRV N, P, and V proteins significantly impaired the activation of both ISRE promoter activation and GAS promoter activation (Figure1B). The expression of these viral proteins was confirmed by Western blot analysis (Figure1B). The antagonistic role of V protein has been reported previously. Therefore, we further focused our study on the antagonistic effect of N and P proteins. The dose-dependent assays demonstrated that both N and P proteins inhibited the ISRE and GAS promoter activation in a dose-dependent manner. However, C protein only slightly suppressed the ISRE promoter activation. The M protein failed to inhibit ISRE or GAS promoter activation (Figure1C,D). These results indicate that PPRV N and P proteins play an antagonistic role against both IFN-β- and IFN-γ-induced IFN response. Viruses 2019, 11, x FOR PEER REVIEW 5 of 17

Reverse: CCAGCTGTAGGTGTCCTTG Forward: TGTCCAAGGTGGTAAAGGGTG OAS1 Reverse: CCGGCGATTTAACTGATCCTG Forward: GAGGAGGTGAAAGACCAGAGCA IRF1 Reverse: TAGCATCTCGGCTGGACTTCGA Forward: ATGGCAGTCTGGCGGCTGAATT STAT1 Reverse: CCAAACCAGGCTGGCACAATTG

2.6. Statistical Analysis All data are presented as mean ± SEM with an error bar that represents at least three independent experiments. Statistical analysis was performed using GraphPad Prism version 5.0 (GraphPad Software, San Diego, CA, USA). Differences in indicators between treatment groups and controls were assessed using the Student’s t-test. A two-tailed p-value < 0.05 was considered statistically significant and are marked as “*” in the legend. p < 0.01 and p < 0.001 values are marked as “**” and “***” to indicate corresponding results were highly significant.

3. Results

3.1. PPRV N and P Proteins Inhibit Both IFN-β- and IFN-γ-Induced IFN Response The PPRV infection resulted in acute immune suppression [30]. To investigate whether PPRV infection inhibits IFN-β or IFN-γ responses, IFN-β- or IFN-γ-induced ISRE and GAS promoter activation status in PPRV-infected cells was evaluated. The IFN-β-induced ISRE promoter activation and IFN-γ-induced GAS promoter activation were both significantly inhibited by PPRV infection (Figure 1A). To identify the viral proteins that were responsible for the PPRV-mediated antagonistic role against IFN-β- and IFN-γ-induced response, the plasmids expressing various viral proteins were co-transfected with ISRE or GAS reporter plasmids, and the cells were then mock-treated or treated with IFN-β and IFN-γ. The results showed that IFN-β incubation considerably activated ISRE promoter activation and IFN-γ treatment highly activated GAS promoter activation. However, PPRV N, P, and V proteins significantly impaired the activation of both ISRE promoter activation and GAS promoter activation (Figure 1B). The expression of these viral proteins was confirmed by Western blot analysis (Figure 1B). The antagonistic role of V protein has been reported previously. Therefore, we further focused our study on the antagonistic effect of N and P proteins. The dose-dependent assays demonstrated that both N and P proteins inhibited the ISRE and GAS promoter activation in a dose-dependent manner. However, C protein only slightly suppressed the ISRE promoter activation. The M protein failed to inhibit ISRE or GAS promoter activation (Figure 1C and D). These Viruses 2019, 11, 629 6 of 17 results indicate that PPRV N and P proteins play an antagonistic role against both IFN-β- and IFN-γ- induced IFN response.

Viruses 2019, 11, x FOR PEER REVIEW 6 of 17

FigureFigure 1. PPRV 1. PPRV N and N Pand proteins P proteins suppressed suppressed IFN- IFN-β andβ and IFN- IFN-γγinduced induced response.response. ( (AA) )HEK-293T HEK-293T cells cells in 24 wellinculture 24 well platesculturewere plates transfected were transfected with ISREwith ISRE (100 (100 ng) orng) GAS or GAS (100 (100 ng) ng) reporter reporter plasmids plasmids along along with pRL-TKwith (10 pRL-TK ng) plasmid (10 ng) and plasmid mock-infected and mock-infected or infected or by infected PPRV (0.1 by MOI)PPRV at (0.1 6 h MOI) post-transfection at 6 h post- (hpt) for anothertransfection 48 h. (hpt) The infectedfor another cells 48 wereh. The then infected treated cells with were IFN- thenβ treated(1000 with U/mL) IFN- orβIFN- (1000γ U/mL)(100 ng or/mL). LuciferaseIFN-γ activity(100 ng/mL). was measuredLuciferase activity at 12 h was after measured IFN-β or at IFN- 12 hγ aftertreatment. IFN-β or The IFN- expressionγ treatment. of The viral P proteinexpression was detected of viral by P Westernprotein was blotting detected and by used Western as an blotting infection and indicator.used as an infection (B) HEK-293T indicator. cells (B) in 24 HEK-293T cells in 24 well culture plates were transfected with ISRE (100 ng) or GAS (100 ng) reporter well culture plates were transfected with ISRE (100 ng) or GAS (100 ng) reporter plasmids together plasmids together with pRL-TK (10 ng) plasmids and 200 ng of various PPRV viral protein expressing with pRL-TK (10 ng) plasmids and 200 ng of various PPRV viral protein expressing plasmids or vector plasmids or vector plasmids. At 24 h post-transfection, the cells were treated or mock treated with β plasmids.IFN-β At (1000 24 hU/mL) post-transfection, or IFN-γ (100 ng/mL). the cells Luciferase were treated activity or was mock determined treated with at 12 IFN-h after (1000IFN-β Uor/ mL) or IFN-IFN-γ (100γ treatment. ng/mL). The Luciferase expression activity of various was PPRV determined proteins in at the 12 transfected h after IFN- cellsβ wereor IFN- detectedγ treatment. by The expressionWestern blot of variousanalysis using PPRV anti-Flag proteins tag in antibody. the transfected (C and cellsD) HEK-293T were detected cells in by24 well Western culture blot plates analysis usingwere anti-Flag transfected tag antibody. with gradient (C and doseD) of HEK-293T plasmids cellscoding in for 24 wellN, P, cultureC or M plates(100, 200 were or 300 transfected ng) along with gradientwith dose ISRE of (100 plasmids ng) or codingGAS (100 for ng) N, reporter P, C or Mplas (100,mids 200 and or pRL-TK 300 ng) (10 along ng) withplasmids ISRE for (100 24 h. ng) Then or GAS (100 ng)the reportercells were plasmids treated with and IFN- pRL-TKβ (1000 (10 U/mL) ng) plasmids or IFN-γ for (100 24 ng/mL) h. Then for the 12 cells h and were subjected treated to with IFN-βluciferase(1000 U /mL)activity or IFN-determination.γ (100 ng /mL)The expression for 12 h and of subjectedthe viral pr tooteins luciferase was detected activity by determination. Western The expressionblotting. of the viral proteins was detected by Western blotting.

3.2. PPRV3.2. PPRV N and N Pand Proteins P Proteins Suppress Suppress IFN- IFN-β-β and- and IFN- IFN-γγ-Induced-Induced Expression Expression of of Antiviral Antiviral Genes Genes IFN inducesIFN induces expression expression of a crucialof a crucial series series of host of cellularhost cellular genes genes that performthat perform a variety a variety of functions of functions via their antiviral, immune-modulatory, and antitumor activities [9]. Some of these genes via their antiviral, immune-modulatory, and antitumor activities [9]. Some of these genes are commonly are commonly inducible by both IFN-β and IFN-γ, while others are only selectively induced by either inducible by both IFN-β and IFN-γ, while others are only selectively induced by either IFN-β or IFN-γ. IFN-β or IFN-γ. IFN-β initiates upregulation of a set of downstream ISGs, such as ISG54, ISG15, IFN-βOAS1,initiates and upregulationMxA, which play of key a set roles of downstreamin the antiviral ISGs,response. such To as determineISG54, ISG15 whether, OAS1, PPRV Nand andMxA , whichP play proteins key inhibited roles in the expressi antiviralon of response. ISGs induced To determineby IFN-β, mRNA whether levels PPRV of ISG54 N and, ISG15 P proteins, OAS1, inhibited and expressionMxA were of ISGs measured induced in the by IFN-IFN-β-treated, mRNA cells levels which of ISG54had been, ISG15 transfected, OAS1, withand emptyMxA werevector, measured N or in theP IFN- expressingβ-treated plasmids. cells which IFN-β had treatment been transfectedinduced high with expression empty of vector, these NISGs or Pin expressingthe empty vector plasmids. IFN-βplasmidstreatment transfected induced cells. high However, expression in ofthe these N or ISGs P expressing in the empty plasmid vector transfected plasmids cells, transfected the cells.expression However, inof thethese N ISGs or P expressingwere remarkably plasmid decreased transfected (Figure cells, 2A). the Similarly, expression IFN- ofγ theseinduced ISGs the were remarkablyexpression decreased of IFN- (Figureγ-regulated2A). genes Similarly, including IFN- IRF1γ induced and STAT1 the expression. IRF1 is thought of IFN- to γcoordinate-regulated the genes expression of multiple inflammatory genes and cytokines, and STAT1 is an important gene to regulate signal transduction [17]. Overexpression of N or P proteins significantly inhibited IFN-γ- induced upregulation of IRF1 and STAT1 (Figure 2B). These results suggest that PPRV N and P proteins inhibit the expression of antiviral related genes induced by both IFN-β and IFN-γ.

