DOCSLIB.ORG

A Suspected Case of Paracoccidioidomycosis Ceti in a Male Aquarium-Maintained Pacific White-Sided Dolphin（Lagenorhynchus Obliquidens）In Japan

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Suspected Case of Paracoccidioidomycosis Ceti in a Male Aquarium-Maintained Pacific White-Sided Dolphin（Lagenorhynchus Obliquidens）In Japan Case report Pathology A Suspected Case of Paracoccidioidomycosis Ceti in a Male Aquarium-maintained Pacific White-sided Dolphin（Lagenorhynchus obliquidens）in Japan Tomoko MINAKAWA1）, Keiichi UEDA2）, Ayako SANO3）, Haruka KAMISAKO2）, Mikuya IWANAGA1）, Takeshi KOMINE1） and Shinpei WADA1 ）＊ 1） Laboratory of Aquatic Medicine, School of Veterinary Medicine, Nippon Veterinary and Life Science University, 1-7-1 Kyonan-Cho, Musashino, Tokyo 180-8602, Japan 2） Okinawa Churashima Foundation, 888 Aza Ishikawa, Motobu-Cho, Kunigami-Gun, Okinawa 905-0206, Japan 3） Department of Animal Sciences, Faculty of Agriculture, University of the Ryukyus, 1 Sembaru, Nishihara-Cho, Nakagusuku-Gun, Okinawa 903-0213, Japan ［Received 21 March 2017; accepted 1 June 2017］ ABSTRACT A Pacific white-sided dolphin diagnosed with suspected paracoccidioidomycosis ceti has suffered clinical manifestations since September 2008. Skin biopsy samples were examined microbiologically, pathologically, and with molecular biology. However, we detected no clear evidence of infection other than multiple budding-yeast cells in a skin stamp smear. The lesion improved after the oral administration of itraconazole and topical treatment with an ointment containing amphotericin B powder. These results imply that some fungal agents might be involved in the pathogenesis of the present case. Key words: Pacific white-sided dolphin, paracoccidioidomycosis ceti － Jpn. J. Zoo. Wildl. Med. 23（2）：45-50，2018 Japan is an endemic area for paracoccidioidomycosis covering most of the area of the tail fluke, the right side of the ceti (PCM-C), with three confirmed cases, two in bottlenose body, and the ventral side of the keel by August 2016 (Fig. dolphins (BDs, Tursiops truncatus) [1] and one in a Pacific 1a, b). The individual foci were 1–2 cm in diameter, although white-sided dolphin (PWSD, Lagenorhynchus obliquidens) [2]. the major axes of some fused lesions were up to 15 cm. The Molecular biological data are essential for the diagnosis of dolphin was captured off the Japan Sea coast in 1996, and PCM-C, so its diagnosis is sometimes difficult. In the present was estimated to have been more than 25 years old at the end case, a PWSD with suspected PCM-C developed clinical of August 2016. Its bodyweight was 121.0 kg in April 2016. manifestations and cytological features similar to those of Topical treatments with ointments containing antimicrobial PCM-C. The male aquarium-maintained PWSD had multiple agents, including gentamicin sulfate (Takeda Pharmaceutical lesions, consisting of whitish-gray dermal tubercles, on the tip Co. Ltd., Osaka, Japan), oxytetracycline hydrochloride (Yoshindo of the right side of its tail fluke, since September 2008. This Inc., Toyama, Japan), and polymyxin B sulfate (Yoshindo Inc.), was similar to a previous case of PCM-C in a PWSD [2] and and steroids, such as hydrocortisone (Yoshindo Inc.) and to a nontuberculous mycobacterial infection in a white whale betamethasone valerate (Shionogi & Co. Ltd., Osaka, Japan), (Delphinopterus leucas) [3]. The lesions gradually increased, were administered at least a few days. Povidone iodine (Meiji fusing with one another to give a keloidal appearance, and Seika Pharma Co. Ltd., Tokyo, Japan), gentian violet (Kishida Chemical Co. Ltd., Osaka, Japan), and hydrogen peroxide (Showa Seiyaku Co. Ltd., Toyohashi, Japan) were also applied to the * Corresponding author：Shinpei WADA（E-mail: [email protected]） lesions as disinfectants. Although these clinical treatments － 45 － TM on potato dextrose agar (potato dextrose agar, Difco , Becton 㻌a Dickinson and Company, Sparks, MD, USA) supplemented with 100 mg/L of chloramphenicol (Wako Chemicals Co. Ltd., Osaka, Japan), Mycosel agar (BBLTM Mycosel agarTM, Becton TM Dickinson and Company), and 1 % yeast extract (Difco , Becton