Development of Bifunctional Alkylating Agents for Association and Migration along DNA

By Mark A. Hutchinson

A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy

Baltimore, Maryland August 2016

© 2016 Mark A. Hutchinson All rights reserved

Abstract

Environmental toxins and a number of drugs have been shown to react with and cause damage to cellular components including DNA. Alkylation of DNA has been shown to result in mutations that may cause detrimental effects to the cell, including cancer. One class of DNA alkylating agents is methides (QM). These compounds are highly electrophilic and are generated by a variety of anti-cancer compounds such as mitomycin C. In order to further understand their ability to alkylate

DNA both their selectivity and mechanism of action must be studied.

These intermediates have been shown to form from metabolism inside of cells and have been found to alkylate DNA in both an irreversible and reversible manner. The reversible DNA adducts may persistent enough to elicit a cellular response, but are difficult to observe for standard analysis. In order to study the QMs ability to alkylate

DNA, a simple QM was used to observe reversible DNA adducts. These adducts could be irreversibly trapped through the use of bis[(trifluoroacetoxy)iodo]benzene (BTI). Once oxidized through the use of BTI, the reversible QM-DNA adducts could withstand lengthy analysis (>24 h) for detection by LC/MS analysis.

Additionally, QMs have been synthesized as bifunctional alkylating agents capable of forming interstrand crosslinking within DNA (BisQM). Once crosslinked,

BisQM is able to exploit the reversible nature of their DNA-adducts providing a potential to migrate along DNA. This has been shown through the use of a BisQM containing an acridine moiety for the association to DNA, however migration was relatively slow (~5% interstrand crosslinks (ISC) after 7 days)). By exchanging the DNA associating moiety

ii from acridine to ammonium complexes, the molecule might be able to slide along the backbone of DNA and allow the QM to migrate rapidly. Several new BisQMs containing varying amounts of positive charges and electron density were synthesized. These compounds had a lower association to DNA than its BisQM acridine counterpart, but were able to generate ISC at a faster rate (~4 h). However, these compounds were unable to exhibit high ISC yields in strand transfer, exchange, or migration. Through additional modifications of BisQMs it is possible to increase the ability of the compounds to associate and migrate along DNA.

Thesis Advisor: Dr. Steven E. Rokita Readers: Dr. Marc M. Greenberg, Dr. John P. Toscano

iii

Dedication: For my Grandparents: Stephen Donald and Mary Elizabeth Hutchinson

iv

Acknowledgements

First and foremost, I would like to thank my advisor Dr. Rokita for the opportunity to work on this project. I could not have asked for a better mentor. You have always given me the support and motivation to further develop myself into a better scientist. You have always been there for discussion with an open mind for the freedom to advance my project and make it my own. I always left your office more confident in the progress and path that the project was heading, as well as in my own abilities. I cannot thank you enough for your continuing support and encouragement throughout these years. I hope to remain close as colleagues and friends.

I would also like to thank my committee members Dr. Greenberg and Dr.

Toscano for taking the time out of their busy schedules to accommodate me. Dr.

Greenberg, thank you for allowing me to audit your nucleic acids course to improve my knowledge of chemistry as well as opening your lab doors for any questions I might have had in regards to troubleshooting PAGE analysis. I would also like to thank Dr. Toscano for assisting me in my job search with the letters of recommendations and allowing me to stop by your lab to talk science and football with Tyler. Also thank you for being so kind as to lend me several compounds here and there for small scale trail reactions.

Thank you to all of the other Johns Hopkins professors who taught my classes and a special thank you to those that I had the privilege to TA for. I would like to specifically thank Dr. Cathy Moore and Joel Tang for their help with NMR experiments and for improving my knowledge of the instruments and their capabilities. Also, a special thank you to Dr. Phil Mortimer for running all of my FAB-HRMS samples and maintaining all

v of the instrumentation to include the LC-MS and UPLC; these instruments were invaluable to my research. Additionally, thank you to the staff here at Johns Hopkins for always being available to take care of ordering, scheduling, printing, and being able to answer any question that I had. I’d also like to thank the staff for the happy hours and holiday parties; they were always a great treat to the end of a week in the lab.

Thank you to all members of the Rokita Lab, both past and present. Everyone was a privilege to work with and was extremely friendly and welcoming from the day I joined. Especially thank you, Dr. Mike McCrane for showing me the ropes when I first joined the lab and allowing me to assist on his project which resulted in my first publication. My desk-mate Dr. Petrina Boucher for being there to talk to and listening when things weren’t working. Our discussions were very useful to my research. Dr.

Abhishek Phatarphekar, thank you for making the lab fun to come to, especially during football season and for all of your assistance and comradery during the writing of our theses. A final thank you to Shane Byrne for saving me several trips into Baltimore by coming in at odd times to freeze time points for me; good luck with the rest of grad school. I’m happy to be handing the project over to you and I know that it is in good hands.

I would like to thank my Mom and Dad for their continued support not only throughout graduate school but in everything that I’ve ever embarked upon. Thank you to my brother David for always being there when I needed a break from chemistry. Thank you to my sister Kelly and brother-in-law Jason for your assistance in preparing me for graduate school entrance exams while I was in Afghanistan, and for listening and reassuring me about my project and graduate school. Additionally I would like to thank

vi my cousin Erin for being there for me while down in the DMV area, and my Aunt

Theresa for all of her support, encouragement, and always being there to share a beer with. Lastly, thank you to all of the Marines and Sailors that I’ve had the honor of serving with. You are an inspiration for achieving all that I have. Semper Fidelis.

Finally, thank you to my loving wife Alison. You have been my biggest supporter during my time in graduate school. Thank you for putting up with all of the complaining, unknown times I’d be home, and the early morning start to the work days. Words cannot explain how much you mean to me and I can never thank you enough for all you’ve done to help me pursue this endeavor. I love you and cannot wait to start the next chapter of our lives together. Tungsten and Bella, thank you for the unconditional love you gave me each and every day that I came home. You made even the worst days of failed experiments so much better.

vii

Table of Contents Abstract ...... ii Dedication: ...... iv Acknowledgements ...... v List of Figures ...... xi List of Schemes ...... xiv List of Tables ...... xvi List of Supporting Figures ...... xvii List of Abbreviations ...... xxii Chapter 1: Introduction ...... 1 Chapter 1.1. Deoxyribonucleic Acid ...... 1 1.2. DNA Damage and Repair ...... 3 1.2.1 DNA Damage ...... 3 1.2.1 DNA Repair ...... 4 1.3. DNA Alkylation ...... 5 1.3.1 Reversible and Non-Reversible Alkylation ...... 5 1.3.2 Non-Reversible Alkylating Agent ...... 6 1.3.2 Reversible Alkylating Agent ...... 8 1.4. Quinone Methides ...... 10 1.4.1. Quinone Methides as Alkylating Agents ...... 10 1.4.2. Quinone Methides and Migration ...... 12 Chapter 2: Oxidative Trapping of a Model Quinone Methide on dA-N1 and Analysis of Adducts in Single and Double Stranded DNA ...... 17 2.1 Introduction ...... 17 2.2 Results and Discussion ...... 18 2.2.1 Trapping and Characterization of dA-N1 ...... 18 2.2.2 Deglycosylation of dG-N7 Adduct ...... 25 2.2.3. Trapping Studies of o-QM with ssDNA and dsDNA ...... 27 2.3. Summary ...... 30 2.4. Materials and Methods ...... 30 2.4.1. Materials ...... 30 2.4.2. Methods ...... 31

viii

2.4.2.2. Oxidative Trapping and Detection of MeQM-DNA Adducts in DNA .... 32 Chapter 3: Development of a New Quinone Methide Precursor for Association and Migration along DNA...... 34 3.1. Introduction ...... 34 3.2. Results and Discussion ...... 35

3.2.1. Synthesis of BisQMPN1 ...... 35 3.2.1.1. Tyramine as a Starting Material ...... 35 3.2.1.2. 4-Hydroxyphenethyl Bromide ...... 37 3.2.1.3. 3 (4-Hydroxyphenyl)propanoic acid ...... 37 3.2.1.4. Acetylation of Benzylic TBDMS Alcohols ...... 39

3.2.1.5. Methylation of Tertiary Amine – (BisQMPN1) ...... 40

3.2.2. Synthesis of BisQMPN2 ...... 42

3.2.3. Synthesis of BisQMPN3 ...... 44 3.2.3.1. Triamination of Compound 5...... 44

3.2.4. Reaction of BisQMPNx with DNA ...... 47 3.2.4.1 Aggregation of DNA through Noncovalent Interactions with Amines ..... 47

3.2.4.2. Concentration Dependence of BisQMPNx ...... 52 3.2.4.3. Time Dependence for the Formation of Interstrand Crosslinks ...... 53

3.2.4.4. Strand Transfer and Exchange of BisQMPNx ...... 54

3.2.4.4. Migration of BisQMPN2&3 ...... 57 3.3. Summary ...... 59 3.4. Materials and Methods ...... 60 Chapter 4: Development of an Electron Rich Bis-Quinone Methide for Association and Migration along DNA...... 72 4.1. Introduction ...... 72 4.2. Results and Discussion ...... 74

4.2.1. Synthesis of eBisQMPN2&3 ...... 74

4.2.2. Reaction of eBisQMPN2&3 with DNA ...... 75

4.2.2.1. Concentration Dependence of BisQMPN2&3 ...... 76 4.2.2.2. Time Dependence for the Formation of Interstrand Crosslinks ...... 77

4.2.2.3. Quenching of eBisQMPN2&3 ...... 78

4.2.2.4. Strand Transfer and Exchange of eBisQMPN2&3 ...... 79

4.2.2.5. Migration of eBisQMPN2&3 ...... 81

ix

4.2.2.6. Over Alkylation of ssDNA ...... 82 4.3. Summary ...... 84 4.4 Materials and Methods ...... 85 4.4.1 Materials ...... 85 4.4.2 Methods ...... 85 Chapter 5: Synthesis of Di-Quinone Methides...... 95 5.1 Introduction: ...... 95 5.2 Results and Discussion ...... 98

5.2.1 Synthesis of Di-QMPNx ...... 98 5.2.1.1 Hydroxymethylation ...... 98 5.2.1.2 TBDMS Protection ...... 99

5.2.1.3 Amination and Coupling of DiQMNx Precursors ...... 100 5.2.1.4 Benzylic TBDMS Cleavage ...... 101 5.2.1.5 Acetylation ...... 102 5.2.1.6 Methylation of Amines ...... 103 5.2 Summary ...... 104 5.3 Materials and Methods ...... 105 5.3.1 Materials ...... 105 5.3.2 Methods ...... 105 Chapter 6: Conclusions ...... 112 References ...... 116 Appendix A: Supporting Information for Chapter 2 ...... 121 Appendix B: Supporting Information for Chapter 3 ...... 124 Appendix C: Supporting Information for Chapter 4 ...... 145 Appendix D: Supporting Information for Chapter 5 ...... 157 Curriculum Vitae ...... 168

x

List of Figures

Figure 1.1 Structure and numbering of the bases of DNA ...... 1

Figure 1.2 Double helical structure of DNA and base pairing ...... 2

Figure 1.3 Types and adducts of mono and bifunctional alkylation ...... 3

Figure 1.4 Structure of nucleotide linkage and location of strong (red) and weak (green)

nucleophiles ...... 6

Figure 1.5 Structure of tri-nuclear bifunctional platinum agent ...... 9

Figure 1.6 Chemical structure of BisQMP containing an acridine group for the

association to DNA ...... 15

Figure 2.1 HPLC analysis of MeQM-dA-N1 decomposition over 72 h...... 20

Figure 2.2 HPLC analysis of a “one-pot” MeQM-dA-N1oxidation...... 22

Figure 2.3 Chemical structure of MeQM-dA-N1 oxidized adduct ...... 24

1 13 Figure 2.4 H- C HMBC of oxidized product MeQM-dA-N1 in DMSO-d6...... 24

1 13 Figure 2.5 H- C HMBC of oxidized product MeQM-dA-N1 in DMSO-d6 connectivity

of H2 to C10...... 24

Figure 2.6 Formation of QM-G-N7 adducts through deglycosylation of QM-dG-N7

adducts over time ...... 26

Figure 2.7 Synthesized complementary oligonucleotide sequences used as a model of

ssDNA and ss DNA. (OD1 and OD2 are complementary) ...... 28

Figure 2.8 1 h and 24 h alkylation and oxidative trapping of MeQM with ssDNA and

dsDNA...... 29

xi

Figure 3.1 Chemical structure of BisQMPNs with varying ammonium linkers ...... 35

Figure 3.2 DNA sequences used for the detection of ISC and migration of BisQMPNx

along DNA ...... 47

Figure 3.3 Formation of DNA crosslinks using varying concentrations of 3.8, 3.12 ...... 48

Figure 3.4 Formation of DNA crosslinks at varying concentrations of 3.8 and 3.12 ...... 49

Figure 3.5 Formation of DNA crosslinks at varying concentrations of 3.8 and 3.12 ...... 50

Figure 3.6 Formation of DNA crosslinks at varying concentrations of 3.8 and 3.12 ...... 51

Figure 3.7 Formation of DNA crosslinks at varying concentrations of 3.12 (diamine) and

BisQMPN2 (diammonium) ...... 52

Figure 3.8 Formation of DNA crosslinks at varying concentrations of BisQMPN1,

BisQMPN2, and BisQMPN3...... 53

Figure 3.9 Kinetics of DNA crosslink formation by BisQMPN2 and BisQMPN3...... 54

Figure 3.10 Transfer of intrastrand OD9-BisQMPN2&3 to OD10 ...... 55

Figure 3.11 Strand Exchange of BisQMPN2&3...... 56

Figure 3.12 Strand Exchange of BisQMPN2&3...... 57

Figure 3.13 Migration of BisQMPN2&3...... 58

Figure 3.14 Migration of BisQMPN2&3 utilizing sticky ends/ toe holds of DNA ...... 59

Figure 4. 1 Migration of BisQMPs along DNA ...... 73

Figure 4.2 DNA sequences used for the detection of ISC and migration of eBisQMPNx

along DNA ...... 75

Figure 4.3 Formation of DNA crosslinks at varying concentrations of eBisQMPN2&3 .. 76

Figure 4.4 Kinetics of DNA crosslink formation by eBisQMPN2 and eBisQMPN3...... 77

xii

Figure 4.5 Kinetics of eBisQMPN2 and eBisQMPN3 quenching ...... 78

Figure 4.6 Transfer of intrastrand OD9-eBisQMPN2&3 to OD10...... 80

Figure 4.7 Strand Exchange of eBisQMPN2&3 ...... 81

Figure 4. 8 Migration of eBisQMPN2&3...... 82

Figure 4. 9 Kinetics of DNA alkylation eBisQMPN3...... 83

Figure 5.1 Chemical structures of DiQMPN2 and DiQMPN3 designed to form ISC ..... 97

Figure 5.2 Chemical structure and 1H-13C HSQC of compound 5.4 ...... 100

xiii

List of Schemes

Scheme 1.1 Effectors and consequences of DNA damage...... 5

Scheme 1.2 Mechanism of nitrogen mustard alkylation of DNA ...... 7

Scheme 1.3 Mechanism of cisplatin metalation of DNA ...... 7

Scheme 1.4 Mechanism of mitomycin C activation and alkylation of DNA ...... 8

Scheme 1.5 Structure and formation of acrolein-DNA adducts ...... 9

Scheme 1.6 Structure and formation of QM adducts ...... 10

Scheme 1.7 Mechanism of BHT activation and alkylation of dC-N3 and dG-N7 ...... 11

Scheme 1.8 Mechanism of NO-NSAID activation and formation of o-QM ...... 12

Scheme 1.9 Activation of a simple QM through fluoride assisted silyl deprotection ...... 13

Scheme 1.10 o-QM-dN adducts. Reversible adducts are labeled in blue and irreversible

adducts are labeled in red. Adapted from ...... 14

Scheme 2.1 Proposed mechanism for BTI oxidation of MeQM ...... 17

Scheme 2.2 Dimroth rearrangement of dA-N1 to dA-N6 ...... 19

Scheme 2.3 Formation and oxidative trapping of dA-N1 adduct ...... 21

Scheme 2.4 Oxidized MeQM-dN adducts...... 27

Scheme 2.5 LC/MS based assay for detecting labile products of DNA alkylation by

MeQM oxidative trapping...... 28

Scheme 3.1 Migration of BisQMs along DNA ...... 34

Scheme 3.2 Dihydroxymethylation of tyramine ...... 36

xiv

Scheme 3.3 Dihydroxymethylation of hydroxyphenethyl bromide ...... 37

Scheme 3.4 Attempted synthetic routes for the production of compound 3.6 ...... 39

Scheme 3.5 Selective benzylic TBDMS deprotection and acetylation ...... 40

Scheme 3.6 Proposed cell permeability, internalization, and accumulation of BisQMPN1

...... 41

Scheme 3.7 Methylation of compound 3.8 ...... 42

Scheme 3.8 Synthetic route of BisQMPN2 ...... 43

Scheme 3.9 Attempted triamination of 3.5 ...... 45

Scheme 3.10 Synthesis of BisQMPN3 ...... 46

Scheme 4.1 Synthetic of eBisQMPN2 and eBisQMPN3 ...... 75

Scheme 5.1 Activation of BisQMPs vs. DiQMPs and their ability to react with DNA .. 96

Scheme 5.2. Proposed mechanism of catechol oxidation and ISC...... 97

Scheme 5.3 Monohydroxymethylation of 4-(2-bromoethyl)phenol ...... 98

Scheme 5.4 TBDMS protection of compound 5.3 ...... 99

Scheme 5.5 Attempted DiQMPN2 coupling ...... 100

Scheme 5.6 Coupling of 5.4 for DiQMPN2 and DiQMPN3 precursors ...... 101

Scheme 5.7 Selective benzylic TBDMS deprotection 5.5 and 5.9 ...... 102

Scheme 5.8 Acetylation of 5.6 and 5.10 ...... 102

Scheme 5.9 Methylation of 5.7 and 5.8 for the production of compounds DiQMPN2 and

DiQMPN3 ...... 104

xv

List of Tables

Table 2.1 13C and 1H- NMR data for MeQM-dA-N1 adduct with HMBC connectivity.25

xvi

List of Supporting Figures

Figure A.1 1H-NMR of Oxidized MeQM-dA-N1 in d6-DMSO at 400 MHz ...... 121

Figure A.2 13C-NMR of Oxidized MeQM-dA-N1 in d6-DMSO at 101 MHz ...... 121

Figure A.3 1H-13C HSQC of Oxidized MeQM-dA-N1 in d6-DMSO at 400 MHz ...... 122

Figure A.4 1H-13C HMBC of Oxidized MeQM-dA-N1 in d6-DMSO at 400 MHz ...... 123

1 Figure B.1 H-NMR of 3.4 in CDCl3 at 400 MHz ...... 124

13 Figure B.2 C-NMR of 3.4 in CDCl3 at 101 MHz...... 124

1 Figure B.3 H-NMR of 3.5 in CDCl3 at 400 MHz ...... 125

13 Figure B.4 C-NMR of 3.5 in CDCl3 at 101 MHz...... 125

1 Figure B.5 H-NMR of 3.6 in CDCl3 at 400 MHz ...... 126

13 Figure B.6 C-NMR of 3.6 in CDCl3 at 101 MHz...... 126

1 Figure B.7 H-NMR of 3.7 in CDCl3 at 400 MHz ...... 127

13 Figure B.8 C-NMR of 3.7 in CDCl3 at 101 MHz...... 127

1 Figure B.9 H-NMR of 3.8 in CDCl3 at 400 MHz ...... 128

1 Figure B. 10 H-NMR of 3.8 in CDCl3 at 400 MHz (1.5 ppm- 2.65 ppm) ...... 128

13 Figure B.11 C-NMR of 3.8 in CDCl3 at 101 MHz ...... 129

1 Figure B.12 H-NMR of 3.9 (BisQMPN1) in CDCl3 at 400 MHz ...... 129

1 Figure B.13 H-NMR of 3.9 (BisQMPN1) in CD3OD at 400 MHz (2.0 ppm- 3.5 ppm)

...... 130

13 Figure B.14 C-NMR of 3.9 (BisQMPN1) in CD3OD 101 MHz ...... 130

1 Figure B.15 H-NMR of 3.10 in CDCl3 at 400 MHz ...... 131

xvii

13 Figure B.16 C-NMR of 3.10 in CDCl3 at 101 MHz ...... 131

1 Figure B.17 H-NMR of 3.11 in CDCl3 at 400 MHz ...... 132

13 Figure B.18 C-NMR of 3.11 in CDCl3 at 101 MHz ...... 132

1 Figure B.19 H-NMR of 3.12 in CDCl3 at 400 MHz ...... 133

1 Figure B. 20 H-NMR of 3.12 in CDCl3 at 400 MHz (1.5 ppm-2.7 ppm) ...... 133

13 Figure B.21 C-NMR of 3.12 in CDCl3 at 101 MHz ...... 134

1 Figure B.22 H-NMR of 3.13 (BisQMPN2) in CD3OD at 400 MHz ...... 134

1 Figure B.23 H-NMR of 3.13 (BisQMPN2) in CD3OD at 400 MHz ...... 135

13 Figure B.24 C-NMR of 3.13 (BisQMPN2) in CD3OD at 101 MHz ...... 135

1 Figure B.25 H-NMR of 3.14 in CDCl3 at 400 MHz ...... 136

13 Figure B.26 C-NMR of 3.14 in CDCl3 at 101 MHz ...... 136

1 13 Figure B.27 H- C HSQC of 3.14 in CDCl3 at 400 MHz ...... 137

1 13 Figure B.28 H- C HMBC of 3.14 in CDCl3 at 400 MHz ...... 137

1 Figure B.29 H-NMR of 3.15 in CDCl3 at 400 MHz ...... 138

13 Figure B.30 C-NMR of 3.15 in CDCl3 at 101 MHz ...... 138

1 13 Figure B.31 H- C HSQC of 3.15 in CDCl3 at 400 MHz ...... 139

1 13 Figure B.32 H- C HMBC of 3.15 in CDCl3 at 400 MHz ...... 139

1 Figure B.33 H-NMR of 3.16 in CDCl3 at 400 MHz ...... 140

13 Figure B.34 C-NMR of 3.16 in CDCl3 at 101 MHz ...... 140

1 Figure B.35 H-NMR of 3.17 in CDCl3 at 400 MHz ...... 141

13 Figure B.36 C-NMR of 3.17 in CDCl3 at 101 MHz ...... 141

1 Figure B.37 H-NMR of 3.18 in CDCl3 at 400 MHz ...... 142

1 Figure B.38 H-NMR of 3.18 in CDCl3 at 400 MHz (1.5 ppm- 2.7 ppm) ...... 142

xviii

13 Figure B.39 C-NMR of 3.18 in CDCl3 at 101 MHz ...... 143

1 Figure B.40 H-NMR of 3.19 (BisQMPN3) in CD3OD at 400 MHz ...... 143

1 Figure B.41 H-NMR of 3.19 (BisQMPN3) in CD3OD at 400 MHz ...... 144

13 Figure B.42 C-NMR of 3.19 (BisQMPN3) in CD3OD at 101 MHz ...... 144

1 Figure C.1 H-NMR of 4.4 in CDCl3 at 400 MHz ...... 145

13 Figure C.2 C-NMR of 4.4 in CDCl3 at 101 MHz ...... 145

1 Figure C.3 H-NMR of 4.5 in CDCl3 at 400 MHz ...... 146

13 Figure C.4 C-NMR of 4.5 in CDCl3 at 101 MHz ...... 146

1 Figure C.5 H-NMR of 4.6 in CDCl3 at 400 MHz ...... 147

13 Figure C.6 C-NMR of 4.6 in CDCl3 at 101 MHz ...... 147

1 Figure C.7 H-NMR of 4.7 in CDCl3 at 400 MHz ...... 148

13 Figure C.8 C-NMR of 4.7 in CDCl3 at 101 MHz ...... 148

1 Figure C.9 H-NMR of 4.8 in CDCl3 at 400 MHz ...... 149

13 Figure C.10 C-NMR of 4.8 in CDCl3 at 101 MHz ...... 149

1 Figure C.11 H-NMR of 4.9 (eBisQMPN2) in CDCl3 at 400 MHz ...... 150

13 Figure C.12 C-NMR of 4.9 (eBisQMPN2) in CDCl3 at 101 MHz ...... 150

1 Figure C.13 H-NMR of 4.10 in CDCl3 at 400 MHz ...... 151

13 Figure C.14 C-NMR of 4.10 in CDCl3 at 101 MHz ...... 151

1 Figure C.15 H-NMR of 4.11 in CDCl3 at 400 MHz ...... 152

13 Figure C.16 C-NMR of 4.11 in CDCl3 at 101 MHz ...... 152

1 Figure C.17 H-NMR of 4.12 in CDCl3 at 400 MHz ...... 153

13 Figure C.18 C-NMR of 4.12 in CDCl3 at 101 MHz ...... 153

1 Figure C.19 H-NMR of 4.13 in CDCl3 at 400 MHz ...... 154

xix

13 Figure C.20 C-NMR of 4.13 in CDCl3 at 101 MHz ...... 154

1 Figure C.21 H-NMR of 4.14 in CDCl3 at 400 MHz ...... 155

13 Figure C.22 C-NMR of 4.14 in CDCl3 at 101 MHz ...... 155

1 Figure C.23 H-NMR of 4.15 (eBisQMPN3) in CDCl3 at 400 MHz ...... 156

13 Figure C.24 C-NMR of 4.15 (eBisQMPN3) in CDCl3 at 101 MHz ...... 156

1 Figure D.1 H-NMR of 5.2 in CDCl3 at 400 MHz ...... 157

13 Figure D.2 C-NMR of 5.2 in CDCl3 at 101 MHz ...... 157

1 Figure D.3 H-NMR of 5.3 in CDCl3 at 400 MHz ...... 158

13 Figure D.4 C-NMR of 5.3 in CDCl3 at 101 MHz ...... 158

1 Figure D.5 H-NMR of 5.4 in CDCl3 at 400 MHz ...... 159

13 Figure D.6 C-NMR of 5.4 in CDCl3 at 101 MHz ...... 159

1 Figure D.7 H-NMR of 5.5 in CDCl3 at 400 MHz ...... 160

13 Figure D.8 C-NMR of 5.5 in CDCl3 at 101 MHz ...... 160

1 Figure D.9 H-NMR of 5.6 in CDCl3 at 400 MHz ...... 161

13 Figure D.10 C-NMR of 5.6 in CDCl3 at 101 MHz ...... 161

1 Figure D.11 H-NMR of 5.7 in CDCl3 at 400 MHz ...... 162

13 Figure D.12 C-NMR of 5.7 in CDCl3 at 101 MHz ...... 162

1 Figure D.13 H-NMR of 5.8 (DiQMPN2) in CD3OD at 400 MHz ...... 163

13 Figure D.14 C-NMR of 5.8 (DiQMPN2) in CD3OD at 101 MHz ...... 163

1 Figure D.15 H-NMR of 5.9 in CDCl3 at 400 MHz ...... 164

13 Figure D.16 C-NMR of 5.9 in CDCl3 at 101 MHz ...... 164

1 Figure D.17 H-NMR of 5.10 in CDCl3 at 400 MHz ...... 165

13 Figure D.18 C-NMR of 5.10 in CDCl3 at 101 MHz ...... 165

xx

1 Figure D.19 H-NMR of 5.11 in CDCl3 at 400 MHz ...... 166

13 Figure D.20 C-NMR of 5.11 in CDCl3 at 101 MHz ...... 166

1 Figure D.21 H-NMR of 5.12 (DiQMPN3) in CD3OD at 400 MHz ...... 167

13 Figure D.22 C-NMR of 5.12 (DiQMPN3) in CD3OD at 101 MHz ...... 167

xxi

List of Abbreviations

BER- Base Excision Repair BisQM- Bi-functional Quinone Methide BisQMP- Bi-functional Quinone Methide Precursor

BisQMPN1- Bi-functional Quinone Methide Precursor (Ammonium x1)

BisQMPN2- Bi-functional Quinone Methide Precursor (Ammonium x2)

BisQMPN3- Bi-functional Quinone Methide Precursor (Ammonium x3) BTI- bis[(triflouroacetoxy)iodo]benzene BHT- Butylated Hydroxytoluene Boc- tert-Butyloxycarbonyl protecting group Calc.- Calculated DiQM- Di-functional Quinone Methide DiQMP- Di-functional Quinone Methide Precursor

DiQMPN2- Di-functional Quinone Methide Precursor (Ammonium x2)

DiQMPN3- Di-functional Quinone Methide Precursor (Ammonium x3) dN- 2’-deoxynucleosides drib- 2’-deoxyribose dsDNA- Double Stranded DNA eBisQMPN2- Electron Rich Bi-functional Quinone Methide Precursor (Ammonium x2) eBisQMPN3- Electron Rich Bi-functional Quinone Methide Precursor (Ammonium x3) EDG- Electron Donating Group ESI- Electrospray Ionization FAB- Fast Atom Bombardment GSH- Glutathione HMBC- Heteronuclear Multiple Bond Correlation HPLC- High Pressure Liquid Chromatography HRMS- High Resolution Mass Spectroscopy

xxii

HSQC- Heteronuclear Single Quantum Correlation IDT- Integrated DNA Technologies ISC- Interstrand Crosslink LAH- Lithium Aluminum Hydride LC/MS- High Pressure Liquid Chromatography - Mass Spectrometry LG- Leaving Group

LN2- Liquid Nitrogen MeI- Methyl Iodine MeQM- 4-methyl o-quinone methide MS- Mass Spectrometry MsCl- Methanesulfonyl chloride NER Nucleotide Excision Repair NMR- Nuclear Magnetic Resonance NO-NSAID- nitric oxide-releasing non-steroidal anti-inflammatory drugs o- ortho OD- Oligodeoxynucleotide o-QM- ortho-quinone methide p- para PAGE- Polyacrylamide Gel Electrophoresis

PBr3- Phosphorus tribromide PCC- Pyridinium Chlorochromate p-QM- para-quinone methide pTsOH- para- toluene sulfonic acid QM- Quinone Methide QMP- Quinone Methide Precursor ssDNA- Single Stranded DNA

TBDMS- tert-butyldimethylsilyl protecting group TBDMS-Cl- tert-butyldimethylsilyl chloride

xxiii

TEA- Triethylamine TEAA- Triethylammonium acetate TLC- Thin Layer Chromatography tr- Retention time UPLC- Ultra High Performance Liquid Chromatography UV-Vis- Ultraviolet-visible spectroscopy

xxiv

Chapter 1: Introduction

Chapter 1.1. Deoxyribonucleic Acid

Deoxyribonucleic acid (DNA) contains all of the genetic information of an organism that in turn regulates all chemical and biological processes within an organism.