Viruses 2019, 11, 629 7 of 17 including IRF1 and STAT1. IRF1 is thought to coordinate the expression of multiple inflammatory genes and cytokines, and STAT1 is an important gene to regulate signal transduction [17]. Overexpression of N or P proteins significantly inhibited IFN-γ-induced upregulation of IRF1 and STAT1 (Figure2B). These results suggest that PPRV N and P proteins inhibit the expression of antiviral related genes inducedViruses by2019 both, 11, x IFN- FOR PEERβ and REVIEW IFN-γ . 7 of 17

FigureFigure 2. PPRV 2. PPRV N andN and P proteinsP proteins inhibited inhibited the the expression expression of of IFN-IFN-ββ or IFN- γ-induced-induced antiviral antiviral genes. genes. HEK-293THEK-293T cells cells grown grown in 6in well6 well culture culture plates plates were were transfected transfected withwith NN proteinprotein expressing plasmids plasmids (2 µg),(2 μ Pg), protein P protein expressing expressing plasmids plasmids (2 µg) (2 orμg) vector or vector plasmids plasmids (2 µg). (2 Theμg). cellsThe werecells were treated treated with IFN-withβ (1000IFN- U/mL)β (1000 (A )U/mL) or IFN- (Aγ) (100or IFN- ng/γmL) (100 ( Bng/mL)) for 12 (B h) atfor 24 12 h h post-transfection. at 24 h post-transfection. qPCR analysis qPCR analysis of various of antiviralvarious genes antiviral was performedgenes was toperformed determine to the determ relativeine mRNAthe relative expression mRNA levels. expression The expression levels. The of the viralexpression proteins of the was viral detected proteins by was Western detected blotting. by Western blotting.

3.3.3.3. PPRV PPRV N andN and P Proteins P Proteins Block Block STAT1 STAT1 Nuclear Nuclear Translocation Translocation STAT1STAT1 nuclear nuclear transportation transportation is is an an essential essential step step for for downstream downstream genegene activation during during IFNs IFNs signalingsignaling cascades, cascades, regardless regardless of of IFNIFN type.type. Be Becausecause PPRV PPRV N Nand and P prot P proteinseins block block both bothIFN-β IFN-- andβ - andIFN- IFN-γγ-induced-induced signaling, signaling, it itwould would be be interesting interesting to to determine determine if ifN N or or P P proteins proteins block block nuclear nuclear translocationtranslocation of STAT1of STAT1 via via subcellular subcellular localization localization of of STAT1 STAT1 withinwithin N-N- andand P-overexpressing cells cells stimulatedstimulated with with IFN- IFN-β orβ or IFN- IFN-γ.γ HeLa. HeLa cells cells were were transfected transfected withwith vectorvector plasmids, plasmids, N- N- or or P-expressing P-expressing plasmidsplasmids for for 24 h,24 andh, and then then mock-treated mock-treated or or treated treated with with IFN- IFN-ββ oror IFN-IFN-γ for 30 min. In In the the vector vector transfected cells, STAT1 mainly distributed into the cytoplasm (Figure 3A, B), and IFN-β or IFN-γ transfected cells, STAT1 mainly distributed into the cytoplasm (Figure3A,B), and IFN- β or IFN-γ treatment considerably induced STAT1 nuclear transportation. However, in the N- or P-expressing treatment considerably induced STAT1 nuclear transportation. However, in the N- or P-expressing cells, no matter IFN-β or IFN-γ treatment, a large amount of STAT1 remained distributed into the cells, no matter IFN-β or IFN-γ treatment, a large amount of STAT1 remained distributed into the cytoplasm (Figure 3A, B). A statistical evaluation was used to analyze the subcellular localization cytoplasm (Figure3A,B). A statistical evaluation was used to analyze the subcellular localization status status of STAT1 in the nucleus and cytoplasm, which confirmed the suppressive role of N and P of STAT1proteins in on the STAT1 nucleus nuclear and cytoplasm, transportation which (Figure confirmed 3C and the D). suppressiveThe expression role of of N Nand and P proteins P proteins was on STAT1also nuclear detected transportation by Western blotting (Figure (Figure3C,D). The3C an expressiond D). These of Nresults and Pindicate proteins that was PPRV also N detected and P by Westernproteins significantly blotting (Figure blocked3C,D). the Thesenuclear results transportation indicate of that STAT PPRV1 stimulated N and P by proteins IFN-β significantlyor IFN-γ. blocked the nuclear transportation of STAT1 stimulated by IFN-β or IFN-γ.

Viruses 2019, 11, 629 8 of 17 Viruses 2019, 11, x FOR PEER REVIEW 8 of 17

FigureFigure 3. PPRV3. PPRV N N and and P proteinsP proteins inhibited inhibited STAT1 STAT1 nuclear nuclear translocation.translocation. ( (AA andand BB) )HeLa HeLa cells cells (5 (5 × × 104)10 were4) were grown grown in in the theglass glass bottom dish. dish. When When the the cells cells reached reached about about 30% confluency, 30% confluency, the cells the were cells weretransfected transfected with with N protein N protein expressing expressing plasmids plasmids (2 μg), (2 Pµ proteing), P protein expressing expressing plasmids plasmids (2 μg) or (2 vectorµg) or vectorplasmids plasmids (2 μg), (2 followedµg), followed by IFN- byβ IFN-(2000β U/mL)(2000 or U /IFN-mL)γ or (200 IFN- ng/mL)γ (200 treatment ng/mL) treatmentfor 30 min.for The 30 cells min. Thewere cells werefixed, fixed, permeabilized, permeabilized, and andincubated incubated with with mouse mouse anti-STAT1 anti-STAT1 antibody antibody and and rabbit rabbit anti-Flag anti-Flag antibodyantibody and and appropriate appropriate secondary secondary antibodies. antibodies. TheThe subcellularsubcellular localization localization of of STAT1 STAT1 in in N N protein protein overexpressingoverexpressing cells cells (A ()A or) or P proteinP protein overexpressing overexpressing cells cells ((BB)) waswas observedobserved (Red). (Red). Confocal Confocal images images werewere obtained obtained using using laser laser confocal confocal microscopy microscopy under under a a 6060× objective. ( (CC) )Statistical Statistical analysis analysis ofof STAT1 STAT1 nuclear translocation in the N and P protein expressing cells.× One hundred cells were counted in the nuclear translocation in the N and P protein expressing cells. One hundred cells were counted in the randomly selected visual fields three times, and the STAT1 nuclear localization ratio was determined. randomly selected visual fields three times, and the STAT1 nuclear localization ratio was determined. The expression of N and P was further detected by Western blotting. The expression of N and P was further detected by Western blotting.