Dickinson and Company), and 1 % glucose (Wako Chemicals Co. Ltd.) added brain heart infusion agar (DifcoTM, Becton Dickinson and Company). The agar plates were incubated at 25 and 35℃ for 4 weeks. Then, stamp smears were performed with the residue from the fresh skin samples, and these samples were stained with Giemsa, periodic acid- Schiff reaction (PAS), and/or Gomori methenamine silver nitrate stain (GMS) for fungi. b㻌 After these procedures, each sample was divided into four small blocks. One was fixed in 10 % phosphate-buffered formalin solution, one in 70 % ethanol, and one in absolute ethanol, all immediately after sampling. The other block was stored in a freezer ( －20℃ ) for up to 48 h, and transported to the laboratory. The frozen skin tissues were thawed and treated with 1N HCl according to Eddyani et al. [4] and/or 1N NaOH according to Yajko et al. [5] for decontamination. Then, each sample was inoculated on 2 % Ogawa slant (Kyokuto, Tokyo, Japan), Middlebrook 7H11 agar with oleic acid-albumin-dextrose- Fig. 1 Granulomatous skin lesions (arrows) on the tail fluke catalase complex (OADC, DifcoTM, Becton Dickinson and (a) and ventral side of the keel (b) in July 2016. Company) enrichment and Middlebrook 7H9 broth (DifcoTM, Becton Dickinson and Company) for NTM cultivation. All of were continued for several months, the skin lesions did not these media were incubated at 30℃. improve. For molecular analysis of NTM, genomic DNA was extracted Two punch biopsies (9 mm in diameter) of the dermal from each skin sample fixed with absolute ethanol using lesions were collected from the tail flukes, and three excisions QIAamp DNA Mini kit (QIAGEN, Venlo, Netherlands) after were made with a surgical blade to obtain small tissue blocks performing the freezing-boiling method according to Fukano (around 0.25 cm2 and 1.0 cm in depth) from the right body et al. [6]. PCR analysis was performed targeting the 16S rRNA surface and the ventral side of the keel, under infiltration gene, the 65-kDa heat shock protein (hsp65) gene, and the anesthesia induced with lidocaine hydrochloride supplemented RNA polymerase β-subunit (rpoB) gene. The primers used with 2 % adrenaline (AstraZeneca K.K., Osaka, Japan) in August for this analysis [6] are listed in Table 1. PCR analysis was and October, 2016. The biopsied tissue samples were divided conducted with GoTaq DNA polymerase (Promega, Madison, into small pieces to culture any fungi or nontuberculous WI, USA) with the following amplification conditions: 95℃ for mycobacteria (NTM), and for cytological studies of stamp 10 min, 35 cycles of 95℃ for 40 sec, 55℃ for 40 sec, 72℃ for smears on glass slides, histopathology, and molecular biological 90 sec, and a final cycle of 72℃ for 3 min. studies. The operative wounds were treated with an ointment For molecular analysis of Paracoccidioides sp., detection of including gentamicin sulfate. the 43-kDa glycoprotein coding gene (gp43) was carried out For mycological examinations, smaller pieces of dermal on the biopsied samples fixed with 70 % ethanol, according to tissue were removed from the fresh samples, and inoculated Ueda et al. [1]. After purification by an ethanol precipitation － 46 － Dermatitis in a Pacific White-sided Dolphin Table 1 PCR primer sets for detection of nontuberculous mycobacteria used in this study. Genes Primers Sequences (5′–3′) 16S rRNA 8F AGAGTTTGATCCTGGCTCAG 1047R TGCACACAGGCCACAAGGGA 830F GTGTGGGTTTCCTTCCTTGG 1542R AAGGAGGTGATCCAGCCGCA hsp65 Tb11 ACCAACGATGGTGTGTCCAT Tb12 CTTGTCGAACCGCATACCCT rpoB MycoF CGCCACTTCGGCAACCG MycoR TCGATCGGGCACATCCGG 20 µm㻌 Fig. 2 Chains of spherical budding-yeast-like structures method, the DNA solutions were subjected to nested PCR to (arrows) stained with Gomori methenamine silver nitrate stain amplify the gp43 gene using the primer set MAE (5′ -TGC TGC observed in the stamp smears of dermal lesions. Bar=20µm. GGC GGG GTT AAA CCA TGT C-3′) and ATO (5′ -GTT GTG GTA TGT GTC GAT GTA GAC G-3′) for the first round of PCR, and the primer set SUM F1 (5 ′ -GTC ATC GAT CTC CAT GGT GTT a AAG-3′ ) and SUM R2 (5′ -GGC AGA RAA GCA TCC GAA A -3′ ) for the second round, using the same protocol as our