DNA consists of four nitrogenous bases; two purines, adenosine (A) and guanine (G), and 2 pyrimidines, thymine (T) and cytosine (C) (Figure 1.1).1

Figure 1.1 Structure and numbering of the bases of DNA

Each nucleoside is linked to a 2’-deoxyribose sugar and coupled via phosphodiester bonds, making up the negatively charged backbone of DNA. The resulting strands of nucleotides hydrogen bond to each other by their respected base pair, a purine to a pyrimidine, A:T and G:C (Figure 1.2).2 With the purines and pyrimidines paired, DNA forms a double helix with the bases hydrogen bonding at the center of the helix thereby leaving the charged backbone exposed to solvent, most commonly water. Salts assist in stabilization of the DNA backbone’s negative charge thereby creating an “ion shell” around the DNA (preferentially (Mg2+)).3

1

Figure 1.2 Double helical structure of DNA and base pairing2

DNA in its naturally occurring double helix has a rise and twist between the bases and around the backbone which creates the major and minor grooves. The major and minor grooves of DNA are named in accordance with their respective size, with the major groove being much wider and shallower than that of the minor groove. This allows for the nucleophilic sites of the major groove to be more exposed and accessible to small molecules and proteins for sequence/site recognition, which naturally occur in the body.1

However, this makes these sites prone to react with unwanted molecules in the body, (i.e. alkylating agents). As DNA is the carrier of all genetic information it is important to study of how DNA is damaged and repaired to preserve the integrity of the genome.

2

1.2. DNA Damage and Repair

1.2.1 DNA Damage

The location and preference of DNA alkylation is responsible for several different types of DNA damage. The general types of DNA damage with respect to alkylation are monoalkylation, intrastrand crosslinking, interstrand crosslinking (ISC), interhelical crosslinking, and DNA-protein crosslinking. (Figure 1.3).4 Monoalkylation occurs when an alkylating agent reacts with one nucleophilic site on DNA or results from the hydrolysis of a bifunctional alkylation agent at one of the two possible electrophilic sites.

The second form of alkylation, intrastrand crosslinking, occurs when a bisalkylating agent binds to two nucleophilic sites on the same strand of DNA. Similarly, bisalkylating agents have the ability to crosslink both strands of duplex DNA. This type of alkylation between strands is extremely detrimental to cells since it prevents separation of DNA strands during replication and may cause cells to initiate apoptosis. Lastly interhelical crosslinking and DNA-protein alkylation occurs when one of the electrophilic sites of a bisalkylating agent is attacked by a nucleophilic site of duplex DNA or any nucleophilic site of a nearby duplex DNA or proteins (cysteine, lysine, , etc.).

Figure 1.3 Types and adducts of mono and bifunctional alkylation

3

1.2.1 DNA Repair

There are hundreds of naturally occurring and synthetic molecules that can interact in an adverse manner within the cell to damage the DNA. To combat the ever present threat of DNA damage, cells have evolved to contain several checkpoints throughout DNA replication that checks for mutations. If mutations are discovered, the cell cycle will halt to allow for repairs to be made by a variety of cell processes. These processes include direct reversal, base excision repair (BER), nucleotide excision repair

(NER), homologous recombination, and if unrepairable, can initiate apoptosis

(programmed cell death).5-8 In many cases, the cell is unable to repair or recognize a mutation in the DNA sequence. This allows the mistake to be replicated through its cell line and the mutation to be replicated exponentially. The effects of these mistakes may not always be harmful to the cell and therefore go unnoticed to the unaffected organism.

However, this is not always the case as some mutations can affect protein folding, cellular processes, and even cause cancer. With cancer being one of the most detrimental consequences of DNA damage and mutation, it is important to study processes that can not only cause damage to DNA but also discover processes that can effectively neutralize and/or kill cancerous cells in the body (Scheme 1.1).

4

Scheme 1.1 Effectors and consequences of DNA damage. Adapted from Shrivastav 9

1.3. DNA Alkylation

1.3.1 Reversible and Non-Reversible Alkylation

Alkylating agents have the ability to damage DNA both reversibly and non- reversibly.6 Non-reversible alkylation occurs with generally weak nucleophiles such as dG-N2, dG-N1, and dA-N6. These adducts form irreversibly due to the nucleophilic center having a poor leaving group ability. Contradictory, reversible adducts tend to form at the more kinetically favorable and stronger nucleophilic sites on DNA: dA-N1, dC-N3, dG-N7 (Figure 1.4). dC-N3 and dA-N1 adducts tend to reduce the of the nucleobases creating a driving effect of the adduct to reversibly eliminate the adduct

(direct reversal). Additionally, in the case of dG-N7, alkylation at this position creates a

5 positive charge on the base, increasing the ability of dG-N7-alkylated adduct to undergo direct reversal, or deglycosylation creating an abasic site.

Figure 1.4 Structure of nucleotide linkage and location of strong (red) and weak (green) nucleophiles

1.3.2 Non-Reversible Alkylating Agent

Nitrogen mustards are among the earliest class of ISC agents and have been widely studied. Nitrogen mustards are non-specific DNA alkylating agents, generally consisting of a bis(2-chloroethyl)amine moiety that can crosslink DNA almost exclusively at 5’-GNC-3’ sequences.10 To crosslink DNA the nitrogen mustard must undergo a four step process which involves two intramolecular Sn2 reactions (Scheme

1.2).11 Most notably, this leads to the formation of a highly electrophilic aziridinium ring containing a localized positive charge on the nitrogen. This positive charge may play an important role in the alkylation of DNA as the charge can associate with the negatively

6 charged backbone of DNA, thereby bringing the alkylating agent into close proximity of the highly nucleophilic dG-N7 position. The aziridinium ring is then attacked by dG-N7 and opened up for a second Sn2 reaction forming another aziridinium ring and alkylating the adjacent dG-N7.

Scheme 1.2 Mechanism of nitrogen mustard alkylation of DNA

Similar to the above alkylating agent, cisplatin (cis-diamminedichloroplatinum) behaves in a like manner as the bifunctional metalation agent. It’s ability to form intrastrand crosslinks has made it useful as an anticancer agent.5, 12 Cisplatin is activated through the displacement of chloride ions by water, creating a highly reactive aquo complex. dG-N7 is able to nucleophilically attack the platinum (II) compound and the process is repeated creating a 5’-GG-3’, or 5’-GNG-3’ intrastrand crosslink (Scheme

1.3). This intrastrand crosslink creates a bend in the DNA of 45° which inhibits the binding of polymerases and DNA repair enzymes, ultimately leading to apoptosis.13

Scheme 1.3 Mechanism of cisplatin metalation of DNA

7

Mitomycin C has also been extensively studied as it is an effective chemotherapeutic agent able to form irreversible ISCs.4, 5 Tumor cells tend to be hypoxic which assists in the reduction of mitomycin C in vivo to form a highly reactive intermediate.14, 15 After reduction, mitomycin C associates to the minor groove of DNA bringing the molecule into a favorable position for the attack of the weak nucleophile, dG-N2.16 This in turn releases a second leaving group creating a second quinone methide intermediate that undergoes nucleophilic attacked by a second dG-N2 on the complementary strand, forming an irreversible ISC (Scheme 1.4). This irreversible ISC prevents DNA strand separation during replication and transcription, ultimately leading to cell death.17

Scheme 1.4 Mechanism of mitomycin C activation and alkylation of DNA

1.3.2 Reversible Alkylating Agent

In addition to cisplatin, a tri-nuclear bifunctional platinum agent has been created and shown to crosslink DNA in a reversible manner (Figure 1.5).13 This compound has a high affinity to DNA through the coordination of its positively charged amines, and has the ability to crosslink DNA through its terminal platinum-chloride moieties as described

8 above. This compound, in addition to being able to form ISC with DNA, has the ability to migrate along DNA through the reversibility of adducts at the dG-N7 position and metalation at an adjacent dG-N7 position.13

Figure 1.5 Structure of tri-nuclear bifunctional platinum agent13

Acrolein (a bis-electrophile) is produced in vivo through lipid oxidation and is found in tobacco smoke with the ability to reversibly crosslink DNA (Scheme 1.5).18, 19

Once the reactive α,β-unsaturated aldehyde is generated and in the presence of DNA, the compound can form ISCs with dG-N2 through initial Michael addition and subsequent nucleophilic attack of the carbonyl carbon by dG-N1 (intramolecularly) or dG-N2 of the complementary strand (ISC). The formation of these adducts can cause excessive stress on the cell which in turn can initiate several repair pathways and even apoptosis.

Scheme 1.5 Structure and formation of acrolein-DNA adducts

9

1.4. Quinone Methides

1.4.1. Quinone Methides as Alkylating Agents

Quinone Methides (QMs) represent a unique class of compounds that have the ability to alkylate DNA in both a reversible and non-reversible manner depending on the location of alkylation. QMs are highly reactive electrophilic species often generated through metabolic activity to either their ortho (o-QM) or para (p-QM) form. These unique compounds behave as Michael acceptors and are susceptible to nucleophilic attack (Scheme 1.6).20 As an alkylating agent it is important that the QM be activated in the presence of DNA nucleophiles, as the highly reactive intermediate can be quenched by formation of an irreversible adduct with water. Once activated through oxidation, photolysis, or fluoride induced desilylation, the QM loses aromaticity.20 This loss of aromaticity is the driving force behind the compound’s reactivity, as the compound will want to regain the stabilizing force of aromaticity.20-22

Scheme 1.6 Structure and formation of QM adducts

10

In addition to acrolein, QMs have the ability to reversibly alkylate DNA at the kinetically favorable nucleophilic sites mentioned previously. An example of reversible

QM activity is seen in butylated hydroxyl toluene (BHT), a food preservative. BHT is oxidized by cytochrome P450 to form a p-QM which has been shown to reversibly alkylate DNA at dG-N7 and dC-N3.23 The reversible dG-N7 adduct has also been observed to decompose through a deglycosylation pathway, effectively trapping the QM in an irreversible manner with the nucleotide, resulting in the formation of an abasic site

(Scheme 1.7). However, dC-N3 has only demonstrated the ability to undergo direct reversal, ultimately regenerating the p-QM and allowing for its reaction with additional nucleophiles. This process can occur over several iterations in which the compound is trapped and released. This repetitive reaction may lead to an increase of in vivo toxicity of the compound.

Scheme 1.7 Mechanism of BHT activation and alkylation of dC-N3 and dG-N7

11

Moreover, a QM precursor has been used as a hybrid drug involving the coupling of two pharmacophores for the additive effect of both drugs and/or the counterbalancing of known side effects from the other.24 An example of this is offered by a nitrogen oxide non-steroidal anti-inflammatory drug (NO-NSAID) which is transformed metabolically and releases a QM (Scheme 1.8).25-27 The development of this QM releasing compound has been reported to react with cellular glutathione (GSH). This in turn depletes the cellular and has the potential to further inhibit cell growth creating and acting as an antitumor agent.28

Scheme 1.8 Mechanism of NO-NSAID activation and formation of o-QM

1.4.2. Quinone Methides and Migration

As previously mentioned, QMs as DNA alkylating agents possess several unique properties. These properties include reversibility, modification of substituents for association to DNA (intercalation/charge), and modifications for the tuning of rate of reversibility which can be manipulated in order to create not only monoalkylation but also intra- and interstrand crosslinks. A model QM utilized by the Rokita group is

12 activated by a fluoride assisted deprotection of a silyl ether ortho to a benzylic leaving group which is expelled during deprotection to produce the o-QM (Scheme 1.9).29

Scheme 1.9 Activation of a simple QM through fluoride assisted silyl deprotection

This highly reactive intermediate in the presence of DNA has been observed to react with kinetic preference at dA-N1, dG-N7, and dC-N3, but creates highly reversible adducts

(Scheme 1.10, Blue).30 The reversibility of the QM-DNA adduct can greatly increase the overall lifetime of the QM and it’s in vivo toxicity.4, 23 Repair pathways may lead to release of the QM which can be subsequently followed by the additional nucleophilic attack of DNA and ultimately re-damaging the newly repaired DNA. Weaker nucleophiles of DNA are thermodynamically stable with respect to QMs but do not exhibit good leaving group ability. This leads to the formation of irreversible QM-DNA adducts at dA-N6, dG-N1, and dG-N2, rendering the QM inactive (Scheme 1.10 Red).

13

Scheme 1.10 o-QM-dN adducts. Reversible adducts are labeled in blue and irreversible adducts are labeled in red. Adapted from Weinert30

The Rokita lab has synthesized and studied a BisQM that is activated in the same manner as the monoalylating agent mentioned before, but contains two sites for alkylation on the same central ring system capable of inducing ISC.31 The basic molecule of the BisQM has been shown to have a low affinity for DNA by itself, but has been modified to contain an acridine linker to the QM in the para position to assist in the association to DNA (Figure 1.6).32

14

Figure 1.6 Chemical structure of BisQMP containing an acridine group for the association to DNA32

The acridine appendage increases the affinity for DNA by intercalation, thereby bringing the QM into close proximity to the nucleophilic sites of DNA. Without coordination of the QM to DNA through the utilization of π-π stacking with the acridine linker, the QM can be quenched by water creating an irreversible mono adduct, or inert/ hydrolyzed QM, unable to produce ISC.32, 33 With the exploitation of the acridine anchor assisting in the association to DNA, the reversible QM could allow for the migration along the length of

DNA, as it will be held in proximity of DNA nucleophiles.33 The reversibility and ability of the molecule to migrate along DNA serves a dual purpose as introduction of a crosslinking agent that can reversibly alkylate DNA may assist in evading DNA repair.

This can occur as the regenerated QM can be readily attacked by additional nucleophilic sites of the repaired DNA. This is assisted by being held in proximity of DNA through the coordination of the acridine linker. As tumors have often developed mechanisms of

15 resistance to bifunctional alkylating and other cancer agents the development of a bifunctional ISC agents that can evade repair enzymes may prove to be a more effective form of chemotherapy.5 Therefore it is the goal of this dissertation to develop new bifunctional QM moieties that have the ability to associate, crosslink, and migrate along

DNA.

16

Chapter 2: Oxidative Trapping of a Model Quinone Methide on dA-N1 and Analysis of Adducts in Single and Double Stranded DNA

2.1 Introduction

Observation and study of transient DNA adducts are important for determining the molecular basis of toxicity as well as possibly shaping the future development of more effective chemotherapeutics. However, reversible quinone methide-DNA adducts are difficult to observe since they do not survive assays for detection that tend to involve lengthy enzymatic digestion, purification, and analysis though liquid chromatography- mass spectrometry (LC/MS) and/or ultra-high pressure liquid chromatography with tandem mass spectrometry (UPLC-MS) (> 24 h).34, 35 This is due to the lability of the

QMs and the leaving group ability of the nucleotide of the dN-QM adduct.22, 30, 36 These reversible QM intermediates are able to be oxidatively de-aromatized through the use of a

4-methyl ortho-quinone methide (MeQM). This compound can be selectively oxidized thought the use of bis[(trifluoroacetoxy)iodo]-benzene (BTI) ultimately quenching the reversibility of the QM and allowing for the observation of the associated kinetic products (Scheme 2.1).22, 37

Scheme 2.1 Proposed mechanism for BTI oxidation of MeQM

17

2.2 Results and Discussion

2.2.1 Trapping and Characterization of dA-N1

Initial trapping studies for the characterization of MeQM-DNA adducts were conducted as previously developed by McCrane et al for which the reversible adducts

(dC-N3, dG-N7, dG-N2, dG-N1, and dA-N6) were isolated by HPLC, concentrated by lyophilization, and characterized by NMR.22, 29, 38 In order to fully develop and characterize all MeQM-DNA adducts on dsDNA, the isolation and characterization of the final MeQM-DNA adduct (dA-N1) was needed. Alkylation of dA-N1 by MeQM was initiated using KF, and formation of the adduct was obtained after 30 mins as detected by

HPLC purification using a gradient of 22- 27.5% CH3CN and ammonium formate buffer

(10 mM, pH 6.8). The QM-dA-N1 adduct was collected at a retention time (tr) of ~20 min, lyophilized, and the resulting product oxidized with BTI to yield the irreversible adduct obtained after HPLC purification. However, this method proved ineffective as the reversible product appeared to decomposed when oxidized and did not give the desired corresponding product as several peaks were observed by HPLC analysis. As the dA-N1 alkylated product required ~16 hours to fully lyophilize, the dA-N1 adduct may have begun to form the irreversible dA-N6 adduct through the inherent reversibility of the dA-

N1 adduct, or a Dimroth rearrangement (Scheme 2.2).39, 40

18

Scheme 2.2 Dimroth rearrangement of dA-N1 to dA-N6 Modified36

In addition to the possibility of the adduct converting to the irreversible dA-N6 adduct, it is possible though lyophilization that the concentration of acid in the buffering system decomposed the desired product.23 To confirm that a loss of product was occurring, the lyophilized samples of dA-N1 alkylated adduct was dissolved in a 1:1

CH3CN: H2O solution and reinjected for HPLC analysis under the same initial conditions for dA-N1 purification. The MeQM-dA-N1 adduct did indeed degrade and after a time course of 72 hours had fully decomposed (Figure 2.1).

19

Figure 2.1 HPLC analysis of MeQM-dA-N1 decomposition over 72 h. Lyophilized samples were dissolved in 1:1 CH3CN: H2O (200 µL) at the indicated time and analyzed using a semi-prep column (5 mL/min). Injection volume was 200 µL.

In an attempt to limit the amount of time from alkylation to oxidation, the alkylated dA-N1 samples were collected and concentrated under reduced pressure at temperatures < 40° C over 10 min. Oxidation of the resulting product and purification by

HPLC again did not yield the desired product, again suggesting decomposition, (observed through NMR and MS analysis).

To avoid this unexpected decomposition, a one-pot alkylation and immediate subsequent BTI oxidation was performed in order to give the corresponding dA-N1 oxidized product. Alkylation was carried out at 37°C for 20 mins by the addition of

MeQMP to a solution of dA in phosphate buffer (pH 7) and KF. The reaction mixture

20 was then transferred to a glass reaction vial and oxidized by the addition of 200 µL BTI

(200 mM) and stirred at room temperature for an additional 5 mins (Scheme 2.3).

Scheme 2.3 Formation and oxidative trapping of dA-N1 adduct37

21

The solution went from clear to bright fluorescent yellow after immediate addition of the

BTI changing to a final orange-brown color after 5 min. The reaction was diluted by the addition of H2O (100 µL), washed with saturated ether, filtered, (as per materials and methods), and fractionalized by HPLC. The resulting chromatogram gave three distinct peaks which were identified by 1H-NMR and electrospray ionization mass spectra (ESI) as unreacted dA, (tr= 15 min), dA-N1 as a diastereotopic pair (tr= 28 min, m/z 370

+ (M+H) ), and an unstable adduct (tr=38 min) which decomposed over time observed by

1H-NMR (Figure 2.2).

Figure 2.2 HPLC analysis of a “one-pot” MeQM-dA-N1oxidation. The MeQM-dA-N1 adduct was generated in situ prior to oxidation by BTI. The reaction was analyzed by HPLC using a 3-33% gradient of acetonitrile in 10 mM ammonium formate at pH 6.9 over 60 mins (5 mL/min).

22

The observed diasteriomers were indicative of a spiro-compound similar to that of dC-N3 previously characterized by McCrane et al.22 Further characterization of the dA-

N1 adduct was done by HRMS (FAB), 1H NMR, 13C NMR, 1H-13C HSQC, and 1H-13C

HMBC experiments (Appendix A) Initial ESI+-MS detected a m/z of 370, consistent of the expected spiro-compound (calc m/z 370 (M+H)+) and not the para-quinol derivative

(calc. m/z 388 (M+H)+). Assignments of NMR signals for the nucleotide dA were assigned from previously established literature values.41 Additional assignments of the spiro-compound were further established with the aid of previously published dC-N3 oxidation.22, 42 Signals which were most indicative of the suggested structure were the assignments of the C11, which was confirmed through 1H-13C HMBC by its connectivity to protons H10A&B (Figure 2.3). Additionally, the chemical shift of C11 was 73.7 ppm which is most indicative of an sp3 hybridized carbon, as compared to an sp2 hybridized carbon ranging between (100 and 150 ppm). Moreover, the splitting of H10A&B (4.30 ppm and 4.07 ppm, J= 11.2 Hz) was observed to be a quartet of doublets instead of the predicted singlet, further supporting the formation of diasteriotopic pairs (Figure 2.4).

Lastly, connectivity of H2 to C10 confirms that the QM adduct is indeed present, as connectivity between these signals can only occur though the bonding at the N1 position of dA (Figure 2.5). Connectivity and chemical shift of MeQM-dA-N1 are further shown in Table 2.1

23

Figure 2.3 Chemical structure of MeQM-dA-N1 oxidized adduct

1 13 Figure 2.4 H- C HMBC of oxidized product MeQM-dA-N1 in DMSO-d6.

1 13 Figure 2.5 H- C HMBC of oxidized product MeQM-dA-N1 in DMSO-d6 connectivity of H2 to C10.

24

Table 2.1 13C and 1H- NMR data for MeQM-dA-N1 adduct with HMBC connectivity

HMBC Position 13C shift (ppm) 1H shift (ppm) Connectivity 1' 83.66 6.23 (t, J=6.3Hz) 2', 3' ,4 2' 39.51 2.27,2.58 (m) 3' 70.65 4.37 (m) 1', 2', 4', 5' 4' 87.92 3.84 (m) 1', 2', 3', 5' 5' 61.61 3.52,3.57 (m) 2 144.23 8.11 (s) 1', 2, 8 4 144.32 1', 2, 8 5 119.69 8 6 151.40 2, 8, 10 8 137.62 8.18 (d, J=1.52Hz) 1' 4.07 (d, J=11.1Hz), 4.30 (d, 10 53.74 J=11.1Hz) 2, 17 11 73.65 10, 13 12 200.26 10, 14, 16 13 123.59 6.00 (d, J=9.3Hz) 14 146.32 7.06 (dd, J= 9.9, 2.3 Hz) 16, 17 15 128.77 13, 14, 17 16 136.98 6.08 (bd, J=8.34Hz) 10, 14, 17 17 20.50 1.93 (d, J=1.52Hz) 14, 16

2.2.2 Deglycosylation of dG-N7 Adduct

As deglycosylation of dG-N7 adducts is spontaneous, the length of time needed for complete deglycosylation was needed in order to prevent the observation of both

MeQM-dG-N7 and MeQM-G-N7 adducts. To observe the degradation of MeQM-dG-N7 adducts over time, dG-N7 was alkylated (as per experimental) and fractionalized by

HPLC. Fractions were collected at 20 mins, frozen by LN2, and lyophilized to a white solid. Lyophilized products were then treated with BTI for 5 mins, quenched with H2O, washed with ether, filtered, and fractionalized by HPLC. Oxidized MeQM-dG-N7 products were collected, frozen with LN2, and lyophilized to a yellow solid. Once

25 lyophilized the product was dissolved in triethylamine acetate (TEAA) buffer 100 mM, pH 10, MgCl2 66.6 mM, and enzymatic conditions (MgCl2 10 mM, ZnSO4 50 mM, Tris-

HCl 50 mM, pH 8, 50% glycerol).43-45 Once products were fully dissolved aliquots were analyzed over time by HPLC with the observation of the disappearance of MeQM-dG-N7

(early fraction) and growth of MeQM-G-N7 adduct (late fraction) (Figure 2.6.) After 8 hours, the majority of the MeQM-dG-N7 adduct was fully deglycosylated to the MeQM-

G-N7 adduct, suggesting that digestion of DNA should also occur at the relative timescale of at least 6 hours. By complete analysis of the aforementioned oxidative trapping experiments and deglycosylation the resulting MeQM-dN adducts were able to be used as standards for analysis of ssDNA and dsDNA trapping studies (Scheme 2.4).

Figure 2.6 Formation of QM-G-N7 adducts through deglycosylation of QM-dG-N7 adducts over time

26

Scheme 2.4 Oxidized MeQM-dN adducts

2.2.3. Trapping Studies of o-QM with ssDNA and dsDNA

Although a simple MeQM was able to alkylate nucleosides in solution, the molecule may react differently in both single and double stranded DNA. Oxidative trapping of MeQM with DNA was conducted at 1 and 24 hours followed by digestion within 8 hours in order to ensure full deglycosylation of dG-N7, as well as to ensure the observation of the kinetic QM-DNA adducts, (dA-N1 and dC-N3) (Scheme 2.5).

27

Scheme 2.5 LC/MS based assay for detecting labile products of DNA alkylation by MeQM oxidative trapping.37

OD1- 5’-d[ACAGTACACCATCACCATCACCATTAGGCGGCCGCTATCA]-3’ OD2- 3’-d[TGTCATGTGGTAGTGGTAGTGGTAATCCGCCGGCGATAGT]-5’ Figure 2.7 Synthesized complementary oligonucleotide sequences used as a model of ssDNA and ds DNA. (OD1 and OD2 are complementary)

ssDNA oxidative trapping studies were initially performed in order to detect products without the influence of the hydrogen bonding of Watson-Crick base pairing.

