Integrin-Dependent Secretion of MMP-9/Gelatinase B
Total Page：16
File Type：pdf, Size：1020Kb
Journal of Cell Science 113, 2909-2921 (2000) 2909 Printed in Great Britain © The Company of Biologists Limited 2000 JCS1511 Mouse keratinocytes immortalized with large T antigen acquire α3β1 integrin-dependent secretion of MMP-9/gelatinase B C. Michael DiPersio1,2,*, Michael Shao1, Lara Di Costanzo2, Jordan A. Kreidberg3 and Richard O. Hynes1 1Howard Hughes Medical Institute, Center for Cancer Research and Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA 2Center for Cell Biology and Cancer Research, Albany Medical College, Albany, New York 12208, USA 3Department of Medicine, Children’s Hospital and Department of Pediatrics, Harvard Medical School, Boston, Massachusetts 02115, USA *Author for correspondence at address 2 (e-mail: [email protected]) Accepted 12 June; published on WWW 20 July 2000 SUMMARY Remodeling of the extracellular matrix during tissue cells derived from wild-type mice, but not in MK cells development, wound repair and tumor cell invasion derived from α3-null mice. Reconstitution of α3β1 depends on the coordinated regulation of cell adhesion expression in α3-null MK cells through transfection with receptors, matrix proteins and enzymes that proteolyse the the α3 subunit restored MMP-9 secretion, indicating an extracellular matrix. Integrin α3β1 is a major receptor on α3β1-dependent pathway for MMP-9 production. α3β1- epidermal keratinocytes for laminin-5 in the cutaneous dependent expression of MMP-9 was associated with the basement membrane and is required for normal basement immortalized phenotype, since nonimmortalized, primary membrane organization during skin development. α3β1 is keratinocytes required soluble growth factors, but not also expressed at high levels in the majority of adherent α3β1, for efficient expression of MMP-9. Our results transformed cells and in most tumors, and it could have suggest that an α3β1-independent pathway(s) for MMP-9 similar roles in extracellular matrix remodeling during production is suppressed in keratinocytes immortalized tumorigenesis and cell invasion. In the present study, we with large T antigen, and that an α3β1-dependent pathway show that α3β1 expression is required in immortalized is required for sustained production of MMP-9 in the mouse keratinocytes (MK) for the production of the matrix absence of other pathways. metalloproteinase MMP-9/gelatinase B, an MMP that is coexpressed with α3β1 in epithelial cell carcinomas and during wound healing, and contributes to the invasive Key words: Integrin, Matrix metalloproteinase, Extracellular matrix, potential of some tumor cells. MMP-9 was expressed in MK Keratinocyte INTRODUCTION the repertoire of integrins expressed by a cell determines its ability to invade an ECM that it encounters. Upon binding to Cell-mediated remodeling of the extracellular matrix (ECM) extracellular ligands, integrins can initiate distinct ‘outside-in’ during tissue development, wound healing, tumor cell invasion signaling events that affect downstream functions (Clark and and other tissue remodeling events requires extracellular Brugge, 1995; Schwartz et al., 1995), including cell migration proteinases that process ECM proteins during matrix assembly and invasion. Signal transduction functions of pre-existing or degrade existing ECM at the invading/migrating cell front integrins can be modulated during cell differentiation (Adams (Werb, 1997). The matrix metalloproteinases (MMPs) are and Watt, 1990) and transformation (Tapley et al., 1989; secreted as inactive proenzymes that are activated in the Schwartz et al., 1996; Rosales and Juliano, 1996; Sanders et pericellular environment through their own proteolytic al., 1998; Ruoslahti, 1999). cleavage by other MMPs or proteinases (Werb, 1997). Epidermal keratinocytes produce many of the proteinases Coupling the expression and activation of MMPs with the cell- involved in ECM remodeling during wound healing, squamous adhesion functions of ECM receptors is a potential mechanism cell carcinoma and pathological conditions of the skin (Kähäri for temporal and spatial regulation of ECM remodeling and Saarialho-kere, 1997; Johnsen et al., 1998; Westermarck (Huhtala et al., 1995; Brooks et al., 1996; Pilcher et al., 1997; and Kähäri, 1999). MMP-9/gelatinase B appears to be Lochter et al., 1999; Pozzi et al., 2000). Integrins are αβ particularly important for keratinocyte migration during re- heterodimers that function as the major receptors for cell epithelialization of cutaneous wounds (Salo et al., 1994; Okada adhesion to the ECM (Hynes, 1992). Most cell types express et al., 1997; Madlener et al., 1998) and invasion of tumor cells several integrins with distinct ligand-binding specificities, and (Westermarck and