3.4.3.4. PPRV PPRV N ProteinN Protein Did Did Not Not Block Block Phosphorylation Phosphorylation andand DimerizationDimerization of STATs SinceSince PPRV PPRV N andN and P proteins P proteins inhibited inhibited STAT1 STAT1 nuclear nuclear transport, transport, we nextwe next investigated investigated JAK-STAT JAK- pathwaySTAT pathway cascades cascades that might that might be targeted be targeted by Nby proteinN protein (the (the most most abundantabundant protein protein of of PRRV). PRRV). To determine which step was affected by N protein, we examined whether the N protein interacted To determine which step was affected by N protein, we examined whether the N protein interacted or or degraded one or several important signal molecules of the JAK-STAT pathway. The HEK-293T degraded one or several important signal molecules of the JAK-STAT pathway. The HEK-293T cells cells were co-transfected with Flag-tagged N protein expressing plasmids or vector plasmids along were co-transfected with Flag-tagged N protein expressing plasmids or vector plasmids along with with a series of plasmids expressing Myc-tagged JAK1, JAK2, TYK2, STAT1, STAT2, or IRF9. Cell a series of plasmids expressing Myc-tagged JAK1, JAK2, TYK2, STAT1, STAT2, or IRF9. Cell lysates lysates were immunoprecipitated using anti-Flag antibody and then subjected to Western blotting wereanalysis. immunoprecipitated As shown in Figure using 4A, anti-Flag no N protein antibody interaction and then with subjected any of tothe Western adaptor blotting molecules analysis. was Asobserved shown in and Figure N protein4A, no expression N protein did interaction not inhibit with expression any of levels the adaptor of these molecules adaptors. Next, was observedbecause andSTAT1 N protein phosphorylation expression didtriggered not inhibit by IFN- expressionβ or IFN- levelsγ normally of these leads adaptors. to STATs Next, dimerization, because STAT1 an phosphorylationessential step triggeredfor STAT1 by IFN-nuclearβ or transport, IFN-γ normally we investigated leads to STATs whether dimerization, N protein an affected essential the step for STAT1 nuclear transport, we investigated whether N protein affected the phosphorylation STAT1

Viruses 2019, 11, 629 9 of 17

Viruses 2019, 11, x FOR PEER REVIEW 9 of 17 and STAT2 or STATs dimerization induced by IFN-β or IFN-γ. The HEK-293T cells were transfected withphosphorylation increasing amounts STAT1 of and N STAT2 protein-expressing or STATs dimerization plasmids andinduced then by treated IFN-β withor IFN- IFN-γ. Theβ or HEK- IFN-γ. As shown293T cells in Figurewere 4transfectedB, the phosphorylation with increasing of STAT1amounts or STAT2of N protein-expressing stimulated by IFN- plasmidsβ was notand a ffthenected by expressiontreated with of IFN- N protein.β or IFN- Theγ. phosphorylationAs shown in Figure of STAT1 4B, the stimulated phosphorylation by IFN- ofγ wasSTAT1 not or aff ectedSTAT2 by expressionstimulated of Nby proteinIFN-β was as well not (Figureaffected4 C).by expression Meanwhile, of evaluationN protein. ofThe STAT’s phosphorylation dimerization of showedSTAT1 thatstimulated overexpression by IFN- ofγ N was protein not affected also had by no expression effect on STAT’s of N pr dimerizationotein as well induced (Figure by4C). IFN- Meanwhile,β or IFN- γ (Figureevaluation4D and of E). STAT’s It suggests dimerization that N protein showed has that no influenceoverexpression on the of phosphorylation N protein also had and no dimerization effect on STAT’s dimerization induced by IFN-β or IFN-γ (Figure 4D and E). It suggests that N protein has no of STATs. influence on the phosphorylation and dimerization of STATs.

FigureFigure 4. N 4. protein N protein did notdid interactnot interact with moleculeswith molecules of the JAK-STATof the JAK-STAT pathway pathway or inhibit or STAT’s inhibit activation. STAT’s (A)activation. HEK-293T (A cells) HEK-293T were transfected cells were with transfected Flag-N expressingwith Flag-N plasmids expressing and plasmids Myc-tagged and Myc-tagged JAK1, JAK2, TYK2,JAK1, STAT1, JAK2, STAT2, TYK2, and STAT1, IRF9 expressing STAT2, and plasmids. IRF9 expressing The cells were plasmids. lysed and The immunoprecipitated cells were lysed and with anti-Flagimmunoprecipitated antibody. Immunoprecipitation with anti-Flag antibody. (IP) and Immunoprecipitation whole-cell lysates were (IP) analyzedand whole-cell by immunoblotting lysates were (IB)analyzed using anti-Myc, by immunoblotting anti-Flag, and (IB) anti- usingβ-actin anti-Myc, antibodies. anti-Flag, (B and andC anti-) HEK-293Tβ-actin antibodies. cells were ( transfectedB and C) withHEK-293T increasing cells amounts were transfected of N protein with expressing increasing plasmidsamounts of (1, N 2 protein or 3 µg). expressing The cells plasmids were treated (1, 2 or with 3 IFN-μg).β (1000 The cells U/mL) were (B )treated or IFN- withγ (100 IFN- ngβ/mL) (1000 (C )U/mL) at 24 h(B post-transfection) or IFN-γ (100 ng/mL) for 30 min.(C) at The 24 h cell post- lysis wastransfection subjected tofor Western 30 min. The blotting cell lysis analysis was subjected using anti-Flag, to Western anti-p–STAT1, blotting analysis anti-p–STAT2, using anti-Flag, anti-STAT1, anti- anti-STAT2,p–STAT1, and anti-p–STAT2, anti-β-Actin anti-S antibodies,TAT1, anti-STAT2, respectively. and (D anti-andβE-Actin) HEK-293T antibodies, cells wererespectively. transfected (D and with 2 µgE) of HEK-293T N protein cells expressing were transfected plasmids with for 242 μ h.g Theof N cellsprotein were expressing then treated plasmids with IFN-for 24β h.(1000 The Ucells/mL) (D)were or IFN- thenγ (100treated ng /withmL) IFN- (E) forβ (1000 30 min. U/mL) Cells (D were) or IFN- lysedγ (100 and ng/mL) subjected (E) tofor Native-PAGE 30 min. Cells analysiswere lysed and wereand detected subjected using to anti-pSTAT1 Native-PAGE antibody, analysis the and expression were detected of N and usingβ-actin anti-pSTAT1 was subjected antibody, to SDS-PAGE the andexpression detected usingof N and appropriate β-actin was antibodies. subjected to SDS-PAGE and detected using appropriate antibodies.

3.5.3.5. Core Core and and Tail Tail Domains Domains of of N N Protein Protein Play Play Di Differentfferent Suppressive Suppressive RolesRoles onon IFN-β- and IFN- IFN-γγ-Triggered-Triggered CellularCellular IFN IFN Responses Responses ParamyxovirusParamyxovirus N proteinsN proteins each each possess possess an an N-terminal N-terminal highly highly conserved conserved helical-core helical-core domain domain and a C-terminaland a C-terminal disordered disordered tail domain tail [domain31–33]. To[31–33]. determine To determine which N proteinwhich N domain protein was domain responsible was forresponsible inhibition of for IFN- inhibitionβ- and IFN-of IFN-γ-inducedβ- and responsesIFN-γ-induced observed responses in this observed study, two in truncated this study, mutants two expressingtruncated the mutants core domain expressing and tailthe domaincore domain of N proteinand tail were domain constructed, of N protein respectively were constructed, (Figure5A). Expressionrespectively of each (Figure truncation 5A). Expression was confirmed of each by tr Westernuncation blot was analysis confirmed (Figure by Western5B). The blot e ffects analysis of core

