DOCSLIB.ORG

Research Article Single-Nucleotide Polymorphisms in XPO5 Are Associated with Noise-Induced Hearing Loss in a Chinese Population

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Research Article Single-Nucleotide Polymorphisms in XPO5 Are Associated with Noise-Induced Hearing Loss in a Chinese Population Hindawi Biochemistry Research International Volume 2020, Article ID 9589310, 10 pages https://doi.org/10.1155/2020/9589310 Research Article Single-Nucleotide Polymorphisms in XPO5 are Associated with Noise-Induced Hearing Loss in a Chinese Population Ning Wang,1,2 Boshen Wang ,1,2 Jiadi Guo,2,3 Suhao Zhang ,4 Lei Han,2 Juan Zhang ,1 and Baoli Zhu 1,2,3 1Key Laboratory of Environmental Medicine Engineering of Ministry of Education, School of Public Health, Southeast University, Nanjing 210009, Jiangsu, China 2Jiangsu ProvincialCenter for Disease Prevention and Control, Nanjing 210009, Jiangsu, China 3Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing 210000, Jiangsu, China 4School of Public Health, NantongUniversity, Nantong 226000, Jiangsu, China Correspondence should be addressed to Baoli Zhu; [email protected] Received 21 May 2019; Revised 20 December 2019; Accepted 30 December 2019; Published 17 February 2020 Academic Editor: Tzi Bun Ng Copyright © 2020 Ning Wang et al. ,is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Objectives.,e purpose of this study was to investigate the correlation between single-nucleotide polymorphism (SNP) in 3′UTR of XPO5 gene and the occurrence of noise-induced hearing loss (NIHL), and to further explore the regulatory mechanism of miRNAs in NIHL on XPO5 gene. Methods.We conducted a case-control study involving 1040 cases and 1060 controls. ,e effects of SNPs on XPO5 expression were studied by genotyping, real-time polymerase chain reaction (qPCR), cell transfection, and the dual-luciferase reporter assay. Results.We genotyped four SNPs (rs2257082, rs11077, rs7755135, and rs1106841) in the XPO5 gene. ,e rs2257082 AG/GG carriers have special connection to an increased risk of noise-induced hearing loss compared to the AA carriers. ,e rs11077TG/GG carriers had a significantly increased association with NIHL susceptibility than the TTcarriers. ,ere was a higher risk of NIHL in the XPO5 gene rs7755135 CC carriers than in the TT carriers. No statistically significant correlation was obtained with respect to SNPrs1106841. Functional experiments showed that the rs11077 change might inhibit the interaction between miRNAs (miRNA-4763-5p, miRNA-5002-3p, and miRNA-617) and XPO5, with rs11077G allele resulting in over- expression of XPO5. Conclusion. ,e genetic polymorphism, rs11077, within XPO5 is associated with the risk of noise-induced hearing loss in a Chinese population. 1. Introduction vital part in the development of NIHL, population epide- miologic studies have shown that, with the exception of the Noise-induced hearing loss (NIHL) refers to progressive influence of other confounding factors, hereditary factors sensorineural hearing impairment caused by patients ex- account for up to 50% of the variability in hearing loss after posed to a noisy environment. NIHL has become a major noise exposure [2,3]. public health problem with industrialization, the increase in MicroRNAs (miRNAs) are highly-conserved, endoge- social noise, and the prolongation of life expectancy. Based nous noncoding single-stranded RNAs with posttranscrip- on the global disease burden report issued by the WHO in tional regulatory functions that are found in eukaryotes and 2005, occupational noise-associated hearing loss accounts consist of approximately 22 nucleotides (nt) [4,5]. Greater for 16% of adult hearing loss worldwide, which is about 4 than 700 kinds of miRNAs have been identified in humans million disability-adjusted life years (DALYs) [1]. ,ere are and regulate at least 30% of protein-coding gene expression greater than 10 million workers employed in high-noise [6,7]. miRNAs are transcribed into primary transcripts of environments in China, of which at least 10% have different miRNAs (pri-miRNAs) in the nucleus by RNA polymerase levels of hearing loss. Although environmental factors play a II and then further assimilated by RNase III Drosha to form a 2 Biochemistry Research International hairpin structure of approximately 60- to 70-nt precursor approved by the Ethics Committee of Jiangsu Centers for miRNAs (pre-miRNAs) [8,9]. Pre-miRNAs are transported Disease Control and Prevention, and all of the subjects from the nucleus to the cytoplasm under the synergistic signed the informed consent in person. Considering the use action of transport receptor exportin-5 (XPO5). It is believed of data analysis, the private information of subjects involved that single-nucleotide polymorphisms (SNPs) exist in the in the study was encrypted. binding sites of the gene encoding miRNAs and related target genes, which can directly or indirectly affect gene 2.2. SNP Selection. SNP loci located in the XPO5 gene were expression and protein function [10]. found from NCBIdbSNP (http://www.ncbi.nlm.nih.gov/ Recent