Fine-Tuning of Translation Termination Efficiency In

Fine-Tuning of Translation Termination Efﬁciency in Saccharomyces cerevisiae Involves Two Factors in Close Proximity to the Exit Tunnel of the Ribosome

Isabelle Hatin,*,†,1 Ce´line Fabret,*,† Olivier Namy,*,† Wayne A. Decatur‡ and Jean-Pierre Rousset*,† *IGM, Universite´ Paris-Sud, UMR 8621, F91405 Orsay, France, †CNRS, F91405 Orsay, France and ‡Department of Biochemistry and Molecular Biology, University of Massachusetts, Amherst, Massachusetts 01003 Manuscript received January 11, 2007 Accepted for publication April 27, 2007

ABSTRACT In eukaryotes, release factors 1 and 3 (eRF1 and eRF3) are recruited to promote translation termination when a stop codon on the mRNA enters at the ribosomal A-site. However, their overexpression increases termination efficiency only moderately, suggesting that other factors might be involved in the termination process. To determine such unknown components, we performed a genetic screen in Saccharomyces cerevisiae that identified genes increasing termination efficiency when overexpressed. For this purpose, we constructed a dedicated reporter strain in which a leaky stop codon is inserted into the chromosomal copy of the ade2 gene. Twenty-five antisuppressor candidates were identified and characterized for their impact on readthrough. Among them, SSB1 and snR18, two factors close to the exit tunnel of the ribosome, directed the strongest antisuppression effects when overexpressed, showing that they may be involved in fine-tuning of the translation termination level.

RANSLATION termination is the step that liber- somal P-site (Mottagui-Tabar and Isaksson 1998), T ates the newly synthesized polypeptide from the (ii) the mRNA structure shape due to the nucleotide se- ribosome before recycling the translational machinery. quence at the P site that could alter decoding through Three triplets—UAA, UAG (Weigert and Garen 1965), distortion of the ribosome structure (Tork et al. 2004), and UGA (Brenner et al. 1967)—were identified as and (iii) the chemical property of the amino acid at nonsense stop codons and shown to serve in vitro as sig- the penultimate position. Previous analyses have shown nals for the release of polypeptide from the ribosome that the nucleotides 39 of the stop have a predominant (Takanami and Yan 1965). The misincorporation of an role on readthrough efficiency and that the 59 context amino acid at the stop codon occurs at a frequency of effect is dependent on the 39 context (Skuzeski et al. 104 and is called readthrough. The efficiency of this 1991; Bonetti et al. 1995; Howard et al. 1996; Mottagui- termination is modulated by cis and trans factors. In Tabar and Isaksson 1998; Cassan and Rousset 2001; general, release factors efficiently recognize the termi- Namy et al. 2001). In particular, the nucleotide imme- nation codons, but in certain instances, near-cognate diately following the stop is highly biased in prokaryotes transfer RNAs (tRNAs) overcompete and lead to read- and eukaryotes and it has been proposed that the stop through. tRNA decoding of a stop codon occurs more signal could involve four nucleotides (nt) (Brown et al. frequently when the stop codon is surrounded by a context 1990). Several studies have pointed to at least three nt that modifies the competition for stop codon recognition upstream and six nt downstream of the stop to be in- between a release factor and near-cognate tRNA (Salser volved in determining readthrough efficiency (Bonetti 1969; Fluck and Epstein 1980; Engelberg-Kulka 1981). et al. 1995; Namy et al. 2001). Aminoglycosides can in- In Saccharomyces cerevisiae,both59 and 39 sequences play a crease readthrough and have been shown to suppress role in translation termination (Bonetti et al. 1995; premature stop mutations in several animal and cul- Namy et al. 2001; Tork et al. 2004). Several studies point tured cell models (Bedwell et al. 1997; Barton-Davis to different elements that could be involved in the 59 et al. 1999; Manuvakhova et al. 2000; Bidou et al. 2004). effect in S. cerevisiae: (i) the tRNA located on the ribo- These observations have opened the possibility of treat- ing patients who bear nonsense mutations with aminoglycoside antibiotics to express full-length protein. Given 1Corresponding author: Institut de Geńe´tique et Microbiologie, Baˆtiment 400, Universite´ Paris-Sud, F91405 Orsay, France. the numerous human diseases caused by nonsense mu- E-mail: [email protected] tation (Krawczak et al. 2000), it is thus imperative to