previous report [2]. The fixed samples with 10 % phosphate-buffered formalin solution were processed routinely to prepare paraffin sections 4 to 5 µm thick for histopathology. The sections were stained with hematoxylin and eosin (H&E). Some other histological staining methods including the Ziehl-Neelsen (ZN) stain for acid-fast bacteria, PAS, and/or GMS, were also performed with the sections. No microorganisms were detected with culture, histopathology, or molecular biology. However, the cytological analysis revealed typical fungal elements consisting of chains b of spherical budding-yeast-like structures, 15–25 µm in diameter, which stained positively with PAS and GMS (Fig. 2). The morphological features of these structures were quite similar to those described in the previous cases of Paracoccidioides brasiliensis infection diagnosed by molecular analyses of the gp43 gene [2, 7]. The characteristics of PCM-C, formerly called “lacaziosis,” “Jorge Lobo’ s disease,” or “lobomycosis” [8], include chronic keloidal skin lesions with or without visceral involvement [1, 2, 8-11]. Taborda et al. [12] classified the causative agent of lacaziosis as Lacazia loboi in 1999, and the name “lacaziosis” Fig. 3 Improved skin lesions (arrows) on the tail fluke has been used preferentially for both human and cetacean (a) and ventral side of the keel (b) in January 2017, after administration of antifungal agents. cases [13]. In the latest report of Vilela et al. [7], the name － 47 － Tomoko MINAKAWA et al. “PCM-C” is proposed for cetacean lacaziosis caused by an Bristol Myers, Squibb, Tokyo, Japan), three times daily, uncultured Paracoccidioides sp., based on a phylogenetic referring to Murata et al. [21]. We applied these dosages of the analysis of multiple genes and some partial gene sequences: antifungal agents to a previous case of PCM-C in PWSD [2], kexin coding gene (Kex), chitin synthase 4 (CHS4), a partial and remarkable improvement of the skin lesions was observed sequence of the 43-kDa glycoprotein coding gene (gp43), and (data not shown). the internal transcribed spacer region of ribosomal RNA (ITS After several months on this regimen, the skin lesions rDNA).
Load more

Recommended publications
  • Paracoccidioidomycosis Surveillance and Control
    Received: January 6, 2010 J. Venom. Anim. Toxins incl. Trop. Dis. Accepted: January 6, 2010 V.16, n.2, p.194-197, 2010. Full paper published online: May 30, 2010 Letter to the Editor. ISSN 1678-9199. Paracoccidioidomycosis surveillance and control Mendes RP (1) (1) Department of Tropical Diseases, Botucatu Medical School, São Paulo State University (UNESP – Univ Estadual Paulista), Botucatu, São Paulo State, Brazil. Dear Editor, Paracoccidioidomycosis (PCM) is a systemic mycosis caused by Paracoccidioides brasiliensis, a thermally dimorphic fungus known to produce disease, primarily in individuals whose profession is characterized by intense and continuous contact with the soil. PCM presents a high incidence in Brazil, especially in the southeastern, southern and center-western regions of the country. On reporting the first two cases, in 1908, Adolpho Lutz presented the clinical picture and histopathological findings – tubercles with giant epithelioid cells and fungal specimens with exosporulation – of the infection. He cultured the fungus at different temperatures, demonstrating its mycelial and yeast phases, and reproduced the disease in guinea pigs (1). Few researchers in that era were so comprehensive when reporting a new disease and its etiological agent. This deep mycosis prevails among men aged between 30 and 59 years, comprising their most productive working phase, with a gender ratio of 10:1 (2). Analysis of 3,181 death certificates that reported PCM during the 16-year period from 1980 to 1995 revealed a mortality rate of 1.487 per one million inhabitants, indicating its considerable magnitude but low visibility (3). PCM was the eighth greatest cause of death from predominantly chronic or repetitive types of infectious and parasitic diseases in Brazil, surpassed only by AIDS, Chagas’ disease, tuberculosis, malaria, schistosomiasis, syphilis and Hansen’s disease.