The MeQM was generated in situ in the presence of OD1 (Figure 2.7) by the addition of

KF, at pH 7 for one hour at 37° C prior to treatment with BTI for 5 mins, followed by the workup and digestion described in the materials and methods section. As expected, the kinetic products (MeQM-dA-N1 and MeQM-dC-N3) were the predominant species observed after 1 hour, with minimal formation of thermodynamic products, and no observable formation of the MeQM-G-N7 adduct (Figure 2.8.A). In tandem this experiment was repeated, but the alkylation reaction of OD1 extended to 24 hours, followed by treatment with BTI for an additional 5 mins, and the procedure repeated as mentioned above. After a time course of 24 hours, the trapped MeQM products were predominantly only the thermodynamic dA-N6, dG-N1, and dG-N2 adducts, as expected

(Figure 2.8.C). In complement to the oxidative trapping of MeQM with ssDNA, dsDNA

28 was also used to observe the effects of alkylation on fully complementary Watson-Crick base pairing. Initiation and reaction of the QM with dsDNA (OD1/OD2) (Figure 2.7) was the same as with ssDNA at both 1 and 24 hours, followed by BTI oxidation, and workup as described. Even in the presence of Watson-Crick base pairing, (which were thought to inhibit the formation of dA-N1 and dC-N3 adducts), the kinetically favorable adducts still dominated the LC/MS profile after 1 hour at slightly less quantities than ssDNA, but again no alkylation of dG-N7 was observed (Figure 2.8.B). Lastly, dsDNA after 24 h of alkylation and subsequent oxidation and workup resulted in a similar profile as ssDNA, but with no observable kinetic products (Figure 2.8.D).37

Figure 2.8 A. OD1 1 h alkylation, 5 min oxidative trapping. B. OD1/2 1 h alkylation, 5 min oxidative trapping. C. OD1 24 h alkylation, 5 min oxidative trapping. D. OD1/2 24 h alkylation, 5 min oxidative trapping. dC-N3 (21.1, 23.6 min), dA-N1 (17.0, 18.1 min), dA-N6 (41.2 min), dG-N2 (47.8 min), dG-N1 (41.2 min), G-N7 (40.2 min).

29

2.3. Summary

Previous studies performed with calf thymus DNA reported that the predominant adduct of QM and nucleotides were formed at the thermodynamically favorable sites,

(dG-N1, dG-N2, and dA-N6).42 However, more recent studies have shown that QMs react at kinetically favorable positions (dG-N7, dC-N3, and dA-N1) but were unable to be detected due to lengthy and harsh enzymatic digestion conditions. Through the oxidative trapping and quenching of MeQMs by BTI it was shown that the majority of adducts observed at early reaction times were formed at the kinetically favorable, highly nucleophilic amines of dA-N1 and dC-N3 in DNA.29 These adducts which predominate early reactions with DNA may be the most biologically relevant during the initial cellular response to DNA repair and the responses correlated to most easily detected products.

The ability to observe these reversible adducts may lead to the best description of biologically relevant adducts in order to more accurately track and observe the source of metabolic genotoxicity.

2.4. Materials and Methods

2.4.1. Materials 37

Solvents, reagents, and starting materials were obtained commercially and used without further purification. Acetonitrile was purchased from Fisher Scientific and and bis[(trifluroacetoxy)iodo]benzene (BTI) was purchased from Acros. Water was purified to a resistivity of 18.2 MΩ-cm-1. 4MeBr-QMP was prepared as previously described.

Oligonucleotides OD1 (5’-d[ACAGTACACCATCACCATCACCATTAGGCGGCCG-

CTATCA]) and OD2 (5’-d[TGATAGCGGCCGCCTAATGGTGATGGTGATGGTGT-

30

ACTGT]) were purchased from Integrated DNA Technologies (IDT) with standard desalting and used without further purification. Oligonucleotide concentrations were calculated from their absorbance at 260 nm and their provided extinction coefficients.

Alkaline phosphatase from Escherichia coli and phosphodiesterase I from Crotalus adamanteus venom were purchased from Sigma-Aldrich as lyophilized solids. Enzymes were stored at concentrations of 0.1 unit/ µL and 0.004 unit/ µL, respectively, in a solution of 50 mM TRIS-HCl at pH 8, 50 µM ZnSO4, 10 Mm MgCl2, and 50% glycerol.

2.4.2. Methods

2.4.2.1. Oxidative Trapping of dA-N137

dA-N1 adducts were generated through initial alkylation initiated by the addition of KF(aq) (1.25 M) to a mixture of the 4MeBrQMP (52 mM) and dA (28 mM) in 50% aqueous DMF (100 µL). The reaction was stirred at room temperature for 30 min and treated with BTI in acetonitrile (50 µL, 200 mM) for 5 mins at room temperature. The mixture was diluted with H2O (100 µL) and washed with water-saturated diethyl ether (3 x 300 µL). The aqueous phase was then filtered through a 0.2 µm nylon-66 syringe filter and purified by preparative reverse phase C18 HPLC using a 3-33% gradient of acetonitrile in 10 mM ammonium formate at pH 6.9 over 60 mins (5 mL/min). The purified oxidized product was collected as a diastereomeric mixture (tr =18.0 and 18.9 min) and lyophilized to a white solid. Multiple preparations and isolations were required

1 to obtain sufficient quantities for NMR analysis. H NMR (400 MHz, DMSO-d6) δ ppm

8.18 (d, J= 1.8 Hz, 1H), 8.11 (s, 1H), 7.06 (dd, J= 2.3, 9.9 Hz, 1H), 6.23 (t, J= 6.7 Hz,

1H) 6.08 (d, J= 2.3 Hz, 1H), 6.00 (d, J= 9.9 Hz, 1H), 4.37 (m, 1H), 4.30 (d, J= 11.2 Hz,

1H), 4.07 (d, J= 11.2, 1H), 3.84 (m, 1H), 3.55 (m, 2H), 2.58 (m, 1H), 2.27 (m, 1H), 1.93,

31

13 (d, J= 1.5 Hz, 3H). C NMR (101 MHz, DMSO- d6) δ ppm 200.2, 151.4, 146.3, 144.3,

144.2, 137.6, 137.0, 128.8, 123.6, 119.7, 87.9, 83.7, 73.7, 70.6, 61.6, 53.7, 39.5, 20.5.

+ + + FAB HRMS m/z Calc ([M+H] ) for C18H20N5O4 370.1515 ([M+H] ) found 370.1516.

2.4.2.2. Oxidative Trapping and Detection of MeQM-DNA Adducts in DNA37

Trapping of MeQM with DNA was generated in situ by the addition of KF(aq)

(500 mM) to solution of OD1 or OD1/OD2, (20 mM in nucleotides) in sodium phosphate buffer (25 mM, pH7), (100 µL) and MeQMP (100 mM) and 30% acetonitrile (200 µL, total volume). Duplex DNA was formed prior to reaction by heating stoichiometric mixture of strands in 50 mM sodium phosphate (pH 7) to 90° C followed by slow cooling overnight. Reaction samples were stirred in sealed 0.3 mL glass vials and maintained at

37° C for 1 and 24 h respectively, followed by treatment with BTI in CH3CN (1 M, 40

µL) for 5 mins at room temperature. The reaction was diluted with H2O (100 µL), and washed with saturated ether (3 x 300 µL). DNA was precipitated with cold ethanol (400

µL, 0° C) and incubated for 30 min at -20° C. Precipitated DNA was isolated by centrifugation (5 mins at 14,800 rpm), supernatant was removed and precipitate washed with cold 80% aqueous ethanol (140 µL). The resulting pellet was dissolved in 11 mM

MgCl2 in 50 mM TEAA at pH10 ( 200 µL), hydrolyzed by alkaline phosphatase (10 units) and phosphodiesterase I (0.23 units) at 37° C for 6 hours, and neutralized by the addition of 1 % aqueous acetic acid (5 µL). The resulting mixture was subjected to solid- phase extraction using a Waters Sep-Pak (plus) which was preconditioned by washing with CH3CN (2 mL) and water (2 mL). Bound material was washed with H2O (1 mL) and eluted with CH3CN (2 mL). Solvent was removed under reduced pressure, and solids

32 stored at -20° C until needed. Samples were dissolved in 50% CH3CN(aq) (100 µL), filtered through a 0.2 µm nylon-66 syringe filter, and analyzed by reverse-phase C18 chromatography using a gradient 3- 13% CH3CN in 10 mM ammonium acetate pH 5.5 for over 10 min, followed by an isocratic 13% CH3CN for 20 min, followed by a 13-33%

CH3CN for an additional 15 min (200 µL/min). Products were collected and analyzed by

LC/MS.

33

Chapter 3: Development of a New Quinone Methide Precursor for Association and Migration along DNA.

3.1. Introduction

Alkylation of DNA can have both beneficial and detrimental effects to cells/organisms depending upon the type of alkylation.9 Therefore, it is imperative to understand how alkylation occurs and its effects in order to prevent and protect DNA from unwanted alkylation while maintaining the ability to selectively alkylate and form interstrand crosslinks (ISC) for use as chemotherapeutics.46 The Rokita group has previously developed a bis-quinone methide (BisQM), that has high affinity for DNA from an attached acridine linker that allows for the molecule to remain in the proximity of DNA while the quinone methide (QM) migrates along DNA (Scheme 3.1).32, 33

Scheme 3.1 Migration of BisQMs along DNA

However, this system may be a double edged sword as the acridine moiety may hinder its relative rate of migration as the acridine linker would need to dissociate from the DNA and intercalate at another set of base pairs in order for the molecule to make any substantial migration along DNA. To circumvent the possible retardation of migration, a new set of BisQMPs linked by varying amounts of ammonium moieties were synthesized

(BisQMPNx) (Figure 3.1).

34

Figure 3.1 Chemical structure of BisQMPNs with varying ammonium linkers

Positively charged molecules have shown great ability to deliver drugs and other compounds to DNA with high affinity.3, 33, 47, 48 The modification of the DNA associating moiety from acridine to ammonium complexes should allow for the linker to slide along

DNA as the core of the BisQM is able to migrate along DNA utilizing the kinetically favorable/ reversible sites of alkylation (dA-N1, dC-N3, and dG-N7).22, 29 Therefore the development, synthesis, and characterization of BisQMPNx and their subsequent reactivity with DNA is herein reported.

3.2. Results and Discussion

3.2.1. Synthesis of BisQMPN1

3.2.1.1. Tyramine as a Starting Material

The synthesis of BisQMPN1 was initially attempted as previously published for the synthesis of the BisQMP acridine utilized by the Rokita group.32 By starting with

35 tyramine the initial integration of the amine was expected to simplify the synthetic route.

Tyramine was expected to undergo dihydroxymethylation, TBDMS protection, acetylation, and methylation in order to create the positive charge needed for association with DNA. However, the initial presence of the amine found in tyramine did not allow for dihydroxymethylation of the starting material (Scheme 3.2). To circumnavigate this problem, tyramine was Boc protected in order to prevent decomposition and polymerization of the starting material.49 However, the dihydroxymethylation of the Boc- protected tyramine utilizing 5 M sodium hydroxide and formalin still did not yield the expected product, as decomposition and polymerization were evident in NMR analysis.

Scheme 3.2 Dihydroxymethylation of tyramine

36

3.2.1.2. 4-Hydroxyphenethyl Bromide

The use of 4-hydroxyphenethyl bromide as a starting material was chosen in order to add the amine later in the synthetic route and avoid decomposition evident from the dihydroxymethylation of tyramine (Scheme 3.3). During dihydroxymethylation, the pH of the reaction mixture was increased to a pH of 11. This most likely resulted in an E2 type mechanism creating a benzyl ethylene, which in turn subsequently led to polymerization with the excess formaldehyde in solution.

Scheme 3.3 Dihydroxymethylation of hydroxyphenethyl bromide

3.2.1.3. 3 (4-Hydroxyphenyl)propanoic acid

Due to the complications mentioned above, dihydroxymethylation was attempted with alternative starting material, 3-(4-hydroxyphenyl)propanoic acid (Scheme 3.4). This compound has been previously dihydroxymethylated in the sysnthesis of a BisQMP acridine conjugate and was used to generate compound 3.2 with relative ease and high yields (>95%).32 After dihydroxymethylation, TBDMS protection of the corresponding alcohols was completed as described in the materials and methods.32 Amination of the resulting compound was then attempted through several pathways. The first method was reductive animation, through reduction of the carboxylic acid to its corresponding

37 aldehyde using stoichiometric amounts of lithium aluminum hydride (LAH).50 This compound would be further aminated by dimethylamine to yield 3.6. The isolation of the aldehyde was not possible as the products obtained were a mixture of unreacted carboxylic acid and the fully reduced alcohol. As the carboxylic acid was able to be reduced to the corresponding alcohol, reduction using borane in THF was completed, as this reaction was previously completed by McCrane et al.22, 51 Once fully reduced, oxidation of the alcohol to the corresponding aldehyde using PCC was attempted but isolation of the desired product was not achieved.50 Conversion of the purified alcohol to the leaving group (bromine) through the use of PBr3 was attempted in order to set up a future conversion to the corresponding product, an amine, via an Sn2 reaction with a dimethylamine.52 However, bromination did not yield the corresponding primary propyl bromide, and resulted in a loss of the TBDMS protecting groups resulting in unprotected phenols/ benzyl alcohols that would impede the aforementioned amination. Though literature precedence, an in situ one pot oxidation was conducted followed by a subsequent imine formation and reduction for the conversion of the alcohol to amine.53

The oxidation of the alcohol to the aldehyde was performed by MnO2 in the presence of

3Å molecular sieves. This method of oxidation-imine formation and reductive amination did not result in the expected aminated product, but led to decomposition of material.

Lastly, the idea of creating a primary leaving group of the reduced alcohol was revisited.

The use of methylsulfonyl chloride (MsCl) was used to convert the alcohol to a leaving

54 group good for subsequent Sn2 reaction with dimethylamine. This method proved efficient in regards of its high yield (>80%), and lack of impurities.

38

Scheme 3.4 Attempted synthetic routes for the production of compound 3.6

3.2.1.4. Acetylation of Benzylic TBDMS Alcohols

Initial acetylation of the benzylic TBDMS ethers was attempted through the use

III 55 of catalytic Fe Cl3 and acetic anhydride as previously utilized in the Rokita lab.

III However, Fe Cl3 was needed in slight excess of stoichiometric amounts as the amine was thought to coordinate the iron, making it inaccessible for reaction. The use of stoichiometric amounts of iron as well as the reaction being completed in acetic anhydride made work up of the reaction difficult. Quenching of excess acetic anhydride and neutralization of the corresponding acetic acid required large quantities of saturated sodium bicarbonate. Furthermore, this required several additional washes with sodium bicarbonate (sat) in order to further remove excess iron without solvating compound 3.8 into the aqueous phase. To circumvent this problem, selective benzylic TBDMS cleavage

39 was performed through the use of para-toluene sulfonic acid (pTsOH).56 This acid was also needed in slight stoichiometric excess as the amine was able to become protonated, preventing the acid from cleaving the benzyl TBDMS groups. This method proved useful as full conversion was observed, and released TBDMS could be removed though a simple hexane: methanol wash. The resulting benzylic alcohols were then easily converted to the corresponding acetate through the addition of acetyl chloride (Scheme 3.5).57

Scheme 3.5 Selective benzylic TBDMS deprotection and acetylation

3.2.1.5. Methylation of Tertiary Amine – (BisQMPN1)

DNA alkylation studies began with the use of compound 3.8 as the tertiary amine was not expected to compete for reaction with DNA as the tertiary amine (pKa ≈ 10) should be protonated and therefore coordinate to the backbone of DNA. This compound could also be used as a method of accumulating BisQMPN1 inside the cell, as the neutral compound would have the potential to cross the lipid bilayer of a cell, where the lysosome (or in many cases, acidic cancer cell) will protonate the amine and unable to

40 migrate back outside of the cell, ultimately shifting the equilibrium for more deprotonated amines to internalize inside of the cell to become protonated, so on, and so forth (Scheme 3.6).58

Scheme 3.6 Proposed cell permeability, internalization, and accumulation of BisQMPN1

However, initial ISC experiments with compound 3.8 demonstrated relatively low reaction with DNA, suggesting that an increase in charge and/or the creation of a permanent positive charge would increase the compounds association to DNA (Section

3.2.4.1, Figure 3.2). To accomplish this, the tertiary amine of 3.8 was added to a 1:1 solution of CH3CN: MeI for one hour, after which the solvents were removed under vacuum (Scheme 3.7).59 1H-NMR showed full conversion of 3.8 to its methylated ammonium derivative 3.9, without the expected increase of mass provided by the compounds counter ion, iodide. However, additional 13C, 1H-13C HSQC, and 1H-13C

HMBC NMR experiments confirmed the compound was indeed compound 3.9,

BisQMPN1 (Appendix B). Furthermore, it is important to note that the carbon

41 signal adjacent to the ammonium was at a much lower relative abundance and ratio than expected in 13C-NMR. This observation may be due to the ammonium center’s ability to increase or decrease the relaxation time of the adjacent carbons. This phenomenon can then be used as an indication of methylated ammonium complexes and useful for future characterization of BisQMPN2 and BisQMPN3.

Scheme 3.7. Methylation of compound 3.8

3.2.2. Synthesis of BisQMPN2

As mentioned above, initial crosslinking studies demonstrated low efficiency in regards to a high concentration of 3.12 needed for effective ISC (Figure 3.2, pg 47). Due

42 to the compound’s low affinity to DNA a BisQMPN2 was created. This BisQMP contains two positively charged ammoniums which may act much like Mg+2 which has a greater ability to stabilize DNA compared to its monovalent counterpart, Na+.60 By using compound 3.5 as a starting material for BisQMPN2, N,N,N’-trimethylethyldiamine was employed to displace the mesyl group through similar Sn2 chemistry. Selective cleavage of the benzylic TBDMS protecting groups was completed with a stoichiometric amount of pTsOH with respect to amines, followed by acetylation and methylation as previously accomplished for BisQMPN1 (Scheme 3.8). Similar to BisQMPN1 the expected total mass of BisQMPN2 did not increase with the addition of the compounds counter ion, and

13C-NMR again resulted in lower intensity of the carbons adjacent to the ammoniums, further suggesting complete conversion to the +2 charged compound.

Scheme 3.8. Synthetic route of BisQMPN2

43

3.2.3. Synthesis of BisQMPN3

3.2.3.1. Triamination of Compound 5

Generation of BisQMPN3 was attempted in a similar manner as BisQMPN1,2 through the addition of bis-dimethylaminopropylamine. However, 1H-NMR suggested that the secondary amine did not add exclusively into compound 3.5 as predicted but the more accessible tertiary amines may have reacted as well giving a mixture of constitutional isomers that could not be separated (Scheme 3.9). To circumvent this problem diethanolamine was used to ensure that amination of compound 3.5 was exclusively at a secondary amine. The alcohols of the resulting compound could be converted to a primary leaving group through chlorination (SOCl2) or mesylated in the same manner as before (compound 3.4 to 3.5). This in turn could be aminated using

47, 61-63 dimethyl amine and the synthetic route continued to yield BisQMPN3. However, this was unsuccessful as it was thought that the mesylation led to a highly reactive intermediate during workup that generated an aziridinium ring susceptible to nucleophilic attack by water during concentration of the compound under rotary evaporation, resulting in degradation of the desired product.63 Additionally, the chlorination of the diol proved ineffective as no reaction appeared to have occurred as indicated by a lack of an upfield shift of the protons adjacent to halogen. To avoid the two-step process above, addition of

44 a nitrogen mustard (bis(2-chloroethyl)amine hydrochloride was attempted but again proved ineffective as reaction did not occur and the expected 1H-NMR downfield chemical shift of protons adjacent to the amine was not seen (Scheme 3.9).64 The 1H-

NMR showed equal amounts of compound 3.4 and the nitrogen mustard but this only gave the illusion that the compounds were connected but were indeed separate as indicated by the chemical shift of proton 11 (Appendix B).

Scheme 3.9. Attempted triamination of 3.5

45

Amination of compound 3.5 was then completed by treatment with 3-methylamino-1- propanol. This proved effective and high yielding (> 80%). This compound was then mesylated without concern of the formation of the aziridium ring as the propyl chain length leads to the less favorable four membered ring.65 This compound was then used without purification for the direct diamination using N,N,N’-trimethylethylenediamine to yield compound 3.16, and synthesis completed in the same manner as used for

BisQMPN1,2 (Scheme 3.10). Again a stoichiometric amount of pTsOH with respect to the amines was used to selectively deprotect the benzylic TBDMS groups to yield (3.17), which was acetylated to yield (3.18). Furthermore, methylation did not yield the expected increase in mass, but again 1H-NMR and 13C-NMR was able to correlate the correct signals confirming the synthesis of compound 3.19, BisQMPN3.

Scheme 3.10. Synthesis of BisQMPN3

46

3.2.4. Reaction of BisQMPNx with DNA

OD3- 5’- GTG TGT GGT GGG TGG CGG TTG AAG AAG TTA A- 3’ OD4- 3’- CAC ACA CCA CCC ACC GCC AAC TTC TTC AAT T- 5’

OD5- 5’- CAG GTC AGT CAT GTC GTT AAT CGC GCG CAT AA- 3’ OD6- 3’- GTC CAG TCA GTA CAG CAA TTA GCG CGC GTA TT- 5’

OD7- 5’- TTT ACC TCT TCA ACC GCC ACC CAC CAC ACA CCC AAC CAC CAC ACC A- 3’ OD8- 3’- AAA TGG AGA AGT TGG CGG TGG GTG TGT TAT GGG TTG GTG GTG TGG T- 5’

OD9- 5’- GTA TGG CAC ACA CAG GTC AGT C- 3’ OD10-3’- CAT ACC GTG TGT GTC CAG TCA GTA CAG CAA TTA GCG CGC GTA TT- 5’ OD12- 5’ –AT GTC GTT AAT CGC GCG CAT AA- 3’

OD11-5’- GTA TGG CAC ACA CAG GTC AGT CAT GTC GTT AAT CGC GCG CAT AA- 3’

OD13-3’- AAT ACG CGC GCT AAT TGC TG- 5’ OD14-5’- TTA TGC GCG CGA TTA ACG ACA TGA C-3’ OD15- 3’- T ACT GAC TGG ACA CAC ACG GTA TGA- 5’ OD16- 5’- TG ACC TGT GTG TGC CAT ACT- 3’ Figure 3.2 DNA sequences used for the detection of ISC and migration of BisQMPNx along DNA

3.2.4.1 Aggregation of DNA through Noncovalent Interactions with Amines

Initial crosslinking experiments were conducted using the amine compounds, 3.8,

3.12, and 3.18. These compounds were expected to be protonated at pH 7, thereby giving the ammoniums a high affinity to the negatively charged backbone of DNA. This however proved troublesome as gel images suggest that the amines were able to aggregate DNA through what was later discovered to be the non-covalent sharing of protons. This interaction effectively neutralized the negative charge on DNA, resulting in a high molecular weight species without the ability to migrate through the gel (Figure

3.3).66

47

Figure 3.3 Formation of DNA crosslinks using varying concentrations of 3.8, 3.12. Duplex DNA was annealed using 5’-32P-OD3 (2.8 µM) and OD4 (3.0 µM) in buffer (MES, 10 mM, pH 7) and NaF (10 mM). The reaction was initiated be the addition of the indicated concentration of amines 3.8 and 3.12 in acetonitrile (final conc. 20%) and incubated at room temperature for 24 h. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis. (ss) and (xl) show samples of 5’-[32P]- OD3/OD4 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMP (100 µM) acridine respectively.

The aggregation of DNA through proton sharing was supported by increasing the pH of the running buffer system (1x Tris, pH 7) to a pH of 9, which fully deprotonated the amines and in turn allowed the QM-DNA complex to migrate through the gel (Figure

3.4). This however is not an effective solution to combat the problem of aggregation as a higher pH will increase the overall reversibility of the QM, by deprotonating the phenol, and consequently allow for an increase in resonance to form the quinone, thereby exacerbating the problem.29, 67

48

Figure 3.4 Formation of DNA crosslinks at varying concentrations of 3.8 and 3.12. Duplex DNA was annealed using 5’-32P-OD3 (2.8 µM) and OD4 (3.0 µM) in buffer (MES, 10 mM, pH 7) and NaF (10 mM). The reaction was initiated be the addition of the corresponding concentration of amines 3.8 and 3.12 in acetonitrile (final conc. 20%) and incubated at room temperature for 24 h. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis using 1xTBE as a running buffer at pH 7 and pH 9 respectively. (ss) and (xl) show samples of 5’-[32P]-OD3/OD4 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMP (100 µM) acridine respectively.

A phenol:chloroform extraction was additionally performed in order eliminate quenched 3.8 and 3.12 which might still associate to and aggregate DNA through proton sharing.66 However, this method proved ineffective as the uncharged DNA was extracted into the organic layer, resulting in a loss of 32P-DNA in the aqueous phase. This was further supported by concentrating the organic layers, followed by resuspension in water, and separated on a 20% PAGE gel, which still resulted in high molecular weight aggregation, further supporting charge neutralization (Figure 3.5).

49

Figure 3.5 Formation of DNA crosslinks at varying concentrations of 3.8 and 3.12. Duplex DNA was annealed using 5’-32P-OD3 (2.8 µM) and OD4 (3.0 µM) in buffer (MES, 10 mM, pH 7) and NaF (10 mM). The reaction was initiated be the addition of the corresponding concentration of amines 3.8 and 3.12 in acetonitrile (final conc. 20%) and incubated at room temperature for 24 h. Quenched 3.8 and 3.12 were removed through a phenol:chloroform extraction, and phases were concentrated and resuspended in 20 µL H2O. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis. (ss) and (xl) show samples of 5’-[32P]-OD3/OD4 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMP (100 µM) acridine respectively.

Due to the amine’s ability to aggregate DNA, removal of the QM-H2O adducts

(which still have the ability to coordinate to DNA) should allow the DNA to retain its negative charge and migrate through the gel. In order to remove only the QM-H2O adducts, bis[(trifluoroacetoxy)iodo] benzene (BTI) was used to oxidatively dearomatize the QMs with DNA, as described in Chapter 2.22, 37 Once the adducts were oxidatively trapped, the pH of the solution could be raised to a pH of 10 in order to deprotonate and dissociate the amines from DNA, and an extraction using ether could be performed. After several washes to remove residual BTI from the solution, samples could be concentrated and suspended in the appropriate buffer at pH 7. However, after the addition of the

50 loading dye to the solution it was evident that residual BTI was still in solution as the dyes turned from blue to brown, suggesting oxidation. The BTI trapping of the QMs with

DNA still did not alleviate the problem of the high molecular weight species and even further exacerbated the migration and observation of DNA (Figure 3.6).

Figure 3.6 Formation of DNA crosslinks at varying concentrations of 3.8 and 3.12. Duplex DNA was annealed using 5’-32P-OD5 (2.8 µM) and OD6 (3.0 µM) in buffer (MES, 10 mM, pH 7) and NaF (10 mM). The reaction was initiated be the addition of the corresponding concentration of amines 3.8 and 3.12 in acetonitrile (final conc. 20%) and incubated at room temperature for 24 h. 3.8 and 3.12 DNA adducts were trapped by the addition of BTI (150 µM), quenched 3.8 and 3.12 were removed by diethyl ether wash, aqueous residue concentrated, and resuspended in H2O. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis. (ss) and (xl) show samples of 5’- [32P]-OD5/OD6 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMP (100 µM) acridine respectively.

In order to prevent aggregation of DNA through the noncovalent interactions with the tertiary amines and the phosphate backbone, methylation of the amines was performed (Schemes 3.5, 3.7, 3.9). By converting the amines to ammonium groups no protons remained to share with DNA. This should lessen aggregation while maintaining

51 association to DNA by electrostatics. The conversion of the amines to ammoniums proved an effective method for the prevention of aggregation as seen in (Figure 3.7).

Figure 3.7 Formation of DNA crosslinks at varying concentrations of 3.12 (diamine) and 32 BisQMPN2 (diammonium). Duplex DNA was annealed using 5’- P-OD5 (2.8 µM) and OD6 (3.0 µM) in buffer (MES, 10 mM, pH 7) and NaF (10 mM). The reaction was initiated be the addition of the corresponding concentration of amines 3.12 and BisQMPN2 in acetonitrile (final conc. 20%) and incubated at room temperature for 24 h. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis. (ss) and (xl) show samples of 5’-[32P]-OD5/OD6 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMP (100 µM) acridine respectively.

3.2.4.2. Concentration Dependence of BisQMPNx

The potency of BisQMPNx was determined though the formation of DNA crosslinks of OD7/8 (Figure 3.8). Several concentrations of excess BisQMPNx were used to observe crosslinking. BisQMPN1 was only able to yield crosslinks of less than

50% at 500 µM, compared to BisQMPN2 which was able to crosslink more than 80% of

OD11/12 at concentrations 5-fold lower, and BisQMPN3 at 10 fold lower concentrations, yielding 100% crosslinks.

52

Figure 3.8 Formation of DNA crosslinks at varying concentrations of BisQMPN1, 32 BisQMPN2, and BisQMPN3. Duplex DNA was annealed using 5’- P-OD7 (2.8 µM) and OD8 (3.0 µM) in buffer (MES, 10 mM, pH 7) and NaF (10 mM). The reaction was initiated by addition of the corresponding concentrations of BisQMPN1, BisQMPN2, and BisQMPN3 in acetonitrile (final conc. 20%), and samples incubated at room temperature for 8 h, 2 h, and 2 h, respectively. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis and quantified by phosophoimagery of the indicated area, and reported (%) relative to the total 32P-DNA. (ss) and (xl) show samples of 5’-[32P]- OD7/OD8 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMP (100 µM) acridine respectively.