Kähäri, 1999; Ramos-DeSimone et al., 2910 C. M. DiPersio and others 1999). A potential mechanism for keratinocytes to acquire mutation as described previously (DiPersio et al., 1997). The presence and/or maintain proteolytic potential is through integrin- of at least one copy of the H-2Kb-tsA58 transgene was confirmed by dependent signaling pathways; however, interactions between PCR using a forward primer (AGCGCTTGTGTCGCCATTGTATTC) integrins and MMP-9 are poorly understood. and a reverse primer (GTAACACCACAGAAGTAAGGTTCC) that Integrin α3β1 is expressed at high levels by basal produced a PCR product of approximately 1000 base pairs in the keratinocytes of the epidermis, where it is a receptor for following PCR reaction: 95°C, 1 minute; 58°C, 2 minutes; 70°C, 3 minutes; 38 cycles. laminin-5 in the basement membrane that separates the Primary keratinocytes were prepared from neonatal mice as epidermis from the dermis (Carter et al., 1991; Delwel et al., described previously (DiPersio et al., 1997; Hodivala-Dilke et al., 1994). α3β1-deficient mice display basement membrane 1998). Keratinocyte growth medium consisted of Eagle’s Minimum disorganization at the dermal-epidermal junction in skin Essential Medium (EMEM; BioWhittaker, Walkersville, MD, USA) (DiPersio et al., 1997; Hodivala-Dilke et al., 1998), as well as supplemented with 4% fetal bovine serum (FBS) (Intergen, Purchase, in kidney and lung (Kreidberg et al., 1996), suggesting a NY, USA) from which Ca2+ had been chelated. Growth medium was µ generally important role for this integrin in ECM assembly supplemented with 0.05 mM CaCl2, 0.4 g/ml hydrocortisone α3β1 (Calbiochem, La Jolla, CA, USA), 5 µg/ml insulin (Sigma, St Louis, during development. is also highly expressed during −10 cutaneous wound healing (Larjava et al., 1993b; Watt and MO, USA), 10 M cholera toxin (ICN Biomedicals, Inc., Costa Mesa, CA, USA), 10 ng/ml epidermal growth factor (EGF; Gibco BRL), Hertle, 1994; Salo et al., 1994;) and in most metastatic 2×10−9 M T3 (Sigma), 100 i.u./ml penicillin and 100 µg/ml carcinomas (Natali et al., 1993; Bartolazzi et al., 1994; streptomycin (Gibco BRL). Cell cultures from one wild-type mouse and Patriarca et al., 1998), suggesting that it may also have a role one α3-null mouse were expanded for approximately 15 passages at the in ECM remodeling during these processes. In the current permissive temperature for large T antigen function (33°C) in study, we established conditionally immortalized mouse keratinocyte growth medium supplemented with 10 units/ml IFNγ keratinocyte (MK) cell lines derived from wild-type or α3β1- (Genzyme, Cambridge, MA, USA, or Gibco BRL). Individual wild- deficient mice. We show that secretion of MMP-9/gelatinase B type or α3-null cell lines were then cloned from each culture by limiting by the MK cell lines was dependent on the presence of dilution and were expanded under permissive conditions (33°C, 10 γ endogenous or transfected α3. α3β1-dependent secretion of units/ml IFN ) for approximately five more passages. MK cell lines MMP-9 was associated with the immortalized phenotype, since were maintained at 33°C, 8% CO2, in keratinocyte growth medium (without cholera toxin) supplemented with 10-20 units/ml IFNγ. freshly isolated primary keratinocytes secreted MMP-9 independently of α3β1 expression. We present evidence that MK cell growth assays immortalization of mouse keratinocytes with large T antigen 14 distinct MK lines (seven wild-type and seven α3-null) were tested results in suppression of certain signaling pathway(s) for for temperature-sensitive growth. MK cultures were trypsinized and MMP-9 production, and that integrin α3β1 is required for counted using Trypan Blue exclusion, then seeded onto culture plates sustained production of MMP-9 in the absence of these other at a density of 50 cells/cm2. Cells were cultured overnight under pathways. permissive conditions (33°C, 10 units/ml IFNγ), then either kept under permissive conditions or shifted to nonpermissive conditions (39°C, no IFNγ) and cultured for 8 days to allow colony formation. Colonies were fixed with 4% formaldehyde and stained with 0.1% Crystal Violet. MATERIALS AND METHODS Preparation of laminin-5-rich ECM from SCC-25 cells Antibodies Laminin-5-rich ECM was prepared from the human squamous cell Rabbit antisera against the cytoplasmic domains of the β1 and α3 carcinoma line SCC-25 (Rheinwald and Beckett, 1981), as described integrin subunits were described previously (Marcantonio and Hynes, previously (Xia et al., 1996). Briefly, SCC-25 cells were grown on 1988; DiPersio et al., 1995). Rabbit antisera against the α5 and αv tissue culture plates in DMEM:HAM’S F-12 (1:1 mix; BioWhittaker), subunits were purchased from Chemicon International (Temecula, 10% FBS, 0.4 µg/ml hydrocortisone for