Genetics 177: 1527–1537 (November 2007) 1528 I. Hatin et al. determine the precise mechanism of translation termi- interaction of eRF1 with PABp has also been shown in nation in eukaryotes. Xenopus and human cells (Cosson et al. 2002) and could In eukaryotic cells, termination necessitates the re- help recycling of translational components. In addition, cruitment of the release factors eRF1 and eRF3 by the Itt1p (Urakov et al. 2001) and PP2A (Andjelkovic et al. ribosomal machinery at the A-site. eRF1 is involved in 1996) have been described to interact with eRF1, but stop codon recognition but fully efficient termination without clue on the mechanism of translational termi- needs interaction with the GTPase eRF3. In 1994, Frolova nation mediated by these interactions. Several observa- and coworkers showed that SUP45 protein of S. cerevisiae tions also suggest a link between termination and the belongs to a highly conserved eukaryotic protein family cytoskeleton. Sla1p is involved in the cytoskeleton and and corresponds most likely to the yeast eRF1 (Frolova has been found to interact with the N-terminal domain et al. 1994). That assignment was subsequently experimen- of eRF3 (Bailleul et al. 1999). Actin mutants have been tally demonstrated by Stansfield et al. (1995b). eRF1 associated with increased readthrough on the UAA stop comprises three domains: the N-terminal domain involved codon (Kandl et al. 2002), and a microtubule binding in stop codon recognition (Bertram et al. 2000; Song et al. protein of the spindle pole body Stu2p has been iden- 2000; Chavatte et al. 2001) and the M domain that con- tified in a genetic screen for factors modulating trans- tains a GGQ motif highly conserved throughout evolution lational termination efficiency (Namy et al. 2002). (Frolova et al. 1999), which is responsible for peptidyl Apart from the above-mentioned proteins, one can transferase hydrolytic activity. These two domains form envision that other factors able to modulate the termina- the functionally active ‘‘core’’ (Frolova et al. 2000). The tion process remain to be discovered. Indeed, overexpres- third domain in eRF1, the C-terminal domain, is involved sion of yeast eRF factors, Sup45p and Sup35p, increases in the interaction with the protein phosphatase PP2A translational termination efficiency no more than 2.6- (Andjelkovic et al. 1996) and with eRF3 (Stansfield et al. fold (Stansfield et al. 1995b; Williams et al. 2004). To 1995b; Zhouravleva et al. 1995). eRF3, encoded by SUP35 identify antisuppressors limiting near-cognate, tRNA- in S. cerevisiae,ismadeupofthreedomains.TheN- mediated suppression, we developed a screen for factors terminal and M domains are not essential for viability and that would increase translational termination when over- termination (Ter-Avanesyan et al. 1993). In S. cerevisiae, expressed (multicopy antisuppressors). For this purpose, the N terminus is asparagine and glutamine rich and un- we used a strain that carries an allele of the ADE2 gene, derlies the conformational changes of eRF3 to proteinase- interrupted by an in-frame UAG stop codon surrounded resistant aggregates, leading to the ½PSI1 phenotype (see by sequences known to promote a readthrough level review in Patino et al. 1996; Paushkin et al. 1996; high enough to obtain white colonies. We screened for Chernoff 2001; Cosson et al. 2002). ½PSI1 cells present candidate DNA fragments able to confer a red color to a defect in translation termination characterized by an the colonies. Among those, SSB1 and snR18 sequences omnipotent nonsense suppression phenotype (Liebman were found repeatedly and have been shown to actually and Sherman 1979). The C-terminal domain carries decrease the readthrough level. The mechanism of GTPase activity (Frolova et al. 1996), which is essential SSB1-induced readthrough decrease has been further for viability and termination and interacts with eRF1 characterized. and Upf1 (Stansfield et al. 1995b; Weng et al. 1996; Czaplinski et al. 1998). Recently, Salas-Marco and edwell B (2004) showed that eRF3 mutants with a MATERIALS AND METHODS reduced GTPase activity lead to a decreased translation termination efficiency. Recent results suggest that a Yeast strains and media: The S. cerevisiae strains used for this work are OL556 (MATa/MATa, cdc25-5/cdc25-5 his3/his3 leu2/ stable interaction between eRF1 and the stop codon in oy arcotte the A-site stimulates eRF3 GTP hydrolysis, which leads to leu2 trp1/TRP1 rca1/rca1 ura3/ura3)(B -M et al. 1996), 74D694 (MATa ade1-14 trp1-289 leu2-3,112 his3-200 ura3-52) efficient release of the polypeptide from the ribosome 1 erkatch a alas arco edwell lkalaeva ½psi; ½psi (D et al. 1998), MT557/3b (MAT ade2-1 by eRF1 (S -M and B 2004; A sup45-2 leu2-3,112 ura3-1 his5-2)(Stansfield et al. 1995a), and et al. 2006). In spite of genetic, biochemical, and FS1 (MATa, ade2-592 lys2-201 leu2-3,112 his3-200 ura3-52) crystallographic analyses of eRF1 and eRF3, questions (Namy et al. 2001). about the translational termination mechanism remain. The modified FS1strain used in the screen was constructed In particular, several factors have been demonstrated to as follows: From the ADE2 gene and its promoter cloned in a interact with the termination process, either directly centromeric URA3 vector (pFL38), a readthrough sequence through contacts with release factors or indirectly,as dem- derived from tobacco mosaic virus (TMV) (GGAACACAA TAGCAGTTACAG) was cloned in the unique HpaI restriction onstrated by genetic experiments. This is the case for the site located within the coding sequence of the ADE2 gene Upf1p factor that physically interacts with release factors (Namy et al. 2001). A homologous recombination in the FS1 eRF3 and eRF1. The two other Upf factors (Upf2p and strain at the ADE2 locus was performed with this vector Upf3p) are also connected with translational termina- linearized by enzymatic restriction. The recombined white tion through a mechanism not well identified (Weng clones were selected on complete medium depleted in adenine et al. 1996; Czaplinski et al. 1998; Wang et al. 2001). An due to the recovery of the activity of the synthesized Ade2p Fine-Tuning of Translation Termination 1529 protein. The correct integration was verified by sequencing of Diego) for amplification of eEF1Ba coding sequence with the genomic allele. high-fidelity Taq DNA polymerase Pfu from Stratagene using The strains were grown in minimal media supplemented eEF1Ba AUG (ATGGCATCCACCGATTTCTC) and eEF1Ba with the appropriate amino acids to allow maintenance of the UAA (TTATAATTTTTGCATAGCAG) as primers. The amplimer different plasmids after transformation. Yeast transformations was cloned in pUC19 vector at the HincII restriction site and a were performed by the lithium acetate method (Ito et al. recombinant vector called pUC-eEF1Bacds was sequenced 1983). Color screening was performed on plates containing a using 21M13, M13 reverse primers. The eEF1Ba coding drop-out medium, complete supplemented medium (CSM) sequence cloned in pUC-SSB1cds vector was cut by PstI and (Bio 101), with all amino acids and 10 mg/liter adenine. The Ecl136II restriction enzymes to be cloned at the same restric- color intensity was checked after incubation for 5 days at 30°.5- tion site in pCM189 vector. The eEF1Ba coding sequence un- FOA was added at a final concentration of 1.5 mg/ml to select der the cyc1 promoter was then cloned in the pFL44L vector at the loss of URA3 plasmids. the SmaI site by enzymatic restriction of the pCM-eEF1Bacds Plasmids and molecular biology methods: A yeast genomic vector with Eco47III and HindIII filled by Klenow enzyme. DNA library was kindly provided by Francxois Lacroute. It was Recombinant clones in the right orientation without an intron constructed by partial restriction of genomic DNA by SauIIIA were verified by amplification, enzymatic restriction, and se- from the S288c strain, and then fragments were ligated into quencing of the junction site. the BamHI site of the pFL44L multicopy vector (Bonneaud The small nucleolar RNA (snoRNA) snR18 was also cloned et al. 1991). pAC derivatives were constructed by cloning the under the cyc1 promoter as the eEF1Ba coding sequence but fragment of interest in the unique MscI site between LacZ and in the first step using snRw (TAAGCATCCACCGATTTCTC Luc open reading frames (ORFs) of pAC99 (Stahl et al. 1995; CAAGATTG) and snRc (TTAGGTTGAACCATCTGGAGAAT Bidou et al. 2000). TTCTGGG) to amplify genomic DNA from the Fy S. cerevisiae The identification of the candidate genes was obtained strain with high-fidelity Taq DNA polymerase Pfu from Strat- by release of plasmid DNA from yeast, as already described agene. All constructs were verified by sequencing the region of by Hoffman and Winston (1987), and used to transform interest using the Big Dye terminator kit and were migrated on Escherichia coli strain DH5a. Plasmid DNA was extracted from an ABI310 automatic sequencer (Applied Biosystems, Foster transformants, and boundaries of the insert were sequenced City, CA). using 21M13 and M13 reverse primers. This allowed us to Quantification of readthrough efficiency: Luciferase and b- determine the coordinates of the genomic region and to iden- galactosidase activities were assayed in the same crude extract tify the ORFs and genes present on the insert by comparison as previously described (Stahl et al. 1995). All the quantifica- with data from the Saccharomyces Genome Databank. tion was the median of at least five independent measurements. The construction of the mutated SSB1 coding sequence was The efficiency is defined as the ratio of luciferase activity to realized as follows: A mutagenesis on pUC-SSB1cds using a b-galactosidase activity. To establish the relative activities of high-fidelity Taq DNA polymerase Pfu from Stratagene (La b-galactosidase and luciferase, the ratio of luciferase activity Jolla, CA) was done for SSB435, a couple of oligonucleotides, to b-galactosidase activity from an in-frame control plasmid was 435w (CAAGAGAAGAACCTTTACTA CAGTCGCTG ACAAC taken as a reference. Efficiency of readthrough, expressed CAAACCACCGTTC) and 435c (GAACGGTGGTTTGGTTGT as percentage, was calculated by dividing the luciferase/b- CAG CGACTGTAGTAAAGGTTCTTCTCTTG); for SSB436, galactosidase ratio obtained from each test construct by the 436w (GAGAAGAACCTTTACT ACATGTAGTGACAACCAAA same ratio obtained with an in-frame control construct (Bidou CCACCGTTCAATTCCC) and 436c (GGGAATTGAACG GTG et al. 2000). GTTTGGTTGTCACTACAT GTAGTAAAGGTTCTTCTC); and for SSBCA, CAw (CCATCAAGAGAAGAACCTTTACTACAGT CAGTGACAACCAAACCACCGTTCAAT TCCC) and CAc (GG RESULTS GAATTGAACGGTGGTTTGGTTGTCACTGACTGTAGTAAA GGT TCTTCTCTTGATGG). The mutated pUC-SSB1cds vec- The genetic screen used was based on the ability to tors, after control of the sequence of the mutated region using monitor termination efficiency through the expression as primer of sequence the oligonucleotide SSBseq2, have been of the ADE2 gene, which encodes the P-ribosyl-amino- digested by BglII and AgeI restriction enzymes to be cloned at the same sites in the pUC-SSB. The sequence of the mutated imidazole-carboxylase (EC 4.1.1.21), responsible for the pUC-SSB was verified. Then the SSB-mutated sequences under degradation of the red pigment amino imidazole ribo- its own promoter were cloned in pFL44L vector following the tide. The screen was performed in a FS1 strain where the same procedure as for wild-type SSB1 under its own promoter. ade2 gene is interrupted by an in-frame UAG stop codon The construction of SUP45 on multicopy vector was re- derived from the TMV leaky context (for the strain con- alized from the pSP35-45 with SUP35 and SUP45 under con- materials and methods trol of their own promoter (Bidou et al. 2000). The SUP35 and struction, see ). This context SUP45 with their promoter were inserted into the multicopy promotes 15% of readthrough that leads to an expres- pHS8 vector at the PvuII restriction site and were called sion of Ade2p sufficient to degrade its red substrate and pHS35-45. The SUP45 with its own promoter was purified obtain white colonies (Namy et al. 2001). This strain was from agarose gel after digestion of pHS35-45 by XbaI and transformed with a S. cerevisiae genomic library cloned on cloned at the same restriction site into the pHS8 vector, and this vector was called pHS-SUP45. the multicopy pFL44L vector and plated on minimal The construction of the eEF1Ba coding sequence under medium supplemented with CSM containing a mini- the cyc1 promoter was realized as follows: Total RNA from the mum quantity of adenine (10 mg/liter), allowing healthy Fy S. cerevisiae strain was extracted from 5 ml of exponential growth with the optimization of red color. This allowed chmitt yeast culture (S et al. 1990) treated by 10 units of RNase us to isolate ‘‘antisuppressor’’ factors in a single step. Of free DNase I (Boehringer Mannheim, Indianapolis) at 37° for 1 hr. DNase I was inactivated by heating at 90° for 5 min, as rec- 52,000 transformants, 26 displayed a red color after 5 ommended by the manufacturer. RNA was reverse transcribed days at 30°. To check whether the antisuppressor phe- with random primer with a Superscript II kit (Invitrogen, San notype of the clones was due to the presence of an 1530 I. Hatin et al.