3.2.4.3. Time Dependence for the Formation of Interstrand Crosslinks

The formation of interstrand crosslinks was determined at established concentrations over 24 hours. BisQMPN1 (500 µM) again was only able to crosslink less than 40% over 24 hours, with an average yield of ~30% over 8 hours (Figure 3.9).

However, BisQMPN2&3 (100 µM), were able to create over 50% ISC over 2 hours, and over 90% yields at 4 hours. Once the kinetics of BisQMPNx to create ISC was determined, concentration dependence was again explored at the optimal times for ~50%

ISC in order to fully visualize concentration dependence.

53

Figure 3.9 Kinetics of DNA crosslink formation by BisQMPN2 and BisQMPN3. Duplex DNA was annealed using 5’-32P-OD7 (2.8 µM) and OD8 (3.0 µM) in buffer (MES, 10 mM, pH 7) and NaF (10 mM). Duplex DNA was then incubated with BisQMPN2 (100 µM) and BisQMPN3 (100 µM) in acetonitrile (final conc. 20%), samples were flash frozen in LN2 at the indicated times and thawed by the addition of loading dye. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis and quantified by phosophoimagery of the indicated area, and reported (%) relative to the total 32P-DNA. (ss) and (xl) show samples of 5’-[32P]-OD7/OD8 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMP (100 µM) acridine respectively.

3.2.4.4. Strand Transfer and Exchange of BisQMPNx

The ability of BisQMPN2&3 to transfer from an intra-strand crosslink to an inter- strand crosslink was explored in order to determine the rate and yield of ISC. Initial transfer experiments were conducted using 100 µM BisQMPN2&3. BisQMPN2&3 were incubated with OD9 for 24 h to create an intrastrand crosslink, after which OD10 was added and the duplex allowed to anneal at room temperature while reversible QM-DNA adducts were able to transfer to the newly added strand forming ISC. Samples were then taken at the indicated times and flash frozen with LN2 until analysis. After 3 days

BisQMPN2 was able form 10% ISC, and BisQMPN3 was able to form 34% ISC (Figure

3.10).

54

Figure 3.10 Transfer of intrastrand OD9-BisQMPN2&3 to OD10. Intrastrand crosslinks were formed by treating OD9 (3 µM), buffer (MES, 10 mM, pH 7), and NaF (10 mM) with BisQMPN2 (100 µM) or BisQMPN3 (100 µM) in acetonitrile (final conc. 20%) for 24 hours. 5’-[32P]-OD10 (2.8 µM) was then added, aliquots of samples taken at the indicated times were flash frozen in LN2, and thawed by the addition of loading dye. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis and quantified by phosophoimagery of the indicated area, and reported (%) relative to the total 32P-DNA. (ss) and (xl) show samples of 5’-[32P]-OD10/OD9 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMPN3 (100 µM) respectively.

The percentages of ISC from strand transfer were further used to observe strand exchange where the short oligo was thermodynamically displaced by a fully complementary strand. However, after PAGE analysis the ability of the BisQMPNx to exchange from OD9/OD10 to OD10/OD11 was not observed. Additionally, it is important to note that the 20% PAGE gel was needed to be run at a temperature of ~50

°C in order to fully denature the OD10/OD11 duplex which did not occur in Figure 3.11 at 35 °C. This suggests that the amount if ISC observed for strand transfer may be too low in order to further observe quantitative ISC through strand exchange. One could argue that a maximum of 50% of BisQMPNx would be transferred to the fully

55 complementary strand and 50% of the BisQMPNx would remain linked to smaller displaced strand, resulting in a maximum possible ISC of 5% (BisQMPN2) and 17%

(BisQMPN3). The inability of the BisQMPNx to demonstrate strand exchange at a detectable level led us to believe that the introduction of an additional strand to fully complement the remaining single stand of DNA would not show migration, and was consistent of what we observed (Figure 3.12). Moreover, it is possible that the increased running temperature of the gel may lead to decrease in observable ISC as previous studies have shown that reversible ISCs degrade at higher temperatures, resulting in only the observation and detection of irreversible adducts.68

Figure 3.11 Strand Exchange of BisQMPN2&3. Initial DNA crosslinks were formed through the transfer of intrastrand OD9-BisQMPN2&3 to OD10. Intrastrand crosslinks were formed by treating OD9 (3.0 µM), buffer (MES, 10 mM, pH 7), and NaF (10 mM) with BisQMPN2 (100 µM) and BisQMPN3 (100 µM) in acetonitrile (final conc. 20%) for 24 h. OD10 (3.0 µM) was then added to the mixture, and incubated for an additional 24 h. 5’-[32P]-OD11 (2.8 µM) was then added and displacement of the short oligo by the full complement observed at the indicated times. Aliquots of samples were flash frozen in LN2 at the indicated times and stored at -20 °C until analysis. Samples were thawed by the addition of loading dye and products separated by denaturing polyacrylamide (20%) gel electrophoresis at a running temperature of ~35 °C. (ss) and (xl) show samples of 5’- [32P]-OD11/OD10 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMPN3 (100 µM) respectively.

56

Figure 3.12 Strand Exchange of BisQMPN2&3. Initial DNA crosslinks were formed through the transfer of intrastrand OD9-BisQMPN2&3 to OD10. Intrastrand crosslinks were formed by treating OD9 (3.0 µM) with BisQMPN2 (100 µM) or BisQMPN3 (100 µM) in acetonitrile (final conc. 20%), buffer (MES, 10 mM, pH 7), and NaF (10 mM) for 24 hours, followed by the addition of OD10 (3.0 µM) and incubated for an additional 24 hours. 5’-[32P]-OD11 (2.8 µM) was then added and displacement of the short oligo by the full complement observed at the indicated times. Aliquots of samples were flash frozen in LN2 at the indicated times and stored at -20 °C until analysis. Samples were thawed by the addition of loading dye and products separated by denaturing polyacrylamide (20%) gel electrophoresis at a running temperature of ~50 °C. (ss) and (xl) show samples of 5’-[32P]-OD11/OD10 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMPN3 (100 µM) respectively. (Samples used were the same as Figure 3.11).

3.2.4.4. Migration of BisQMPN2&3

To observe migration of BisQMPN2&3 in DNA, crosslinks were formed selectively by strand transfer to the duplex region of DNA containing a toe-hold region

(OD9/OD10) followed by the addition of a third strand complementary to the toehold region (OD12) and the formation of new crosslinks were monitored over time. After several days migration was not observed (Figure 3.13). This could be due to the low initial loading of the QM on duplex of DNA, which lessens the amount of QM available for migration on DNA.

57

Figure 3.13 Migration of BisQMPN2&3. Initial DNA crosslinks were formed through the transfer of intrastrand OD9-BisQMPN2&3 to OD10. Intrastrand crosslinks were formed by treating OD9 (3.0 µM) with BisQMPN2 (100 µM) or BisQMPN3 (100 µM) in acetonitrile (final conc. 20%), buffer (MES, 10 mM, pH 7), and NaF (10 mM) for 24 hours, followed by the addition of OD10 (3.0 µM) and incubated for an additional 24 hours. 5’-[32P]-OD12 (2.8 µM) was then added to anneal to the toehold region of OD10. Aliquots of samples were flash frozen in LN2 at the indicated times, and stored at -20 °C until analysis. Samples were thawed by the addition of loading dye and products were separated by denaturing polyacrylamide (20%) gel electrophoresis. (ss) and (xl) show samples of 5’-[32P]-OD12/OD10 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMPN3 (100 µM) respectively.

As migration of BisQMPN2&3 was not observed, the use of “sticky end” DNA was employed in order to circumnavigate the low strand transfer experiment needed for the observation of migration. This experiment utilized that ability of “sticky ends”

(compleimentary 5 base pair overhangs on duplex DNA), one duplex containing the overhang would be crosslinking with BisQMPNx for 24 hours followed by addition of a radiolabeled second duplex containing the overhang complement. If migration were to occur, a higher molecular weight species would be observed as the BisQMPNx would have had to migrate past the nicked site to the adjacent strands. After several days,

58 migration was still not observed using this method, further supporting that the methylene bridged BisQMPNx is unable to migrate along DNA (Figure 3.14).

Figure 3.14 Migration of BisQMPN2&3 utilizing sticky ends/ toe holds of DNA. Duplex DNA was formed by annealing OD13 (3.0 µM) and OD14 (3.0 µM) in buffer (MES, 10 mM, pH 7) and NaF (10 mM). The duplex DNA was then incubated with either BisQMPN2 (100 µM) or BisQMPN3 (100 µM) in acetonitrile (final conc. 20%) at room temperature for 24 hours. Duplex 5’-[32P]-OD16/15 (2.8 µM) was then added to anneal to the toehold region of OD14. Aliquots of samples were flash frozen in LN2 at the indicated times, and stored at -20 °C until analysis. Samples were thawed by the addition of loading dye and products separated by denaturing polyacrylamide (20%) gel electrophoresis. (ss) and (xl) show samples of 5’-[32P]-OD16/OD15 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMPN3 (100 µM) respectively.

3.3. Summary

Through several iterations of synthesis, it was possible to develop new BisQMs for the association and crosslinking of DNA. During the development it was found that the synthesis of compound 3.5 could be achieved with relative ease and in high yields.

This compound was then used as a starting point for the synthesis of the desired ammonium linkers. Furthermore, it may be possible to extend the amount of ammonium linkers attached to the BisQMP beyond the three developed, by repetitive addition of 3- methylamino-1-propanol, mesylation of the primary alcohol, followed by the subsequent

59 addition of yet again, 3-methylamino-1-propanol, etc. The resulting BisQMPNs were efficient crosslinkers of DNA. Lower concentrations of the BisQMPNs were needed to efficiently crosslink DNA as the quantity of ammoniums increased for the association to

DNA. Moreover, the BisQMPNs were able to rapidly and fully crosslink DNA in less than four hours. This was significantly faster than the acridine linked BisQM conjugate.33

However, these compounds were unable to efficiently transfer from an intrastrand crosslink to an ISC in high yields. This resulted in lower concentrations of BisQMPNx available for strand exchange and migration. It is possible that the higher concentration of

BisQMPNx may over alkylate the initial donor strand of DNA, making the ability of the donor strand to base pair with the acceptor strand difficult. This would ultimately decrease the possibility of the BisQMPNx to transfer and subsequently migrate along

DNA. Moreover, the inability of the BisQMPNx to migrate along DNA may be due to the slow regeneration of the QM intermediate, observed by Fakhari et al.33 By increasing the electron density of the quinone methide it is possible to increase the regeneration of the QM intermediate and consequently allow for a higher probability of migration.33

3.4. Materials and Methods

3.4.1 Materials

Starting materials, reagents, and solvents were obtained commercially and used without further purification. Water was purified to a resistivity of 18.2 MΩ-cm by a

Thermo Scientific® Barnsted GenPure purification system. Silica gel ( SiliaFlash® P60,

230-400 mesh, 40- 63 µm) for flash column chromatography was purchased from

Silicycle. N,N’-Dimethyl-1,3-propanediamine and N,N-bis[3-(methylamino)propyl]

60 methylamine were purchased from Sigma Aldrich. NMR solvents were purchased from

Cambridge Isotope Laboratories. NMR data was recorded with a 300 MHz and 400 MHz spectrometers and chemical shifts (δ) are reported in parts per million (ppm) relative to the solvent protons. High resolution mass spectroscopy (HRMS) was performed by Dr.

Phil Mortimer using a VS70S/E magnetic sector mass spectrometer and fast atom bombardment (FAB) ionization. Oligonucleotides were purchased from IDT and labeled at their 5’ terminus with γ-32P-ATP (purchased from Perkin Elmer), and T4 Pol (New

England Biolabs). Concentrations of DNA were measured with an Agilent UV-Vis spectrometer and calculated from ε260 provided by IDT.

3.4.2 Methods

3-(4-Hydroxy-3,5-bis(hydroxymethyl)phenyl)propanoic acid (3.2).32 3-(4-

Hydroxyphenyl)propanoic acid (3.1) (2.0 g, 12 mmol) was dissolved in 5 M aq. NaOH (5 mL) and 6 mL of 37% aq. formaldehyde. The solution was stirred at 55° C for 4 h. To the solution, 100 mL of acetone was added and the resulting orange oil collected. The oil was dissolved in 15 mL of methanol and poured into 250 mL of acetone to generate a white precipitate that was collected by vacuum filtration. The residual solvent was removed under vacuum to yield (2) as a white solid, 2.60 g, 11.5 mmol. 96% yield.

3-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)- methyl)phenyl)propanoic acid (3.3).32 Compound 3.2 (2.60 g, 11.5 mmol) was dissolved in 40 mL anhydrous DMF. To the solution was added tert-butyldimethylsilyl chloride (10.4 g, 69.0 mmol) and imidazole (9.4 g, 140 mmol). The reaction was stirred at room temperature under N2 for 4 h. The reaction was quenched by the addition of 50

61 mL of H2O and the product extracted with ether (3x75 mL). The organic phases were pooled, washed with brine (2x50 mL), sat. ammonium chloride (2x50 mL), dried with

MgSO4, filtered and concentrated under vacuum to yield compound (3.3) that was used without further purification.

3-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)- methyl)phenyl)propan-1-ol (3.4). Borane/ THF (1 M),(40 mL, 40 mmol) was added slowly to a solution of compound 3.3 (~ 8 g crude) in 40 mL of anhydrous THF while stirring at 0° C under N2. The reaction was allowed to warm to room temperature while stirring for 2 h. The reaction was then quenched by the addition of 50 mL H2O. The product was extracted with EtOAc (3x50 mL). The organic layers were pooled, washed with water (3x50 mL), brine (50 mL), dried with MgSO4, and evaporated under reduced pressure to a pale yellow oil. The compound was purified using flash silica column chromatography with 9:1 Hex:EtAc to yield compound 3.4 as a clear viscous oil (6.50 g,

1 11.7 mmol 98% yield). H NMR (400 MHz, CDCl3) δ ppm 7.21 (s, 2H), 4.71 (s, 4H),

3.70 (t, J=6.7 Hz, 2H), 2.69 (t, J=7.5 Hz, 2H), 1.91 (dt, J=7.5, 14.2, 2H), 1.04 (9H, s),

13 0.96 (18H, s), 0.18 (6H, s), 0.10 (12H, s). C NMR (101 MHz, CDCl3) δ ppm 146.1,

134.6, 131.4, 125.8, 62.5, 60.7, 34.2, 31.7, 26.1, 26.0, 18.8, 18.4, -3.4, -5.2. FAB HRMS

+ + m/z Calcd ([M-H] ) for C29H58O4Si3 553.3564 found 553.3571 ([M-H] ).

3-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)- methyl)phenyl)propyl methanesulfonate (3.5). Methanesulfonyl chloride (MsCl) (1.6 g, 14 mmol, 1.1 mL) was added slowly to a solution of 3.4 (6.5 g, 11.7 mmol) in 30 mL of CH2Cl2 and 1.5 mL of triethylamine at 0° C. The solution was allowed to warm to room temperature while stirring for 2 hours. The reaction was quenched by the addition

62 of 50 mL H2O and the product was extracted with CH2Cl2 (3x50 mL). The organic layers were pooled and washed with water (2x50 mL), dried with MgSO4 and concentrated to yield 3.5 as an opaque viscous oil (6.50 g, 10.3 mmol, 89% yield). 1H NMR (400 MHz,

CDCl3) δ ppm 7.19 (s, 2H), 4.71 (s, 4H), 4.25 (t, J=6.5 Hz, 2H), 3.00 (s, 3H), 2.74 (t,

J=7.5 Hz, 2H), 2.09 (dt, J=7.0 Hz, 2H), 1.04 (s, 9H), 0.96 (s, 18H), 0.18 (s, 6H), 0.11 (s,

13 12H). C NMR (101 MHz, CDCl3) δ ppm 146.4, 133.2, 131.7, 125.8, 69.5, 60.6, 37.3,

31.1, 30.6, 26.1, 26.0, 18.8, 18.5, -3.3, -5.2. FAB HRMS m/z Calcd ([M-H]+) for

+ C30H60O6SSi3 631.3340 found 631.3340 ([M-H] ).

3-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)- methyl)phenyl)-N,N-dimethylpropan-1-amine (3.6). To a solution of 3.5 (500 mg, 0.79 mmol) in 2 mL CH3CN and 200 µL (1.48 mmol) triethylamine, 4 mL of 2 M dimethylamine-THF solution was added. The mixture was allowed to stir in a sealed pressure tube for 16 h at 40° C. The reaction was cooled to room temperature and diluted with 150 mL of EtOAc. The organic phase was washed with sat. NaHCO3 (3x50 mL), dried with MgSO4, and concentrated to yield compound 3.6 as a pale yellow oil (450 mg,

1 0.77 mmol 97% yield). H NMR (400 MHz, CDCl3) δ ppm 7.19 (s, 2H), 4.71 (s, 4H),

2.63 (t, J=7.7 Hz, 2H), 2.43 (t, J= 7.7 Hz, 2H), 1.85 (dt, J=7.7, 15.5 Hz, 2H), 1.04 (s,

13 9H), 0.95 (s, 18H), 0.17 (s, 6H), 0.09 (s, 12H). C NMR (101 MHz, CDCl3) δ ppm

146.1, 134.8, 131.4, 125.8, 60.7, 59.1, 45.0, 33.2, 28.8, 26.1, 26.0, 18.8, 18.4, -3.4, -5.2.

+ + FAB HRMS m/z Calcd ([M+H] ) for C31H63NO3Si3 582.4194 found 582.4195 ([M+H] ).

(2-((tert-Butyldimethylsilyl)oxy)-5-(3-(dimethylamino)propyl)-1,3- phenylene)dimethanol (3.7). para-Toluenesulfonic acid (p-TsOH) (150 mg, 0.79 mmol) was added to a solution of 3.6 (450 mg, 0.77 mmol) in 5 mL methanol and stirred at room

63 temperature for 1 h. The solution was diluted with 100 mL EtOAc and washed with sat

NaHCO3 (3x50 mL), dried with MgSO4, and concentrated. The crude product was then dissolved in 2 mL of methanol and washed with 2 mL hexane to remove residual

TBDMS, to yield compound 3.7 as a pale yellow oil (180 mg, 0.51 mmol, 66% yield). 1H

NMR (400 MHz, CDCl3) δ ppm 7.10 (s, 2H), 4.59 (s, 4H), 2.45 (t, J=7.7 Hz, 2H), 2.21 (t,

J=7.7 Hz, 2H), 2.13 (s, 6H), 1.66 (dt, J=7.7 Hz, 15.4, 2H), 1.00 (s, 9H), 0.15 (s, 6H) 13C

NMR (101 MHz, CDCl3) δ 148.0, 135.9, 131.8, 128.1, 61.0, 59.2, 45.3, 32.8, 29.1, 26.0,

+ 18.7, -3.6. FAB HRMS m/z Calcd ([M+H] ) for C19H35NO3Si 354.2464 found 354.2461

([M+H]+).

(2-((tert-Butyldimethylsilyl)oxy)-5-(3-(dimethylamino)propyl)-1,3- phenylene)bis(methylene) diacetate (3.8). Acetyl chloride (31 mg, 0.39 mmol, 28 µL) was added to a solution of 3.7 (55 mg, 0.16 mmol) in 1 mL CH2Cl2 and triethylamine (50 mg, 0.5 mmol, 60 µL) and the reaction was stirred at room temperature for 1 h. The reaction was diluted with 100 mL of EtOAc and washed with sat. NaHCO3 (3x50 mL), dried to MgSO4, and concentrated under reduced pressure to yield 3.8 as a pale yellow oil

1 (60 mg, 0.14 mmol, 88% yield). H NMR (400 MHz, CDCl3) δ 7.13 (s, 2H), 5.09 (s, 4H),

2.57 (t, J=7.8 Hz, 2H), 2.34 (t, J=7.7 Hz, 2H), 2.28 (s, 6H), 2.11 (s, 6H), 1.80 (dt, J =7.7,

13 15.7 Hz, 2H), 1.03 (s, 9H), 0.20 (s, 6H). C NMR (101 MHz, CDCl3) δ 170.9, 149.4,

135.5, 130.2, 126.7, 61.9, 59.0, 45.3, 32.7, 29.1, 25.9, 25.9, 21.0, 18.6, -3.8. FAB HRMS

+ + m/z Calcd ([M+H] ) for C23H39NO5Si 438.2676 found 438.2672 ([M+H] ).

3-(3,5-bis(Acetoxymethyl)-4-((tert-butyldimethylsilyl)oxy)phenyl)-N,N,N- trimethylpropan-1-aminium iodide (3.9), (BisQMPN1). Methyl iodide (1 mL) was added to a solution of 3.8 (65 mg, 0.15 mmol) in 1 mL of CH3CN. The pressure tube was

64 sealed and the reaction was allowed to stir at ambient temperature for 2 h. The solvents were removed under reduced pressure to yield (3.9), BisQMPN1 as a yellow oil (70 mg,

1 0.12 mmol, 80% yeild). H NMR (400 MHz, CD3OD) δ ppm 7.29 (s, 2H), 5.12 (s, 4H),

3.46 - 3.39 (m, 2H), 3.17 (s, 9H), 2.71 (t, J =7.7 Hz, 2H), 2.15 (m, 2H), 2.10 (s, 6H), 1.06

13 (s, 9H), 0.22 (s, 6H) C NMR (101 MHz, CD3OD) δ ppm = 171.3, 149.9, 133.6, 130.2,

127.2, 65.9, 61.8, 52.3, 30.8, 25.0, 24.4, 19.6, 18.2, -4.9. 8. FAB HRMS m/z Calcd (M+)

+ + for C24H42NO5Si 452.2832 found 452.2836 (M ).

N-(3-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)- methyl)phenyl)propyl)-N,N’,N’-trimethylethane-1,2-diamine (3.10). To a solution of

3.5 (1.0 g, 1.6 mmol) in 2 mL CH3CN and triethylamine (250 µL, 1.8 mmol) was added

N,N,N’-trimethylethyldiamine (205 mg, 2.0 mmol, 260 µL) and the reaction was allowed to stir in a sealed pressure tube at 75° C for 16 h. The reaction was cooled to room temperature, diluted in 150 mL of EtOAc, washed with sat. NaHCO3 (3x50 mL), dried with MgSO4, and concentrated under reduced pressure to yield 3.10 as an orange oil (810

1 mg, 1.3 mmol, 81% yield). H NMR (400 MHz, CDCl3) δ ppm 7.18 (s, 2H), 4.70 (s, 4H),

2.60 (t, J=7.7 Hz, 2H), 2.49 (m, 6H), 2.25 (s, 9H), 1.81 (dt, J=7.4, 15.3 Hz, 2H), 1.03 (s,

13 9H), 0.95 (s, 18H), 0.17 (s, 6H), 0.09 (s, 12H). C NMR (101 MHz, CDCl3) δ ppm

146.0, 135.2, 131.2, 125.8, 60.7, 58.1, 57.5, 55.5, 45.9, 42.6, 33.5, 28.9, 26.1, 26.0, 18.8,

+ 18.4, -3.4, -5.2. FAB HRMS m/z Calcd ([M+H] ) for C34H70N2O3Si3 639.4772 found

639.4745 ([M+H]+).

(2-((tert-Butyldimethylsilyl)oxy)-5-(3-((2-(dimethylamino)ethyl)(methyl)- amino)propyl)-1,3-phenylene)-dimethanol (3.11). p-TsOH (500 mg, 2.6 mmol) was added to a solution of 3.10 (800 mg, 1.3 mmol) in 5 mL methanol and stirred for 1 h. The

65 product was diluted in 100 mL EtOAc and washed with sat NaHCO3 (2x50 mL), dried with MgSO4, and concentrated under reduced pressure. The crude product was then dissolved in 2 mL methanol and washed with 2 mL hexane to remove residule TBDMS to yield 3.11 as an orange oil (380 mg, 0.91 mmol, 70% yield). 1H NMR (400 MHz,

CDCl3) δ ppm 7.14 (s, 2H), 4.59 (s, 4H), 2.51 (t, J=7.4 Hz, 2H), 2.33 - 2.41 (2H, m), 2.32

(4H, m), 2.16 (s9H), 1.66 - 1.78 (dt, J=7.6, 15.2 Hz, 2H), 1.00 (s, 9H), 0.14 (s, 6H). 13C

NMR (101 MHz, CDCl3) δ ppm 147.5, 135.4, 132.1, 127.6, 60.3, 57.1, 56.6, 54.9, 45.6,

+ 42.2, 32.8, 28.0, 26.0, 18.6, -3.6. FAB HRMS m/z Calcd ([M+H] ) for C22H42N2O3Si

411.3043 found 411.3042 ([M+H]+).

(2-((tert-Butyldimethylsilyl)oxy)-5-(3-((2-(dimethylamino)ethyl)(methyl)- amino)propyl)-1,3-phenylene)-bis(methylene) diacetate (3.12). Acetyl chloride (160

µL, 2.3 mmol,) was added to a solution of 3.11 (380 mg, 0.91 mmol) in 5 mL CH2Cl2 and triethylamine (250 µL, 1.8 mmol) and stirred at room temperature for 1 h. The reaction was diluted in 100 mL of CH2Cl2, washed with sat. NaHCO3 (3x50 mL), dried with

MgSO4, and concentrated under reduced pressure to yield 3.12 as a pale yellow oil (340

1 mg, 0.68 mmol, 75% yield). H NMR (400 MHz, CDCl3) δ ppm 7.11 (s, 2H), 5.08 (s,

4H), 2.55 (t, J=7.5 Hz, 2H), 2.52 - 2.46 (m, 2H), 2.46-2.40 (m, 4H), 2.25 (s, 6H), 2.25 (s,

3H), 2.10 (s, 6H), 1.83 - 1.73 (dt, J=7.5, 15.3 Hz, 2H), 1.02 (s, 9H), 0.19 (s, 6H). 13C

NMR (101 MHz, CDCl3) δ ppm 171.0, 149.5, 135.5, 130.2, 126.7, 62.0, 57.6, 57.0, 55.3,

45.6, 42.4, 32.8, 28.7, 25.9, 21.0, 18.6, -3.8. FAB HRMS m/z Calcd ([M+H]+) for

+ C26H46N2O5Si 495.3294 found 495.3246 ([M+H] ).

66

N-(3-(3,5-bis(Acetoxymethyl)-4-((tert-butyldimethylsilyl)oxy)phenyl)propyl)-

N,N,N’,N’,N’-pentamethylethane-1,2-diammonium iodide (3.13), (BisQMPN2).

Methyl iodide (1 mL) was added to a solution of 3.12 (340 mg, 0.60 mmol) in 2 mL of

CH3CN and the reaction was stirred at ambient temperature for 2 h. The product was collect by removal of solvents under reduced pressure to yield (3.13) BisQMPN2 as a

1 yellow oil (360 mg, 0.46 mmol 76% yield). H NMR (400 MHz, CD3OD) δ ppm 7.37 (s,

2H), 5.12 (s, 4H), 4.26 - 4.19 (m, 2H), 4.19 - 4.12 (m, 2H), 3.68 - 3.60 (m, 2H), 3.40 (s,

9H), 3.34 (s, 6H), 2.76 (t, J =7.7 Hz, 2H), 2.23- 2.23 (m, 2H), 2.12 (s, 6H), 1.06 (s, 9H),

13 0.22 (s, 6H) C NMR (101 MHz, CD3OD) δ ppm 171.3, 149.9, 133.5, 130.4, 127.1,

65.2, 61.8, 57.7, 56.0, 53.5, 51.0, 30.7, 25.1, 24.4, 19.8, 18.2, -4.8. FAB MS m/z Calcd

2+ for C28H52N2O5Si 262.2, found 262.3.