    [Show full text]
  • Med Chem 401: Mycology Mycology
    Med Chem 401: Mycology (www.doctorfungus.org) Mycology is the Study of Fungi (Monera, Protoctista, Fungi, Plantae, Animalia). Fungi are eukaryotic cells and as such contain nuclei, mitochondria, ER, golgi, 80S ribosomes, etc., bound by a plasma membrane. Note that fungal cell membranes contain ergosterol rather than cholesterol. Mycology In addition, fungi possess a rigid cell wall containing chitin, glucans and other sugar polymers. Mycology Fungi are classified as •Yeasts - round/oval cells that divide by budding •Moulds - tubular structures (hyphae) that grow by longitudinal extension and branching. A mass of hyphae is called a mycelium Diseases Caused by Fungi Fungal infections in normal healthy adults are confined to conditions such as mucosal candidiasis (e.g., thrush) and dermatophyte (tinea) skin infections (e.g., athlete's foot). However, in the immunocompromised host, a variety of normally mild or nonpathogenic fungi can cause potentially fatal infections. Diseases Caused by Fungi Fungal infections are classified depending on the degree of tissue involvement and mode of entry: 1. Superficial - localized to the skin, hair and nails. 2. Subcutaneous - infection confined to the dermis, subcutaneous tissue, or adjacent structures. 3. Systemic - deep infections of the internal organs. 4. Opportunistic - cause infection only in the immunocompromised. 1. Superficial Mycoses The Dermatophytes The dermatophytes are not a specific fungus, but rather a short-hand label for three genera of fungi that commonly cause skin disease (tinea). •Epidermophyton spp. •tinea capitis •tinea barbae •Trichophyton spp. •tinea pedis •Microsporum spp. •tinea cruis 1. Superficial Mycoses The Dermatophytes Tinea pedis “athletes foot” Tinea capitis Epidermophyton spp. Microsporum spp. 1.
    [Show full text]
  • Subcutaneous Mycoses in Peru: a Systematic Review and Meta-Analysis for the Burden of Disease
    Tropical Medicine Rounds Subcutaneous mycoses in Peru: a systematic review and meta-analysis for the burden of disease Max Carlos Ramırez Soto1, BSc, MPH , and German Malaga2, MD, MSc 1Medicine School, Universidad Nacional Abstract Mayor de San Marcos, Lima, Peru, and Background There is a worrying lack of epidemiological data on the geographical 2 Medicine School, Universidad Peruana distribution and burden of subcutaneous mycoses in Peru, hindering the implementation of Cayetano Heredia, Lima, Peru surveillance and control programs. Correspondence Objectives This study aimed to estimate the disease burden of subcutaneous mycoses in Max Carlos Ramırez Soto, BSC, MPH Peru and identify which fungal species were commonly associated with these mycoses. Medicine School Methods We performed a meta-analysis after a systematic review of the published literature Universidad Nacional Mayor de San in PubMed, LILACS, and SciELO to estimate the burden of subcutaneous mycoses in 25 Marcos regions in Peru. The disease burden was determined in terms of prevalence (number of Av. Grau 755 Lima 01 cases per 100,000 inhabitants) and the number of reported cases per year per region. Peru Results A total of 26 studies were eligible for inclusion. Results showed that sporotrichosis E-mail: [email protected] was the most common subcutaneous mycosis (99.7%), whereas lobomycosis, chromoblastomycosis, and subcutaneous phaeohyphomycosis were rare. Cases of Funding sources: None. eumycetoma and subcutaneous zygomycosis were not found. Of the 25 regions, the Conflicts of interest: The authors have burden of sporotrichosis was estimated for four regions classified as endemic; in nine declared that no competing interests exist. regions, only isolated cases were reported.