Viruses 2019, 11, 629 10 of 17

domainViruses (N-core)2019, 11, x FOR and PEER tail REVIEW domain (N-tail) on IFN responses were separately evaluated. As10 of shown 17 in Figure5C, the N-core domain inhibited IFN- β-induced ISRE promoter activation, while the N-tail(Figure domain 5B). didThe not.effects By of contrast,core domain the (N-core) N-tail domain and tail exerted domain a(N-tail) crucial on suppressive IFN responses effect were upon IFN-separatelyγ-induced evaluated. GAS promoter As shown activation, in Figure while 5C, the the N-core N-core domain domain inhibited exhibited IFN- noβ-induced inhibitory ISRE eff ect promoter activation, while the N-tail domain did not. By contrast, the N-tail domain exerted a crucial (Figure5D). The suppressive roles of both mutants were further investigated by evaluating their e ffects suppressive effect upon IFN-γ-induced GAS promoter activation, while the N-core domain exhibited on expression levels of various host antiviral genes normally induced by IFN-β or IFN-γ. As observed no inhibitory effect (Figure 5D). The suppressive roles of both mutants were further investigated by in the aforementioned reporter assay, IFN-β-induced expression of ISG54 and ISG15 was significantly evaluating their effects on expression levels of various host antiviral genes normally induced by IFN- inhibitedβ or IFN- byγ the. As N-coreobserved domain, in the aforementioned but not by the reporter N-tail domainassay, IFN- (Figureβ-induced5E), whileexpression IFN- ofγ -inducedISG54 expressionand ISG15 of wasIRF1 significantlyand STAT1 inhibitedwas inhibited by the N-core by the domain, N-tail domain, but not by but the not N-tail by the domain N-core (Figure domain (Figure5E), 5whileF). The IFN- e γff-inducedect of N-core expression and N-tail of IRF1 on and nuclear STAT1 transport was inhibited of STAT1 by the wasN-tail also domain, investigated but not by IFAby assay the N-core (Figure domain5G), which (Figure showed 5F). The that effect N-core of N-core suppressed and N-tail the on nuclear nuclear importtransport of of STAT1 STAT1 induced was by IFN-also investigatedβ but not IFN- by IFAγ. However, assay (Figure N-tail 5G), only which suppressed showed that IFN- N-coreγ-induced suppressed nuclear the nuclear import import of STAT1. A statisticalof STAT1 evaluationinduced by was IFN- usedβ butto not analyze IFN-γ. theHowever, subcellular N-tail localization only suppressed status IFN- of STAT1γ-induced in the nuclear nucleus andimport cytoplasm of STAT1. which A confirmed statistical theevaluation different was eff ectused of N-coreto analyze and the N-tail subcellular (Figure 5localizationH and I). These status results of suggestSTAT1 that in the PPRV nucleus N protein and cytoplasm core and which tail domains confirmed play the di differentfferent antagonisticeffect of N-core roles and and N-tail each (Figure operate in an5H IFN and type-specific I). These results manner. suggest that PPRV N protein core and tail domains play different antagonistic roles and each operate in an IFN type-specific manner.

FigureFigure 5. N-core5. N-core domain domain and and N-tail N-tail domaindomain of PPRV N N pr proteinotein show show different different antagonistic antagonistic roles roles in in IFNIFN response response inhibition. inhibition. ( A(A)) SchematicsSchematics of of N, N, N-core, N-core, and and N-tail. N-tail. (B) The (B) Theexpression expression of N-core of N-core and N- and N-tailtail domaindomain in HEK-293T HEK-293T cells cells were were analyzed analyzed by byimmunoblotting. immunoblotting. (C and (C Dand) HEK-293TD) HEK-293T cells were cells co- were co-transfectedtransfected with ISRE ( (CC)) or or GAS GAS (D (D) )reporter reporter plasmids plasmids together together wi withth pRL-TK pRL-TK plasmids, plasmids, and and empty empty vector,vector, N, N-coreN, N-core or or N-tail N-tail expressing expressing plasmids. plasmids. The IFN treatment treatment and and lucife luciferaserase activity activity detection detection werewere performed performed at at 24 24 h post-transfectionh post-transfection asas describeddescribed in in Figure Figure 1B.1B. (E ( Eandand F)F HEK-293T) HEK-293T cells cells were were transfectedtransfected with with empty empty vector, vector, N, N, N-core N-core oror N-tailN-tail expressing plasmids plasmids for for 24 24 h. h.The The cells cells were were then then treatedtreated with with IFN- IFN-β (E)β (E) or or IFN- IFN-γγ(F) (F) for for 1212 h.h. The relative mRNA mRNA expression expression levels levels of ISG54 of ISG54, ISG15, ISG15, , 4 IRF1IRF1, and, andSTAT1 STAT1were were determined determined respectively. respectively. (G) HeLa cells (5 × 10 ) were grown in the glass bottom dish. The monolayer cells were transfected with N (2 μg), N-core (2 μg), N-tail domain expressing plasmids (2 μg) or vector plasmids (2 μg), followed by IFN-β (2000 U/mL) or IFN-γ (200 ng/mL) treatment for 30 min. The cells were fixed and permeabilized and incubated with mouse anti-

Viruses 2019, 11, 629 11 of 17

(G) HeLa cells (5 104) were grown in the glass bottom dish. The monolayer cells were transfected × with N (2 µg), N-core (2 µg), N-tail domain expressing plasmids (2 µg) or vector plasmids (2 µg), followed by IFN-β (2000 U/mL) or IFN-γ (200 ng/mL) treatment for 30 min. The cells were fixed and permeabilized and incubated with mouse anti-STAT1 antibody and rabbit anti-Flag antibody and appropriate secondary antibodies. The subcellular localization of STAT1 was detected (Red). ConfocalViruses 2019, images 11, x FOR were PEER obtainedREVIEW using laser confocal microscopy under a 60 objective. (H11and of 17I) × Statistical analysis of STAT1 nuclear translocation in the N-core and N-tail proteins expressing cells. One-hundredSTAT1 antibody cells were and rabbit counted anti-Flag in the antibody randomly and selected appropriate visual secondary fields for antibodies. three times, The subcellular and the STAT1 nuclearlocalization localization of STAT1 ratio waswas determined.detected (Red). Confocal images were obtained using laser confocal microscopy under a 60× objective. (H and I) Statistical analysis of STAT1 nuclear translocation in the 3.6. PPRVN-core P Protein and N-tail Interacts proteins with expressing STAT1 cells. and BlocksOne-hundred STAT1 cells phosphorylation were counted in the randomly selected visual fields for three times, and the STAT1 nuclear localization ratio was determined. Besides N protein, we also investigated whether the PPRV P protein targeted adaptor molecules of the3.6. JAK-STAT PPRV P Protein pathway. Interacts As demonstratedwith STAT1 and inBlocks Figure STAT16A, phosphorylation only STAT1 co-precipitated with P protein, while P protein showed no inhibitory effect on the expression of these adaptor molecules. Moreover, Besides N protein, we also investigated whether the PPRV P protein targeted adaptor molecules a clear cytoplastic co-localization pattern between P protein and endogenous STAT1 was observed as of the JAK-STAT pathway. As demonstrated in Figure 6A, only STAT1 co-precipitated with P protein, well,while with mostP protein endogenous showed no STAT1 inhibitory localizing effect on to the expression cytoplasm of (Figure these adaptor6B). The molecules. overlapping Moreover, coe ffi cient 2 (r) anda clear Pearson’s cytoplastic correlation co-localization (R ) valuespattern werebetween further P protein determined, and endogenous which STAT1 showed was the observed significant colocalizationas well, with of STAT1most endogenous and P protein STAT1 (Figure localizing6B). The to etheff ectcytoplasm of P protein (Figure on 6B). STAT’s The phosphorylationoverlapping was subsequentlycoefficient (r) and evaluated. Pearson’s Thecorrelation phosphorylation (R2) values were of STAT1 further induced determined, by eitherwhich IFN-showedβ or the IFN- γ was significantlysignificant colocalization blocked by of the STAT1 presence and P of protein P protein (Figure in a6B). dose-dependent The effect of P mannerprotein on (Figure STAT’s6C,D). The relativephosphorylation fold change was ofsubsequently p–STAT1 was evaluated. also determined The phosphorylation by densitometric of STAT1 analysis induced after by either normalized IFN- to β-actinβ or which IFN-γconfirmed was significantly this inhibitive blocked by eff theect presence by P protein of P protein (Figure in6 aC,D). dose-dependent However, phosphorylationmanner (Figure of 6C and D). The relative fold change of p–STAT1 was also determined by densitometric analysis after STAT2 induced by IFN-β was not affected by P protein (Figure6C). The STAT1 phosphorylation induced normalized to β-actin which confirmed this inhibitive effect by P protein (Figure 6C and D). However, by IFN-β or IFN-γ was also detected in the PPRV-infected cells. Similarly, the phosphorylation of STAT1 phosphorylation of STAT2 induced by IFN-β was not affected by P protein (Figure 6C). The STAT1 β γ was dramaticallyphosphorylation impaired induced byby PPRVIFN-β or infection, IFN-γ was no also matter detected treated in the with PPRV-infected IFN- or IFN- cells. Similarly,(Figure6 E,F). The expressionthe phosphorylation of ISGs of in STAT1 the goat was fibroblastsdramatically that impaired was infectedby PPRV infection, by PPRV no and matter treated treated with with IFN- β or IFN-IFN-γβwas or IFN- furtherγ (Figure detected. 6E and The F). The results expression showed of ISGs that PPRVin the goat infection fibroblasts dramatically that was infected decreased by the downstreamPPRV and antiviral treated with genes IFN- regulatedβ or IFN- byγ was STAT1 further (Figure detected.6G and TheH). results Collectively, showed that these PPRV results infection indicate that Pdramatically protein interacts decreased with the STAT1 downstream and inhibits antivira IFN-l genesβ- and regulated IFN-γ -inducedby STAT1 STAT1(Figure phosphorylation 6G and H). and resultedCollectively, in decreased these results expression indicate that of ISGs.P protein interacts with STAT1 and inhibits IFN-β- and IFN- γ-induced STAT1 phosphorylation and resulted in decreased expression of ISGs.