3-((3-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)- methyl)phenyl)propyl)-(methyl)amino)propan-1-ol (3.14). To a solution of 3.5 (1.0 grams, 1.6 mmol) in 2 mL CH3CN and triethylamine (400 µL, 3.0 mmol) was added 3- methylamino-1-propanol (210 mg, 2.4 mmol, 230 µL) and the reaction was stirred in a sealed pressure tube at 75° C for 16 h. The reaction was cooled to room temperature, diluted with 150 mL of EtOAc, washed with sat. NaHCO3 (3x50 mL), dried with MgSO4, and concentrated under reduced pressure to yield compound 3.14 as an opaque oil (800

1 mg, 1.3 mmol, 81% yield). H NMR (400 MHz, CDCl3) δ ppm 7.18 (s, 2H), 4.71 (s, 4H),

3.86 (t, J =5.5 Hz, 2H), 2.56 - 2.62 (m, 4H), 2.42 (t, J=7.7 Hz, 2H), 2.26 (s, 3H), 1.82 (dt,

J=7.6, 15.1 Hz, 2H), 1.70 (dt, J=5.5, 11.0 Hz, 2H), 1.03 (s, 9H), 0.95 (s, 18H), 0.17 (s,

13 6H), 0.09 (s, 12H). C NMR (101 MHz, CDCl3) δ ppm 146.1, 134.9, 131.3, 125.9, 64.7,

67

60.7, 58.4, 57.9, 41.9, 33.2, 28.9, 27.9, 26.1, 26.0, 18.7, 18.4, -3.4, -5.2. FAB HRMS m/z

+ + Calcd ([M+H] ) for C33H67NO4Si3 626.4456 found 626.4444 ([M+H] ).

3-((3-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)- methyl)phenyl)propyl)-(methyl)amino)propyl methanesulfonate (3.15). MsCl (220 mg, 1.9 mmol, 150 µL) was added dropwise to a solution of 3.14 (800 mg, 1.3 mmol) in

20 mL of CH2Cl2 and triethylamine (280 µL, 2.0 mmol). The solution was stirred at room temperature for 2 h. The reaction was quenched by addition of 50 mL H2O and the product was extracted with CH2Cl2 (2x50 mL). The organic layers were pooled and washed with sat. NaHCO3 (2x50 mL), dried with MgSO4,, and concentrated under reduced pressure to yield 3.15 as an opaque viscous oil (970 mg, 1.3 mmol, 81% yield).

1 The product was used without further purification. H NMR (400 MHz, CDCl3) δ ppm

7.16 (s, 2H), 4.69 (s, 4H), 4.28 (t, J= 6.5 Hz, 2H), 2.98 (s, 3H), 2.58 (t, J=7.6 Hz, 2H),

2.45 (t, J=6.9 Hz, 2H), 2.37 (t, J =7.2 Hz, 2H), 2.20 (s, 3H), 1.89 (dt, J=6.6, 13.2 Hz,

2H), 1.75 (dt, J =7.5, 15.1 Hz, 2H), 1.02 (s, 9H), 0.93 (s, 18H), 0.16 (s, 6H), 0.08 (s,

13 12H). C NMR (101 MHz CDCl3) δ ppm 146.0, 135.0, 131.3, 125.8, 68.6, 60.7, 57.3,

53.3, 41.9, 37.1, 33.2, 28.9, 27.1, 26.0, 26.0, 18.7, 18.4, -3.4, -5.2. FAB HRMS m/z Calcd

+ + ([M-CH3SO3] ) for C33H66NO3Si3 ([M-CH3SO3] ) 608.4350 found 608.4346 ([M-

+ CH3SO3] ).

N-(3-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)- methyl)phenyl)propyl)-N’-(2-(dimethylamino)ethyl)-N,N’-dimethylpropane-1,3- diamine (3.16). To a solution of 3.15 (760 mg, 1.1 mmol) in 2 mL CH3CN and triethylamine (170 µL, 1.2 mmol) was added N,N,N’-trimethylethyldiamine (170 mg, 1.6 mmol, 210 µL) and the reaction was stirred in a sealed pressure tube at 75° C for 16 h.

68

The reaction was cooled to room temperature, diluted in 150 mL of EtOAc, washed with sat. NaHCO3 (3x50 mL), dried with MgSO4, and concentrated to yield 3.16 as an orange

1 oil (650 mg, 0.91 mmol, 85% yield). H NMR (400 MHz, CDCl3) δ ppm 7.16 (s, 2H),

4.68 (s, 4H), 2.57 (t, J = 7.7 Hz, 2H), 2.41 - 2.49 (m, 2H), 2.28 - 2.41 (m, 8H), 2.22 (s,

9H), 2.20 (s, 3H), 1.77 (dt, J=15.4, 7.9 Hz, 2H), 1.64 (dt, J=15.1, 7.5 Hz, 2H), 1.01 (s,

13 9H), 0.92 (s, 18H), 0.14 (s, 6H), 0.06 (s, 12H). C NMR (101 MHz, CDCl3) δ ppm

146.0, 135.2, 131.2, 125.8, 60.7, 57.6, 57.5, 56.5, 55.7, 55.7, 45.9, 42.6, 42.2, 33.4, 29.0,

26.0, 26.0, 25.2, 18.7, 18.4, -3.4, -5.2. FAB HRMS m/z Calcd ([M+H]+) for

+ C38H79N3O3Si3 710.5507 found 710.5506 ([M+H] ).

(2-((tert-Butyldimethylsilyl)oxy)-5-(3-((3-((2-(dimethylamino)ethyl)(methyl)- amino)propyl)(methyl)amino)-propyl)-1,3-phenylene)dimethanol (3.17). p-TsOH

(450 mg, 2.5 mmol) was added to a solution of the 3.16 (600 mg, 0.85 mmol) in 5 mL methanol and was stirred for 1 h. The reaction was diluted in 100 mL EtOAc, washed with sat NaHCO3 (2x50 mL), dried with MgSO4, and concentrated under reduced pressure. The crude product was dissolved in 2 mL of methanol and washed with 2 mL hexane to remove residual TBDMS and solvent removed under reduced pressure to yield compound 3.17 as an orange oil (386 mg, 0.8 mmol, 94% yield). 1H NMR (400 MHz,

CDCl3) δ ppm 7.19 (s, 2H), 4.64 (s, 4H), 2.60 (t, J = 7.3 Hz, 2H), 2.44 - 2.38 (m, 4H),

2.38 - 2.30 (m, 8H), 2.23 (s, 3H), 2.23 (s, 6H) 2.21 (s, 3H) 1.80 (dt, J = 7.2, 14.4 Hz, 2H),

13 1.60 (dt, J = 7.5, 14.8 Hz, 2H), 1.04 (s, 9H), 0.19 (s, 6H). C NMR (101 MHz, CDCl3) δ ppm 147.8, 135.6, 132.2, 128.1, 60.5, 56.8, 56.1, 55.4, 55.3, 55.0, 45.7, 42.6, 42.4, 32.3,

+ 28.0, 26.0, 25.8, 18.7, -3.6. FAB HRMS m/z Calcd ([M+H] ) for C26H51N3O3Si, 482.3778 found 482.3775 ([M+H]+).

69

(2-((tert-Butyldimethylsilyl)oxy)-5-(3-((3-((2-(dimethylamino)ethyl)(methyl)- amino)propyl)(methyl)-amino)propyl)-1,3-phenylene)bis(methylene) diacetate

(3.18). Acetyl chloride (120 mg, 1.6 mmol, 110 µL) was added to a solution of 3.17 (290 mg, 0.61 mmol) in 3 mL CH2Cl2 and triethylamine (180 µL, 1.2 mmol), and was stirred at room temperature for 1 h. The reaction was diluted in 100 mL of CH2Cl2, washed with sat. NaHCO3 (2x50 mL), dried with MgSO4, and concentrated under reduced pressure to yield 3.18 as a pale yellow oil (180 mg, 0.33 mmol, 54% yield). 1H NMR (400 MHz,

CDCl3) δ ppm 7.12 (s, 2H), 5.09 (s, 4H), 2.57 (t, J = 7.6 Hz, 2H), 2.53 - 2.45 (m, 2H),

2.45 - 2.34 (m, 8H), 2.26 (s, 6H), 2.25 (s, 3H), 2.24 (s, 3H), 2.11 (s, 6H), 1.78 (dt, J =7.6,

15.3 Hz, 4H), 1.67 (dt, J = 7.5, 15.1 Hz, 2H), 1.03 (s, 9H), 0.20 (s, 6H). 13C NMR (101

MHz, CDCl3) δ 171.0, 149.4, 135.7, 130.2, 126.7, 62.0, 57.2, 56.4, 55.7, 55.5, 45.7, 42.5,

42.1, 32.8, 28.9, 25.9, 24.9, 21.1, 18.6, -3.7 FAB HRMS m/z Calcd ([M+H]+) for

+ C30H55N3O5Si 566.3989, found 566.3988 ([M+H] ).

N-(3-(3,5-bis(Acetoxymethyl)-4-((tert-butyldimethylsilyl)oxy)phenyl)propyl)-

N,N,N’,N’-tetramethyl-N’-(2-(trimethylammonio)ethyl)propane-1,3-diammonium iodide (3.19) (BisQMPN3). Methyl iodide (1 mL) was added to a solution of 3.18 (130 mg, 0.22 mmol) in 2 mL of CH3CN and stirred at ambient temperature for 2 h. The product was collect by removal of solvents under reduced pressure to yield 3.19 (83 mg,

1 0.08 mmol, 36% yield) BisQMPN3. H NMR (400 MHz, CD3OD) δ ppm 7.36 (s, 2H),

5.12 (s, 4H), 4.34 (s, 4H), 3.80 (t, J = 7.5 Hz, 2H), 3.69 - 3.57 (m, 4H), 3.51 (s, 6H), 3.47

(s, 9H), 3.31 (s, 6H), 2.76 (t, J =7.5 Hz, 2H), 2.65 - 2.53 (m, 2H), 2.24 - 2.16 (m, 2H),

13 2.12 (s, 6H), 1.05 (s, 9H), 0.22 (s, 6H). C NMR (101 MHz, CD3OD) δ ppm 171.4,

70

149.8, 133.7, 130.4, 127.0, 64.7, 61.8, 61.8, 59.9, 57.6, 56.5, 53.9, 51.9, 50.9, 30.8, 25.1,

24.4, 19.9, 18.4, 18.2, -4.8.

Oligonucleotide Studies. 32, 33 Duplex DNA was annealed by heating (90 °C) 1 .0 equivalent of the radiolabeled strand (2.8 µM) with 1.1 equivalent of its complementary unlabeled strand (3.0 µM) in water and slowly cooling to room temperature (~4 h). To the resulting samples to include individual nucleotides was added 10 mM MES, pH 7 and

10 mM NaF. Alkylation and crosslinking was initiated by the addition of BisQMPNx in acetonitrile (final conc. 20%) and reacted at 20 °C. At the indicated times, reactions were flash frozen in LN2 and stored at -20 °C. Samples were thawed and diluted by 50% by the addition of formamide loading solution (0.05% bromophenol blue and 0.05% xylene cyanol FF in formamide) and analyzed by polyacrylamide denaturing gel electrophoresis

(20%).

For strand cleavage experiments samples were lyophilized and suspended in 10% aqueous piperidine (30 µL), heated (90 °C, 30 min), and lyophilized. The resulting residue was washed with water (3x 30 µL) in order to remove trace piperidine. Samples were lyophilized, dissolved in 20 µL water, 20 µL loading dye solution, and analyzed by polyacrylamide denaturing gel electrophoresis (20 %). Radiolabeled DNA was detected using an Amersham Typhoon 9410 Variable Mode Imager and quantified with

ImageQuant software for determining reaction yields (% product relative to total radiolabeled material).

71

Chapter 4: Development of an Electron Rich Bis- Quinone Methide for Association and Migration along DNA.

4.1. Introduction

Successful strand exchange and migration along DNA was not observed in the methylene bridged BisQMPNx compounds. This could be possibly due to the relatively slow regeneration of the QM intermediate from reversible DNA adducts. Strand transfer may have been visible due to the QM needing to only create a single regeneration event.

However for strand displacement and migration, multiple QM regeneration and crosslink formation events must occur. Previous research conduct by Weinert et al. has shown that the addition of electron donating groups (EDGs) greatly increase the initial rate of QM generation as well as its regeneration from DNA adducts.67 The increase of stability in the electron rich QM intermediate will also slow the relative rate of Michael addition.

This in turn will allow for more time for the QM to diffuse and rearrange along DNA in order reach adjacent nucleophilic sites, ultimately allowing for migration to occur.67

Fakhari et al. previously reported that the methylene bridged BisQMP acridine moiety was unable to migrate along DNA (Figure 4.1, BisQMP Acridine).33 However, through the addition of an ether bridged between the acridine appendage and the BisQM, migration was observed after 5 days (Figure 4.1, eBisQMP Acridine).33 Due to the ability of an electron rich BisQM acridine compound to migrate along DNA, the synthesis of electron rich BisQMPN2&3, (eBisQMPNx) was completed. The addition of the EDG should increase the overall reversibility of the QM-DNA adducts and allow for

72 migration to occur. This in conjunction with the ammonium moieties was expected to greatly increase the overall migration of crosslinks along DNA. Due to the relative low affinity and crosslinking ability of BisQMPN1 the synthesis of the eBisQMPN1 moiety was not pursued. Instead, synthesis of eBisQMPN2 and eBisQMPN3 was completed.

33 Figure 4. 1 Migration of BisQMPs along DNA.

73

4.2. Results and Discussion

4.2.1. Synthesis of eBisQMPN2&3

Synthesis of both eBisQMPN2&3 were completed in a similar manner as their

BisQMPNx counterparts (Scheme 4.1). However, methylation of the amines (4.8, 4.14) initially led to decomposition. To overcome the decomposition, CH3CN solutions of compounds 4.8 and 4.14 were purged with N2 in order to eliminate the presence of O2, thought to have assisted in the oxidation of iodide and the final product. 69 However, this did not support the formation of the final product. Next, methyl iodide (MeI) was used at stoichiometric amounts in order to prevent side reactions. Again this did not yield the expected product but led to decomposition. Lastly, MeI was used in excess but only allowed to react for 2 min with the starting material prior to immediate evaporation under reduced pressure, as MeI readily evaporated at < 40 °C. This proved an effective method as both compound eBisQMPN2 and eBisQMPN3 were afforded with minimal impurities

(Appendix C).

74

Scheme 4.1 Synthetic of eBisQMPN2 and eBisQMPN3

4.2.2. Reaction of eBisQMPN2&3 with DNA

OD9- 5’- GTA TGG CAC ACA CAG GTC AGT C- 3’ OD10-3’- CAT ACC GTG TGT GTC CAG TCA GTA CAG CAA TTA GCG CGC GTA TT- 5’ OD12- 5’ –AT GTC GTT AAT CGC GCG CAT AA- 3’ OD11-5’- GTA TGG CAC ACA CAG GTC AGT CAT GTC GTT AAT CGC GCG CAT AA- 3’

Figure 4.2 DNA sequences used for the detection of ISC and migration of eBisQMPNx along DNA

75

4.2.2.1. Concentration Dependence of BisQMPN2&3

The potency of eBisQMPNx was determined though its formation of DNA crosslinks of OD10/OD11 over 24 h (Figure 4.3). eBisQMPN2 yielded 50% crosslinks at

100 µM. This same percentage of ISC was observed at 50 µM eBisQMPN3 and 100%

ISC obtained at 100 µM eBisQMPN3.

Figure 4.3 Formation of DNA crosslinks at varying concentrations of eBisQMPN2&3. Duplex DNA was annealed using 5’-32P-OD10 (2.8 µM) and OD11 (3.0 µM) in buffer (MES, 10 mM, pH 7) and NaF (10 mM). The reaction was initiated by addition of the corresponding concentrations eBisQMPN2&3 in acetonitrile (final conc. 20%), and samples were incubated at room temperature for 24 h. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis and quantified by phosophoimagery of the indicated area, and reported (%) relative to the total 32P-DNA. (ss) and (xl) show samples of 5’-[32P]-OD10/OD11 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of BisQMPN3 (100 µM) respectively.

76

4.2.2.2. Time Dependence for the Formation of Interstrand Crosslinks

The formation of interstrand crosslinks was determined at established concentrations (100 µM) over 24 h. The eBisQMPN2 was only able to form 50% ISC over 24 h, consistent with what was observed during concentration dependence studies with BisQMPN2 (Figure 4.3). However, eBisQMPN3 was able to crosslink over 80% of

DNA at 4 h, and 100% at 8 h (Figure 4.4). These results are similar to those observed with BisQMPN2&3, and therefore 100 µM eBisQMPN2&3 were used for the observation of strand transfer, exchange, and migration in order for direct comparison with

BisQMPN2&3.

Figure 4.4 Kinetics of DNA crosslink formation by eBisQMPN2 and eBisQMPN3. Duplex DNA was annealed using 5’-32P-OD10 (2.8 µM) and OD11 (3.0 µM) in buffer (MES, 10 mM, pH 7) and NaF (10 mM). Duplex DNA was then incubated with BisQMPN2&3 (100 µM) in acetonitrile (final conc. 20%), samples were flash frozen with LN2 at the indicated times and thawed by the addition of loading dye. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis and quantified by phosophoimagery of the indicated area, and reported (%) relative to the total 32P-DNA. (ss) and (xl) show samples of 5’-[32P]-OD10/OD11 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of eBisQMPN3 (100 µM) respectively.

77

4.2.2.3. Quenching of eBisQMPN2&3

Quenching studies of eBisQMPN2&3 were conducted in order to observe the length of time needed to fully inactivate eBisQMPN2&3 by the formation of hydrolyzed adduct. This will ensure that only ISC of transfer, exchange, and migration will be observed as there is no residual bis alkylating agent available for reaction. Both eBisQMPN2&3 appeared to have been fully quenched after ~4 h, as ISC was no longer observed (Figure 4.5). This observation in conjunction with time dependence suggests that alkylation of donor strands can be conducted 6 h prior to the addition of the complementary acceptor strand.

Figure 4.5 Kinetics of eBisQMPN2 and eBisQMPN3 quenching. Reactions were initiated by the addition of eBisQMPN2 (100 µM) or eBisQMPN3 (100 µM) to a solution of buffer (MES, 10 mM, pH 7) and NaF (10 mM) in acetonitrile (final conc. 20%). After the indicated time duplex DNA (5’-32P-OD10 (2.8 µM) and OD11 (3.0 µM)) was added and samples allowed to react for an additional 24 h, after which samples were flash frozen with LN2 and thawed by the addition of loading dye. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis and quantified by phosophoimagery of the indicated area, and reported (%) relative to the total 32P-DNA. (ss) and (xl) show samples of 5’-[32P]-OD10/OD11 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of eBisQMPN3 (100 µM) respectively.

78

4.2.2.4. Strand Transfer and Exchange of eBisQMPN2&3

The ability of eBisQMPN2&3 to transfer from an intra-strand crosslink to an inter- strand crosslink was explored in order to determine the rate and yield of ISC for future migration studies. Initial transfer experiments were conducted using 100 µM eBisQMPN2&3. eBisQMPN2&3 were incubated with OD9 for 24 h to create an intrastrand crosslink, after which OD10 was added and the duplex allowed to anneal at room temperature while reversible QM-DNA adducts were able to transfer to the newly added strand forming ISC. Aliquots were then taken at the indicated times and flash frozen with

N2(l) until analysis. Since the overall goal for eBisQMPN2&3 is to promote migration, observation of the eBisQMPN2&3 transfer was conducted for 24 h (consistent with

BisQMP acridine). However, after several experiments, no transfer was observed for eBisQMPN2 (Figure 4.6). However, eBisQMPN3 was able to form ~10% ISC after 24 h.

These values are very low compared to the full transfer (> 95%) observed in the electron rich BisQMP acridine over 24 h.33

79

Figure 4.6 Transfer of intrastrand OD9-eBisQMPN2&3 to OD10. Intrastrand crosslinks were formed by treating OD9 (3 µM), buffer (MES, 10 mM, pH 7), and NaF (10 mM) with eBisQMPN2 (100 µM) or eBisQMPN3 (100 µM) in acetonitrile (final conc. 20%) for 24 hours. 5’-[32P]-OD10 (2.8 µM) was then added, aliquots of samples taken at the indicated times were flash frozen with LN2, and thawed by the addition of loading dye. Products were separated by denaturing polyacrylamide (20%) gel electrophoresis and quantified by phosophoimagery of the indicated area, and reported (%) relative to the total 32P-DNA. (ss) and (xl) show samples of 5’-[32P]-OD10/OD9 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of eBisQMPN3 (100 µM) respectively.

Although minimal strand transfer was observed, strand exchange was conducted in tandem for comparison with BisQMPNx. However eBisQMPNx exchange from

OD9/OD10 to OD10/OD11 was not observed (Figure 4.7). This again is similar to

BisQMPNx as the low initial loading capacity of eBisQMPN3 determined in Figure

4.6.would only allow for observation of 5% ISC maximum over time. This is due to the ability of only a maximum of 50% of eBisQMPNx being able to transfer to the fully complementary strand, as 50% of the eBisQMPNx would remain linked to the smaller displaced strand.

80

Figure 4.7 Strand Exchange of eBisQMPN2&3. Initial DNA crosslinks were formed through the transfer of intrastrand OD9-eBisQMPN2&3 to OD10. Intrastrand crosslinks were formed by treating OD9 (3.0 µM), buffer (MES, 10 mM, pH 7), and NaF (10 mM) with eBisQMPN2 (100 µM) and eBisQMPN3 (100 µM) in acetonitrile (final conc. 20%) for 24 h. OD10 (3.0 µM) was then added to the mixture, and incubated for an additional 24 h. 5’-[32P]-OD11 (2.8 µM) was then added and displacement of the short oligo by the full complement observed at the indicated times. Aliquots of samples were flash frozen in LN2 at the indicated times and stored at -20 °C until analysis. Samples were thawed by the addition of loading dye and products separated by denaturing polyacrylamide (20%) gel electrophoresis. (ss) and (xl) show samples of 5’-[32P]-OD11/OD10 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of eBisQMPN3 (100 µM) respectively.

4.2.2.5. Migration of eBisQMPN2&3

The test for migration of eBisQMPN2&3 along DNA was conducted as previously described in section 3.2.4.4. Initial ISC were created through strand transfer in order to ensure that alkylation is only present in the duplex of DNA, and not at the free (ss) toehold region of OD10. After the formation of ISC, a strand complementary to the exposed toehold of OD10 was added and migration monitored over time. However, no migration was detected even with the assistance of a strong electron donating moiety of eBisQMPN2&3 (Figure 4.8).

81

Figure 4. 8 Migration of eBisQMPN2&3. Initial DNA crosslinks were formed through the transfer of intrastrand OD9-eBisQMPN2&3 to OD10. Intrastrand crosslinks were formed by treating OD9 (3.0 µM) with eBisQMPN2 (100 µM) or eBisQMPN3 (100 µM) in acetonitrile (final conc. 20%), buffer (MES, 10 mM, pH 7), and NaF (10 mM) for 24 hours, followed by the addition of OD10 (3.0 µM) and incubated for an additional 24 hours. 5’-[32P]-OD12 (2.8 µM) was then added to anneal to the toehold region of OD10. Aliquots of samples were flash frozen in LN2 at the indicated times, and stored at -20 °C until analysis. Samples were thawed by the addition of loading dye and products were separated by denaturing polyacrylamide (20%) gel electrophoresis. (ss) and (xl) show samples of 5’-[32P]-OD12/OD10 in MES buffer (10 mM, pH 7), NaF (10 mM), and 20% acetonitrile with and without the presence of eBisQMPN3 (100 µM) respectively.

4.2.2.6. Over Alkylation of ssDNA

If DNA were over alkylated, the ability of the complementary strand to base pair would be diminished, thereby hindering eBisQMPN2&3 from undergoing transfer and subsequent reactions along dsDNA. In order to observe if DNA is being over-alkylated,

OD9 was reacted with eBisQMPN3 for up to 24 h and samples frozen at the indicated time points (Figure 4.9).

82

32 Figure 4. 9 Kinetics of DNA alkylation eBisQMPN3. 5’- P-OD9 (3.0 µM) in buffer (MES, 10 mM, pH 7) and NaF (10 mM) was incubated with BisQMPN3 (100 µM) in acetonitrile (final conc. 20%). Samples were flash frozen in LN2 at the indicated times until needed for analysis. Indicated samples were treated with hot piperidine (90° C, 30 min). Products were separated by denaturing polyacrylamide (20%) gel electrophoresis. G+A lane represents 5’-32P-OD9 treated with 10% formic acid (15 µL, 37° C, 30 mins) followed by treatment with piperidine as described above.

After ~2 h, OD9 appears to be fully alkylated as a higher molecular weight band is observed and does not increase further with time. Piperidine cleavage shows complete fragmentation of the oligonucleotide. This supports the notion that although eBisQMPN3 is able to rapidly alkylate dG-N7 and crosslink DNA, over-alkylation would prohibit the ability of DNA to anneal, eBisQMPNx to transfer, and ultimately migrate along DNA.

83

4.3. Summary

Through minimal modification of the synthesis of BisQMPNx, electron rich bifunctional alkylating agents (eBisQMPN2&3) were synthesized. These compounds were able to form ISC at similar concentrations and exhibit similar kinetics to its BisQMPNx counterparts. By increasing the electron density and subsequent stability of the QM eBisQMPNx was expected to migrate along DNA as seen in an electron rich acridine moiety (Figure 4.1).33 However, this was not the case as minimal strand transfer was observed in only eBisQMPN3 (< 10%). Moreover, strand exchange and migration were not visible at the observed time points.

Several possibilities have been proposed to explain these observations. The first possibility is that the acceptor strand is over-alkylated by eBisQMPNx, as observed in

Figure 4.9. By over-alkylating the initial acceptor strand its complement will lack the ability to base pair and subsequently limit the ability of the eBisQMPNx to migrate along

DNA. Moreover it is possible that once the duplex forms, eBisQMPNx associates to the minor groove of DNA, as seen with other small molecule DNA associating moieties.4, 6, 70

2 If eBisQMPNx resides in the minor groove of DNA, dG-N may be irreversibly alkylated, effectively neutralizing an ability to migrate along DNA. To circumvent these possibilities, an additional bifunctional alkylating that lacks distance constraints between the electrophilic sites could alleviate the exclusive association to the minor groove, as well as increase the relative “reach” for alkylation and migration to occur.

84

4.4 Materials and Methods

4.4.1 Materials

Starting materials, reagents, and solvents were obtained commercially and used without further purification. Water was purified to a resistivity of 18.2 MΩ-cm by a

Thermo Scientific® Barnsted GenPure purification system. Silica gel ( SiliaFlash® P60,

230-400 mesh, 40- 63 µm) for flash column chromatography was purchased from

Silicycle. N,N’-Dimethyl-1,3-propanediamine and N,N-bis[3-(methylamino)propyl] methylamine were purchased from Sigma Aldrich. NMR solvents were purchased from

Cambridge Isotope Laboratories. NMR data was recorded with a 300 MHz and 400 MHz spectrometers and chemical shifts (δ) are reported in parts per million (ppm) relative to the solvent protons. High resolution mass spectroscopy (HRMS) was performed by Dr.

Phil Mortimer using a VS70S/E magnetic sector mass spectrometer and fast atom bombardment (FAB) ionization. Oligonucleotides were purchased from IDT and labeled at their 5’ terminus with γ-32P-ATP (purchased from Perkin Elmer), and T4 Pol (New

England Biolabs). Concentrations of DNA were measured with an Agilent UV-Vis spectrometer and calculated from ε260 provided by IDT.

4.4.2 Methods

2-(4-Hydroxy-3,5-bis(hydroxymethyl)phenoxy)acetic acid (4.2).33 2-(4-

Hydroxyphenoxy)acetic acid (4.1) (2.0 g, 12 mmol) was dissolved in 5 M aq. NaOH (5 mL) and 6 mL of 37% aq. formaldehyde. The solution was stirred at 55° C for 4 h. To the solution, 100 mL of acetone was added and the resulting orange oil collected. The oil was

85 dissolved in 15 mL of methanol and poured into 250 mL of acetone to generate a white precipitate that was collected by vacuum filtration. The residual solvent was removed under vacuum to yield (4.2) as a white solid, 2.60 g, 11.9 mmol. 99% yield.

2-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)methyl) phenoxy)acetic acid (4.3).33 Compound 4.2 (2.70 g, 11.9 mmol) was dissolved in 40 mL anhydrous DMF. To the solution was added TBDMS-Cl (13.0 g, 87.0 mmol) and imidazole (13 g, 191 mmol). The reaction was stirred at room temperature under N2 for 4 h. The reaction was quenched by addition of 50 mL of H2O and the product extracted with ether (3x75 mL). The organic phases were pooled, washed with brine (2x50 mL), sat. ammonium chloride (2x50 mL), dried with MgSO4, filtered and concentrated under vacuum to yield compound (4.3) this was used without further purification.