    [Show full text]
  • Fungal Infections
    Fungal infections Natural defence against fungi y Fatty acid content of the skin y pH of the skin, mucosal surfaces and body fluids y Epidermal turnover y Normal flora Predisposing factors y Tropical climate y Manual labour population y Low socioeconomic status y Profuse sweating y Friction with clothes, synthetic innerwear y Malnourishment y Immunosuppressed patients HIV, Congenital Immunodeficiencies, patients on corticosteroids, immunosuppressive drugs, Diabetes Fungal infections: Classification y Superficial cutaneous: y Surface infections eg. P.versicolor, Dermatophytosis, Candidiasis, T.nigra, Piedra y Subcutaneous: Mycetoma, Chromoblastomycosis, Sporotrichosis y Systemic: (opportunistic infection) Histoplasmosis, Candidiasis Of these categories, Dermatophytosis, P.versicolor, Candidiasis are common in daily practice Pityriasis versicolor y Etiologic agent: Malassezia furfur Clinical features: y Common among youth y Genetic predisposition, familial occurrence y Multiple, discrete, discoloured, macules. y Fawn, brown, grey or hypopigmented y Pinhead sized to large sheets of discolouration y Seborrheic areas, upper half of body: trunk, arms, neck, abdomen. y Scratch sign positive PITYRIASIS VERSICOLOR P.versicolor : Investigations y Wood’s Lamp examination: y Yellow fluorescence y KOH preparation: Spaghetti and meatball appearance Coarse mycelium, fragmented to short filaments 2-5 micron wide and up to 2-5 micron long, together with spherical, thick-walled yeasts 2-8 micron in diameter, arranged in grape like fashion. P.versicolor: Differential diagnosis y Vitiligo y Pityriasis rosea y Secondary syphilis y Seborrhoeic dermatitis y Erythrasma y Melasma Treatment P. versicolor Topical: y Ketoconazole , Clotrimazole, Miconazole, Bifonazole, Oxiconazole, Butenafine,Terbinafine, Selenium sulfide, Sodium thiosulphate Oral: y Fluconazole 400mg single dose y Ketoconazole 200mg OD x 14days yGriseofulvin is NOT effective.
    [Show full text]
  • Candidemia in Critically Ill Patients: Comparison in IC VS
    Histopathological diagnosis Arunaloke Chakrabarti 2017 Professor & Head Center for Advanced Research in Medical Mycology & WHO Collaborating Center Histopathological diagnosis Department of Medical Microbiology Postgraduate Institute of Medical EducationAUG & Research Professor Arunaloke Chakrabarti Chandigarh – 160012, India Head, Department of Medical Microbiology Postgraduate Institute of Medical Education and Research Chandigarh, India 5-6 Co-chair, ISHAM Asia Fungal Working Group SPEAKER CONFERENCE,OF MMTN Need of histopathological diagnosis Learning histopathological diagnosis • Fungi are ubiquitous & saprophyticAT • Learn tissue reaction to fungi • Usual laboratory contaminant COPYRIGHT • Commonly performed H & E stain in histopathology will help you to • Infection versus colonization - a frequent problem observe tissue reaction • Rapid & cost-effective means of providing a presumptive or • Difficult to identify fungi on H & E (except Histoplasma, Mucor etc.) definitive diagnosis of an invasive fungal infection • On H&E, all fungi show pink cytoplasm, blue nuclei & no colouration of • Help in knowing the load, tissue reaction, extent & invasion the wall. You may see unstained area in the position of fungi • Difficulty – to get samples from deep tissue • Go ahead performing PAS, GMS • Advances in diagnostic radiology & patient support (platelet • Other specific stains – Alcian blue, Mucicarmine, Fontana Masson etc. transfusions) have improved collection of tissue biopsy specimens PRESENTED • Need training…. 1 Other challenges •