studies have confirmed that the abnormal ex- SNP) and ENSEMBL (http://www.ensembl.org/). ,e pression of miRNAs is related to many diseases, including principles for screening SNPs are indicated as follows: (a) auditory diseases [11]. ,ere is increasing evidence that the XPO5 binding site; (b) minor allele frequency (MAF) > 0.05; imbalance of miRNAs in NIHL affects the expression of (c) p of Hardy–Weinberg equilibrium (HWE) > 0.05; and (d) target genes and further affects the necessary cellular pro- linkage disequilibrium (LD) of r2 >0.8. Four SNPs cesses, including cell metabolism, proliferation, differenti- (rs2257082, rs11077, rs7755135, and rs1106841) were se- ation, and apoptosis [12,13]. Compared with the control lected as candidate SNPs because the target gene (XPO5) was group, the expression of miRNA-24, miRNA-185-5p, and associated with the pathogenesis of NIHL. miRNA-451a increased significantly in the NIHL group [14]. Li et al. [15] reported that the serum miRNA-1229-5p level of male workers suffering from NIHL was significantly 2.3. Genetic Analysis. Peripheral blood samples from the higher than the control group. subjects were stored in Vacutainers containing the anti- XPO5 exists in the nuclear membrane and participates in coagulant, (ethylenediaminetetraacetic® acid) EDTA. ,e the transport of pre-miRNAs. Previous results have indi- total DNA template was extracted using a DNA extraction cated that overexpression of XPO5 enhances the activity of kit (QIAGEN, Duesseldorf, Germany). ,e concentration miRNAs, and under- or nonexpression of XPO5 results in a and purity of the extracted DNA were determined using an decrease in the nuclear output of pre-miRNAs [16,17]. SNPs ultraviolet spectrophotometer (NanoDrop ND-1000; associated with miRNAs in the XPO5 3′untranslated region ,ermo Scientific, Wilmington, DE, USA). Based on the (3′UTR) affect the risk of disease in the synthesis pathway of NCBIdbSNP database, the primers of the SNP locus were miRNAs [18]. Currently, there is a lack of research on the designed. ,e genomic DNA was amplified using an relationship betweenXPO5 and the risk of NIHL develop- ABI7900HT real-time PCR system (Applied Biosystems, ment; however, several studies have demonstrated that the Foster City, CA,USA) at 94°C for 5 min, followed by 40 transporter, XPO5, is involved in the miRNA pathway. ,e cycles at 94°C for 20 s, 56°C for 30 s, 72°C for 30 s, and 72°C structural changes of XPO5 may cause abnormal expression for 7 min. Detection of gene polymorphisms was controlled of the miRNA, leading to tumorigenesis [19–21], which may by ABITaqManSNP genotyping assays (Applied Biosystems, also be the case in the hearing system. Based on bio- Foster City, CA, USA). Five percent samples were randomly informatics prediction and statistical analysis, we found that sampled for quality control of duplicate genotyping, and the SNPs in XPO5 may play a potential role in NIHL. In this reproducibility of SNPs was 100%. study, we focused on the SNPs located in the binding region of miRNAs and XPO5. For significant SNPs, we performed 2.4. Plasmid Construction. Human miRNA-4763-5p, functional validation to evaluate the potential function of miRNA-5002-3p, and miRNA-617 were cloned into the these SNPs on XPO5. expression vector pcDNA3.1(+) to generate stably-trans- fected human embryonic kidney cell lines (HEK293T) using 2. Materials and Methods forward primers (GAATCTGGTCACCTGATGGGA) and reverse primers (GTGCCTGAGTGGACCTTGAG). ,e 2.1. Study Population Collection. In the current study, a total plasmid containing the sequence of the wild-type or mutant of 1040 cases and 1060 controls were recruited from the miRNA-4763-5p, miRNA-5002-3p, or miRNA-617 binding Yizheng Branch of the SAIC Volkswagen Automobile Co., XPO5, was cloned into the luciferase reporter vector (pGL3- Ltd. ,e subjects were engaged in steady-state noise work for CMV-LUC-MCS). ,e successfully constructed expression a long time, and the exposure period of noise was not less vector was inoculated into LB (Luria–Bertani) medium and than 1year. Workers exposed to noise did not have any cultured on a shaking table (220 rpm)at 37°C for 24 h. ,e history of disease or current illness that might affect their plasmids were extracted and sequenced using a high-purity hearing, nor of the long-term use of ototoxic drugs. ,e plasmid extraction kit (QIAGEN). definition of hearing loss was as follows: the subject’s au- diogram falls at high frequencies; the average hearing threshold of high frequencies in both ears and the better 2.5. Reagents, Cell Culture, and Transfection. ,e unilateral ear are >25 dB; and the high frequencies are HEK293T cell lines used in this study were obtained from greater than the low frequencies. Normal hearing refers to a Novobio Scientific (Shanghai, China). All cells were pre- subject’s high and low frequency threshold ≤25 dB. NIHL served in Dulbecco’s Modified Eagle’s medium (DEME) cases and controls were matched, including age, gender, fortified with 10% fetal bovine serum (FBS) and placed in a ° smoking status, and noise exposure time.