2-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)methyl) phenoxy)ethan-1-ol (4.4). Borane/ THF (1 M), (40 mL, 40 mmol) was added slowly to a solution of compound 4.3 (~ 8.0 g crude) in 40 mL of anhydrous THF while stirring at 0°

C under N2. The reaction was allowed to warm to room temperature while stirring for 2 h.

The reaction was then quenched by addition of 50 mL H2O. The product was extracted with EtOAc (3x50 mL). The organic layers were pooled, washed with water (3x50 mL), brine (50 mL), dried with MgSO4, and evaporated under reduced pressure to yield a pale yellow oil. The compound was purified using flash silica column chromatography with

9:1 Hex:EtAc to yield compound 4.4 as a clear viscous oil (3.50 g, 6.3 mmol 53% yield).

1 H NMR (400 MHz, CDCl3) δ 6.97 (s, 2H), 4.70 (s, 4H), 4.08 (t, J =4.8 Hz, 2H), 3.96 (t,

J =4.8 Hz, 2H), 1.03 (s, 9H), 0.96 (s, 18H), 0.17 (s, 6H), 0.11 (s, 12H) 13C NMR (101

MHz, CDCl3) δ ppm 153.4, 141.9, 132.8, 111.6, 69.4, 61.6, 60.6, 26.1, 26.0, 18.4, 18.0, -

86

+ 3.5, -5.3 FAB HRMS m/z Calcd ([M-H] ) for C28H56O5Si3 556.3435 found 556.3423 ([M-

H]+).

2-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)methyl) phenoxy)ethyl methanesulfonate (4.5). MsCl (930 mg, 8.1 mmol, 630 µL) was added dropwise to a solution of 4.4 (3.5 g, 6.3 mmol) in 20 mL of CH2Cl2 and 1.0 mL of triethylamine at 0° C. The solution was allowed to warm to room temperature while stirring for 1 h. The reaction was quenched by the addition of 50 mL H2O and the product was extracted with CH2Cl2 (3x50 mL). The organic layers were pooled and washed with water (2x50 mL), dried with MgSO4 and concentrated to yield 4.5 as an opaque viscous

1 oil (3.5 g, 5.5 mmol, 87% yield). H NMR (400 MHz, CDCl3) δ ppm 6.95 (s, 2H), 4.70

(s, 4H), 4.60 (t, J = 4.4 Hz, 2H), 4.23 (t, J = 4.4 Hz, 2H), 3.13 (s, 3H), 1.03 (s, 9H), 0.96

13 (s, 18H), 0.17 (s, 6H), 0.11 (s, 12H). C NMR (101 MHz, CDCl3) δ ppm 152.7, 142.2,

133.0, 111.5, 68.6, 66.0, 60.6, 37.8, 26.0, 25.9, 18.8, 18.4, -3.4, -5.3. FAB HRMS m/z

+ + Calcd ([M-H] ) for C29H58O7SSi3 634.3208 found 634.3194 ([M-H] ).

N-(2-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)methyl) phenoxy)ethyl)-N,N’,N’-trimethylethane-1,2-diamine (4.6). To a solution of 4.5 (1.0 g,

1.6 mmol) in 2 mL CH3CN and triethylamine (250 µL, 1.8 mmol) was added N,N,N’- trimethylethyldiamine (200 mg, 2.0 mmol, 260 µL) and the reaction was allowed to stir in a sealed pressure tube at 75° C for 16 h. The reaction was cooled to room temperature, diluted in 150 mL of EtOAc, washed with sat. NaHCO3 (3x50 mL), dried with MgSO4, and concentrated under reduced pressure to yield 4.6 as an orange oil (950 mg, 1.5 mmol,

1 94% yield). H NMR (400 MHz, CDCl3) δ ppm 6.94 (s, 2H), 4.69 (s, 4H), 4.08 (t, J = 6.1

Hz, 2H), 2.85 (t, J = 6.1 Hz, 2H), 2.63 (t, J = 7.6 Hz, 2H), 2.46 (t, J = 7.6, 2H), 2.38 (s,

87

3H), 2.27 (s, 6H), 1.02 (s, 9H), 0.95 (s, 18H), 0.16 (s, 6H), 0.10 (s, 12H). 13C NMR (101

MHz, CDCl3) δ ppm 153.6, 141.6, 132.6, 111.7, 66.3, 60.7, 57.3, 56.8, 55.9, 45.8, 43.1,

+ 26.1, 26.0, 18.7, 18.4, -3.4, -5.3. FAB HRMS m/z Calcd ([M+H] ) for C33H68N2O4Si3

641.4565 found 641.4547 ([M+H]+).

(2-((tert-Butyldimethylsilyl)oxy)-5-(2-((2-(dimethylamino)ethyl)(methyl)amino) ethoxy)-1,3-phenylene)dimethanol (4.7). p-TsOH (550 mg, 2.9 mmol) was added to a solution of 4.6 (930 mg, 1.45 mmol) in 5 mL methanol and stirred at ambient temperature for 1 h. The product was diluted with 100 mL EtOAc and washed with sat NaHCO3

(2x50 mL), dried with MgSO4, and concentrated under reduced pressure. The crude product was dissolved in 2 mL of methanol and washed with 2 mL of hexane to remove residual TBDMS, and the solvent removed under reduced pressure to yield 4.7 as an

1 orange oil (300 mg, 0.73 mmol, 50% yield). H NMR (400 MHz, CDCl3) δ ppm 6.89 (s,

2H), 4.59 (s, 4H), 3.97 (t, J = 5.8 Hz, 2H), 2.72 (t, J = 5.8 Hz, 2H), 2.50- 2.42 (m, 2H),

2.37- 2.30 (m, 2H), 2.29 (s, 3H), 2.20 (s, 6H), 1.00 (s, 9H), 0.14 (s, 6H). 13C NMR (101

MHz, CDCl3) δ ppm 153.5, 143.1, 133.2, 113.4, 66.1, 60.4, 56.7, 56.6, 55.3, 45.6, 42.9,

+ 26.0, 18.6, -3.7. FAB HRMS m/z Calcd ([M+H] ) for C21H40N2O4Si 413.2835 found

413.2841 ([M+H]+).

(2-((tert-Butyldimethylsilyl)oxy)-5-(2-((2-(dimethylamino)ethyl)(methyl)amino) ethoxy)-1,3-phenylene)bis(methylene) diacetate (4.8). Acetyl chloride (115 µL, 1.6 mmol,) was added to a solution of 4.7 (260 mg, 0.64 mmol) in 5 mL CH2Cl2 and triethylamine (200 µL, 1.5 mmol) and stirred at room temperature for 1 h. The reaction was diluted in 100 mL of CH2Cl2, washed with sat. NaHCO3 (3x50 mL), dried with

MgSO4, and concentrated under reduced pressure to yield 4.8 as a pale yellow oil (220

88

1 mg, 0.44 mmol, 69% yield). H NMR (400 MHz, CDCl3) δ ppm 6.83 (s, 2H), 5.05 (s,

4H), 4.01 (t, J = 5.9 Hz, 2H), 2.80 (t, J = 5.9 Hz, 2H), 2.61 (t, J = 7.5 Hz, 2H), 2.47 (t, J =

7.5 Hz, 2H), 2.34 (s, 3H), 2.27 (s, 6H), 2.08 (s, 6H), 0.99 (s, 9H), 0.15 (s, 6H) 13C NMR

(101 MHz, CDCl3) δ ppm 170.8, 153.2, 144.8, 127.8, 115.6, 66.4, 61.7, 56.9, 56.7, 55.6,

+ 45.5, 43.1, 25.9, 21.0, 18.6, -3.8. FAB HRMS m/z Calcd ([M+H] ) for C25H44N2O6Si

497.3046 found 497.3049 ([M+H]+).

N-(2-(3,5-bis(Acetoxymethyl)-4-((tert-butyldimethylsilyl)oxy)phenoxy)ethyl)-

N,N,N’,N’,N’-pentamethylethane-1,2-diaminium iodide (4.9), (eBisQMPN2). Methyl iodide (1 mL) was added to a solution of 4.8 (340 mg, 0.60 mmol) in 1 mL of CH3CN and the reaction was stirred at ambient temperature for 5 mins. The product was collect by removal of solvents under reduced pressure to yield (4.9) eBisQMPN2 as a yellow oil

1 (360 mg, 0.46 mmol 76% yield). H NMR (400 MHz, CDCl3) δ ppm 6.76 (s, 2H), 5.00

(s, 4H), 3.97 (t, J = 5.0 Hz, 2H), 3.83 - 3.77 (m, 2H), 3.42 (s, 6H), 3.38 (s, 3H), 2.97 (br. s., 2H), 2.82 (t, J = 5.0 Hz, 2H), 2.36 (s, 3H), 2.05 (s, 6H), 0.96 (s, 9H), 0.12 (s, 6H). 13C

NMR (101 MHz, CDCl3) δ ppm 170.9, 152.7, 145.2, 128.0, 115.7, 66.2, 62.5, 61.7, 56.6,

54.4, 53.0, 50.2, 42.0, 25.9, 21.1, 18.6, -3.8

3-((2-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)methyl) phenoxy)ethyl)(methyl)amino)propan-1-ol (4.10). To a solution of 4.5 (1.0 g, 1.6 mmol) in 2 mL CH3CN and triethylamine (250 µL, 1.9 mmol) was added 3- methylamino-1-propanol (180 mg, 2.1 mmol, 195 µL) and the reaction was stirred in a sealed pressure tube at 75° C for 16 h. The reaction was cooled to room temperature, diluted with 150 mL of EtOAc, washed with sat. NaHCO3 (3x50 mL), dried with MgSO4, and concentrated under reduced pressure to yield compound 4.10 as an opaque oil (950

89

1 mg, 1.6 mmol, 94% yield). H NMR (400 MHz, CDCl3) δ ppm 6.95 (s, 2H), 4.69 (s, 4H),

4.10 (t, J = 5.9 Hz, 2H), 3.80 (t, J = 5.4 Hz, 2H), 2.88 (t, J = 5.9 Hz, 2H), 2.75 (t, J = 5.7,

2H), 2.41 (s, 3H), 1.75 (tt, J = 5.6, 11.0 Hz, 2H), 1.03 (s, 9H), 0.96 (s, 18H), 0.16 (s, 6H),

13 0.10 (s, 12H) C NMR (101 MHz, CDCl3) δ ppm 153.4, 141.8, 132.7, 111.8, 66.0, 64.3,

60.7, 58.3, 56.6, 42.6, 28.0, 26.1, 26.0, 18.7, 18.4, -3.4, -5.3. FAB HRMS m/z Calcd

+ + ([M+H] ) for C32H65NO5Si3 628.4248 found 628.4233 ([M+H] ).

3-((2-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)methyl) phenoxy)ethyl)(methyl)amino)propyl methanesulfonate (4.11). MsCl (290 mg, 2.6 mmol, 200 µL) was added dropwise to a solution of 4.10 (950 mg, 1.6 mmol) in 15 mL of CH2Cl2 and triethylamine (250 µL, 1.9 mmol). The solution was stirred at room temperature for 2 h. The reaction was quenched by addition of 50 mL H2O and the product was extracted with CH2Cl2 (2x50 mL). The organic layers were pooled and washed with sat. NaHCO3 (2x50 mL), dried with MgSO4 and concentrated under reduced pressure to yield 4.11 as an opaque viscous oil (1.1 g, 1.6 mmol, 98% yield). The product

1 was used without further purification. H NMR (400 MHz, CDCl3) δ ppm 6.93 (s, 2H),

4.68 (s, 4H), 4.33 (t, J = 6.3 Hz, 2H), 4.05 (t, J = 5.7 Hz, 2H), 2.99 (s, 3H), 2.82 (t, J =

5.7 Hz, 2H), 2.61 (t, J = 6.9 Hz, 2H), 2.35 (s, 3H), 1.99- 1.91 (m, 2H), 1.02 (s, 9H), 0.95

13 (s, 18H), 0.15 (s, 6H), 0.10 (s, 12H) C NMR (101 MHz CDCl3) δ ppm 153.5, 141.7,

132.7, 111.6, 68.4, 66.1, 60.6, 56.3, 53.5, 42.5, 39.6, 37.1, 26.0, 26.0, 18.7, 18.4, -3.4, -

+ + 5.3FAB HRMS m/z Calcd ([M+H] ) for C33H67NO7SSi3 ([M+H] ) 706.4024 found

706.3977 ([M+H]+).

90

N-(2-(4-((tert-Butyldimethylsilyl)oxy)-3,5-bis(((tert-butyldimethylsilyl)oxy)methyl) phenoxy)ethyl)-N’’-(2-(dimethylamino)ethyl)-N,N’’-dimethylpropane-1,3-diamine

(4.12). To a solution of 4.11 (1.0 g, 1.4 mmol) in 2 mL CH3CN and triethylamine (250

µL, 1.9 mmol) was added N,N,N’-trimethylethyldiamine (200 mg, 1.9 mmol, 250 µL) and the reaction was stirred in a sealed pressure tube at 75° C for 16 h. The reaction was cooled to room temperature, diluted in 150 mL of EtOAc, washed with sat. NaHCO3

(3x50 mL), dried with MgSO4, and concentrated to yield 4.12 as an orange oil (800 mg,

1 1.1 mmol, 79% yield). H NMR (400 MHz, CDCl3) δ ppm 6.95 (s, 2H), 4.68 (s, 4H),

4.06 (t, J = 6.1 Hz, 2H), 2.81 (t, J = 6.1 Hz, 2H), 2.51 - 2.45 (m, 4H), 2.43 - 2.37 (m, 4H),

2.35 (s, 3H), 2.25 (s, 3H), 2.25 (s, 6H), 1.74- 1.66 (m, 2H), 1.02 (s, 9H), 0.95 (s, 18H),

13 0.16 (s, 6H), 0.10 (s, 12H) C NMR (101 MHz, CDCl3) δ ppm 153.7, 141.6, 132.7,

111.6, 68.4, 66.1, 60.6, 56.3, 53.5, 42.5, 39.6, 37.1, 26.0, 26.0, 18.7, 18.4, -3.4, -5.3. FAB

+ + HRMS m/z Calcd ([M+H] ) for C37H77N3O4Si3 712.5300 found 712.5281 ([M+H] ).

(2-((tert-Butyldimethylsilyl)oxy)-5-(2-((3-((2-(dimethylamino)ethyl)(methyl)amino) propyl)(methyl)amino)ethoxy)-1,3-phenylene)dimethanol (4.13). p-TsOH (490 mg,

2.5 mmol) was added to a solution of the 4.12 (610 mg, 0.85 mmol) in 5 mL methanol and was stirred at ambient temperature for 1 h. The reaction was diluted in 100 mL

EtOAc, washed with sat. NaHCO3 (2x50 mL), dried with MgSO4, and concentrated under reduced pressure. The crude product was dissolved in 2 mL of methanol and washed with

2 mL hexane to remove residual TBDMS and solvent removed under reduced pressure to yield compound 4.13 as an orange oil (180 mg, 0.37 mmol, 44% yield). 1H NMR (400

MHz, CDCl3) δ ppm 6.92 (s, 2H), 4.60 (s, 4H), 4.03 (t, 5.8 Hz, 2H), 2.73 (t, J = 5.8 Hz,

2H), 2.47 - 2.40 (m, 2H), 2.40 - 2.33 (m, 6H), 2.31 (s, 3H), 2.20 (s, 3H), 2.19 (s, 6H),

91

13 1.62 (m, 2H), 1.01 (s, 9H), 0.15 (s, 6H) C NMR (101 MHz, CDCl3) δ ppm 153.6, 143.0,

133.4, 113.4, 66.2, 60.3, 56.9, 56.1, 55.7, 55.7, 55.1, 45.6, 43.2, 42.3, 26.0, 24.6, 18.6, -

+ 3.7. FAB HRMS m/z Calcd ([M+H] ) for C26H51N3O3Si 484.3570, found 484.3585

([M+H]+).

(2-((tert-Butyldimethylsilyl)oxy)-5-(2-((3-((2-(dimethylamino)ethyl)(methyl)amino) propyl)(methyl)amino)ethoxy)-1,3-phenylene)bis(methylene) diacetate (4.14). Acetyl chloride (60 mg, 0.7 mmol, 50 µL) was added to a solution of 4.13 (130 mg, 0.27 mmol) in 2 mL CH2Cl2 and triethylamine (72 µL, 0.54 mmol), and was stirred at room temperature for 1 h. The reaction was diluted in 100 mL of CH2Cl2, washed with sat.

NaHCO3 (2x50 mL), dried with MgSO4, and concentrated under reduced pressure to yield

1 4.14 as a pale yellow oil (110 mg, 0.19 mmol, 70% yield). H NMR (400 MHz, CDCl3) δ ppm 6.86 (s, 2H), 5.07 (s, 4H), 4.03 (t, J = 5.8 Hz, 2H), 2.80 (t, J = 5.8 Hz, 2H), 2.59 -

2.53 (m, 4H), 2.53 - 2.43 (m, 4H), 2.36 (s, 3H), 2.32 (s, 6H), 2.28 (s, 3H), 2.11 (s, 6H),

13 1.02 (s, 9H), 0.18 (s, 6H) C NMR (101 MHz, CDCl3) δ ppm 170.9, 153.2, 144.9, 127.8,

115.6, 66.3, 61.8, 56.3, 56.2, 56.0, 55.9, 54.6, 45.1, 42.7, 42.1, 25.9, 24.4, 21.0, 18.6, -3.8

+ + FAB HRMS m/z Calcd ([M+H] ) for C30H55N3O5Si 568.3781, found 568.3780 ([M+H] ).

N-(2-(3,5-bis(Acetoxymethyl)-4-((tert-butyldimethylsilyl)oxy)phenoxy)ethyl)-

N,N,N’,N’-tetramethyl-N3-(2-(trimethylammonio)ethyl)propane-1,3-diaminium iodide (4.15) (eBisQMPN3). Methyl iodide (1 mL) was added to a solution of 4.14 (45 mg, 0.08 mmol) in 1 mL of CH3CN and stirred at ambient temperature for 5 min. The product was collect by removal of solvents under reduced pressure to yield an orange oil.

92

® The crude product was dissolved in 1 mL H2O and loaded on a C-18 Sep-Pak , sample was washed with 2 mL H2O, eluted with 2 mL CH3CN, and concentrated under reduced

1 pressure to yield 4.15 as an orange oil (30 mg, 0.03 mmol, 38 % yield) eBisQMPN3. H

NMR (400 MHz, CDCl3) δ ppm 6.90 (s, 2H), 5.05 (s, 4H), 4.11 (br. s., 2H), 3.97 (br. s.,

2H), 3.92 - 3.84 (m, 2H), 3.75 - 3.60 (m, 2H), 3.56 - 3.39 (m, 18H), 2.98 - 2.92 (m, 2H),

2.72 (t, J = 6.0 Hz, 2H), 2.41 (s, 3H), 2.16 (br. s., 2H), 2.12 (s, 6H), 1.01 (s, 9H), 0.16 (s,

13 6H) C NMR (101 MHz, CDCl3) δ ppm 170.9, 151.4, 146.0, 128.3, 115.9, 63.2, 61.7,

61.6, 56.6, 54.6, 54.6, 54.6, 52.5, 52.4, 42.8, 25.9, 25.2, 21.2, 18.6, -3.8

Oligonucleotide Studies. 32, 33 Duplex DNA was annealed by heating (90 °C) 1.0 equivilent of the radiolabeled strand (2.8 µM) with 1.1 equivalent of its complementary unlabeled strand (3.0 µM) in water and slowly cooling to room temperature (~4 h). To the resulting samples to include individual nucleotides was added 10 mM MES, pH 7 and

10 mM NaF. Alkylation and crosslinking was initiated by the addition of BisQMPNx dissolved in acetonitrile (final conc. 20%) at 20 °C. At the indicated times, reactions were flash frozen in LN2 and stored at -20 °C. Samples were thawed and diluted by 50% by the addition of formamide loading solution (0.05% bromophenol blue and 0.05% xylene cyanol FF in formamide) and analyzed by polyacrylamide denaturing gel electrophoresis

(20%).

For strand cleavage experiments samples were lyophilized and suspended in 10% aqueous piperidine (30 µL), heated (90 °C, 30 min), and lyophilized. The resulting residue was washed with water (3x 30 µL) in order to remove trace piperidine. Samples were lyophilized, dissolved in 20 µL water, 20 µL loading dye solution, and analyzed by polyacrylamide denaturing gel electrophoresis (20 %). Radiolabeled DNA was detected

93 using an Amersham Typhoon 9410 Variable Mode Imager and quantified with

ImageQuant software for determining reaction yields (% product relative to total radiolabeled material).

94

Chapter 5: Synthesis of Di-Quinone Methides

5.1 Introduction:

Bis-quinone methides (BisQMPs) have demonstrated high efficiency of crosslinking and an ability to migrate along DNA when conjugated to an acridine moiety.33 However, migration was slow and required 6 days to move a maximum of 7-10 base pairs. Replacing acridine with ammonium moieties for the association to DNA

(BisQMPNx) did not promote migration (Chapters 3 & 4). If migration is hindered by the

BisQMP’s dependence on the sequential reaction of the two QM sites (Scheme 5.1), separation of the QMs on separate aromatic ring systems may increase the ability of a di- quinone methide (DiQM) to migrate along DNA. Each QM would now be free to act independently of each other.71-73 Inspiration for this drew from a publication by Wang et al in which the ability of a BisQM and DiQM to create ISC was compared.73 Bis- quaternary ammonium and biphenol biquarternary ammonium compounds were prepared for high affinity to DNA (Scheme 5.1).73 Once activated to their respected o-QMs, the

DiQMs formed ISC, at lower concentrations than its BisQM counterpart. By creating higher yields of initial ISC it is possible that DiQMs could exhibit a higher potential for migration along DNA as there is a higher concentration of dialkylating agent available to migrate.73

95

Scheme 5.1 Activation of BisQMPs vs. DiQMPs and their ability to react with DNA. Modified73

In addition to a DiQM’s ability to react independently of each other, similar di- alkylating agents which lack the distance constraints associated with BisQMPNx have been used to create ISC. Through the incorporation of a linker moiety it is possible to increase the overall flexibility, and relative “reach” of the alkylating agent could allow for further increase in migration. This type of crosslinking has been shown through several models to include bis(catechol) quaternary ammonium derivatives, and previously mentioned bifunctional trinuclear PtII complexes, with the latter being able to migrate along DNA.13, 71-73 Most notably, Bai et al. have developed a series of bis(catechol) derivatives varying in aliphatic chain length.71 These compounds have been shown to undergo oxidative activation to form intermediates that are sequentially attacked by DNA to form an ISC and effectively act as a potential chemotherapy (Scheme 5.2). 71, 72

96

Scheme 5.2. Proposed mechanism of catechol oxidation and ISC72

These compounds have shown a high affinity to DNA through the coordination of their positively charged amine to the negatively charged backbone of DNA. Although these electrophilic compounds are not QMs, similarities between the two and their ability to be selectively activated in the presence of DNA via oxidation or photolysis to form ISC became inspiration for the design of new bifunctional QMs. These principles have now been applied to create new crosslinking agents, DiQMPNx (Figure 5.1).

Figure 5.1 Chemical structures of DiQMPN2 and DiQMPN3 designed to form ISC

97

5.2 Results and Discussion

5.2.1 Synthesis of Di-QMPNx

5.2.1.1 Hydroxymethylation

The synthesis of DiQMPNx was initiated with mono-hydroxymethylation of 4-(2- bromoethyl)phenol (Scheme 5.3). In order to prevent dihydroxymethylation, sodium borohydride was used to chelate the mono-hydroxymethylation product for isolation and removal of excess paraformaldehyde.74 However, hydroxymethylation and chelation was not observed during reaction. The expected product appeared to have decomposed, since its methylene signal at ~5.0 ppm was not evident. The use of phenylboric acid provided the ability to create and isolate a stable key intermediate (5.2). This intermediate was then treated with 30% H2O2 to remove the boron and silica gel chromatography preformed to remove the phenol borate byproduct (Scheme 5.3).75

Scheme 5.3 Monohydroxymethylation of 4-(2-bromoethyl)phenol

98

5.2.1.2 TBDMS Protection

The protection of the alcohol and phenol was completed with the use of tert- butyldimethylsilane chloride. Stoichiometric amounts of TBDMS-Cl were used rather than the excess for the synthesis of BisQMPs to afford the protected compound in high yield without further purification (Scheme 5.4).32

Scheme 5.4 TBDMS protection of compound 5.3

Once protected, the alkyl chain’s protons (11 and 12) split into a doublet of triplets which was not expected. 1H-13C HSQC NMR experiments confirmed that the protons are indeed coupled to each other. Due to conformational restraints, two separate chemical shifts for carbons 11, (39.1 and 38.9 ppm) and 12, (45.2 and 33.2 ppm) respectively were generated. 1H-NMR only shows a splitting of the protons on carbons 11 and 12. The absence of additional splitting and other proton signals supports that 5.4 was protected and did not contain any impurities (Figure 5.2) (Appenix D).

99

Figure 5.2 Chemical structure and 1H-13C HSQC of compound 5.4

5.2.1.3 Amination and Coupling of DiQMNx Precursors

The initial coupling of DiQMPN2 was attempted with the tertiary diamine,

N,N,N’,N’-tetramethyl-1,4-butanediamine. These amines were expected to react through an Sn2 reaction with the electrophilic carbon and displace the primary bromide (carbon

12, Figure 5.2), but no reaction was observed even at high temperatures (> 100° C)

(Scheme 5.5).71, 72 This result was not so disappointing since the product and future reactions would be troublesome, as the positively charged compound would make purification by silica gel chromatography and aqueous extractions exceedingly difficult as the compound would have the potential to be water soluble.

Scheme 5.5 Attempted DiQMPN2 coupling

100

Use of stoichiometric amounts of secondary amines in CH3CN at 70° C produced the desired neutral compounds, 5.5 and 5.9 (Scheme 5.6).73 These compounds could be easily separated through simple organic and sat. NaHCO3 extractions. Full consumption of the starting material and conversion to the desired product was indicated by the change in chemical shifts of protons 11 and 12 from 3.01 and 3.60 ppm to 2.50 and 2.76 ppm respectively. (Appendix D).

Scheme 5.6 Coupling of 5.4 for DiQMPN2 and DiQMPN3 precursors

5.2.1.4 Benzylic TBDMS Cleavage

Cleavage of the benzylic TBDMS protecting groups was completed through the use of para-toluenesulfonic acid (pTsOH) at stoichiometric amounts relative to the amines, as applied before with the BisQMPNs (Scheme 5.7).56 Full conversion was observed through 1H-NMR of the benzylic protons, from a chemical shift of the protected compound (5.4) from 4.74 ppm to that of the free alcohol at 4.66 ppm. Excess TBDMS was removed through a simple hexanes:methanol wash, as the greasy TBDMS partitioned into the hexane layer Compounds 5.6 and 5.10 remain in the methanol layer due to their polar hydroxyls and tertiary amine moieties.

101

Scheme 5.7 Selective benzylic TBDMS deprotection 5.5 and 5.9

5.2.1.5 Acetylation

Acetylation of the primary alcohols was completed using acetyl chloride as previously conducted with the BisQMPNs (Scheme 5.8).57 Again, full conversion of the alcohols was observed by the large chemical shift of proton 4 in the 1H-NMR from 4.66 ppm, to 5.09 ppm, as well as the appearance of a carbonyl signal in the 13C-NMR at 171 ppm (Appendix D).

Scheme 5.8 Acetylation of 5.6 and 5.10

102

5.2.1.6 Methylation of Amines

To prevent aggregation of DNA by its association with free amines, the amines of compounds 5.7 and 5.11 were methylated. Much like the synthesis of the BisQMPNx, the use of methyl iodide in acetonitrile for one hour was sufficient to fully methylate compounds 5.7 and 5.11 (Scheme 5.9).73 Removal of solvent under reduced pressure yielded the desired pure product but without the expected gain of mass from the addition of both methyl groups to the amines and the resulting ammonium’s counter ion (iodide).