    [Show full text]
  • Human Case of Lobomycosis Sameer Elsayed,*† Susan M
    Human Case of Lobomycosis Sameer Elsayed,*† Susan M. Kuhn,† Duane Barber,*† Deirdre L. Church,*† Stewart Adams,‡ and Richard Kasper*† We describe a 42-year-old woman with histologically confirmed lobomycosis, a cutaneous fungal infection rarely reported outside of Latin America. Our case represents the first published report of imported human lobomycosis in Canada and the fifth in an industrialized country. Figure 1. Photomicrograph of keloidal skin lesion on patient’s right utaneous fungal infections are rarely reported outside upper arm. Cof Latin America. We document the first case of imported human lobomycosis in Canada. (1995 to 1996). During her time in South America, she lived mainly in rural camps and had extensive exposure to The Study freshwater, soil, and underground caves. Health problems In February 2001, a healthy, 42-year-old, female geolo- encountered during her travels included dengue fever, gist from Canada came to her dermatologist with a slowly amebic dysentery, and intestinal helminthiasis. Of note, growing, 1.5-cm diameter, dusky-red, nontender, plaque- she had never traveled to the African continent. like lesion surrounded by keloidal scar tissue on the poste- Her medical history was otherwise unremarkable. rior aspect of her right upper arm (Figure 1). It was located Family history was positive for hypothyroidism. She was a at the site of a scar from a previous excision attempt of a nonsmoker and a social alcohol drinker. She was on hor- similar lesion 2 years earlier. The original lesion was first mone replacement therapy but no other medications and noticed while the patient was visiting Southeast Asia in had no known allergies.
    [Show full text]
  • Ten Years Experience with Jorge Lobo's Disease in the State of Acre, Amazon
    Rev. Inst. Med. Trop. Sao Paulo 52(5):273-278, September-October, 2010 doi: 10.1590/S0036-46652010000500010 TEN YEARS EXPERIENCE WITH JORGE LOBO’S DISEASE IN THE STATE OF ACRE, AMAZON REGION, BRAZIL William John WOODS(1), Andréa de Faria Fernandes BELONE(2), Léia Borges CARNEIRO(1) & Patrícia Sammarco ROSA(2) SUMMARY Jorge Lobo’s disease is a cutaneous and subcutaneous mycosis that affects patients in the Amazon region. The number of patients is relatively small, but the real situation of the disease as public health problem is not known, because Jorge Lobo’s disease is not a notifiable disease. This study aims to report the clinical evolution in patients affected and to determine the prevalence and areas of occurrence of the disease. A retrospective study was carried out based on the analysis of the clinical records, which included a collection of photographs of patients in the Department of Sanitary Dermatology, in Rio Branco, and patients seen in the interior of the state. In a decade, in Rio Branco, 249 cases of the disease were reported, 30 were females and 219 males. Of these patients, 153 had localized lesions, 94 of them were on one ear, 55 had multifocal lesions and 41 had disseminated lesions. The average time between the onset of symptoms and diagnosis was 19 years. The average age at the time of diagnosis was 53 years, and ages ranged from 14 to 96 years. KEYWORDS: Jorge Lobo’s disease; Epidemiology; Prevalence; Lacazia loboi. INTRODUCTION Some authors refer to constant increase in number of Jorge Lobo’s disease cases.