Load more

Recommended publications
  • Mutations in Multiple Components of the Nuclear Pore Complex Cause Nephrotic Syndrome
    Mutations in multiple components of the nuclear pore complex cause nephrotic syndrome Daniela A. Braun, … , Mustafa K. Khokha, Friedhelm Hildebrandt J Clin Invest. 2018;128(10):4313-4328. https://doi.org/10.1172/JCI98688. Research Article Genetics Nephrology Steroid-resistant nephrotic syndrome (SRNS) almost invariably progresses to end-stage renal disease. Although more than 50 monogenic causes of SRNS have been described, a large proportion of SRNS remains unexplained. Recently, it was discovered that mutations of NUP93 and NUP205, encoding 2 proteins of the inner ring subunit of the nuclear pore complex (NPC), cause SRNS. Here, we describe mutations in genes encoding 4 components of the outer rings of the NPC, namely NUP107, NUP85, NUP133, and NUP160, in 13 families with SRNS. Using coimmunoprecipitation experiments, we showed that certain pathogenic alleles weakened the interaction between neighboring NPC subunits. We demonstrated that morpholino knockdown of nup107, nup85, or nup133 in Xenopus disrupted glomerulogenesis. Re- expression of WT mRNA, but not of mRNA reflecting mutations from SRNS patients, mitigated this phenotype. We furthermore found that CRISPR/Cas9 knockout of NUP107, NUP85, or NUP133 in podocytes activated Cdc42, an important effector of SRNS pathogenesis. CRISPR/Cas9 knockout of nup107 or nup85 in zebrafish caused developmental anomalies and early lethality. In contrast, an in-frame mutation of nup107 did not affect survival, thus mimicking the allelic effects seen in humans. In conclusion, we discovered here that mutations in 4 genes encoding components of the outer ring subunits of the NPC cause SRNS and thereby provide further evidence that specific hypomorphic mutations in these essential genes cause a distinct, […] Find the latest version: https://jci.me/98688/pdf The Journal of Clinical Investigation RESEARCH ARTICLE Mutations in multiple components of the nuclear pore complex cause nephrotic syndrome Daniela A.
    [Show full text]
  • Anti-Exportin-5 Picoband Antibody Catalog # ABO12998
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Anti-Exportin-5 Picoband Antibody Catalog # ABO12998 Specification Anti-Exportin-5 Picoband Antibody - Product Information Application WB Primary Accession Q9HAV4 Host Rabbit Reactivity Human, Mouse, Rat Clonality Polyclonal Format Lyophilized Description Rabbit IgG polyclonal antibody for Exportin-5(XPO5) detection. Tested with WB in Human;Mouse;Rat. Reconstitution Add 0.2ml of distilled water will yield a concentration of 500ug/ml. Figure 1. Western blot analysis of Exportin-5 using anti-Exportin-5 antibody (ABO12998). Anti-Exportin-5 Picoband Antibody - Additional Information Anti-Exportin-5 Picoband Antibody - Gene ID 57510 Background Other Names Exportin-5 (XPO5) is a protein that in humans Exportin-5, Exp5, Ran-binding protein 21, is encoded by the XPO5 gene. The XPO5, KIAA1291, RANBP21 International Radiation Hybrid Mapping Consortium mapped the XPO5 gene to Calculated MW chromosome 6. This gene encodes a member 136311 MW KDa of the karyopherin family that is required for the transport of small RNAs and Application Details double-stranded RNA-binding proteins from the Western blot, 0.1-0.5 µg/ml, Human, Mouse, nucleus to the cytoplasm. The encoded protein Rat<br> translocates cargo through the nuclear pore complex in a RanGTP-dependent process. Subcellular Localization Nucleus . Cytoplasm . Shuttles between the nucleus and the cytoplasm. Tissue Specificity Expressed in heart, brain, placenta, lung, skeletal muscle, kidney and pancreas. Contents Each vial contains 5mg BSA, 0.9mg NaCl, 0.2mg Na2HPO4, 0.05mg NaN3. Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Immunogen A synthetic peptide corresponding to a sequence at the N-terminus of human Exportin-5 (2-43aa AMDQVNALCEQLVKAVTV MMDPNSTQRYRLEALKFCEEFKEK), different from the related mouse sequence by four amino acids.