Although this was of concern, both 1H and 13C-NMR provided signals consistent with the desired methylated compound, most notably the methyl amine protons shifted from 2.2 ppm to 3.3 ppm and the methylene protons adjacent to the positively charged amines shifting from 2.4 ppm and 2.5 ppm to 3.2 ppm and 3.7 ppm respectively. In addition to these notable shifts, 13C NMR provided an indicative chemical shift of the methyl groups attached to the amines from 42 ppm to 50 ppm (Appendix D). The signal intensity of the methylene carbons adjacent to the amines were considerably lower relative to that of the unmethylated compounds (5.7 and 5.11). This similar trend was noted for the methylation for BisQMPNs which further supports the conversion to the methylated compounds 5.8 and 5.12, (DiQMPN2&3).

103

Scheme 5.9 Methylation of 5.7 and 5.8 for the production of compounds DiQMPN2 and DiQMPN3

5.2 Summary

Through a similar synthetic pathway developed for the synthesis of BisQMPNx, two new bifunctional alkylating agents, DiQMPN2&3, were created. These compounds may increase the overall rate of migration along DNA, based on the separation of QMs on different aromatic rings and the ability of the QMs to form independently.71-73

Additionally, an intermediate (5.4) was obtained which could serve as a common starting material for further modifications. In the future, the linker may be further modified to increase flexibility by increasing the chain length between the QMs, or create a more rigid framework by shortening the overall chain length or introducing rotational constraints. Additional moieties such as benzene could also be incorporated in the linker to increase the QMs affinity to DNA as seen by Bai et al.59, 71, 72

104

5.3 Materials and Methods

5.3.1 Materials

Starting materials, reagents, and solvents were obtained commercially and used without further purification. Water was purified to a resistivity of 18.2 MΩ-cm by a

Thermo Scientific® Barnsted GenPure purification system. Silica gel ( SiliaFlash® P60,

230-400 mesh, 40- 63 µm) for flash column chromatography was purchased from

Silicycle. N,N’-Dimethyl-1,3-propanediamine and N,N-bis[3-(methylamino)propyl] methylamine were purchased from Sigma Aldrich. NMR solvents were purchased from

Cambridge Isotope Laboratories. NMR data was recorded with a 300 MHz and 400 MHz spectrometers and chemical shifts (δ) are reported in parts per million (ppm) relative to the solvent protons. High resolution mass spectroscopy (HRMS) was performed by Dr.

Phil Mortimer using a VS70S/E magnetic sector mass spectrometer and fast atom bombardment (FAB) ionization.

5.3.2 Methods

6-(2-Bromoethyl)-2-phenyl-4H-benzo[d][1,3,2]dioxaborinine (5.2). 4-(2-

Bromoethyl)phenol 5.1(2.0 g, 10 mmol), phenylboric acid (1.3 g, 11 mmol), trichloroacetic acid (810 mg, 5.0 mmol), and paraformaldehyde (1.4 g, 16 mmol) were dissolved in 20 mL of benzene and refluxed at 80° C for 4 h. Solvent was removed under reduced pressure. The residue was dissolved in 100 mL ethyl ether, washed with sat.

NaHCO3 (2x50 mL), dried with MgSO4, and concentrated under reduced pressure to

1 yield 5.2 as a white solid (3.2 g, 10 mmol 99% yield). H NMR (400 MHz, CDCl3) δ ppm

7.99 (dd, J = 1.6, 6.6 Hz, 2H), 7.53 - 7.48 (m, 1H), 7.47 - 7.43 (m, 2H), 7.39 (s, 1H), 7.15

105

- 7.09 (m, 1H), 7.09 - 7.03 (m, 1H), 6.90 - 6.87 (m, 1H), 5.25 (s, 2H), 3.57 (t, J =7.4 Hz,

13 2H), 3.14 (t, J =7.4 Hz, 2H). C NMR (101 MHz, CDCl3) δ ppm 148.1, 134.4, 133.7,

131.6, 129.9, 129.0, 127.8, 125.0, 122.6, 118.1, 62.9, 38.6, 33.1. FAB HRMS m/z Calcd

+ + ([M+H] ) for C15H14BBrO2 316.0270, found 316.0760 ([M+H] ).

4-(2-Bromoethyl)-2-(hydroxymethyl)phenol (5.3). To a solution of 5.2 (3.2 g,

10 mmmol) in 20 mL of THF was added 30% H2O2 (4 mL) and the reaction was stirred at room temperature for 2 h. The reaction was quenched with 50 mL of H2O and extracted with ethyl ether (3x50 mL), dried with MgSO4, and concentrated under reduced pressure.

The desired product was purified by silica gel column chromatography using 2:1

Hex:EtOAc to yield 5.3 as a white solid (2.3 g, 9.7 mmol, 97% yield). 1H NMR (400

MHz, CDCl3) δ ppm 7.06 (dd, J =2.3, 8.3 Hz, 1H), 6.91 (d, J =1.8 Hz, 1H), 6.85 (d, J

=8.3 Hz, 1H), 4.85 (s, 2H), 3.53 (t, J =7.6 Hz, 2H), 3.08 (t, J =7.6 Hz, 2H). 13C NMR

(101 MHz, CDCl3) δ 154.9, 130.6, 129.6, 128.2, 124.8, 116.7, 64.5, 38.5, 33.4 FAB

+ + HRMS m/z Calcd ([M+H] ) for C9H11BrO2 229.9942, found 229.9932 ([M+H] ).

(4-(2-Bromoethyl)-2-(((tert-butyldimethylsilyl)oxy)methyl)phenoxy)-(tert- butyl)dimethylsilane (5.4). To a solution of 5.3 (2.3 g, 9.7 mmol) in 30 mL of anhydrous

DMF under N2 was added TBDMS-Cl (3.75 g, 25 mmol) and imidazole (3.4 g, 50 mmol). The reaction was stirred at room temperature for 4 h. The reaction was quenched with 50 mL of H2O, extracted with ethyl ether (2x50 mL), washed with brine 50 mL, and sat. ammonium chloride (50 mL), dried with MgSO4, and solvent removed under vacuum

1 to yield 5.4 (4.2 g, 9.2 mmol, 92% yield). H NMR (400 MHz, CDCl3) δ ppm 7.36 (s,

1H), 7.00 (dd, J =2.3, 8.3 Hz, 1H), 6.74 (d, J =8.3 Hz, 1H), 4.81 (s, 2H), 3.64 (dt, J =7.7,

43.1 Hz, 2H), 3.11 (dt, J =7.7, 28.0 Hz, 2H), 1.06 (s, 9H), 1.02 (s, 9H), 0.27 (s, 6H), 0.17

106

13 (s, 6H). C NMR (101 MHz, CDCl3) δ ppm 150.9, 132.3, 131.5, 130.6, 127.6, 117.8,

60.6, 45.2, 39.1, 38.9, 33.2, 26.0, 25.8, 18.5, 18.2, -4.2, -5.3. FAB HRMS m/z Calcd

+ + ([M] ) for C21H39BrO2Si2 458.1672, found 457.1588 ([M-H] ).

N,N’-bis(4-((tert-Butyldimethylsilyl)oxy)-3-(((tert-butyldimethylsilyl)- oxy)methyl)phenethyl)-N,N’-dimethylpropane-1,3-diamine (5.5). To a solution of 5.4

(1.0 g, 2.2 mmol) in 2 mL of CH3CN and trimethylamine (280 µL, 2.2 mmol) was added

N,N’-dimethyl-1,3-propanediamine (140 µL, 1.1 mmol). The reaction was stirred at 75

°C for 18 hours. The solution was diluted with 150 mL of EtOAc, washed NaHCO3

(3x50 mL), dried with MgSO4, and solvent removed under vacuum to yield 5.5 as an

1 orange oil (750 mg, 0.87 mmol, 79% yield). H NMR (400 MHz, CDCl3) δ ppm 7.28 (s,

2H), 6.94 (dd, J =2.3, 8.2 Hz, 2H), 6.66 (d, J =8.2 Hz, 2H), 4.74 (s, 4H), 2.80- 2.74 (m,

4H), 2.67- 2.63 (m, 4H), 2.50 (t, J =7.4 Hz, 4H), 2.35 (s, 6H), 1.81- 1.71 (m, 2H), 1.00 (s,

13 18H), 0.96 (s, 18H), 0.21 (s, 12H), 0.11 (s, 12H). C NMR (101 MHz, CDCl3) δ ppm

150.2, 132.4, 131.9, 127.3, 127.3, 117.7, 60.5, 59.6, 55.4, 42.0, 32.8, 26.0, 25.7, 18.5,

+ 18.2, -4.2, -5.3. FAB HRMS m/z Calcd ([M+H] ) for C47H90N2O4Si4, 859.6065, found

859.6065 ([M+H]+).

(((Propane-1,3-diylbis(methylazanediyl))bis(ethane-2,1-diyl))-bis(6-((tert- butyldimethylsilyl)oxy)-3,1-phenylene))dimethanol (5.6). p-TsOH (160 mg, 0.86 mmol) was added to a solution of 5.5 (370 mg, 0.43 mmol) in 5 mL methanol and stirred at room temperature for 1 hour. The product was diluted in 100 mL EtOAc, washed with sat NaHCO3 (2x50 mL), dried with MgSO4, and concentrated under reduced pressure.

The crude product was dissolved in 2 mL of methanol and washed with 2 mL hexane to remove residual TBDMS, and concentrated under reduced pressure to yield 5.6 as an

107

1 orange oil (160 mg, 0.26 mmol, 60% yield). H NMR (400 MHz, CDCl3) δ ppm 7.20 (d,

J =2.2 Hz, 2H), 6.97 (dd, J =2.2, 8.1 Hz, 2H), 6.72 (d, J =8.1 Hz, 2H), 4.66 (s, 4H), 2.73-

2.69 (m, 4H), 2.60- 2.56 (m, 4H), 2.37 (t, J =7.5, 4H), 2.28 (s, 6H), 1.71- 1.61 (m, 2H),

13 1.02 (s, 18H), 0.24 (s, 12H). C NMR (101 MHz, CDCl3) δ ppm 151.3, 133.1, 131.6,

128.6, 128.4, 118.2, 61.4, 59.3, 55.6, 42.3, 32.7, 25.8, 24.8, 18.2, -4.2. FAB HRMS m/z

+ + Calcd ([M+H] ) for C35H62N2O2Si2, 631.4326, found 631.4319 ([M+H] ).

(((Propane-1,3-diylbis(methylazanediyl))bis(ethane-2,1-diyl))bis(6-((tert- butyldimethylsilyl)oxy)-3,1-phenylene))bis(methylene) diacetate (5.7). Acetyl chloride (62 mg, 0.80 mmol, 57 µL) was added to a solution of 5.6 (200 mg, 0.32 mmol) in 3 mL CH2Cl2 and triethylamine (85 µL, 0.64 mmol) and stirred at room temperature for 1 hour. The reaction was diluted in 100 mL of CH2Cl2, washed with sat. NaHCO3

(2x50 mL), dried with MgSO4, and concentrated under reduced pressure to yield 5.7 as a

1 pale yellow oil (170 mg, 0.24 mmol, 75% yield). H NMR (400 MHz, CDCl3) δ ppm

7.13 (d, J = 2.2 Hz, 2H), 7.04 (dd, J = 2.3, 8.3 Hz, 2H), 6.74 (d, J = 8.3 Hz, 2H), 5.08 (s,

4H), 2.73- 2.69 (m, 4H), 2.61- 2.57 (m, 4H), 2.44 (t, J = 7.5 Hz, 4H), 2.31 (s, 6H), 2.07

13 (s, 6H), 1.76 - 1.63 (m, 2H), 0.99 (s, 18H), 0.23 (s, 12H). C NMR (101 MHz, CDCl3) δ ppm 170.9, 152.3, 132.9, 130.7, 129.6, 126.1, 118.5, 62.3, 59.6, 55.5, 42.1, 32.8, 25.7,

+ 24.9, 21.0, 18.2, -4.2. FAB HRMS m/z Calcd ([M+H] ) for C39H66N2O6Si2 715.4538, found 715.4527 ([M+H]+).

N,N’-bis(3-(Acetoxymethyl)-4-((tert-butyldimethylsilyl)oxy)phenethyl)-

N,N,N’,N’-tetramethylpropane-1,3-diaminium iodide (5.8), (Di-QMPN2). Methyl iodide (1 mL) was added to a solution of 5.7 (170 mg, 0.24 mmol) in 2 mL of CH3CN and the reaction stirred at ambient temperature for 2 h. The product was collect by

108 removal of solvents under reduced pressure to yield 5.8 (Di-QMPN2) as a pale yellow oil

1 (96 mg, 0.10 mmol, 40% yield). H NMR (400 MHz, CD3OD) δ ppm 7.46 (d, J =2.2 Hz,

2H), 7.36 (dd, J =2.2, 8.3 Hz, 2H), 6.88 (d, J =8.3 Hz, 2H), 5.09 (s, 4H), 3.77 - 3.68 (m,

8H), 3.37 (s, 12H), 3.22 - 3.15 (m, 4H), 2.57 - 2.46 (m, 2H), 2.08 (s, 6H), 1.02 (s, 18H),

13 0.25 (s, 12H). C NMR (101 MHz, CD3OD) δ ppm 171.3, 153.2, 131.2, 130.4, 128.1,

126.8, 118.9, 65.7, 61.9, 60.4, 50.8, 27.9, 24.9, 20.0, 18.0, 17.8, -5.3.

N-(4-((tert-Butyldimethylsilyl)oxy)-3-(((tert-butyldimethylsilyl)oxy)methyl)- phenethyl)-N’’(3-((4-((tert-butyldimethylsilyl)oxy)-3-(((tert-butyldimethylsilyl)oxy)- methyl)phenethyl)(methyl)amino)propyl)-N,N’’-dimethylpropane-1,3-diamine (5.9).

To a solution of 5.4 (1.0 g, 2.2 mmol) in 2 mL of CH3CN and trimethylamine (280 µL,

2.2 mmol) was added N,N-bis[3-(methylamino)propyl]methylamine (140 µL, 1.1 mmol).

The reaction was stirred at 75 °C for 18 hours. The solution was diluted with 150 mL of

EtOAc, washed NaHCO3 (3x50 mL), dried with MgSO4, and solvent removed under vacuum to yield 5.9 as an orange oil (750 mg, 0.87 mmol, 79% yield). 1H NMR (400

MHz, CDCl3) δ ppm 7.29 (d, J = 2.2 Hz, 2 H), 6.94 (dd, J = 2.2, 8.1 Hz, 2 H), 6.66 (d, J

= 8.1 Hz, 2 H), 4.75 (s, 4 H), 2.78 - 2.71 (m, 4 H), 2.64 - 2.58 (m, 4H), 2.44 (t, J =7.4 Hz,

4H), 2.37 (t, J =7.4 Hz, 4H), 2.33 (s, 6H), 2.25 (s, 3H), 1.70 (m, 4H), 1.01 (s, 18H), 0.97

13 (s, 18H), 0.22 (s, 12H), 0.12 (s, 12H). C NMR (101 MHz, CDCl3) δ ppm 150.1, 132.9,

131.8, 127.3, 127.3, 117.7, 60.6, 59.9, 55.9, 55.7, 42.2, 33.2, 26.0, 25.7, 25.0, 18.5, 18.2,

+ -4.2, -5.3 FAB HRMS m/z Calcd ([M+H] ) for C51H99N3O4Si4, 930.6791 found 930.6774

([M+H]+).

109

(((((Methylazanediyl)bis(propane-3,1-diyl))bis(methylazanediyl))bis(ethane-

2,1-diyl))bis(6-((tert-butyldimethylsilyl)oxy)-3,1-phenylene))dimethanol (5.10). p-TsOH (160 mg, 0.86 mmol) was added to a solution of 5.9 (370 mg, 0.43 mmol) in 5 mL methanol and stirred at room temperate for 1 hour. The product was diluted with 100 mL EtOAc, washed with sat NaHCO3 (2x50 mL), dried with MgSO4, and concentrated under reduced pressure. The crude product was dissolved in 2 mL of methanol and washed with 2 mL hexane to remove residual TBDMS, and concentrated under reduced pressure to yield 5.10 as an orange oil (160 mg, 0.26 mmol, 60% yield). 1H NMR (400

MHz, CDCl3) δ ppm 7.20 (d, J = 2.2 Hz, 2H), 6.96 (dd, J = 2.2, 8.2 Hz, 2H), 6.70 (d, J =

8.2 Hz, 2H), 4.66 (s, 4H), 2.74 - 2.67 (m, 4H), 2.61 - 2.55 (m, 4H), 2.40 (t, J =7.4 Hz,

4H), 2.31 (d, J = 7.4 Hz, 4H), 2.28 (s, 6H), 2.19 (s, 3H), 1.69 - 1.59 (m, 4H), 1.01 (s,

13 18H), 0.24 (s, 12H). C NMR (101 MHz, CDCl3) δ ppm 151.3, 133.1, 131.7, 128.5,

128.3, 118.1, 61.2, 59.3, 55.6, 55.6, 42.3, 42.2, 32.8, 25.8, 24.7, 18.2, -4.2. FAB HRMS

+ + m/z Calcd ([M+H] ) for C39H71N3O2Si2, 702.5061 found 702.5038 ([M+H] ).

(((((Methylazanediyl)bis(propane-3,1-diyl))bis(methylazanediyl))bis(ethane-

2,1-diyl))bis(6-((tert-butyldimethylsilyl)oxy)-3,1-phenylene))bis(methylene) diacetate

(5.11). Acetyl chloride (62 mg, 0.80 mmol, 57 µL) was added to a solution of 5.10 (200 mg, 0.32 mmol) in 5 mL CH2Cl2 and triethylamine (85 µL, 0.64 mmol) and stirred at room temperature for 1 hour. The reaction was diluted with 100 mL of CHCl3, washed with sat. NaHCO3 (2x50 mL), dried with MgSO4, and concentrated under reduced pressure to yield 5.11 as a pale yellow oil (170 mg, 0.24 mmol, 75% yield). 1H NMR

(400 MHz, CDCl3) δ ppm 7.13 (d, J = 2.3 Hz, 2H), 7.04 (dd, J = 2.3, 8.3 Hz, 2H), 6.74

(d, J = 8.3 Hz, 2H), 5.08 (s, 4H), 2.74 - 2.67 (m, 4H), 2.61 - 2.55 (m, 4H), 2.42 (t, J = 7.5

110

Hz, 4H), 2.36 (t, J = 7.5 Hz, 4H), 2.30 (s, 9H), 2.23 (s, 3H), 2.09 (s, 6H), 1.72 - 1.62 (m,

13 4H), 1.00 (s, 18H), 0.23 (s, 12H). C NMR (101 MHz, CDCl3) δ ppm 170.9, 152.2,

133.0, 130.6, 129.6, 126.1, 118.4, 62.3, 59.8, 55.9, 55.7, 42.3, 42.2, 33.0, 25.7, 25.2, 21.0,

+ 18.2, -4.2. FAB HRMS m/z Calcd ([M+H] ) for C43H75N3O6Si2, 786.5272 found

786.5239 ([M+H]+).

N-(3-Acetoxymethyl)-4-((tert-butyldimethylsilyl)oxy)phenethyl)-N’’-(3-((3-

(acetoxymethyl)-4-((tert-butyldimethylsilyl)oxy)phenethyl)dimethylammonio)- propyl)-N,N,N’’,N’’-tetramethylpropane-1,3-diaminium iodide (5.12), (Di-QMPN3).

Methyl iodide (1 mL) was added to a solution of 5.11 (170 mg, 0.24 mmol) in 2 mL of

CH3CN and the reaction stirred at ambient temperature for 2 h. The product was collect by removal of solvents under reduced pressure to yield 5.12 (Di-QMPN3) as a pale

1 yellow oil (96 mg, 0.10 mmol, 40% yield). H NMR (400 MHz, CD3OD) δ ppm 7.47 (d,

J = 2.0, 2H), 7.37 (dd, J = 2.0, 8.3 Hz, 2H), 6.88 (d, J = 8.3 Hz, 2H), 5.09 (s, 4H), 3.88 -

3.63 (m, 12H), 3.43 (s, 6H), 3.39 (s, 12H), 3.25 - 3.12 (m, 4H), 2.64 - 2.44 (m, 4H), 2.09

13 (s, 6H), 1.02 (s, 18H), 0.25 (s, 12H) C NMR (101 MHz, CD3OD) δ ppm 171.3, 153.1,

131.3, 130.4, 128.1, 126.8, 118.8, 65.8, 61.9, 60.6, 60.4, 51.6, 50.9, 28.0, 24.9, 20.1, 18.2,

17.8, -5.0.

111

Chapter 6: Conclusions

Of the vast number of intracellular and extracellular chemicals that can damage

DNA, alkylating agents are of great interest to the scientific community. Numerous alkylating agents are found naturally in the environment and made synthetically. If this damage is not repaired, the resulting DNA adducts can cause mutations leading to apoptosis and even cancer. However, several DNA alkylating compounds are also effective chemotherapeutics, such as mitomycin C. The electrophile generated by mitomycin C relates to a class of compounds known as quinone methides (QM). These intermediates are able to alkylate DNA in both a reversible and irreversible manner dependent on their site of alkylation on DNA. Through the exploitation of reversible QM-

DNA adducts, the QM is able to increase its overall lifetime in vivo from hours to days.

However, this complicates detection as reversible QM-DNA do not survive lengthy assays required for analysis (>24 h). The study of the kinetically favorable and reversible adducts may prove to be the most biologically relevant as it may initiate early cellular responses to DNA damage.

In order to detect reversible QM-DNA adducts at early reaction times with DNA, a chemical trap was required to oxidize a simple MeQM to an irreversible derivative. In this instance, bis[(trifluoroacetoxy)iodo]benzene (BTI) was used to trap the MeQM at the kinetically favorable and reversible sites of DNA, (dA-N1, dG-N7, dC-N3). Previous studies have fully characterized dC-N3, dG-N1, dG-N2, dG-N7/G-N7, dA-N6 adducts by

1D-NMR, 2D-NMR, and ESI+-MS, leaving the full characterization of MeQM-dA-N1 to be completed. Through use of a one-pot alkylation and oxidation, MeQM-dA-N1 was

112 converted to a stable spiro-cyclized product, similar to MeQM-dC-N3. This compound was then used as a standard for the observation of adducts in ssDNA and dsDNA.

Although QMs were able to react at kinetically favorable sites of nucleosides, the ability of the compound to react with ssDNA and dsDNA may differ due to conformation changes in DNA to include Watson-Crick base pairing. From oxidative trapping of

MeQM with ssDNA and ds DNA at 1 and 24 h, the major products at early time points were indeed the kinetically favorable and highly reversible adducts (QM-dA-N1 and

QM-dC-N3). The ability to observe these reversible adducts may therefore lead to the best description of the biologically relevant adducts in order to more accurately track and observe the source of genotoxicity.

As QMs have demonstrated the ability to alkylate DNA in a reversible manner, bifunctional QMs (BisQMP) were developed to form ISCs and migrate along DNA.

Simple QMs do not possess a high affinity for DNA, but through the coupling to an acridine linker, BisQMPs were able to form ISC efficiently. These compounds were also tested for their ability to migrate along DNA, as one electrophilic site would be anchored to DNA as the other moved, much like how an individual walks, one step at a time.

However, the BisQMP acridine moiety was only able to migrate along DNA with the addition of increased electron density on the aromatic ring, provided by an ether linkage.

Moreover, the overall rate of migration was relatively slow (5 days). This was thought to be due to the necessity of the acridine to dissociate from DNA, and reinsert itself at an adjacent base pair in order for migration of the QM to occur. To this end several

BisQMPs were constructed with the substitution of acridine for varying amounts of positive charges and electron density. Results indicated that the association of the

113

BisQMPs containing 3 ammonium complexes (BisQMPN3 and eBisQMPN3) had the highest affinity to DNA and able to create 100% ISC at ~10-fold excess to DNA.

Additionally, these compounds were shown to form ISC at much faster rates than their

BisQMP acridine counterparts (~4 h vs 24 h). However, these compounds were not effective at producing high yields of ISC in strand transfer experiments. Additionally, no

ISC was observed in strand migration and exchange.

The inability of BisQMPN3 to transfer from donor to acceptor strand may be due their ability to over alkylate the donor strand prior to initial strand transfer, effectively hindering the ability of the acceptor strand to anneal with the donor strand. This in turn would not allow the QM to be in proximity of the acceptor strand’s nucleophilic sites, subsequently diminishing its effectiveness to form ISC. In order to overcome over alkylation, the concentration of BisQMPNx should be decreased or excess BisQMPN3 should be removed at early time points (~1-2 hours), after short reaction time. This will decrease the amount of BisQMPN3 on the donor strand which in turn should allow for the acceptor strand to anneal, subsequently allowing the BisQMPN3 to transfer. Once initial transfer is optimized through the regulation of initial BisQMPNx loading, strand exchange and migration experiments could be further explored.

BisQMPNx may also no longer associate with DNA in a manner that presents the alkylating agent to kinetically favorable sites. It has been shown that small molecules exhibiting positive charges tend to associate to the minor groove of DNA. If this were to occur with BisQMPNx the ability to migrate would be diminished as the accessibility of the reversible adducts is hindered. As the minor groove contains dG-N2, alkylation at this

114 site would most likely be preferred and ultimately lead to the formation of an irreversible adduct no longer able to migrate along DNA.

In addition to the modification of the DNA associating moiety and electron density, migration may be hindered by the BisQMP’s dependence on the sequential reaction of the two QM sites. Separation of the electrophilic species on different aromatic rings may increase the overall rate of migration as the QMs are able to act independently of each other. Therefore, the development of bifunctional alkylating agents containing

QMs on separate ring systems was created (DiQMPN2&3). These compounds were linked together through the addition of ammonium complexes at varying lengths. This may also assist in the migration along DNA as the QMs “reach/stride” has been increased possibly increasing its flexibility. These compounds are currently being evaluated for their ability to form ISC, transfer, exchange, and ultimately migrate along DNA by Shane Byrne.

The goals of the studies presented in this dissertation were to develop a bifunctional alkylating agent for association and migration along DNA. With the development of BisQMPNx and eBisQMPNx, these compounds exhibited the ability to associate and form ISC with DNA. However, migration was not observed in the compounds developed. Further modification of experiments (as described above) and/or modification of the compounds through additional or different DNA associating moieties may alleviate the inability to migrate thereby creating an alternate means of migration along DNA.

115

References

1. Voet, D. V. J. G., . 4th Edition ed.; John Wiley & Sons: New York, 2011. 2. Zephyris, DNA Structure. In Attribution-ShareAlike 3.0 Unported [CC BY-SA 3.0]: 2011. 3. McFail-Isom, L.; Sines, C. C.; Williams, L. D., DNA structure: cations in charge? Curr. Opin. Struct. Biol. 1999, 9, (3), 298-304. 4. Rajski, S. R.; Williams, R. M., DNA Cross-Linking Agents as Antitumor Drugs. Chem. Rev. 1998, 98, (8), 2723. 5. Noll, D. M.; Mason, T. M.; Miller, P. S., Formation and Repair of Interstrand Cross-Links in DNA. Chem. Rev. 2006, 106, (2), 277-301. 6. Mishina, Y.; Duguid, E. M.; He, C., Direct Reversal of DNA Alkylation Damage. Chem. Rev. 2006, 106, (2), 215-232. 7. Lehmann, A. R., DNA Repair and Mutagenesis, second ed., E.C. Friedberg, G.C. Walker, W. Siede, R.D. Wood, R.A. Schultz, T. Ellenberger. ASM Press, ISBN 1-55581- 319-4. DNA Repair 2006, 5, (6), 759. 8. Lawley, P. D., Alkylation of DNA and its aftermath. Bioessays 1995, 17, (6), 561- 568. 9. Shrivastav, N.; Li, D.; Essigmann, J. M., Chemical biology of mutagenesis and DNA repair: cellular responses to DNA alkylation. Carcinogenesis 2011, 31, (1), 59-70. 10. Rink, S. M.; Solomon, M. S.; Taylor, M. J.; Rajur, S. B.; McLaughlin, L. W.; Hopkins, P. B., Covalent structure of a nitrogen mustard-induced DNA interstrand cross- link: an N7-to-N7 linkage of deoxyguanosine residues at the duplex sequence 5'-d(GNC). J. Am. Chem. Soc. 1993, 115, (7), 2551-2557. 11. Rajski Sr Fau - Williams, R. M.; Williams, R. M., DNA Cross-Linking Agents as Antitumor Drugs. Chem. Rev. 1998, 98, 1520-6890. 12. Romano, K. P.; Newman, A. G.; Zahran, R. W.; Millard, J. T., DNA Interstrand Cross-Linking by Epichlorohydrin. Chem. Res. Toxicol. 2007, 20, (5), 832-838. 13. Malina, J.; Kasparkova, J.; Farrell, N. P.; Brabec, V., Walking of antitumor bifunctional trinuclear PtII complex on double-helical DNA. Nucleic Acids Res. 2011, 39, (2), 720-728. 14. Tomasz, M., Mitomycin C: small, fast and deadly (but very selective). Chem. Biol. 1995, 2, (9), 575-579. 15. Tomasz, M.; Chawla, A. K.; Lipman, R., Mechanism of monofunctional and bifunctional alkylation of DNA by mitomycin C. Biochemistry 1988, 27, (9), 3182. 16. Ueda, K.; Komano, T., Sequence-specific DNA damage induced by reduced mitomycin C and 7-N-(p-hydroxyphenyl)mitomycin C. Nucleic Acids Res. 1984, 12, (17), 6673-6683. 17. Hlavin, E. M.; Smeaton, M. B.; Miller, P. S., Initiation of DNA Interstrand Cross- link Repair in Mammalian Cells. Environ. Mol. Mutagen. 2010, 51, (6), 604-624. 18. Kozekov, I. D.; Nechev, L. V.; Sanchez, A.; Harris, C. M.; Lloyd, R. S.; Harris, T. M., Interchain Cross-Linking of DNA Mediated by the Principal Adduct of Acrolein. Chem. Res. Toxicol. 2001, 14, (11), 1482-1485.