FigureFigure 6. PPRV 6. PPRV P protein P protein binds binds to to STAT1 STAT1 and and inhibitsinhibits STAT1 STAT1 phosphorylation. phosphorylation. (A) (HEK-293TA) HEK-293T cells cells werewere transfected transfected with with Flag-P Flag-P expressing expressing plasmids plasmids and and Myc-tagged Myc-tagged JAK1, JAK1, JAK2, JAK2, TYK2, TYK2, STAT1, STAT1, STAT2, and IRF9STAT2, expressing and IRF9 expressing plasmids. plasmids. The cells The were cells lysedwere lysed and and subjected subjected to to immunoprecipitation immunoprecipitation and immunoblottingand immunoblotting analysis analysis similar simila as describedr as described in Figure in Figure4A. 4A. (B) HeLa cells were transfected with P protein expressing plasmids for 24 h, the colocalization of P (Green) and STAT1 (Red) was determined by IFA, the nucleus was stained with DAPI (Blue). The overlapping coefficient (r) and Pearson’s correlation (R2) values were further determined in the merged image. The intensity profile of the linear region of interest (ROI) across a HeLa cell co-stained with P and STAT1 is presented below the merged image. (C and D) HEK-293T cells were transfected with increasing amounts of P protein expressing plasmids (1, 2 or 3 μg). The cells were treated with IFN-β (1000 U/mL) (C) or IFN- γ (100 ng/mL) (D) at 24 h post-transfection for 30 min. The relative fold change of p–STAT1 was

Viruses 2019, 11, 629 12 of 17

(B) HeLa cells were transfected with P protein expressing plasmids for 24 h, the colocalization of P (Green) and STAT1 (Red) was determined by IFA, the nucleus was stained with DAPI (Blue). The overlapping coefficient (r) and Pearson’s correlation (R2) values were further determined in the merged image. The intensity profile of the linear region of interest (ROI) across a HeLa cell co-stained with P and STAT1 is presented below the merged image. (C and D) HEK-293T cells were transfected with increasing amounts of P protein expressing plasmids (1, 2 or 3 µg). The cells were treated with IFN-β (1000 U/mL) (C) or IFN-γ (100 ng/mL) (D) at 24 h post-transfection for 30 min. The relative fold change of p–STAT1 was determined by densitometric analysis after being normalized to β-actin. The cell lysis was subjected to Western blot analysis using anti-Flag, anti-p–STAT1, anti-p–STAT2, anti-STAT1, anti-STAT2, and anti-β-Actin antibodies, respectively. (E and F) HEK-293T cells were infected with PPRV for 48 h and then treated with IFN-β (1000 U/mL) (E) or IFN-γ (100 ng/mL) (F) for 30 min. The cells were then lysed and subjected to immunoblotting analysis using the indicated antibodies against pSTAT1, STAT1, P, and β-Actin. (G and H) Goat fibroblasts were infected with PPRV for 36 h and then the cells were treated with IFN-β (1000 U/mL) (G) or IFN-γ (100 ng/mL) (H) for 12 h. The qPCR analysis of various antiviral genes was performed to determine the relative mRNA expression levels. 3.7. Tyrosine 110 of P Protein is Critical for Blocking IFN-β- and IFN-γ-Induced STAT1 Activation P and V proteins of paramyxoviruses share similar N-terminal domains. However, it has been found that these proteins may act via different antagonistic mechanisms to counter host antiviral responses, such as the V protein of rinderpest virus (RPV) could effectively block the IFN-induced phosphorylation of STAT1; however, P protein was relatively inefficient [22,34]. Measles virus (MV) P but not V protein could inhibit STAT1 phosphorylation [35,36]. We determined that PPRV P protein significantly blocked both IFN-β- and IFN-γ-induced phosphorylation of STAT1. A previous study had indicated that tyrosine 110 (Y110) of the PPRV V protein, the key amino acid involved in the interaction between V and STAT1, was involved in inhibiting IFN signaling [24]. We also investigated whether the Y110 of PPRV P protein was involved in the P protein-mediated antagonistic effect involving STAT1 observed here. To avoid a P protein conformational change-mediated explanation for loss of function resulting from amino acid substitution, Y110 was substituted with either a basic amino acid residue (histidine, H) or an aromatic amino acid residue (phenylalanine, F). To investigate whether the mutation of Y110 affects the interaction of P protein with STAT1, Myc-STAT1 expressing plasmids were co-transfected with wild-type P protein (WT), the mutants of P protein Y110H or Y110F expressing plasmids or empty vector in HEK-293T cells. The co-immunoprecipitation assay was then performed. As shown in Figure7A, introduction of Y110H or Y110F into the P protein abrogated its interaction with STAT1, suggesting that Y110 is a key residue involved in the P protein interaction with STAT1. The V protein shares the N-terminus to the P protein. It suggested both the N terminus of V and P proteins showed significant antagonistic roles, and the involved antagonistic mechanism by the N terminus might be similar. The effect of P mutants Y110H and Y110F on IFN-β- or IFN-γ-induced IFN response was further investigated. The plasmids expressing mutants Y110H, Y110F or WT P proteins were co-transfected with reporter plasmids and subjected to IFN-β or IFN-γ treatment. The luciferase activity was then measured and compared. The ISRE promoter activation level induced by IFN-β and the GAS promoter activation level induced by IFN-γ were clearly higher in the Y110H or Y110F mutant expressing cells than that in the WT P protein expressing cells (Figure7B and C). However, the mutation of Y110 did not fully recover the total (100%) activity. The ISRE promoter activation level induced by IFN-β in the Y110H or Y110F mutant expressing cells did not reach the control levels. Maybe other sites were also involved in this suppressive effect. The expression of antiviral-related genes stimulated by IFN-β or IFN-γ were further evaluated and analyzed. The IFN-β-induced expression of ISG54 and ISG15 and the IFN-γ-induced expression of IRF1 and STAT1 were remarkably increased in the Y110H or Y110F mutant expressing cells than in the WT P protein expressing cells (Figure7D and Viruses 2019, 11, 629 13 of 17

E). These results indicate that P protein Y110 plays an important role in inhibiting the IFN-β- and IFN-Virusesγ-induced 2019, 11, x IFN FOR response.PEER REVIEW 13 of 17

