Direct Evidence That the N-Terminal Extensions of the TAP Complex Act As Autonomous Interaction Scaffolds for the Assembly of the MHC I Peptide-Loading Complex
Total Page：16
File Type：pdf, Size：1020Kb
Cell. Mol. Life Sci. (2012) 69:3317–3327 DOI 10.1007/s00018-012-1005-6 Cellular and Molecular Life Sciences RESEARCH ARTICLE Direct evidence that the N-terminal extensions of the TAP complex act as autonomous interaction scaffolds for the assembly of the MHC I peptide-loading complex Sabine Hulpke • Maiko Tomioka • Elisabeth Kremmer • Kazumitsu Ueda • Rupert Abele • Robert Tampe´ Received: 26 February 2012 / Revised: 18 April 2012 / Accepted: 20 April 2012 / Published online: 27 May 2012 Ó The Author(s) 2012. This article is published with open access at Springerlink.com Abstract The loading of antigenic peptides onto major Keywords ABC transporter Á Antigen processing Á histocompatibility complex class I (MHC I) molecules is Membrane protein interaction Á Macromolecular an essential step in the adaptive immune response against membrane complex Á Tapasin virally or malignantly transformed cells. The ER-resident peptide-loading complex (PLC) consists of the transporter Abbreviations associated with antigen processing (TAP1 and TAP2), Crt Calreticulin assembled with the auxiliary factors tapasin and MHC I. ER Endoplasmic reticulum Here, we demonstrated that the N-terminal extension of ERGIC ER-Golgi intermediate compartment each TAP subunit represents an autonomous domain, MHC I Major histocompatibility complex class I named TMD0, which is correctly targeted to and inserted PLC Peptide-loading complex into the ER membrane. In the absence of coreTAP, each TAP Transporter associated with antigen processing TMD0 recruits tapasin in a 1:1 stoichiometry. Although the TMD Transmembrane domain TMD0s lack known ER retention/retrieval signals, they are Tsn Tapasin localized to the ER membrane even in tapasin-deficient wt Wild-type cells. We conclude that the TMD0s of TAP form autono- mous interaction hubs linking antigen translocation into the ER with peptide loading onto MHC I, hence ensuring a major function in the integrity of the antigen-processing Introduction machinery. The adaptive immune system of jawed vertebrates is responsible for detection and elimination of virus-infected or malignantly transformed cells, thus playing an essential & S. Hulpke Á R. Abele Á R. Tampe´ ( ) role in survival. Information about the cellular proteome is Biocenter, Institute of Biochemistry and Cluster of Excellence Frankfurt (CEF) - Macromolecular Complexes, presented to cytotoxic T cells on the cell surface in the Goethe-University Frankfurt, Max-von-Laue-Str. 9, form of complexes of MHC I molecules with antigenic 60438 Frankfurt am Main, Germany peptides derived from intracellular proteins [1–3]. A large e-mail: [email protected] portion of the cellular proteome is degraded by the pro- M. Tomioka Á K. Ueda teasome. A fraction of these antigenic peptides is Laboratory of Cellular Biochemistry, Division of Applied Life transported into the lumen of the endoplasmic reticulum Sciences, Graduate School of Agriculture and Institute for (ER) by the transporter associated with antigen processing Integrated Cell-Material Sciences (iCeMS), Kyoto University, (TAP), a heterodimeric ABC complex composed of TAP1 Kyoto 606-8502, Japan (ABCB2) and TAP2 (ABCB3). The loading of peptides E. Kremmer onto MHC I takes place within the peptide-loading com- Helmholtz-Center Munich, German Research Center plex (PLC), a multisubunit machinery consisting of TAP1/2, for Environmental Health, Institute of Molecular Immunology, MHC I heavy chain/b -microglobulin, the chaperone Marchioninistr. 25, 81377 Munich, Germany 2 123 3318 S. Hulpke et al. calreticulin, the oxidoreductase ERp57, and tapasin (Tsn). 50-GTCGACGCGGCCGCTCAAGCGTAGTCTGGGACG The latter is an essential adapter molecule within the PLC, TCGTATGGGTAGGATCCCTTCTCCTGGGCTCC-30 TAP2 as it bridges the peptide donor (TAP) with the peptide for TMD0 . CoreTAP1 (amino acids 165–748, containing acceptor (MHC I) [4, 5]. For a large number of MHC I an N-terminal methionine) was amplified with primer pairs alleles, tapasin is required for loading of high-affinity 50-CGATTACTCGAGATGGGTCAGGGCGGCTC-30and peptides onto MHC I, a process known as peptide editing 50-CGATTAGAATTCCCTTCTGGAGCATCTGC-30 and [6, 7]. After loading their peptide cargo, MHC I complexes cloned into pEGFP-N3 (BD Biosciences, Franklin Lakes, travel via the secretory pathway to the cell surface. Large NJ, USA) via XhoI and EcoRI sites. CoreTAP2-mCerulean efforts have been made to understand the assembly, orga- (amino acids 125-716 plus N-terminal methionine) con- nization, and function of the PLC. For most ER-lumenal taining a C-terminal StrepII-tag was amplified with the parts, structural information is available [8–12]. However, primer pair 