TABLE 1 Selected clones

Name Insert size (bp) ORF or gene name Readthrough decrease (%) 1 4732 MRPL32-YCP4-CIT2-YCR006 15 2 3490 VPS8-SNR18-eEF1Ba 26 3 5462 MSN1-RRI2-YOL118c-MCH4 9 4 5764 SSB1-YDL228c-HO 46 5 5434 PRC1-YMR298w-YMR299c-ADE4-ATML 37 6 4572 STB4 11 7 3945 SUP35-ARG82-HMO1- 25 8 3882 YBR225w-YBR226c-MCX1-SLX1 12 9 4292 RPL20B-SPS4-YOR314w-YOR314W A-59YOR315w 20 10 4092 BNA4 -BRN1-YBL096c-YBL095w 17 11 6574 PTP1-SSB1-YDL228c-HO 43 12 6033 STU1-RIB1-HEK2-SHE1 13 13 4000 VTS1-PDE2-PRT1 10 14 4636 SSB1-YDL228c-HO 35 15 3928 ILV2-YMR107w-YMRWD15-YMRcD14 20 16 5429 YAP1-GIS4-ARNtS(AGA) 35 18 5140 ATM1-PRP12 12 19 4088 TUS1-YLRCD26 21 20 4531 HFA1-ERG12-YMR209c 5 21 9430 VPS67-YKR021W-YKR022C-YKR023W-DBP7-RPC37 10 22 5170 eEF1Ba-SNR18-VPS8 56 23 5724 PTP1-SSB1-YDL228c-HO 40 24 6257 PIN4-SAS3-YBL053w-YBL054w 20 25 3680 SSB1-YDL228c-HO 51 26 5735 MPH2-YDL246C 8 Twenty-five clones selected with the name of the genes present on the DNA fragments are listed. FS1 strain was cotransformed with pFL44L clones and pAC vector bearing a UAG stop codon. The readthrough decrease was expressed as the percentage of readthrough decrease referred to empty pFL44L vector. overexpressed gene, they were plated in the presence of through efficiency in the presence or absence of the 5-FOA, which selects for cells that have lost the plasmid. candidate plasmids. All of the isolated candidates, except no. 17, reversed These vectors (pAC) carry a dual lacZ-luc reporter the phenotype after 1 week; this isolate was kept to serve interrupted by a unique cloning site at the junction of as a negative control in further experiments. This result the two coding sequences where in-frame stop codons in demonstrates that, for the vast majority of the candi- different contexts are inserted. The SV40 promoter, dates, the effect was dependent on the continuous known to be active in both S. cerevisiae and mammalian presence of the vector. This point is important since it cells (Camonis et al. 1990), drives the expression. b- ruled out the involvement of a cytoplasmic factor, which Galactosidase that originates from translation upstream might have been induced by an overexpressed gene. For of the stop codon is used as an internal control, reca- each of the 25 confirmed candidates, sequencing of the pitulating the different levels where expression could fragment boundaries was performed, allowing identifi- be modulated. The firefly luciferase activity depends cation of the inserted genomic fragment. The complete on translation downstream of the stop codon and allows list of the genes present on these 25 fragments is pre- precise quantification of readthrough (Stahl et al. sented in Table 1. Seven are known to be involved in 1995; Bidou et al. 2000). Under these conditions, the different aspects of translation: ribosomal protein, trans- ratio of firefly luciferase to b-galactosidase activities lation termination factor, translation initiation factor, reflects the readthrough efficiency without interference elongation factor, tRNA, and Hsp70 chaperone. from other levels of control. To obtain absolute read- Many irrelevant factors might modify the pigment through levels, the values obtained with the test con- accumulation in cells. Among these are the enzymes structs are normalized against results from a similar dual early in the adenine biosynthesis pathway, proteins lacZ-luc reporter gene where the stop is replaced with a involved in vacuole permeability where the pigment sense codon. Each of the 26 vectors was cotransformed, accumulates, factors involved in controlling the effi- with a pAC vector bearing a UAG stop codon, into the ciency of translation initiation, etc. To identify factors FS1 strain. For each cotransformation, five independent actually involved in translation termination, we used assays with two independent clones were performed. an independent reporter system and quantified read- The readthrough level was quantified and compared to Fine-Tuning of Translation Termination 1531