Figure 7. Tyrosine 110 of the P protein is a key site for P–STAT1 interaction and inhibition of IFN response.Figure 7. ( ATyrosine) HEK-293T 110 of cells the wereP protein co-transfected is a key site with for Myc-taggedP–STAT1 interaction STAT1 expression and inhibition plasmids of IFN and emptyresponse. vector, (A) P HEK-293T protein, Y110H cells were mutant co-transfected or Y110F mutant.with Myc-tagged Immunoprecipitation STAT1 expression (IP) plasmids and whole-cell and lysatesempty were vector, analyzed P protein, by immunoblottingY110H mutant or (IB) Y110F using mutant. anti-Myc, Immunoprecipitation anti-Flag, and anti- (IP)β and-actin whole-cell antibodies. lysates were analyzed by immunoblotting (IB) using anti-Myc, anti-Flag, and anti-β-actin antibodies. (B and C) HEK-293T cells were transfected ISRE (B) or GAS (C) reporter plasmids along with pRL-TK (B and C) HEK-293T cells were transfected ISRE (B) or GAS (C) reporter plasmids along with pRL- plasmids, and P protein expressing plasmids, Y110H or Y110F. The cells were treated with IFN-β TK plasmids, and P protein expressing plasmids, Y110H or Y110F. The cells were treated with IFN-β (1000 U/mL) or IFN-γ (100 ng/mL) for 12 h at 24 h post-transfection, and the luciferase activity was (1000 U/mL) or IFN-γ (100 ng/mL) for 12 h at 24 h post-transfection, and the luciferase activity was determined. (D and E) HEK-293T cells were transfected with empty vector or P protein expressing determined. (D and E) HEK-293T cells were transfected with empty vector or P protein expressing plasmids, Y110H or Y110F, and the cells were treated with IFN-β (1000 U/mL) (D) or IFN-γ (100 ng/mL) plasmids, Y110H or Y110F, and the cells were treated with IFN-β (1000 U/mL) (D) or IFN-γ (100 (E) for 12 h at 24 h post-transfection. The relative mRNA expression levels of ISG54, ISG15, IRF1, ng/mL) (E) for 12 h at 24 h post-transfection. The relative mRNA expression levels of ISG54, ISG15, and STAT1 were measured by qPCR analysis. IRF1, and STAT1 were measured by qPCR analysis. 4. Discussion 4. Discussion The IFNs elicit host antiviral actions by activating the JAK-STAT pathway and inducing The IFNs elicit host antiviral actions by activating the JAK-STAT pathway and inducing transcription of hundreds of antiviral genes [37]. To evade IFN-mediated antiviral effects, many transcription of hundreds of antiviral genes [37]. To evade IFN-mediated antiviral effects, many viruses have evolved various strategies to impair activation of the JAK-STAT pathway through its viruses have evolved various strategies to impair activation of the JAK-STAT pathway through its viralviral protein. protein. The The V V protein protein ofof PPRVPPRV inhibitsinhibits the IFN IFN response response through through interaction interaction with with STAT1/2 STAT1 and/2 and blockingblocking STAT1 STAT1/2/2 nuclear nuclear translocation translocation [[24].24]. Recently, Recently, it it has has been been demonstrated demonstrated that that the the V and V and C C proteinsproteins of of PPRV PPRV inhibited inhibited the the induction induction ofof IFN-IFN-β [38],[38], indicating indicating that that PPRV PPRV may may suppress suppress the the host host antiviralantiviral response response through through didifferentfferent mechanismsmechanisms medi mediatedated by by different different viral viral proteins. proteins. In Inthis this study, study, wewe identified identified that that PPRV PPRV N N and and P P proteins proteins performedperformed significant significant antagonistic antagonistic effect effect against against host host IFN IFN response,response, and and they they have have been been shown shown to to counteract counteract the the cellular cellular IFN IFN response response by by targeting targeting the the JAK-STAT JAK- signalingSTAT signaling pathway. pathway. TheThe N N proteins proteins of of enveloped enveloped RNARNA virusesviruses play an an important important role role in in the the formation formation and and protection protection ofof viral viral ribonucleoprotein ribonucleoprotein (RNP) (RNP) complexes.complexes. In addi additiontion to to their their functions functions as as structural structural components, components, NN proteins proteins also also counteract counteract host host antiviral antiviral responsesresponses and promote promote viral viral replication. replication. InIn coronaviruses coronaviruses andand arenaviruses, arenaviruses, N N protein protein hashas beenbeen identifiedidentified as as an an antagonistic antagonistic factor factor to to inhibit inhibit IFN IFN production. production. ForFor instance, instance, porcine porcine epidemic epidemic diarrheadiarrhea virusvirus N protein inhibits inhibits IFN IFN production production by by interacting interacting with with TANKTANK binding binding kinase kinase 1 1 (TBK1) (TBK1) and and disruptingdisrupting the association association of of interferon interferon regulation regulation factor factor 3 (IRF3) 3 (IRF3) withwith TBK1 TBK1 [39 [39].]. Mouse Mouse hepatitis hepatitis virusvirus (MHV)(MHV) and severe severe acute acute respiratory respiratory syndrome syndrome coronavirus coronavirus (SARS-CoV)(SARS-CoV) N N protein protein interacts interacts with with the the protein protein activator activator of of protein protein kinase kinase R R (PACT) (PACT) and and disrupts disrupts the the interaction between PACT and retinoic acid-induced gene I (RIG-I)/melanoma differentiation interaction between PACT and retinoic acid-induced gene I (RIG-I)/melanoma differentiation gene 5 gene 5 (MDA5), which suppresses the production of IFN [40]. The SARS-CoV N protein also directly (MDA5), which suppresses the production of IFN [40]. The SARS-CoV N protein also directly interacts interacts with tripartite motif protein 25 (TRIM25) and sequesters the interwork between TRIM25 and with tripartite motif protein 25 (TRIM25) and sequesters the interwork between TRIM25 and RIG-I, RIG-I, and further disturbs the RIG-I ubiquitination mediated by TRIM25 [41]. Arenavirus N protein also interacts with PACT and inhibits PACT-enhanced RIG-I-induced IFN production similar to

Viruses 2019, 11, 629 14 of 17 and further disturbs the RIG-I ubiquitination mediated by TRIM25 [41]. Arenavirus N protein also interacts with PACT and inhibits PACT-enhanced RIG-I-induced IFN production similar to MHV and SARS-CoV. However, the involved mechanism is different from the antagonistic manner of MHV and SARS-CoV N proteins. Arenavirus N protein performs the suppressive role through its RNase activity [42]. In paramyxoviruses, MV N protein blocks the STAT1/2 nuclear translocation induced by IFNs. The MV N protein blocks the nuclear transportation of STAT without preventing STAT and JAK activation. However, MV N protein acts as an IFN-α/β and γ-antagonist as strong as P protein [25]. NiV and HeV N proteins interfere with the formation of IFN-induced STAT complexes to inhibit the host antiviral response. The NiV and HeV N proteins inhibit the IFN response by interfering with the STAT complex formation in their core domains. The NiV N protein inhibits the nuclear transportation of both STAT1 and STAT2, which is not associated with the nuclear transport system for STATs [26]. In this study, we found that PPRV N protein also impaired the host IFN response by blocking JAK-STAT pathway signaling. No interaction was observed between PPRV N protein and components of the JAK-STAT pathway, and N protein exhibited no inhibitive effect on IFN-β- or IFN-γ-induced phosphorylation of STATs. The PPRV N protein considerably reduced STAT1 nuclear accumulation which was similar than the effect caused by MV and NiV N proteins [25,26]. However, PPRV N protein did not affect STAT’s complex formation. Further studies should be performed to investigate the different mechanisms used by N proteins of various paramyxoviruses. The N-terminal domain of N protein has previously been identified as the core domain required for RNA binding and nucleocapsid helical core formation [31,32,43]. The C-terminal tail in N protein possesses the features of intrinsically disordered proteins [33]. It is identified that the 1–375 amino acid region of MV N protein is the minimal region for nucleocapsid assembly [31]. In the present study, the region of amino acids 1–375 of the PPRV N protein was defined as the N-core domain, and the 376–525 region was defined as the N-tail domain. We determined that the N-core suppressed the IFN-β-meditated signaling, but the N-tail inhibited the IFN-γ-induced signaling, showing that the different regions of the N protein targeted different IFN pathways. The N-core and N-tail might target different adaptor molecules and result in this distinction. This is different from the N-cores of NiV and HeV, which inhibit both the IFN-β- and IFN-γ-induced IFN response [26]. This might be the reason why N proteins of different paramyxoviruses reveal different functions in suppression of host IFN response. Whether PPRV N protein inhibited the nuclear transport system for STATs should be further investigated. The mechanisms for the different role of N-core and N-tail should also be explored. The P proteins of paramyxoviruses have two main functions in the viral life cycle: they 1) function as a cofactor of viral RNA-dependent RNA polymerase and 2) serve as a guardian for the correct assembly of nucleocapsids. Meanwhile, the products of P gene in paramyxoviruses have also been shown to inhibit IFN response at various levels [20,22,23,35,44]. In the present study, we determined that PPRV P protein interacted with STAT1 and suppressed STAT1 phosphorylation and nuclear transportation. The P protein of MV was able to interact with STAT1 and prevented the phosphorylation of STAT1 to inhibit the IFN-β-induced response [35,45]. The PPRV P protein may suppress host IFN response through a similar manner used by the MV P protein. However, the MV V protein does not interfere with STAT1 phosphorylation [35,36]. As for the PPRV V protein, it showed an inhibitory effect on STAT1 phosphorylation, which was different from the MV V protein [46]. This also indicated the multiple antagonistic strategies for different paramyxoviruses. In IFN-β-induced signaling, JAK1 is responsible for STAT1 phosphorylation, while both JAK1 and JAK2 are critical for IFN-γ-induced STAT1 phosphorylation [47]. The PPRV V protein interacts with JAK1 [46], but we did not observe an interaction between P protein and JAK1. Both PPRV P and V proteins interacted with STAT1. The tyrosine 110 (Y110) in the PPRV V protein is critical for its interaction with STAT1. We found mutation of Y110 in the P protein completely abrogated its interaction with STAT1 and resulted in a considerably decreased suppressive effect of P protein on IFN response. The Y110 site of PPRV V and P proteins might share a similar antagonistic mechanism by targeting STAT1. The Y110 in the MV P protein is also required to block STAT1 phosphorylation [35]. Viruses 2019, 11, 629 15 of 17

The Y110 in the V and P proteins is identified as specific amino acid residue for the STAT1 interaction in some Morbilliviruses [35,48,49]. These results indicate that the Y110 plays a significant role in the V protein and P protein of paramyxoviruses. We speculate that the binding site of STAT1 for PPRV P protein may be essential for phosphorylation of STAT1. The Src homology 2 (SH2) domain of STAT1 is critical for the phosphorylation of STAT1, the P protein of MV binds with the SH2 domain of STAT1, which sequesters the JAK1-meditated STAT1 phosphorylation or hinders the interaction between STAT1 and its receptor [45]. Further investigation will focus on more extensive elucidation of STAT1 residues involved in binding to the PPRV P protein.