    [Show full text]
  • Lobomycosis: Epidemiology, Clinical Presentation, and Management Options
    Therapeutics and Clinical Risk Management Dovepress open access to scientific and medical research Open Access Full Text Article REVIEW Lobomycosis: epidemiology, clinical presentation, and management options Valeska Albuquerque Abstract: Lobomycosis is a subcutaneous mycosis of chronic evolution caused by the Lacazia Francesconi1 loboi fungus. Its distribution is almost exclusive in the Americas, and it has a particularly high Ana Paula Klein2 prevalence in the Amazon basin. Cases of lobomycosis have been reported only in dolphins Ana Paula Botelho Gualda and humans. Its prevalence is higher among men who are active in the forest, such as rubber Santos2 tappers, bushmen, miners, and Indian men. It is recognized that the traumatic implantation of Rajendranath Ramasawmy3 the fungus on the skin is the route by which humans acquire this infection. The lesions affect mainly exposed areas such as the auricles and upper and lower limbs and are typically presented Fábio Francesconi4 as keloid-like lesions. Currently, surgical removal is the therapeutic procedure of choice in 1 Department of Dermatology, Tropical initial cases. Despite the existing data and studies to date, the active immune mechanisms in Medicine Foundation Heitor Vieira For personal use only. Dourado, Manaus, Amazonas, Brazil; this infection and its involvement in the control or development of lacaziosis have not been fully 2Amazon Federal University, Manaus, clarified. In recent years, little progress has been made in the appraisal of the epidemiologic 3 Amazonas, Brazil; Department of aspects of the disease. So far, we have neither a population-based study nor any evaluation Immunogenetics, 4Department of Dermatology, Tropical Medicine directed to the forest workers.
    [Show full text]
  • Dermatophyte and Non Dermatophyte Fungi in Riyadh City, Saudi Arabia
    Saudi Journal of Biological Sciences (2015) xxx, xxx–xxx King Saud University Saudi Journal of Biological Sciences www.ksu.edu.sa www.sciencedirect.com ORIGINAL ARTICLE Dermatophyte and non dermatophyte fungi in Riyadh City, Saudi Arabia Jamal M. Khaled a,b,*, Hammed A Golah c, Abdulla S. Khalel a, Naiyf S. Alharbi a, Ramzi A. Mothana d a Department of Botany and Microbiology, College of Science, King Saud University, Riyadh, Saudi Arabia b Department of Biotechnology and Food Technology, Thamar University, Yemen c Agriculture and Veterinary Medicine, Department of Veterinary Medicine, Thamar University, Yemen d Department of Pharmacognosy, College of Pharmacy, King Saud University, Riyadh, Saudi Arabia Received 2 September 2014; revised 24 November 2014; accepted 15 December 2014 KEYWORDS Abstract Background: Dermatophytes are a scientific label for a group of three genera (Micros- Dermatophytes; porum, Epidermophyton and Trichophyton) of fungus that causes skin disease in animals and Microsporum; humans. Conventional methods for identification of these fungi are rapid and simple but are not Epidermophyton; accurate comparing to molecular methods. Trichophyton; Objective: This study aimed to isolate human pathogenic dermatophytes which cause dermato- Tinea phytosis in Riyadh City, Saudi Arabia and to identify these fungi by using conventional and molec- ular methods. Methods: The study was conducted in Medical Complex, Riyadh and King Saud University. Samples of infected skin, hairs and nails were collected from 112 patients. Diagnosis of skin infec- tions, direct microscopic test, isolation and identification of dermatophytes by conventional and molecular methods were carried out. Results: The results indicated that the tinea capitis infection had the highest prevalence among the patients (22.3%) while Tinea barbae had the lowest.
    [Show full text]
  • Lacazia Loboi
    CLOSE ENCOUNTERS WITH THE ENVIRONMENT Fungal Foes: Lacazia loboi Dirk M. Elston, MD; Omar P. Sangüeza, MD obomycosis is a chronic cutaneous infection that may present with keloidal masses, and L nodular, verrucous, or ulcerated lesions. The causative organism, Lacazia (formerly Loboa) loboi, affects dolphins as well as humans and is more com- mon where water salinity is reduced. The Amazon Basin is endemic for the disease, but it is being rec- ognized in other parts of the world such as the Indian River Lagoon in Florida. In the Indian River Lagoon, the disease is more common in the southern portion of the lagoon where fresh water effluents dilute the salt water. In one study, 9 of 30 dolphins from the southern portion of the lagoon were found to have lobomycosis compared to none of the 45 dolphins from the northern portion of the lagoon or estuaries off the coast of South Carolina.1 Human disease occurs mostly in the Amazon Basin. Because of travel, human disease occasion- A B ally has been identified in Europe, the United States, and Canada.2,3 Keloidal or nodular lesions are most common (Figure 1). Squamous cell car- cinoma has been reported in long-standing scars of lobomycosis.4 The diagnosis of lobomycosis is confirmed by biopsy, which demonstrates chains of large spheri- cal organisms (6–12 μm in diameter) resembling a child’s pop beads. The chains are more eas- ily identified with Gomori methenamine-silver or periodic acid–Schiff stains (Figure 2). In tissue, the organisms reach larger sizes in humans than in dolphins.5 Lacazia loboi is closely related to Paracoccidioides brasiliensis and both demonstrate Accepted for publication September 8, 2008.