50-CATGCTTAAGATGGCCCAGGAGAAGG TAP cannot yet be crystallized, and only a homology AGCAGGACC-30and 50-CCGCTCGAGTCACTTCTCGA model of the coreTAP complex is available based on the ATTGTGGGTGAGACCAAGC-30, then cloned into X-ray structures of bacterial ABC transporter Sav1866 and pcDNA3.1(?) via AflII and XhoI. Tsn-TMD0 constructs the NBD1 of TAP1 [13–15]. were amplified via PCR with the following primers: 50-AG Each coreTAP subunit consists of six transmembrane ATCTATGAAGTCCCTGTCTCTGCTCCTCG -30 as for- helices plus the nucleotide-binding domain. CoreTAP ward primer for both constructs, 50-ATCGCGGCCGCT shares significant homology with other ABC transporters CACAGATCCTCTTCTGAGATGAGTTTTTGTTCACC 0 TAP1 and is necessary and sufficient for peptide binding and TCCAGGCACCCAAAGACTACC-3 for Tsn-TMD0 transport [16]. In contrast, the unique N-terminal domain containing a C-terminal myc-tag and 50-GTCGACGCGGC with four putative transmembrane-spanning segments, CGCTCAAGCGTAGTCTGGGACGTCGTATGGGTAG 0 called TMD0, shares no homology to any other known GATCCTTTTTCTTGGGCACCTGGTGGAC-3 for Tsn- TAP2 protein. Deletion of the first transmembrane-spanning TMD0 with a C-terminal HA-tag. A 34 amino acid long segment of TAP destroys its ability to interact with tapasin flexible glycine-serine linker was inserted between the [17]. However, there is no structural information available C-terminus of tapasin and the N-terminus of the TMD0. for the TMD0 of TAP1 and TAP2. Despite their critical Both constructs were cloned into pcDNA3.1(?) via Bam- role in PLC assembly, the TMD0s constitute the least HI/NotI. For the TAP1/TAP2 coexpression plasmid, TAP1 understood part of this macromolecular machinery. TMD0 was cloned into the MCS2 of pVitro2-neo-mcs (Invivogen, TAP2 of TAP2 (hereafter named TMD0 ) is about 30 amino San Diego, CA, USA) via BglII and NheI, TAP2 was TAP1 acids shorter than that of TAP1 (TMD0 ). Although their cloned into MCS1 via BamHI and SalI. sequences markedly differ, both TMD0s seem to fulfill similar functions in tapasin binding [16], in spite of data Cell lines and transfection indicating a functional asymmetry of greater significance TAP2 of the rat TMD0 in PLC function [18]. In this study, the HeLa cells were cultured in DMEM (PAA Laboratories, functionality and structural integrity of the TMD0s of both Pasching, Austria) supplemented with 10 % fetal calf TAP subunits were addressed with regard to their subcel- serum (FCS; Biochrom, Berlin, Germany). M553, a human lular localization, binding, and stoichiometry of tapasin. tapasin-deficient melanoma cell line [19, 20], was main- tained in RPMI 1640 with 10 % FCS. Transfection of M553 was performed using XtremeGene HP (Roche, Materials and methods Grenzach-Wyhlen, Germany) according to the manufac- turer’s instructions. HeLa cells were transfected with Cloning and constructs 18 mM branched polyethyleneimine (PEI) with a DNA-to- PEI ratio of one to three. After 24–48 h, cells were har- TAP1 TAP2 TMD0 and TMD0 were cloned into pcDNA3.1(?) vested and used for the indicated experiments. (Invitrogen, Darmstadt, Germany) via XhoI/EcoRI and TAP1 KpnI/NotI, respectively. To generate TMD0 (aa 1–164 Antibodies TAP2 of TAP1) with a C-terminal myc-tag and TMD0 (aa 1–127 of TAP2) with a C-terminal HA-tag, the following For immunofluorescence experiments, the following anti- primer pairs were used: 50-GTCGACGAATTCATGGC bodies were used: mouse anti-myc 4A6 (Millipore, TAGCTCTAGGTG-30 and 50-GTCGACCTCGAGTCACA Billerica, MA, USA), mouse anti-HA HA-7 (Abcam, GATCCTCTTCTGAGATGAGTTTTTGTTCGGATCCG Cambridge, UK), mouse anti-TAP1 148.3 [21], and mouse 0 TAP1 0 CCGGGCACCCAG-3 for TMD0 ,5-GTCGACGG anti-StrepII (IBA BioTAGnology, Go¨ttingen, Germany). TACCAGATCTACCATGCGGCTCCCTGACCTG-30 and As organelle makers, rabbit anti-Calreticulin (polyclonal 123 N-terminal extensions of the TAP complex act as autonomous interaction scaffolds 3319 IgG fraction; Sigma-Aldrich, Steinheim, Germany), anti- JACoP plug-in [23] for ImageJ was used to calculate ERGIC-53 (Sigma-Aldrich), and anti-GM130 (Golgi; Pearson’s coefficients out of 8–10 individual cells per EP892Y; Abcam) were used. Detection of the primary construct and organelle marker. For coreTAP1 and core- antibodies was done with donkey anti-mouse-Alexa488 TAP2 co-expression, Pearson’s coefficients were (Invitrogen), goat anti-rabbit-Cy3 (Dianova, Hamburg, calculated for coreTAP1-GFP and the organelle marker. Germany), and, for simultaneous detection of GFP and StrepII together with organelle marker, goat anti-mouse- Coimmunoprecipitation Alexa633 (Invitrogen). For immunoblotting, anti-myc 4A6, anti-HA HA-7, anti-SRP54 (BD Bioscience), anti-MHC I hc For coimmunoprecipitation, sheep anti-mouse Dynabeads HC10 [22] and mAb 7F6, raised against amino acids (Invitrogen) were loaded with mouse anti-myc 4A6 TAP1 TAP1 21GPAVIECWFVEDASGKG35 of human tapasin, were used. (TMD0 and Tsn-TMD0