5. Conclusions In conclusion, we demonstrated that the N and P proteins functioned as two novel IFN antagonistic factors of PPRV. Multiple viral proteins are involved in suppression of host antiviral response during PPRV infection. Mechanistic studies demonstrate that N and P suppress JAK-STAT pathway signaling by blocking STAT1 nuclear aggregation. Our results definitely broaden our knowledge of PPRV-mediated immune evasion and provide a reference for vaccine development against PPRV.

Author Contributions: Investigation, P.L. and Z.Z.; methodology, P.L., Z.Z., X.Z., X.D. and X.L.; formal analysis, P.L., Z.Z., L.L, Q.X., Z.M. and C.W.; writing–original draft preparation, P.L. and Z.Z.; writing–review and editing, Z.Z., W.D., Y.N. and H.Z.; supervision, Z.Z., Y.N. and H.Z. Funding: This work was supported by a grant from the National Key Research and Development Program of China awarded to Y.N. and C.W. (Grant No. 2017YFD0501004) and a grant from the Key Research and Development Program of Shaanxi Province awarded to C.W. (Grant No. 2017NY-156). Conflicts of Interest: The authors declare no conflicts of interest.

References

1. Baron, M.D.; Diallo, A.; Lancelot, R.; Libeau, G. Peste des Petits Ruminants Virus. Adv. Virus Res. 2016, 95, 1–42. [CrossRef][PubMed] 2. Gargadennec, L.; Lalanne, A. La peste des petits ruminants. Bull. Serv. Zoo Techiques Epizoot. Afr. Occident. Fr. 1942, 5, 16–21. 3. Banyard, A.C.; Parida, S.; Batten, C.; Oura, C.; Kwiatek, O.; Libeau, G. Global distribution of peste des petits ruminants virus and prospects for improved diagnosis and control. J. Gen. Virol. 2010, 91, 2885–2897. [CrossRef][PubMed] 4. Donduashvili, M.; Goginashvili, K.; Toklikishvili, N.; Tigilauri, T.; Gelashvili, L.; Avaliani, L.; Khartskhia, N.; Loitsch, A.; Bataille, A.; Libeau, G.; et al. Identification of Peste des Petits Ruminants Virus, Georgia, 2016. Emerg. Infect. Dis. 2018, 24, 1576–1578. [CrossRef][PubMed] 5. Rajko-Nenow, P.Z.; Cunliffe, T.G.; Flannery, J.T.; Ropiak, H.M.; Avaliani, L.; Donduashvili, M.; Baron, M.D.; Batten, C.A. Complete genome sequence of peste des petits ruminants virus from Georgia, 2016. Genome Announc. 2017, 5, e01091-17. [CrossRef][PubMed] 6. Liu, F.; Li, J.; Li, L.; Liu, Y.; Wu, X.; Wang, Z. Peste des petits ruminants in China since its first outbreak in 2007: A 10-year review. Transbound. Emerg. Dis. 2018, 65, 638–648. [CrossRef][PubMed] 7. Kumar, N.; Maherchandani, S.; Kashyap, S.K.; Singh, S.V.; Sharma, S.; Chaubey, K.K.; Ly, H. Peste Des Petits Ruminants Virus Infection of Small Ruminants: A Comprehensive Review. Viruses 2014, 6, 2287–2327. [CrossRef] 8. Gibbs, E.P.J.; Taylor, W.P.; Lawman, M.J.P.; Bryant, J. Classification of peste des petits ruminants virus as the fourth member of the genus Morbillivirus. Intervirology 1979, 11, 268–274. [CrossRef] 9. Platanias, L.C. Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat. Rev. Immunol. 2005, 5, 375–386. [CrossRef] 10. Der, S.; Zhou, A.M.; Silverman, R.H.; William, B.R.G. Identification of genes differentially regulated by IFN-alpha, beta, gamma using oligonucleotide microarrays. Proc. Natl. Acad. Sci. USA 1998, 95, 15623–15628. [CrossRef] 11. Stark, G.R.; Kerr, I.M.; Williams, B.R.G.; Silverman, R.H.; Schreiber, R.D. How Cells Respond to Interferons. Annu. Rev. Biochem. 1998, 67, 227–264. [CrossRef][PubMed] Viruses 2019, 11, 629 16 of 17

12. Ihle, J.N. The Janus protein tyrosine kinase family and its role in cytokine signaling. Adv. Immunol. 1995, 60, 1–35. [CrossRef][PubMed] 13. Schindler, C.; Shuai, K.; Prezioso, V.; Darnell, J. Interferon-dependent tyrosine phosphorylation of a latent cytoplasmic transcription factor. Science 1992, 257, 809–813. [CrossRef][PubMed] 14. Qureshi, S.A.; Salditt-Georgieff, M.; Darnell, J.E. Tyrosine-phosphorylated Stat1 and Stat2 plus a 48-kDa protein all contact DNA in forming interferon-stimulated-gene factor 3. Proc. Natl. Acad. Sci. USA 1995, 92, 3829–3833. [CrossRef][PubMed] 15. Darnell, J.; Kerr, I.; Stark, G. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 1994, 264, 1415–1421. [CrossRef][PubMed] 16. Pestka, S.; Kotenko, S.V.; Muthukumaran, G.; Izotova, L.S.; Cook, J.R.; Garotta, G. The interferon gamma (IFN-γ) receptor: A paradigm for the multichain cytokine receptor. Cytokine Growth Factor Rev. 1997, 8, 189–206. [CrossRef] 17. Schroder, K.; Hertzog, P.J.; Ravasi, T.; Hume, D.A. Interferon-gamma: An overview of signals, mechanisms and functions. J. Leukoc. Biol. 2004, 75, 163–189. [CrossRef][PubMed] 18. Shuai, K.; Horvath, C.M.; Huang, L.H.T.; Qureshi, S.A.; Cowburn, D.; Darnell, J.E. Interferon activation of the transcription factor Stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions. Cell 1994, 76, 821–828. [CrossRef] 19. Andrejeva, J.; Young, D.F.; Goodbourn, S.; Randall, R.E. Degradation of STAT1 and STAT2 by the V proteins of simian virus 5 and human parainfluenza virus type 2, respectively: Consequences for virus replication in the presence of alpha/beta and gamma interferons. J. Virol. 2002, 76, 2159–2167. [CrossRef] 20. Caignard, G.; Guerbois, M.; Labernardière, J.L.; Jacob, Y.; Jones, L.M.; Wild, F.; Tangy, F.; Vidalain, P.O.Measles virus V protein blocks Jak1-mediated phosphorylation of STAT1 to escape IFN-α/β signaling. Virology 2007, 368, 351–362. [CrossRef] 21. Precious, B.; Young, D.F.; Andrejeva, L.; Goodbourn, S.; Randall, R.E. In vitro and in vivo specificity of ubiquitination and degradation of STAT1 and STAT2 by the V proteins of the paramyxoviruses simian virus 5 and human parainfluenza virus type 2. J. Gen. Virol. 2005, 86, 151–158. [CrossRef][PubMed] 22. Nanda, S.K.; Baron, M.D. Rinderpest virus blocks type I and type II interferon action: Role of structural and nonstructural proteins. J. Virol. 2006, 80, 7555–7568. [CrossRef][PubMed] 23. Shaw, M.L.; Garcia-Sastre, A.; Palese, P.; Basler, C.F. Nipah virus V and W proteins have a common STAT1-binding domain yet inhibit STAT1 activation from the cytoplasmic and nuclear compartments, respectively. J. Virol. 2004, 78, 5633–5641. [CrossRef][PubMed] 24. Ma, X.S.; Yang, X.; Nian, X.F.; Zhang, Z.D.; Dou, Y.X.; Zhang, X.H.; Luo, X.N.; Su, J.H.; Zhu, Q.Y.; Cai, X.P. Identification of amino-acid residues in the V protein of peste des petits ruminants essential for interference and suppression of STAT-mediated interferon signaling. Virology 2015, 483, 54–63. [CrossRef][PubMed] 25. Takayama, I.; Sato, H.; Watanabe, A.; Omi-Furutani, M.; Sugai, A.; Kanki, K.; Yoneda, M.; Kai, C.K. The nucleocapsid protein of measles virus blocks host interferon response. Virology 2012, 424, 45–55. [CrossRef][PubMed] 26. Sugai, A.; Sato, H.; Takayama, I.; Yoneda, M.; Kai, C. Nipah and Hendra Virus Nucleoproteins Inhibit Nuclear Accumulation of Signal Transducer and Activator of Transcription 1 (STAT1) and STAT2 by Interfering with Their Complex Formation. J. Virol. 2017, 91, 15. [CrossRef][PubMed] 27. Zhu, Z.; Li, C.; Du, X.; Wang, G.; Cao, W.; Yang, F.; Feng, H.; Zhang, X.; Shi, Z.; Liu, H.; et al. Foot-and-mouth disease virus infection inhibits LGP2 protein expression to exaggerate inflammatory response and promote viral replication. Cell Death Dis. 2017, 8, e2747. [CrossRef] 28. Zhu, Z.; Wang, G.; Yang, F.; Cao, W.; Mao, R.; Du, X.; Zhang, X.; Li, C.; Li, D.; Zhang, K.; et al. Foot-and-Mouth Disease Virus Viroporin 2B Antagonizes RIG-I-Mediated Antiviral Effects by Inhibition of Its Protein Expression. J. Virol. 2016, 90, 11106–11121. [CrossRef][PubMed] 29. Li, P.F.; Zhang, X.L.; Cao, W.J.; Yang, F.; Du, X.L.; Shi, Z.W.; Zhang, M.T.; Liu, X.T.; Zhu, Z.X.; Zheng, H.X. RIG-I is responsible for activation of type I interferon pathway in Seneca Valley virus-infected porcine cells to suppress viral replication. Virol. J. 2018, 15, 9. [CrossRef] 30. Rojas, J.M.; Sevilla, N.; Martin, V. PPRV-induced immunosuppression at the interface of virus-host interaction. Br. J. Virol. 2016, 3, 140. [CrossRef] 31. Kingston, R.L.; Baase, W.A.; Gay, L.S. Characterization of nucleocapsid binding by the measles virus and mumps virus phosphoproteins. J. Virol. 2004, 78, 8630–8640. [CrossRef][PubMed] Viruses 2019, 11, 629 17 of 17