TABLE 2 Readthrough efﬁciency in the presence of overexpressed proteins

TAA TAG TGA TMG IXR1 MoMuLV Expression vector (%) (%) (%) (%) (%) (%) Empty vector 11 31 15 4 3 4 igure F 1.—FS1 modified strain with ADE2 locus reporter SSB1 2 19 9 2 1 2 was transformed by pFL44L vector empty, pFL44L-eEF1Ba, SSB2 5 23 19 2 2 4 or pFL44L-snR18 and spread on CSM minimal medium. eEF1Ba 27 36 38 The color intensity was checked after incubation for 5 days coding sequence ° at 30 . snR18 10 20 10 SUP35 and SUP45 3 SUP45 4 that obtained in the presence of an empty pFL44L vector. As shown in Table 1, the readthrough level decreases The readthrough efficiency was expressed as the ratio of lu- in the presence of each of the 25 confirmed candidates. ciferase activity to b-galactosidase activity referred to a similar To assess if the difference of readthrough level between ratio from an in-frame control in the presence or absence of the overexpressed proteins Ssb1p and Ssb2p, the eEf1bap candidates and strain FS1 transformed by the empty coding sequence, and the snoRNAs SnR18 and Sup45p alone pFL44L vector is significant, we performed a nonpara- or with Sup35p. Columns correspond to the different stop co- metric statistical test (Mann–Whitney). Candidate no. don targets tested: TAA, TAG, and TGA correspond to 17, like the empty pFL44L cloning vector, did not affect the three stop codons in the same TMV-surrounded context readthrough, which validated the screen. According to (CAA stop CAA); TMG corresponds to the TAG stop codon surrounded by CAG on each side of the stop; IXR1 corre- the Mann–Whitney test, a difference of at least 20% on sponds to the TAA stop codon from the IXR1 S. cerevisiae cod- termination translation between the candidate and the ing sequence; and MoMuLV corresponds to the TAG stop empty vector is needed to consider an effect as signifi- codon from the Gag–Pol junction of the Moloney murine leu- cant. Two candidates do not exhibit a significant differ- kemia virus. All the tests were performed in the FS1 strain. ence in readthrough efficiency compared to the negative controls: isolate no. 3 carrying the transcriptional activa- of eEF1Ba protein or snR18 is involved in the decrease tor gene MSN1 and isolate no. 12 bearing the HEK2 gene of readthrough, we have cloned two different versions of involved in translation initiation. On the other hand, the coding region in a multicopy vector pFL44L under isolate no. 7 harboring SUP35 (eRF3), isolate no. 9 car- the strong Cyc1 promoter: (i) the open reading frame of rying RPL20B, isolate no. 18 carrying tRNAser (IGA), the eEF1Ba without the intron and (ii) the intron contain- five isolates carrying the SSB1 gene, and the two isolates ing snR18 surrounded by only 80 nt of the eEF1Ba cod- carrying the eEF1Ba gene display a statistically signifi- ing sequence and lacking the ATG. These constructs cant difference. Altogether, 12 of the 25 candidates di- were transformed into the FS1 parental strain. As shown rected a significant decrease of readthrough efficiency, in Figure 1, only the construct carrying snR18 was able which indicates that the screen based on ADE2 activity to restore the antisuppression phenotype. The read- was highly stringent. through efficiencies directed by these two constructs eEF1Ba: eEF1Ba is the b-subunit of the eukaryotic was quantified using the three stop codons in the same translation elongation factor 1 (eEF1), which is highly surrounding context cloned in the pAC vector as conserved both functionally and structurally among targets. Strains cotransformed with the two pFL44L con- species (Le Sourd et al. 2006). In yeast cells, eEF1 is a structs were compared to strains cotransformed with the heterotrimer containing three units, responsible for empty vector. Results presented in Table 2 show that, binding the amino-acylated tRNA to the ribosomal A- with the construct expressing only the snR18 matured site and also participating in the proofreading of the from the eEF1Ba intron, there is a significant decrease codon–anticodon match; eEF1A is a classic G protein of readthrough (31–20%, P ¼ 0.03) on the UAG stop involved in the GTP-dependent binding of amino- codon and a slight decrease of readthrough on the UAA acylated tRNA, and the eEF1Ba subunit, associated with and UGA stop codons (11–10%, P ¼ 0.045 and 15–10%, the g-subunit, functions as a guanine exchange factor P ¼ 0.025, respectively). Interestingly, a strong increase in vitro and catalyzes the exchange of GDP for GTP on of readthrough on UAA and UGA stop codons is ob- eEF1A to recycle it. The function of eEF1B has been served upon overexpression of the eEF1Ba open read- described as critical in regulation of eEF1A activity, trans- ing frame without an intron (11–27%, P ¼ 0.012 and lational fidelity, translation rate, and cell growth (Le 15–38%, P ¼ 0.006, respectively). This is reminiscent Sourd et al. 2006). The eEF1Ba gene, in addition to en- of previous observations by Carr-Schmid et al. (1999). coding the eEF1Ba translation factor, contains an in- Altogether, we have observed that the increase of ter- tervening sequence encoding the small nucleolar RNA mination, especially for the UAG stop codon, involves snR18. To determine whether the increased expression the small nucleolar RNA snR18, and not eEF1Ba. 1532 I. Hatin et al.

multicopy vector pYESSB2 and compared the same vector expressing SSB1 (kindly provided by S. Rospert) on the same set of readthrough targets. As shown in Table 2, the effect on the level of translation termination was significantly less pronounced for Ssb2p than for Ssb1p. As mentioned above, overexpression of release factors in yeast has been shown to have only a moderate effect on translation termination. To compare the extent of the effect directed by Ssb1p and release factor overexpression, we cloned both SUP45 and SUP35 genes on the same multicopy vector and quantified the readthrough efficiency. As for Ssb1p, a threefold increase was Figure 2.—FS1 and 74D694 ½psi or ½psi1 strains were co- obtained upon Sup35p and Sup45p overexpression on transformed with pAC-TMG vector bearing a UAG stop codon the UAA stop codon in the TMV readthrough context. and SSB1 expressed either from centromeric (pCMSSB1) or This confirms the relatively weak effect of the over- multicopy (pYESSB1) vector. The readthrough level was ex- expression of both factors on termination. pressed as the percentage of readthrough decrease referred To evaluate whether Ssb proteins are actually involved to the empty vector. in the termination process, we used the MT556/3b strain that carries a sup45 thermo-sensitive allele and deter- SSB1: As mentioned above, the five candidates mined whether Ssb1p overexpression could revert the carrying the SSB1 gene and YDL228c were all able to phenotype. The readthrough level was quantified at 30° efficiently decrease the readthrough level (from 35 to in the presence or absence of the overexpressed release 51%) when cotransformed with pAC-TMG (compared factor eRF1 or/and the Ssbp chaperones. The Sup45 to the empty vector pFL44L). To establish if this effect thermo-sensitive S. cerevisiae strain was first transformed could be attributed to SSB1 or YDL228c overexpression, with multicopy URA3 vectors carrying either SUP45 we cloned the SSB1 coding sequence in a centromeric alone or SUP45 and SUP35. The MT556/3b strain was vector under the strong Cyc1 promoter (pCMSSB1) and then transformed with pYESSB1 or pYESSB2 or the tested the readthrough efficiency in the presence of this empty pFL44L vector. Figure 3 shows that a very high construct in different S. cerevisiae strains. Results pre- readthrough level is obtained with all three stop codons sented in Figure 2 show that overexpression of SSB1 in the TMV context in the MT557/3b strain (27% reproduces the effect observed with the entire DNA on UGA, 33% on UAA, and 69% on UAG stop codon). fragment, although translational termination increases The readthrough efficiency decreases 10-fold for all to a greater extent when expressed from the multicopy stop codons in the presence of overexpressed wild-type vector than from a centromeric vector (2- and 1.6-fold, Sup45p protein, but is not affected by Ssb1p or Ssb2p respectively, in the FS1 strain). Overexpression of SSB1 overexpression (Figure 3). We then examined the from a multicopy vector has a significant effect on thermo-sensitive phenotype. At 30°, all transformants termination in 74D694 ½psi and FS1 strains (1.3- to 2- grow on liquid culture with a generation time of 2 hr. At fold, respectively), but surprisingly not in the ½psi1 37°, only cells transformed with SUP45, with SUP45 and state in the 74D694 strain (Figure 2). This may be SUP35, or with SSB1 are able to grow, but no growth is related to different levels of accumulation of the Sup35 detected in cells transformed with pFL44L or SSB2. The protein in these two strains. generation time is 8 hr with SSB1 and 2 hr with SUP45 at To better characterize the effect of SSB1 protein, we nonpermissive temperature (Table3). Thus, overexpres- tested a panel of recoding targets corresponding to dif- sion of Ssb1p, but not of Ssb2p, allows a partial recovery ferent stop codons and surrounding sequences in the of the thermo-resistance in the Sup45 thermo-sensitive FS1 strain: the UAG stop codon targets corresponding strain (Figure 4). To determine if suppression of the to the TMV termination context, a derived sequence thermo-sensitive phenotype is a general chaperone ef- (TMG) where CAA on each side of the stop were re- fect of Ssb1p, we tested in the same manner the ability of placed by CAG, and the MoMuLV context including the Ssb1p to revert thermo-sensitivity of a cdc25 thermo- UAG stop and the downstream pseudoknot. In all cases, sensitive mutant in the strain OL556. We observe no re- a 2-fold increase of translation termination is observed version of thermo-sensitive phenotype in this strain in upon SSB1 overexpression (Table 2). The effect of SSB1 presence of Ssb1p overexpression (data not shown). overexpression on termination was also examined in the The difference in the ability of Ssb1p and Ssb2p to three stop codons in the TMV context. Although an revert the sup45p thermo-sensitivity allows determining effect is observed in all cases, its extent varies, from a 1.5- if one or more of the amino acids that differ between the fold increase with UGA to a 4-fold increase with UAA. two proteins could play a role in the ability to revert the We also tested the effect of overexpressing the para- thermo-sensitivity. An aspartate is found in Ssb1p and a logous SSB2 gene under its own promoter cloned in the glutamine is found in Ssb2p at position 49 in the ATPase Fine-Tuning of Translation Termination 1533