    [Show full text]
  • Chromoblastomycosis
    REVIEW crossm Chromoblastomycosis Flavio Queiroz-Telles,a Sybren de Hoog,b Daniel Wagner C. L. Santos,c Claudio Guedes Salgado,d Vania Aparecida Vicente,e Alexandro Bonifaz,f Emmanuel Roilides,g Liyan Xi,h Conceição de Maria Pedrozo e Silva Azevedo,i Moises Batista da Silva,j Zoe Dorothea Pana,g Arnaldo Lopes Colombo,k l Thomas J. Walsh Downloaded from Department of Public Health, Hospital de Clínicas, Federal University of Paraná, Curitiba, Paraná, Brazila; CBS- KNAW Fungal Biodiversity Centre, Utrecht, The Netherlandsb; Special Mycology Laboratory, Department of Medicine, Federal University of São Paulo, São Paulo, Brazilc; Dermato-Immunology Laboratory, Institute of Biological Sciences, Federal University of Pará, Marituba, Pará, Brazild; Microbiology, Parasitology and Pathology Graduation Program, Department of Basic Pathology, Federal University of Paraná, Curitiba, Paraná, Brazile; Dermatology Service and Mycology Department, Hospital General de México, Mexico City, Mexicof; Infectious Diseases Unit, 3rd Department of Pediatrics, Aristotle University School of Health Sciences and Hippokration General Hospital, Thessaloniki, Greeceg; Department of Dermatology, Sun Yat-sen Memorial Hospital, Sun Yat- h sen University, Guangzhou, China ; Department of Medicine, Federal University of Maranhão, Vila Bacanga, http://cmr.asm.org/ Maranhão, Brazili; Dermato-Immunology Laboratory, Institute of Biological Sciences, Pará Federal University, Marituba, Pará, Brazilj; Division of Infectious Diseases, Paulista Medical School, Federal University
    [Show full text]
  • Imported Mycoses: Some Diagnostic Problems W
    Postgrad Med J: first published as 10.1136/pgmj.55.647.598 on 1 September 1979. Downloaded from Postgraduate Medical Journal (September 1979) 55, 598-602 Imported mycoses: some diagnostic problems W. ST C. SYMMERS M.D. Charing Cross Hospital and Medical School, The Reynolds Building, St Dunstan's Road, London W6 8RP Summary Trichophyton and possibly of other fungi that cause Infections by actinomycetes or by true fungi may cause dermatophytosis may invade the subcutaneous diagnostic difficulties in countries where they are not tissues and eventually give rise to distant lesions as a familiar. Illustrative cases from a series of 353 result of spread by the lymphatics or in the blood instances are given together with rare indigenous stream. examples of the same infections. Early, accurate In any case of the infections listed above, and diagnosis is essential for rational and effective particularly in any case of those infections that occur treatment. less frequently in Europe than in other parts of the world, the possibility that infection took place while Introduction the patient was resident or travelling outside Europe The first, and in many cases the greatest, problem ought to be considered. None of the infections is in the correct clinical management of mycoses is their confined to Europe. In contrast, some important recognition. In general, delay in the diagnosis of mycoses do not occur naturally in north-westernProtected by copyright. mycoses results primarily from failure to consider Europe. that a fungal or actinomycetous infection may be the cause of a patient's symptoms. In this respect the Mycoses not indigenous in north-western Europe problem is a commonplace one, not confined to Blastomycosis (caused by Blastomyces dermati- mycoses: its solution lies in greater knowledge and tidis); coccidioidomycosis; histoplasmosis, including greater awareness of diagnostic possibilities.
    [Show full text]