116

19. Pawlowicz, A. J.; Munter, T.; Zhao, Y.; Kronberg, L., Formation of Acrolein Adducts with 2'-Deoxyadenosine in Calf Thymus DNA. Chem. Res. Toxicol. 2006, 19, (4), 571-576. 20. Rokita, S. E., Quinone Methides. John Wiley & Sons: Hoboken, New Jersey 2009; Vol. 1. 21. Kulikov, A.; Arumugam, S.; Popik, V. V., Photolabile Protection of Alcohols, Phenols, and Carboxylic Acids with 3-Hydroxy-2-Naphthalenemethanol. J. Org. Chem. 2008, 73, (19), 7611-7615. 22. McCrane, M. P.; Weinert, E. E.; Lin, Y.; Mazzola, E. P.; Lam, Y.-F.; Scholl, P. F.; Rokita, S. E., Trapping a Labile Adduct Formed between an ortho-Quinone Methide and 2'-Deoxycytidine. Org. Lett. 2011, 13, (5), 1186. 23. Lewis, M. A.; Graff Yoerg, D.; Bolton, J. L.; Thompson, J. A., Alkylation of 2'- Deoxynucleosides and DNA by Quinone Methides Derived from 2,6-Di-tert-butyl-4- methylphenol. Chem. Res. Toxicol. 1996, 9, (8), 1368-1374. 24. Denny, W. A.; Wilson, W. R.; Hay, M. P., Recent developments in the design of bioreductive drugs. Br. J. Cancer, BJC. 1996, 27, S32-8. 25. Hulsman, N.; Medema, J. P.; Bos, C.; Jongejan, A.; Leurs, R.; Smit, M. J.; de Esch, I. J. P.; Richel, D.; Wijtmans, M., Chemical Insights in the Concept of Hybrid Drugs: The Antitumor Effect of Nitric Oxide-Donating Aspirin Involves A Quinone Methide but Not Nitric Oxide nor Aspirin. J. Med. Chem. 2007, 50, (10), 2424-2431. 26. Gao, J.; Kashfi, K.; Rigas, B., In Vitro Metabolism of Nitric Oxide-Donating Aspirin: The Effect of Positional Isomerism. J. Pharmacol. Exp. Ther. 2005, 312, (3), 989-997. 27. Kodela, R.; Chattopadhyay, M.; Kashfi, K., NOSH-Aspirin: A Novel Nitric Oxide-Hydrogen Sulfide-Releasing Hybrid: A New Class of Anti-inflammatory Pharmaceuticals. ACS Med. Chem. Lett. 2012, 3, (3), 257-262. 28. Dunlap, T.; Abdul-Hay, S. O.; Chandrasena, R. E. P.; Hagos, G. K.; Sinha, V.; Wang, Z.; Wang, H.; Thatcher, G. R. J., Nitrates and NO-NSAIDs in cancer chemoprevention and therapy: In vitro evidence querying the NO donor functionality. Nitric Oxide 2008, 19, (2), 115-124. 29. Veldhuyzen, W. F.; Shallop, A. J.; Jones, R. A.; Rokita, S. E., Thermodynamic versus Kinetic Products of DNA Alkylation as Modeled by Reaction of Deoxyadenosine. J. Am. Chem. Soc. 2001, 123, (45), 11126-11132. 30. Weinert, E. E. Quinone methide alkylation of DNA: Understanding reactivity through reversibility, trapping, and substitutent effects. University of Maryland, College Park, MD, 2006. 31. Zeng, Q.; Rokita, S. E., Tandem Quinone Methide Generation for Cross-Linking DNA. J. Org. Chem. 1996, 61, (26), 9080-9081. 32. Veldhuyzen, W. F.; Pande, P.; Rokita, S. E., A Transient Product of DNA Alkylation Can Be Stabilized by Binding Localization. J. Am. Chem. Soc. 2003, 125, (46), 14005-14013. 33. Fakhari, F.; Rokita, S. E., A walk along DNA using bipedal migration of a dynamic and covalent crosslinker. Nat Commun 2014, 5, 10. 34. Tretyakova, N.; Villalta, P. W.; Kotapati, S., Mass Spectrometry of Structurally Modified DNA. Chem. Rev. 2013, 113, (4), 2395-2436.

117

35. Farmer, P. B., DNA and protein adducts as markers of genotoxicity. Toxicol. Lett. 2004, 149, (13), 3-9. 36. Veldhuyzen, W. F.; Lam, Y.-F.; Rokita, S. E., 2'-Deoxyguanosine Reacts with a Model Quinone Methide at Multiple Sites. Chem. Res. Toxicol. 2001, 14, (9), 1345-1351. 37. McCrane, M. P.; Hutchinson, M. A.; Ad, O.; Rokita, S. E., Oxidative Quenching of Quinone Methide Adducts Reveals Transient Products of Reversible Alkylation in Duplex DNA. Chem. Res. Toxicol. 2014, 27, (7), 1282-1293. 38. Rokita, S. E.; Yang, J.; Pande, P.; Greenberg, W. A., Quinone Methide Alkylation of Deoxycytidine. J. Org. Chem. 1997, 62, (9), 3010-3012. 39. Barlow, T.; Takeshita, J.; Dipple, A., Deamination and Dimroth Rearrangement of Deoxyadenosine Styrene Oxide Adducts in DNA. Chem. Res. Toxicol. 1998, 11, (7), 838-845. 40. Engel, J. D., Mechanism of the dimroth rearrangement in adenosine. Biochem. Biophys. Res. Commun. 1975, 64, (2), 581-586. 41. Pretsch, E., Bühlmann, Philippe, Badertscher, Martin, Structure Determination of Organic Compounds: Tables of Spectral Data. 3rd ed.; Springer: Berlin, 2009. 42. Pande, P.; Shearer, J.; Yang, J.; Greenberg, W. A.; Rokita, S. E., Alkylation of Nucleic Acids by a Model Quinone Methide. J. Am. Chem. Soc. 1999, 121, (29), 6773. 43. Pritchard, A. E.; Kowalski, D.; Laskowski, M., An endonuclease activity of venom phosphodiesterase specific for single-stranded and superhelical DNA. J. Biol. Chem. 1977, 252, (23), 8652-9. 44. Pollack, S. E.; Uchida, T.; Auld, D. S., Snake venom phosphodiesterase: A zinc metalloenzyme. J. Protein Chem. 1983, 2, (1), 1-12. 45. Williams, E. J.; Sung, S.-C.; Laskowski, M., Action of Venom Phosphodiesterase on Deoxyribonucleic Acid. J. Biol. Chem. 1961, 236, (4), 1130-1134. 46. Drablos, F.; Feyzi, E.; Aas, P. A.; Vaagbo, C. B.; Kavli, B.; Bratlie, M. S.; Pena- Diaz, J.; Otterlei, M.; Slupphaug, G.; Krokan, H. E., Alkylation damage in DNA and RNA-repair mechanisms and medical significance. DNA Repair 2004, 3, (11), 1389- 1407. 47. Lin, S.-W.; Sun, Q.; Ge, Z.-M.; Wang, X.; Ye, J.; Li, R.-T., Synthesis and structure-analgesic activity relationships of a novel series of monospirocyclopiperazinium salts (MSPZ). Bio. Org. Med. Chem. Lett. 2011, 21, (3), 940-943. 48. Baguley, B. C., Nonintercalative DNA-binding antitumour compounds. Mol. Cell Biochem. 1982, 43, (3), 167-181. 49. Shendage, D. M.; Frahlich, R.; Haufe, G., Highly Efficient Stereoconservative Amidation and Deamidation of α-Amino Acids. Org. Lett. 2004, 6, (21), 3675-3678. 50. Meyers, M. J.; Sun, J.; Carlson, K. E.; Marriner, G. A.; Katzenellenbogen, B. S.; Katzenellenbogen, J. A., Estrogen Receptor-β Potency-Selective Ligands: Structure- Activity Relationship Studies of Diarylpropionitriles and Their Acetylene and Polar Analogues. J. Med. Chem. 2001, 44, (24), 4230-4251. 51. Yoon, N. M.; Pak, C. S.; Brown Herbert, C.; Krishnamurthy, S.; Stocky, T. P., Selective reductions. XIX. Rapid reaction of carboxylic acids with borane- tetrahydrofuran. Remarkably convenient procedure for the selective conversion of carboxylic acids to the corresponding alcohols in the presence of other functional groups. J. Org. Chem. 1973, 38, (16), 2786-2792.

118

52. Roy, A. K.; B, R.; Batra, S., Insights into the bromination of 3-aryl-5-methyl- isoxazole-4-carboxylate: synthesis of 3-aryl-5-bromomethyl-isoxazole-4-carboxylate as precursor to 3-aryl-5-formyl-isoxazole-4-carboxylate. Tetrahedron 2004, 60, (10), 2301- 2310. 53. Blackburn, L.; Taylor, R. J. K., In Situ Oxidation-Imine Formation-Reduction Routes from Alcohols to Amines. Org. Lett. 2001, 3, (11), 1637-1639. 54. Albrecht, S.; Defoin, A.; Tarnus, C., Simple Preparation of O-Substituted Hydroxylamines from Alcohols. Synthesis 2006, 2006, (10), 1635-1638. 55. Ganem, B.; Small, V. R., Ferric chloride in acetic anhydide. Mild and versatile reagent for the cleavage of ethers. J. Org. Chem. 1974, 39, (25), 3728-3730. 56. Izzo, I.; De Caro, S.; De Riccardis, F.; Spinella, A., Synthesis of alkylphenols and alkylcatechols from the marine mollusc Haminoea callidegenita. Tetrahedron Lett. 2000, 41, (20), 3975-3978. 57. Ishihara, K.; Kurihara, H.; Yamamoto, H., An extremely simple, convenient, and selective method for acetylating primary alcohols in the presence of secondary alcohols. J. Org. Chem. 1993, 58, (15), 3791-3793. 58. Kato, Y.; Ozawa, S.; Miyamoto, C.; Maehata, Y.; Suzuki, A.; Maeda, T.; Baba, Y., Acidic extracellular microenvironment and cancer. Cancer Cell Int. 2013, 13, (1), 1- 8. 59. Stewart, K. D.; Gray, T. A., Survey of the DNA binding properties of natural and synthetic polyamino compounds. J. Phys. Org. Chem. 1992, 5, (8), 461-466. 60. Tan, Z.-J.; Chen, S.-J., Nucleic Acid Helix Stability: Effects of Salt Concentration, Cation Valence and Size, and Chain Length. Biophys. J. 2006, 90, (4), 1175-1190. 61. Chen, W.; Balakrishnan, K.; Kuang, Y.; Han, Y.; Fu, M.; Gandhi, V.; Peng, X., Reactive Oxygen Species (ROS) Inducible DNA Cross-Linking Agents and Their Effect on Cancer Cells and Normal Lymphocytes. J. Med. Chem .2014, 57, (11), 4498-4510. 62. Fang, B.; Zhou, C.-H.; Rao, X.-C., Synthesis and biological activities of novel amine-derived bis-azoles as potential antibacterial and antifungal agents. Eur. J. Med. Chem. 2010, 45, (9), 4388-4398. 63. Kushakova, P. M.; Chernobroviy, A. N.; Kuznetsov, V. A.; Garabadgiu, A. V., Preparation of 1-amino-4-methylpiperazine. Chem. Heterocycl. Compd. 2004, 40, (12), 1546-1549. 64. Yan, Z.-Z.; Dai, G.-L.; Liang, H.-D.; Lin, Y.-Q., Synthesis, characterization and luminescent properties of lanthanide complexes with an unsymmetrical tripodal ligand. Luminescence 2010, 26, (3), 218-222. 65. Casadei, M. A.; Galli, C.; Mandolini, L., Ring-closure reactions. 22. Kinetics of cyclization of diethyl (.omega.-bromoalkyl)malonates in the range of 4- to 21-membered rings. Role of ring strain. J. Am. Chem. Soc. 1984, 106, (4), 1051-1056. 66. Chen, W.; Gerasimov, J. Y.; Zhao, P.; Liu, K.; Herrmann, A., High-Density Noncovalent Functionalization of DNA by Electrostatic Interactions. J. Am. Chem. Soc. 2015, 137, (40), 12884-12889. 67. Weinert, E. E.; Dondi, R.; Colloredo-Melz, S.; Frankenfield, K. N.; Mitchell, C. H.; Freccero, M.; Rokita, S. E., Substituents on Quinone Methides Strongly Modulate Formation and Stability of Their Nucleophilic Adducts. J. Am. Chem. Soc. 2006, 128, (36), 11940-11947.

119

68. Lönnberg, T.; Hutchinson, M.; Rokita, S., Selective Alkylation of C-Rich Bulge Motifs in Nucleic Acids by Quinone Methide Derivatives. Chem. Eur. J. 2104, 21, (37), 13127-13136. 69. Iwamoto, R. T., Solvent Effects on the Electro-oxidation of Iodide Ion. Anal. Chem. 1959, 31, (5), 955-955. 70. Gold, B.; Marky, L. M.; Stone, M. P.; Williams, L. D., A Review of the Role of the Sequence-Dependent Electrostatic Landscape in DNA Alkylation Patterns. Chem. Res. Toxicol. 2006, 19, (11), 1402-1414. 71. Bai, M.; Huang, J.; Zheng, X.; Song, Z.; Tang, M.; Mao, W.; Yuan, L.; Wu, J.; Weng, X.; Zhou, X., Highly Selective Suppression of Melanoma Cells by Inducible DNA Cross-Linking Agents: Bis(catechol) Derivatives. J. Am. Chem. Soc. 2014, 132, (43), 15321-15327. 72. Song, Z.; Weng, X.; Weng, L.; Huang, J.; Wang, X.; Bai, M.; Zhou, Y.; Yang, G.; Zhou, X., Synthesis and Oxidation-Induced DNA Cross-Linking Capabilities of Bis(catechol) Quaternary Ammonium Derivatives. Chem. Eur. J. 2008, 14, (19), 5751- 5754. 73. Wang, P.; Liu, R.; Wu, X.; Ma, H.; Cao, X.; Zhou, P.; Zhang, J.; Weng, X.; Zhang, X.-L.; Qi, J.; Zhou, X.; Weng, L., A Potent, Water-Soluble and Photoinducible DNA Cross-Linking Agent. J. Am. Chem. Soc. 2003, 125, (5), 1116-1117. 74. Belyanin, M. L.; Filimonov, V. D.; Krasnov, E. A., Efficient Procedure for Preparing Salicyl Alcohols. Russ. J. Appl. Chem. 2001, 74, (1), 103-105. 75. Nagata, W.; Okada, K.; Aoki, T., ortho-Specific a-Hydroxyalkylation of Phenols with Aldehydes. An Efficient Synthesis of Saligenol Derivatives. Synthesis 1979, (05), 365-368.

120

Appendix A: Supporting Information for Chapter 2

Figure A.1 1H-NMR of Oxidized MeQM-dA-N1 in d6-DMSO at 400 MHz

Figure A.2 13C-NMR of Oxidized MeQM-dA-N1 in d6-DMSO at 101 MHz

121

Figure A.3 1H-13C HSQC of Oxidized MeQM-dA-N1 in d6-DMSO at 400 MHz

122

Figure A.4 1H-13C HMBC of Oxidized MeQM-dA-N1 in d6-DMSO at 400 MHz

123

Appendix B: Supporting Information for Chapter 3

1 Figure B.1 H-NMR of 3.4 in CDCl3 at 400 MHz

13 Figure B.2 C-NMR of 3.4 in CDCl3 at 101 MHz

124

1 Figure B.3 H-NMR of 3.5 in CDCl3 at 400 MHz

13 Figure B.4 C-NMR of 3.5 in CDCl3 at 101 MHz

125

1 Figure B.5 H-NMR of 3.6 in CDCl3 at 400 MHz

13 Figure B.6 C-NMR of 3.6 in CDCl3 at 101 MHz

126

1 Figure B.7 H-NMR of 3.7 in CDCl3 at 400 MHz

13 Figure B.8 C-NMR of 3.7 in CDCl3 at 101 MHz

127

1 Figure B.9 H-NMR of 3.8 in CDCl3 at 400 MHz

1 Figure B. 10 H-NMR of 3.8 in CDCl3 at 400 MHz (1.5 ppm- 2.65 ppm)

128

13 Figure B.11 C-NMR of 3.8 in CDCl3 at 101 MHz

1 Figure B.12 H-NMR of 3.9 (BisQMPN1) in CDCl3 at 400 MHz

129

1 Figure B.13 H-NMR of 3.9 (BisQMPN1) in CD3OD at 400 MHz (2.0 ppm- 3.5 ppm)

13 Figure B.14 C-NMR of 3.9 (BisQMPN1) in CD3OD 101 MHz

130

1 Figure B.15 H-NMR of 3.10 in CDCl3 at 400 MHz

13 Figure B.16 C-NMR of 3.10 in CDCl3 at 101 MHz

131

1 Figure B.17 H-NMR of 3.11 in CDCl3 at 400 MHz

13 Figure B.18 C-NMR of 3.11 in CDCl3 at 101 MHz

132

1 Figure B.19 H-NMR of 3.12 in CDCl3 at 400 MHz

1 Figure B. 20 H-NMR of 3.12 in CDCl3 at 400 MHz (1.5 ppm-2.7 ppm)

133

13 Figure B.21 C-NMR of 3.12 in CDCl3 at 101 MHz

1 Figure B.22 H-NMR of 3.13 (BisQMPN2) in CD3OD at 400 MHz

134

1 Figure B.23 H-NMR of 3.13 (BisQMPN2) in CD3OD at 400 MHz

13 Figure B.24 C-NMR of 3.13 (BisQMPN2) in CD3OD at 101 MHz

135

1 Figure B.25 H-NMR of 3.14 in CDCl3 at 400 MHz

13 Figure B.26 C-NMR of 3.14 in CDCl3 at 101 MHz

136

1 13 Figure B.27 H- C HSQC of 3.14 in CDCl3 at 400 MHz

1 13 Figure B.28 H- C HMBC of 3.14 in CDCl3 at 400 MHz

137

1 Figure B.29 H-NMR of 3.15 in CDCl3 at 400 MHz

13 Figure B.30 C-NMR of 3.15 in CDCl3 at 101 MHz

138

1 13 Figure B.31 H- C HSQC of 3.15 in CDCl3 at 400 MHz

1 13 Figure B.32 H- C HMBC of 3.15 in CDCl3 at 400 MHz

139

1 Figure B.33 H-NMR of 3.16 in CDCl3 at 400 MHz

13 Figure B.34 C-NMR of 3.16 in CDCl3 at 101 MHz

140

1 Figure B.35 H-NMR of 3.17 in CDCl3 at 400 MHz

13 Figure B.36 C-NMR of 3.17 in CDCl3 at 101 MHz

141

1 Figure B.37 H-NMR of 3.18 in CDCl3 at 400 MHz

1 Figure B.38 H-NMR of 3.18 in CDCl3 at 400 MHz (1.5 ppm- 2.7 ppm)

142

13 Figure B.39 C-NMR of 3.18 in CDCl3 at 101 MHz

1 Figure B.40 H-NMR of 3.19 (BisQMPN3) in CD3OD at 400 MHz

143

1 Figure B.41 H-NMR of 3.19 (BisQMPN3) in CD3OD at 400 MHz

13 Figure B.42 C-NMR of 3.19 (BisQMPN3) in CD3OD at 101 MHz

144

Appendix C: Supporting Information for Chapter 4

1 Figure C.1 H-NMR of 4.4 in CDCl3 at 400 MHz

13 Figure C.2 C-NMR of 4.4 in CDCl3 at 101 MHz

145

1 Figure C.3 H-NMR of 4.5 in CDCl3 at 400 MHz

13 Figure C.4 C-NMR of 4.5 in CDCl3 at 101 MHz

146

1 Figure C.5 H-NMR of 4.6 in CDCl3 at 400 MHz

13 Figure C.6 C-NMR of 4.6 in CDCl3 at 101 MHz

147

1 Figure C.7 H-NMR of 4.7 in CDCl3 at 400 MHz

13 Figure C.8 C-NMR of 4.7 in CDCl3 at 101 MHz

148

1 Figure C.9 H-NMR of 4.8 in CDCl3 at 400 MHz

13 Figure C.10 C-NMR of 4.8 in CDCl3 at 101 MHz

149

1 Figure C.11 H-NMR of 4.9 (eBisQMPN2) in CDCl3 at 400 MHz

13 Figure C.12 C-NMR of 4.9 (eBisQMPN2) in CDCl3 at 101 MHz

150

1 Figure C.13 H-NMR of 4.10 in CDCl3 at 400 MHz

13 Figure C.14 C-NMR of 4.10 in CDCl3 at 101 MHz

151

1 Figure C.15 H-NMR of 4.11 in CDCl3 at 400 MHz

13 Figure C.16 C-NMR of 4.11 in CDCl3 at 101 MHz

152

1 Figure C.17 H-NMR of 4.12 in CDCl3 at 400 MHz

13 Figure C.18 C-NMR of 4.12 in CDCl3 at 101 MHz

153

1 Figure C.19 H-NMR of 4.13 in CDCl3 at 400 MHz

13 Figure C.20 C-NMR of 4.13 in CDCl3 at 101 MHz

154

1 Figure C.21 H-NMR of 4.14 in CDCl3 at 400 MHz

13 Figure C.22 C-NMR of 4.14 in CDCl3 at 101 MHz

155

1 Figure C.23 H-NMR of 4.15 (eBisQMPN3) in CDCl3 at 400 MHz

13 Figure C.24 C-NMR of 4.15 (eBisQMPN3) in CDCl3 at 101 MHz

156

Appendix D: Supporting Information for Chapter 5

1 Figure D.1 H-NMR of 5.2 in CDCl3 at 400 MHz

13 Figure D.2 C-NMR of 5.2 in CDCl3 at 101 MHz

157

1 Figure D.3 H-NMR of 5.3 in CDCl3 at 400 MHz

13 Figure D.4 C-NMR of 5.3 in CDCl3 at 101 MHz

158

1 Figure D.5 H-NMR of 5.4 in CDCl3 at 400 MHz

13 Figure D.6 C-NMR of 5.4 in CDCl3 at 101 MHz

159

1 Figure D.7 H-NMR of 5.5 in CDCl3 at 400 MHz

13 Figure D.8 C-NMR of 5.5 in CDCl3 at 101 MHz

160

1 Figure D.9 H-NMR of 5.6 in CDCl3 at 400 MHz

13 Figure D.10 C-NMR of 5.6 in CDCl3 at 101 MHz

161

1 Figure D.11 H-NMR of 5.7 in CDCl3 at 400 MHz

13 Figure D.12 C-NMR of 5.7 in CDCl3 at 101 MHz

162

1 Figure D.13 H-NMR of 5.8 (DiQMPN2) in CD3OD at 400 MHz

13 Figure D.14 C-NMR of 5.8 (DiQMPN2) in CD3OD at 101 MHz

163

1 Figure D.15 H-NMR of 5.9 in CDCl3 at 400 MHz

13 Figure D.16 C-NMR of 5.9 in CDCl3 at 101 MHz

164

1 Figure D.17 H-NMR of 5.10 in CDCl3 at 400 MHz

13 Figure D.18 C-NMR of 5.10 in CDCl3 at 101 MHz

165

1 Figure D.19 H-NMR of 5.11 in CDCl3 at 400 MHz

13 Figure D.20 C-NMR of 5.11 in CDCl3 at 101 MHz

166

1 Figure D.21 H-NMR of 5.12 (DiQMPN3) in CD3OD at 400 MHz

13 Figure D.22 C-NMR of 5.12 (DiQMPN3) in CD3OD at 101 MHz

167

Curriculum Vitae

Mark Hutchinson 9625 Hingston Downs, Columbia, MD 21218 | 716-200-3342 (cell)| [email protected]

EDUCATION

Johns Hopkins University, Baltimore, MD 2016 Ph.D. Chemistry Research Advisor: Dr. Steven Rokita Dissertation Title: Development of Bifunctional Alkylating Agents for the Association and Migration along DNA

Johns Hopkins University, Baltimore, MD M.A. Chemistry 2013

Nazareth College of Rochester, Rochester, NY B.S. in Biology 2009 Areas of Concentration: Bioorganic chemistry Minor: Chemistry

PUBLICATIONS

Lönnberg, T., Hutchinson, M. and Rokita, S. Selective Alkylation of C-Rich Bulge Motifs in Nucleic Acids by Quinone Methide Derivatives. Chem. Eur. J., 2015, 21, 13127–13136.

Michael P. McCrane, Mark A. Hutchinson, Omer Ad, Steven E. Rokita. Oxidative quenching of reversible quinone methide adducts reveal kinetic products of DNA alkylation. Chem. Res. Toxicol., 2014, 27, 1282-1293.

TEACHING EXPERIENCE

Head Teaching Assistant- to Dr. Rokita “Intermediate Organic Chemistry Laboratory” 2013 (AS.030.228)

168

Collaborated on curriculum development by creating new, modifying, and implementing improvements from old procedures. Obtained NMR spectra for undergraduate students in the lab. Performed polarimeter experiments for undergraduate students. Met with students upon request outside of the lab to assist in help and clarification of problem sets and procedures.

Teaching Assistant- to Dr. Lectka “Intermediate Organic Chemistry Laboratory” 2012 (AS.030.228) Monitored undergraduate students in the lab to ensure that protocols and safety were being followed. Assisted in any experimental modifications needed for laboratory procedures.

Teaching Assistant- to Dr. Falzone “Organic Chemistry I” (AS.030.205) 2011, 2012 Conducted weekly conferences with over 20+ undergraduate students, administered quizzes, problem sets, and proctored exams. Assisted in grading of all assignments and exams. Met with students upon request outside of office hours for additional help.

RELATED EXPERIENCE

Johns Hopkins University Research- (Dr. Rokita, P.I.) 2011-2016 Design, synthesis, and analysis of several novel quinone methides with the ability to associate, crosslink, and migrate in DNA.

Nazareth College of Rochester Research- (Dr. Lauren O’Neil) 2011 Assisted in the development of a Malachite green derivative capable of polymerization through photolysis and depolymerization through heat.

United States Marine Corps Infantry Squad Leader 2004-2011 Taught junior Marines several fields of study including Operational Risk Management (ORM), combat lifesaving skills, basic first aid, leadership techniques, in addition to basic and advanced combat skills.

Nazareth College of Rochester Research- (Dr. Timm Knoerzer) 2007-2009 Assisted in the synthesis of site-switchable DNA binding mini-proteins coupled through CLICK chemistry

169

INSTRUMENT & LAB PROFICIENCY

Multi-step organic synthesis utilizing air-free Schlenk line techniques, NMR, UPLC-MS, LC-MS, HPLC, UV-Vis, phosphoimaging, PAGE gel separation of DNA, 32P- radiolabeling of DNA.

AWARDS

Ernest M. Marks Award in recognition of teaching excellence 2013 Western New York Marine of the Year 2011 Naval and Marine Corps Achievement Medal x2 2005, 2011 Outstanding Volunteer Service Medal 2008 Nazareth College (Purple and Gold) Scholarship 2006-2009 Combat Action Ribbon 2005

170