Figure 3.—The readthrough level in MT557/ 3b strain was quantiﬁed by the dual reporter system pAC with the three stop codon targets TAA, TAG, or TGA in the presence or absence of overexpressed Sup45p, Ssb1p, or Ssb2p.

domain. Three others are found in the polypeptide- factor 1 also carries an intron encoding the snR18 binding domain and correspond to methionine at posi- snoRNA, we uncoupled expression of these two factors tion 413, cysteine at position 435, and alanine at position and showed that the effect on termination is directed by 436 in Ssb1p compared to isoleucine, valine, and serine the snR18. In the following sections, we shall discuss the at the corresponding positions in Ssb2p (Figure 5). results obtained with the two genes independently, Methionine and isoleucine are neutral amino acids, but although they may have similar mode(s) of action since cysteine in SSB1 could form a disulfide bridge, which is both potentially affect the peptide exit tunnel region of not possible in Ssb2p. The cysteine in position 435 was the ribosome. mutated to valine or the alanine in position 436 was mu- snR18: The maturation of preribosomal RNA in the tated to serine in Ssb1p protein. A third mutant was con- translational machinery involves a large number of cleav- structed with both mutations. Overexpression of any of age events, which frequently follow alternative pathways. these mutated forms is not able to revert the thermo- In addition, ribosomal RNAs (rRNAs) are extensively sensitive phenotype (Figure 4). modified, with the methylation of the 29-hydroxyl group of sugar residues and conversion of uridines to pseu- douridines being the most frequent modifications, DISCUSSION although the extent of the modification event (i.e., the In this work, we identify eEF1Ba and SSB1 genes as proportion of modified ribosomes) is unknown and pos- able to increase translation termination efficiency when sibly variable (Grosjean 2005). In particular, the degree overexpressed. Since the eEF1Ba gene that encodes of modification has been shown to vary with growth tem- the b-subunit of the eukaryotic translation elongation perature in certain Archaea, plants, and trypanosomes (Brown et al. 2003; Omer et al. 2003; Uliel et al. 2004). In humans, it has been shown that the 5.8S rRNA is hypo- TABLE 3 29-O-methylated in neoplastic tissues (Munholland and Growth of the MT557/3b strain in the presence of overexpressed proteins at permissive and nonpermissive temperatures

Generation time MT557/3b transformed by 30° 37° Empty vector 2 hr .20 hr SUP45 2 hr 2 hr SSB1 2 hr 8 hr SSB2 2 hr .13 hr Ssb1.435 2 hr .13 hr Ssb1.436 2 hr .13 hr Ssb1.CA 2 hr .13 hr The generation time at 30° and 37° was established from liquid culture of the MT557/3b strain in the presence or ab- Figure 4.—The MT557/3b strain transformed or not trans- sence of overexpressed proteins Sup45p, Ssb2p, and Ssb1p formed by mutated overexpressed proteins Sup45p, Ssb2p, and Ssb1p mutants. Ssb1p, or ssb1p was incubated at 30° and 37° for 3 days. 1534 I. Hatin et al.

Figure 5.—Four amino acids differ between S. cerevisiae SSB1 and SSB2. These proteins show an ATPase domain from amino acid 1 to 400 and a polypeptide-binding domain from amino acid 401 to 507.

Nazar 1987). Both cleavage and modification reactions agreement with the work of Carr-Schmid et al. (1999) of pre-rRNAs are assisted by a variety of an abundant who have previously shown that eEF1Ba mutants exhibit class of trans-acting RNAs, snoRNAs, which function in an antisuppressor phenotype. They interpreted this the form of ribonucleoprotein particles (snoRNPs). effect as a more efficient competition for recognition The majority of snoRNAs act as guides directing site- of the stop codon by release factors due to an increased specific 29-O-ribose methylation or pseudouridine for- ratio of release factor to active eEF1A. This interpreta- mation by base pairing near target sites. Eukaryotic tion is strongly supported by the results presented here. rRNAs display a complex pattern of ribose methylations. Finally, it might be significant that two factors acting in Ribose methylations of eukaryotic rRNAs are each an opposite way on termination are coexpressed as a guided by a cognate small RNA, belonging to the family single RNA, preventing an imbalance in termination of box C/D antisense snoRNAs, through transient for- efficiency. mation of a specific base pairing at the rRNA modifica- SSB1: We show that the SSB1 gene is able to increase tion site. Over 100 RNAs of this type have been identified translation termination efficiency when overexpressed. to date in vertebrates and the yeast S. cerevisiae.Many This increase is effective on the three stop codons, al- snoRNAs are produced by unorthodox modes of bio- though to different extents, and on several stop codon genesis, including salvage from introns of pre-mRNAs, contexts. Ssb1p is one of the Hsp70 homologs present as for snR18 in yeast, or from non-protein-coding tran- in the S. cerevisiae genome. It is closely related to its scripts. In yeast, however, numerous snoRNAs are gen- Ssb2p paralogous gene. Ssb1p and Ssb2p share identical erated from independent transcription units. function and a similar level of expression; they differ by The snoRNA snR18 is 102 nucleotides long and four amino acids (Boorstein et al. 1994). Rakwalska guides the methylation at the sites corresponding to and Rospert (2004) showed previously that the lack of the A647/C648 positions of the 25S rRNA (Lowe and functional Ssb1/2 in yeast caused severe problems in Eddy 1999). We have shown here that overexpression of translational fidelity, which were strongly enhanced by snR18 induces increased termination efficiency. Differ- paromomycin and correlated with growth inhibition. ent mechanisms may account for this observation. If the Since SSB1 and SSB2 transcript levels are regulated inde- effect is direct, it could act through a hyper-modification pendently of those of genes encoding ribosomal pro- of the A647/C648 position. This would imply that, in teins (see Discussion in Muldoon-Jacobs and Dinman the normal situation, not all ribosomes are methylated 2006), not all ribosomes would be associated with at this position and that modified ribosomes are more functional chaperone complement, and overexpression efficient terminators than unmodified ones. Although of Ssb proteins would improve the functioning of the the proportion of ribosomes methylated at A647/C648 ribosome. is not known, it has been shown for other positions that The quantification of readthrough in the strain with only a fraction of ribosomes are modified (Grosjean a conditional-lethal mutant allele of SUP45 (sup45-2) 2005). Alternatively, the effect of snR18 overexpression demonstrates an extremely high level of readthrough might be indirect. A possibility would be that it acts on the UAG stop codon and 30% readthrough on UAA through titration of a general factor(s)—perhaps even and UGA stop codons in the same surrounding envi- the methylase Nop1p—involved in the biogenesis or ac- ronment. Ssb1p overexpression does not decrease the tion of methylation snoRNPs, which could result in pro- readthrough level in the SUP45 thermo-sensitive strain ducing fewer snoRNP complexes, less active snoRNP but specifically allows a partial recovery of the thermo- complexes, and/or less stable snoRNP complexes. Such resistance phenotype, which suggests that this effect an effect might lead to hypomethylation of other po- could be associated with the chaperone role of the sition(s). The precise role of the different methylated Ssb1p protein in the folding of the Sup45p protein. It nucleotides in the rRNA has not yet been deciphered, would, however, be insufficient to allow a significant ef- precluding further speculations. fect on the termination capacity of the protein, since the While trying to identify the portion of the eEF1Ba mutation specifically affects this activity. Interestingly, gene region involved in the effect on readthrough, we overexpression of Ssb2p protein was unable to reverse made the interesting observation that overexpression of the Sup45p thermo-sensitivity phenotype. The proteins the eEF1Ba gene, devoid of its snR18-encoding intron, differ by only four amino acids. Of these four amino actually decreases termination efficiency. This is in full acids, three are located in the polypeptide-binding Fine-Tuning of Translation Termination 1535