32. Buchholz, C.; Spehner, D.; Drillien, R.; Neubert, W.J.; Homann, H.E. The conserved N-terminal region of Sendai virus nucleocapsid protein NP is required for nuclocapsid assembly. J. Virol. 1993, 167, 5803–5812. [CrossRef] 33. Longhi, S.; Receveur-Brechot, V.; Karlin, D.; Johansson, K.; Darbon, H.; Bhella, D.; Yeo, R.; Finet, S.; Canard, B. The C-terminal domain of the measles virus nucleoprotein is intrinsically disordered and folds upon binding to the C-terminal moiety of the phosphoprotein. J. Biol. Chem. 2003, 278, 18638–18648. [CrossRef][PubMed] 34. Chinnakannan, S.K.; Holzer, B.; Bernardo, B.S.; Nanda, S.K.; Baron, M.D. Different functions of the common P/V/W and V-specific domains of rinderpest virus V protein in blocking IFN signalling. J. Gen. Virol. 2014, 95, 44–51. [CrossRef][PubMed] 35. Devaux, P.; von Messling, V.; Songsungthong, W.; Springfeld, C.; Cattaneo, R. Tyrosine 110 in the measles virus phosphoprotein is required to block STAT1 phosphorylation. Virology 2007, 360, 72–83. [CrossRef] [PubMed] 36. Palosaari, H.; Parisien, J.P.; Rodriguez, J.J.; Ulane, C.M.; Horvath, C.M. STAT protein interference and suppression of cytokine signal transduction by measles virus V protein. J. Virol. 2003, 77, 7635–7644. [CrossRef] 37. Randall, R.E.; Goodbourn, S. Interferons and viruses: An interplay between induction, signalling, antiviral responses and virus countermeasures. J. Gen. Virol. 2008, 89, 1–47. [CrossRef] 38. Bernardo, B.S.; Goodbourn, S.; Baron, M.D. Control of the induction of type I interferon by Peste des petits ruminants virus. PLoS ONE 2017, 12, 28. [CrossRef] 39. Ding, Z.; Fang, L.R.; Jing, H.Y.; Zeng, S.L.; Wang, D.; Liu, L.Z.; Zhang, H.; Luo, R.; Chen, H.C.; Xiao, S.B. Porcine Epidemic Diarrhea Virus Nucleocapsid Protein Antagonizes Beta Interferon Production by Sequestering the Interaction between IRF3 and TBK1. J. Virol. 2014, 88, 8936–8945. [CrossRef] 40. Ding, Z.; Fang, L.; Yuan, S.; Zhao, L.; Wang, X.; Long, S.; Wang, M.; Wang, D.; Foda, M.; Xiao, S. The nucleocapsid proteins of mouse hepatitis virus and severe acute respiratory syndrome coronavirus share the same IFN-β antagonizing mechanism: Attenuation of PACT-mediated RIG-I/MDA5 activation. Oncotarget 2017, 8, 49655–49670. [CrossRef] 41. Hu, Y.; Li, W.; Gao, T.; Cui, Y.; Jin, Y.W.; Li, P.; Ma, Q.J.; Liu, X.; Cao, C. The Severe Acute Respiratory Syndrome Coronavirus Nucleocapsid Inhibits Type I Interferon Production by Interfering with TRIM25-Mediated RIG-I Ubiquitination. J. Virol. 2017, 91, 15. [CrossRef][PubMed] 42. Shao, J.J.; Huang, Q.F.; Liu, X.Y.; Da, D.; Liang, Y.Y.; Ly, H. Arenaviral Nucleoproteins Suppress PACT-Induced Augmentation of RIG-I Function to Inhibit Type I Interferon Production. J. Virol. 2018, 92, 11. [CrossRef] [PubMed] 43. Liston, P.; Batal, R.; DiFlumeri, C.; Briedis, D.J. Protein interaction domains of the measles virus nucleocapsid protein (NP). Arch. Virol. 1997, 142, 305–321. [CrossRef][PubMed] 44. Vidy, A.; Chelbi-Alix, M.; Blondel, D. Rabies virus P protein interacts with STAT1 and inhibits interferon signal transduction pathways. J. Virol. 2005, 79, 14411–14420. [CrossRef][PubMed] 45. Devaux, P.; Priniski, L.; Cattaneo, R. The measles virus phosphoprotein interacts with the linker domain of STAT1. Virology 2013, 444, 250–256. [CrossRef][PubMed] 46. Chinnakannan, S.K.; Nanda, S.K.; Baron, M.D. Morbillivirus v proteins exhibit multiple mechanisms to block type 1 and type 2 interferon signalling pathways. PLoS ONE 2013, 8, e57063. [CrossRef][PubMed] 47. Silva, C.M.; Lu, H.; Weber, M.J.; Thorner, M.O. Differential tyrosine phosphorylation of JAK1, JAK2, and STAT1 by growth hormone and interferon-gamma in IM-9 cells. J. Biol. Chem. 1994, 269, 27532–27539. 48. Ohno, S.; Ono, N.; Takeda, M.; Takeuchi, K.; Yanagi, Y. Dissection of measles virus V protein in relation to its ability to block alpha/beta interferon signal transduction. J. Gen. Virol. 2004, 85, 2991–2999. [CrossRef] 49. Rothlisberger, A.; Wiener, D.; Schweizer, M.; Peterhans, E.; Zurbriggen, A.; Plattet, P. Two domains of the V protein of virulent canine distemper virus selectively inhibit STAT1 and STAT2 nuclear import. J. Virol. 2010, 84, 6328–6343. [CrossRef]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).