Figure 6.—snR18 guides modification to sites in the wall of the polypeptide exit tunnel. (A) The large ribosomal subunit viewed down the polypeptide exit tunnel, with the start of the tunnel in the front of the image and the end, where the nascent polypeptide emerges, in the back. Pro- teins (red) and RNA as ribbon representation. The nucleotides targeted for 29-O-methylation due to complementarity between the rRNA and snR18 are highlighted by showing their van der Waals radii (green). Starting in the canonical ‘‘crown view,’’ the subunit (of Thermus thermophi- lus; pdb code 2j01) has been rotated forward slightly around the horizontal axis and slightly counterclockwise around the vertical axis. The fragment of A-site tRNA visible in the complex is pink; a complete P-site tRNA (purple) and E-site tRNA (cyan) is observed. Importantly, the targeted sites occur in the conserved core of the large subunit (Gerbi 1996), validating examining structures from other species. (B) Cross section of the large ribosomal subunit (a 13.2 A˚ thick slab) as viewed from the side to feature the polypeptide exit tunnel. Details are as in A, except the tRNAs are not shown. This view is obtained by rotation of 90° about the vertical axis from the crown view and rotating the subunit backward slightly around the horizontal axis. domain. We analyzed the role of cysteine 435 and is significant that the absence of the RAC complex alanine 436 found in the Ssb1p protein by mutating components, Ssz1 and zuotin, decreases translational them to the amino acids found in the corresponding accuracy, reinforcing the role of the ribosome-exit-tunnel- residues of the Ssb2p protein. The mutant Ssb1p pro- associated chaperone in decoding (Rakwalska and teins are not able to reverse the thermo-sensitivity of Rospert 2004). Whether overexpression of Ssz1 and the mutant SUP45 strain. This demonstrates that the zuotin also increases termination efficiency would be polypeptide-binding domain is responsible for the spe- interesting to determine. cific effect of Ssb1p on the thermo-sensitive phenotype Remarkably, positions A647/C648 that are methyl- of the strain with allele sup45-2. Since the effect was ated by the snoRNA snR18 were included in the se- recapitulated by mutation of only the cysteine residue, it quences identified as approaching the surface around could be dependent on the formation of a specific di- the lumen of the polypeptide exit tunnel in the large sulfide bridge with misfolded Sup45p. Although we can- ribosomal subunit (Nissen et al. 2000) (see Figure 6). not exclude an additional effect of the polymorphism Although the precise mechanism of this effect could not located in the ATPase domain, this effect should be be inferred from the study reported here, the fact that limited, since the mutants of the polypeptide-binding both Ssb1p and snR18 are somehow linked to the exit domain recapitulate the observed difference between tunnel might be significant regarding the termination the two isoforms. mechanism. Possible involvement of the polypeptide exit tunnel We thank members of our laboratory for numerous stimulating of the ribosome in translation termination: Ssbp is discussions. This research was supported by grants from the Associa- associated with the ribosome when it is actively synthe- tion pour la Recherche sur le Cancer (grant 3849 to J.-P.R.) and the sizing proteins (Nelson et al. 1992), and it interacts with Association Francxaise contre les Myopathies (grants 9584 and 10683 both the ribosome and directly with the nascent chain to J.-P.R.). as it emerges from the ribosome. Ssb1p and Ssb2p are actually in close proximity to a variety of nascent poly- fund autschi peptides (P et al. 1998; G et al. 2002; LITERATURE CITED Rospert et al. 2002). This suggests that Ssbp functions Alkalaeva, E. Z., A. V. Pisarev,L.Y.Frolova,L.L.Kisselev and as a chaperone for polypeptide chains during trans- T. V. Pestova, 2006 In vitro reconstitution of eukaryotic translation. Such a role in emerging polypeptides could be lation reveals cooperativity between release factors eRF1 and to facilitate the successful folding of newly synthesized eRF3. Cell 125: 1125–1136. ndjelkovic olnierowicz an oof oris proteins (Beckmann et al. 1990; Frydman et al. 1994; A , N., S. Z ,C.V H ,J.G and B. A. Hemmings, 1996 The catalytic subunit of protein phosphatase Hardesty et al. 1995; Eggers et al. 1997). An alternative 2A associates with the translation termination factor eRF1. explanation of the role of the Ssb chaperone would be EMBO J. 15: 7156–7167. ailleul ewnam teenbergen hernoff through a direct role in the decoding process. As pro- B ,P.A.,G.P.N ,J.N.S and Y. O. C , uldoon acobs inman 1999 Genetic study of interactions between the cytoskeletal as- posed by M -J and D (2006), Ssb sembly protein sla1 and prion-forming domain of the release fac- chaperone activity might help nascent peptides to back tor Sup35 (eRF3) in Saccharomyces cerevisiae. Genetics 153: 81–94. up into the exit tunnel and thus would participate in the Barton-Davis, E. R., L. Cordier,D.I.Shoturma,S.E.Leland and H. L. Sweeney, 1999 Aminoglycoside antibiotics restore efficient accommodation of the aminoacyl tRNA in the dystrophin function to skeletal muscles of mdx mice. J. Clin. ribosomal A-site. Whatever the mechanism involved, it Invest. 104: 375–381. 1536 I. Hatin et al.

Beckmann, R. P., L. E. Mizzen and W. J. Welch, 1990 Interaction of Fluck, M. M., and R. H. Epstein, 1980 Isolation and characteriza- Hsp 70 with newly synthesized proteins: implications for protein tion of context mutations affecting the suppressibility of non- folding and assembly. Science 248: 850–854. sense mutations. Mol. Gen. Genet. 177: 615–627. Bedwell, D. M., A. Kaenjak,D.J.Benos,Z.Bebok,J.K.Bubien et al., Frolova,L.,X.Le Goff,H.H.Rasmussen,S.Cheperegin,G.Drugeon 1997 Suppression of a CFTR premature stop mutation in a et al., 1994 A highly conserved eukaryotic protein family pos- bronchial epithelial cell line. Nat. Med. 3: 1280–1284. sessing properties of polypeptide chain release factor. Nature Bertram, G., H. A. Bell,D.W.Ritchie,G.Fullerton and I. 372: 701–703. Stansfield, 2000 Terminating eukaryote translation: domain Frolova, L., X. Le Goff,G.Zhouravleva,E.Davydova,M.Philippe 1 of release factor eRF1 functions in stop codon recognition. et al., 1996 Eukaryotic polypeptide chain release factor eRF3 is RNA 6: 1236–1247. an eRF1- and ribosome-dependent guanosine triphosphatase. Bidou, L., G. Stahl,I.Hatin,O.Namy,J.P.Rousset et al., RNA 2: 334–341. 2000 Nonsense-mediated decay mutants do not affect pro- Frolova, L. Y., R. Y. Tsivkovskii,G.F.Sivolobova,N.Y.Oparina,O. grammed -1 frameshifting. RNA 6: 952–961. I. Serpinsky et al., 1999 Mutations in the highly conserved Bidou, L., I. Hatin,N.Perez,V.Allamant,J.J.Panthier et al., GGQ motif of class 1 polypeptide release factors abolish ability 2004 Premature stop codons involved in muscular dystrophies of human eRF1 to trigger peptidyl-tRNA hydrolysis. RNA 5: show a broad spectrum of readthrough efficiencies in response 1014–1020. to gentamicin treatment. Gene Ther. 11: 619–627. Frolova, L. Y., T. I. Merkulova and L. L. Kisselev, 2000 Trans- Bonetti, B., L. W. Fu,J.Moon and D. M. Bedwell, 1995 The effi- lation termination in eukaryotes: polypeptide release factor ciency of translation termination is determined by a synergistic eRF1 is composed of functionally and structurally distinct do- interplay between upstream and downstream sequences in Sac- mains. RNA 6: 381–390. charomyces cerevisiae. J. Mol. Biol. 251: 334–345. Frydman, J., E. Nimmesgern,K.Ohtsuka and F. U. Hartl, Bonneaud, N., O. Ozier-Kalogeropoulos,G.Y.Li,M.Labouesse, 1994 Folding of nascent polypeptide chains in a high molecular L. Minvielle-Sebastia et al., 1991 A family of low and high mass assembly with molecular chaperones. Nature 370: 111–117. copy replicative, integrative and single-stranded S. cerevisiae/ Gautschi, M., A. Mun,S.Ross and S. Rospert, 2002 A functional E. coli shuttle vectors. Yeast 7: 609–615. chaperone triad on the yeast ribosome. Proc. Natl. Acad. Sci. Boorstein,W.R.,T.Ziegelhoffer and E. A. Craig, 1994 Molecular USA 99: 4209–4214. evolution of the HSP70 multigene family. J. Mol. Evol. 38: 1–17. Gerbi, S. A., 1996 Expansion segments: regions of variable size that Boy-Marcotte,E.,D.Tadi,M.Perrot,H.Boucherie and M. Jacquet, interrupt the universal core secondary structure of ribosomal 1996 High cAMP levels antagonize the reprogramming of gene RNA, pp. 71–87 in Ribosomal RNA: Structure, Evolution, Processing expression that occurs at the diauxic shift in Saccharomyces cer- and Function in Protein Biosynthesis, edited by R. A. Dahlberg evisiae. Microbiology 142(Pt. 3): 459–467. and A. E. Zimmermann. CRC Press, New York. Brenner, S., L. Barnett,E.R.Katz and F. H. Crick, 1967 UGA: Grosjean, H., 2005 Modification and editing of RNA: historical a third nonsense triplet in the genetic code. Nature 213: 449–450. overview and important facts to remember, pp. 1–22 in Fine-Tuning Brown, C. M., P. A. Stockwell,C.N.Trotman and W. P. Tate, of RNA Functions by Modification and Editing,editedbyH.Grosjean. 1990 Sequence analysis suggests that tetra-nucleotides signal Springer-Verlag, New York. the termination of protein synthesis in eukaryotes. Nucleic Acids Hardesty, B., W. Kudlicki,O.W.Odom,T.Zhang,D.McCarthy Res. 18: 6339–6345. et al., 1995 Cotranslational folding of nascent proteins on Es- Brown, J. W., M. Echeverria and L. H. Qu, 2003 Plant snoRNAs: cherichia coli ribosomes. Biochem. Cell Biol. 73: 1199–1207. functional evolution and new modes of gene expression. Trends Hoffman, C. S., and F. Winston, 1987 A ten-minute DNA prepara- Plant Sci. 8: 42–49. tion from yeast efficiently releases autonomous plasmids for Camonis, J. H., M. Cassan and J. P. Rousset, 1990 Of mice and transformation of Escherichia coli. Gene 57: 267–272. yeast: versatile vectors which permit expression in both budding Howard, M., R. A. Frizzell and D. M. Bedwell, 1996 Amino- yeast and higher eukaryotic cells. Gene 86: 263–268. glycoside antibiotics restore CFTR function by overcoming pre- Carr-Schmid, A., L. Valente,V.I.Loik,T.Williams,L.M.Starita mature stop mutations. Nat. Med. 2: 467–469. et al., 1999 Mutations in elongation factor 1beta, a guanine nu- Ito, H., Y. Fukuda,K.Murata and A. Kimura, 1983 Transformation cleotide exchange factor, enhance translational fidelity. Mol. of intact yeast cells treated with alkali cations. J. Bacteriol. 153: Cell. Biol. 19: 5257–5266. 163–168. Cassan, M., and J. P. Rousset, 2001 UAG readthrough in mamma- Kandl, K. A., R. Munshi,P.A.Ortiz,G.R.Andersen,T.G.Kinzy lian cells: effect of upstream and downstream stop codon con- et al., 2002 Identification of a role for actin in translational fi- texts reveal different signals. BMC Mol. Biol. 2: 3. delity in yeast. Mol. Genet. Genomics 268: 10–18. Chavatte, L., L. Frolova,L.Kisselev and A. Favre, 2001 The Krawczak, M., E. V. Ball,I.Fenton,P.D.Stenson,S.Abeysinghe polypeptide chain release factor eRF1 specifically contacts the et al., 2000 Human gene mutation database: a biomedical infor- s(4)UGA stop codon located in the A site of eukaryotic ribo- mation and research resource. Hum. Mutat. 15: 45–51. somes. Eur. J. Biochem. 268: 2896–2904. Le Sourd, F., S. Boulben,R.Le Bouffant,P.Cormier,J.Morales Chernoff, Y. O., 2001 Mutation processes at the protein level: Is et al., 2006 eEF1B: at the dawn of the 21st century. Biochim. Lamarck back? Mutat. Res. 488: 39–64. Biophys. Acta 1759: 13–31. Cosson, B., A. Couturier,S.Chabelskaya,D.Kiktev,S.Inge- Liebman, S. W., and F. Sherman, 1979 Extrachromosomal psi1 de- Vechtomov et al., 2002 Poly(A)-binding protein acts in transla- terminant suppresses nonsense mutations in yeast. J. Bacteriol. tion termination via eukaryotic release factor 3 interaction and 139: 1068–1071. does not influence ½PSI(1) propagation. Mol. Cell. Biol. 22: Lowe, T. M., and S. R. Eddy, 1999 A computational screen for meth- 3301–3315. ylation guide snoRNAs in yeast. Science 283: 1168–1171. Czaplinski, K., M. J. Ruiz-Echevarria,S.V.Paushkin,X.Han,Y. Manuvakhova, M., K. Keeling and D. M. Bedwell, 2000 Amino- Weng et al., 1998 The surveillance complex interacts with the glycoside antibiotics mediate context-dependent suppression of translation release factors to enhance termination and degrade termination codons in a mammalian translation system. RNA aberrant mRNAs. Genes Dev. 12: 1665–1677. 6: 1044–1055. Derkatch, I. L., M. E. Bradley and S. W. Liebman, 1998 Over- Mottagui-Tabar, S., and L. A. Isaksson, 1998 The influence of the expression of the SUP45 gene encoding a Sup35p-binding pro- 59 codon context on translation termination in Bacillus subtilis tein inhibits the induction of the de novo appearance of the and Escherichia coli is similar but different from Salmonella ½psi1 prion. Proc. Natl. Acad. Sci. USA 95: 2400–2405. typhimurium. Gene 212: 189–196. Eggers, D. K., W. J. Welch and W. J. Hansen, 1997 Complexes be- Muldoon-Jacobs, K. L., and J. D. Dinman, 2006 Specific effects of tween nascent polypeptides and their molecular chaperones in ribosome-tethered molecular chaperones on programmed -1 the cytosol of mammalian cells. Mol. Biol. Cell 8: 1559–1573. ribosomal frameshifting. Eukaryot. Cell 5: 762–770. Engelberg-Kulka, H., 1981 UGA suppression by normal tRNA Trp Munholland, J. M., and R. N. Nazar, 1987 Methylation of ribo- in Escherichia coli: codon context effects. Nucleic Acids Res. 9: somal RNA as a possible factor in cell differentiation. Cancer 983–991. Res. 47: 169–172. Fine-Tuning of Translation Termination 1537

Namy, O., I. Hatin and J. P. Rousset, 2001 Impact of the six nu- Stahl, G., L. Bidou,J.P.Rousset and M. Cassan, 1995 Versatile cleotides downstream of the stop codon on translation termina- vectors to study recoding: conservation of rules between yeast tion. EMBO Rep. 2: 787–793. and mammalian cells. Nucleic Acids Res. 23: 1557–1560. Namy, O., I. Hatin,G.Stahl,H.Liu,S.Barnay et al., 2002 Gene Stansfield, I., Akhmaloka and M. F. Tuite, 1995a A mutant allele overexpression as a tool for identifying new trans-acting factors of the SUP45 (SAL4) gene of Saccharomyces cerevisiae shows involved in translation termination in Saccharomyces cerevisiae. temperature-dependent allosuppressor and omnipotent suppres- Genetics 161: 585–594. sor phenotypes. Curr. Genet. 27: 417–426. Nelson, R. J., T. Ziegelhoffer,C.Nicolet,M.Werner-Washburne Stansfield, I., K. M. Jones,V.V.Kushnirov,A.R.Dagkesamanskaya, and E. A. Craig, 1992 The translation machinery and 70 kd heat A. I. Poznyakovski et al., 1995b The products of the SUP45 shock protein cooperate in protein synthesis. Cell 71: 97–105. (eRF1) and SUP35 genes interact to mediate translation termina- Nissen, P., J. Hansen,N.Ban,P.B.Moore and T. A. Steitz, tion in Saccharomyces cerevisiae. EMBO J. 14: 4365–4373. 2000 The structural basis of ribosome activity in peptide bond Takanami, M., and Y. Yan, 1965 The release of polypeptide chains synthesis. Science 289: 920–930. from ribosomes in cell-free amino acid-incorporating systems Omer, A. D., S. Ziesche,W.A.Decatur,M.J.Fournier and P. P. by specific combinations of bases in synthetic polyribonucleoti- Dennis, 2003 RNA-modifying machines in Archaea. Mol. des. Proc. Natl. Acad. Sci. USA 54: 1450–1458. Microbiol. 48: 617–629. Ter-Avanesyan, M. D., V. V. Kushnirov,A.R.Dagkesamanskaya,S. Patino, M. M., J. J. Liu,J.R.Glover and S. Lindquist, A. Didichenko,Y.O.Chernoff et al., 1993 Deletion analysis of 1996 Support for the prion hypothesis for inheritance of a phe- the SUP35 gene of the yeast Saccharomyces cerevisiae reveals two notypic trait in yeast. Science 273: 622–626. non-overlapping functional regions in the encoded protein. Mol. Paushkin,S.V.,V.V.Kushnirov,V.N.SmirnovandM.D. Ter-Avanesyan, Microbiol. 7: 683–692. 1996 Propagation of the yeast prion-like ½psi1 determinant Tork, S., I. Hatin,J.P.Rousset and C. Fabret, 2004 The major 59 is mediated by oligomerization of the SUP35-encoded poly- determinant in stop codon read-through involves two adjacent peptide chain release factor. EMBO J. 15: 3127–3134. adenines. Nucleic Acids Res. 32: 415–421. Pfund, C., N. Lopez-Hoyo,T.Ziegelhoffer,B.A.Schilke,P.Lopez- Uliel, S., X. H. Liang,R.Unger and S. Michaeli, 2004 Small nu- Buesa et al., 1998 The molecular chaperone Ssb from Saccha- cleolar RNAs that guide modification in trypanosomatids: reper- romyces cerevisiae is a component of the ribosome-nascent chain toire, targets, genome organisation, and unique functions. Int. complex. EMBO J. 17: 3981–3989. J. Parasitol. 34: 445–454. Rakwalska, M., and S. Rospert, 2004 The ribosome-bound chap- Urakov, V. N., I. A. Valouev,E.I.Lewitin,S.V.Paushkin,V.S. erones RAC and Ssb1/2p are required for accurate translation in Kosorukov et al., 2001 Itt1p, a novel protein inhibiting trans- Saccharomyces cerevisiae. Mol. Cell. Biol. 24: 9186–9197. lation termination in Saccharomyces cerevisiae. BMC Mol. Biol. Rospert,S.,Y.Dubaquie and M. Gautschi,2002 Nascent-polypeptide- 2: 9. associated complex. Cell. Mol. Life Sci. 59: 1632–1639. Wang, W., K. Czaplinski,Y.Rao and S. W. Peltz, 2001 The role of Rospert, S., M. Rakwalska and Y. Dubaquie, 2005 Polypeptide Upf proteins in modulating the translation read-through of chain termination and stop codon readthrough on eukaryotic nonsense-containing transcripts. EMBO J. 20: 880–890. ribosomes. Rev. Physiol. Biochem. Pharmacol. 155: 1–30. Weigert, M. G., and A. Garen, 1965 Base composition of nonsense Salas-Marco, J., and D. M. Bedwell, 2004 GTP hydrolysis by eRF3 codons in E. coli: evidence from amino-acid substitutions at a facilitates stop codon decoding during eukaryotic translation ter- tryptophan site in alkaline phosphatase. Nature 206: 992–994. mination. Mol. Cell. Biol. 24: 7769–7778. Weng, Y., K. Czaplinski and S. W. Peltz, 1996 Genetic and bio- Salser, W., 1969 The influence of the reading context upon the chemical characterization of mutations in the ATPase and heli- suppression of nonsense codons. Mol. Gen. Genet. 105: 125–130. case regions of the Upf1 protein. Mol. Cell. Biol. 16: 5477–5490. Schmitt, M. E., T. A. Brown and B. L. Trumpower, 1990 A rapid Williams, I., J. Richardson,A.Starkey and I. Stansfield, and simple method for preparation of RNA from Saccharomyces 2004 Genome-wide prediction of stop codon readthrough dur- cerevisiae. Nucleic Acids Res. 18: 3091–3092. ing translation in the yeast Saccharomyces cerevisiae. Nucleic Skuzeski, J. M., L. M. Nichols,R.F.Gesteland and J. F. Atkins, Acids Res. 32: 6605–6616. 1991 The signal for a leaky UAG stop codon in several plant viruses Zhouravleva, G., L. Frolova,X.Le Goff,R.Le Guellec,S.Inge- includes the two downstream codons. J. Mol. Biol. 218: 365–373. Vechtomov et al., 1995 Termination of translation in eukar- Song, H., P. Mugnier,A.K.Das,H.M.Webb,D.R.Evans et al., yotes is governed by two interacting polypeptide chain release 2000 The crystal structure of human eukaryotic release factor factors, eRF1 and eRF3. EMBO J. 14: 4065–4072. eRF1: mechanism of stop codon recognition and peptidyl-tRNA hydrolysis. Cell 100: 311–321. Communicating editor: A. Nicolas