    [Show full text]
  • Global Microrna Elevation by Inducible Exportin 5 Regulates Cell Cycle Entry
    Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press REPORT Global microRNA elevation by inducible Exportin 5 regulates cell cycle entry YUKA W. IWASAKI,1,2,4 KOTARO KIGA,1,4 HIROYUKI KAYO,1 YOKO FUKUDA-YUZAWA,1 JASMIN WEISE,1 TOSHIFUMI INADA,3 MASARU TOMITA,2 YASUSHI ISHIHAMA,2 and TARO FUKAO1,5 1Max-Planck Institute of Immunobiology and Epigenetics, Freiburg 79108, Germany 2Institute for Advanced Biosciences, Keio University, Tsuruoka 997-0017, Japan 3Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai 980-8578, Japan ABSTRACT Proper regulation of gene expression during cell cycle entry ensures the successful completion of proliferation, avoiding risks such as carcinogenesis. The microRNA (miRNA) network is an emerging molecular system regulating multiple genetic pathways. We demonstrate here that the global elevation of miRNAs is critical for proper control of gene expression program during cell cycle entry. Strikingly, Exportin 5 (XPO5) is promptly induced during cell cycle entry by a PI3K-dependent post-transcriptional mechanism. Inhibition of XPO5 induction interfered with global miRNA elevation and resulted in a proliferation defect associated with delayed G1/S transition. During cell cycle entry, XPO5 therefore plays a paramount role as a critical molecular hub controlling the gene expression program through global regulation of miRNAs. Our data suggest that XPO5-mediated global miRNA elevation might be involved in a broad range of cellular events associated with cell cycle control. Keywords: microRNA; Exportin 5; PI3-kinase; cell cycle INTRODUCTION The biogenesis of functional mature miRNAs is based on the stepwise processing machinery (Fukao et al.
    [Show full text]
  • Evolution of Microrna Biogenesis Genes in the Sterlet (Acipenser Ruthenus) and Other Polyploid Vertebrates
    International Journal of Molecular Sciences Article Evolution of MicroRNA Biogenesis Genes in the Sterlet (Acipenser ruthenus) and Other Polyploid Vertebrates Mikhail V. Fofanov 1,2,* , Dmitry Yu. Prokopov 1 , Heiner Kuhl 3, Manfred Schartl 4,5 and Vladimir A. Trifonov 1,2,* 1 Institute of Molecular and Cellular Biology SB RAS, Lavrentiev Ave. 8/2, 630090 Novosibirsk, Russia; [email protected] 2 Department of Natural Sciences, Novosibirsk State University, Pirogova 2, 630090 Novosibirsk, Russia 3 Leibniz-Institute of Freshwater Ecology and Inland Fisheries, Müggelseedamm 301 and 310, 12587 Berlin, Germany; [email protected] 4 Developmental Biochemistry, Biocenter, University of Wuerzburg, Am Hubland, 97074 Wuerzburg, Germany; [email protected] 5 Xiphophorus Genetic Stock Center, Texas State University, 601 University Drive, 419 Centennial Hall, San Marcos, TX 78666-4616, USA * Correspondence: [email protected] (M.V.F.); [email protected] (V.A.T.) Received: 14 November 2020; Accepted: 14 December 2020; Published: 15 December 2020 Abstract: MicroRNAs play a crucial role in eukaryotic gene regulation. For a long time, only little was known about microRNA-based gene regulatory mechanisms in polyploid animal genomes due to difficulties of polyploid genome assembly. However, in recent years, several polyploid genomes of fish, amphibian, and even invertebrate species have been sequenced and assembled. Here we investigated several key microRNA-associated genes in the recently sequenced sterlet (Acipenser ruthenus) genome, whose lineage has undergone a whole genome duplication around 180 MYA. We show that two paralogs of drosha, dgcr8, xpo1, and xpo5 as well as most ago genes have been retained after the acipenserid-specific whole genome duplication, while ago1 and ago3 genes have lost one paralog.
    [Show full text]
  • Micrornas: Crucial Regulators of Placental Development
    155 6 REPRODUCTIONREVIEW MicroRNAs: crucial regulators of placental development Heyam Hayder, Jacob O’Brien, Uzma Nadeem and Chun Peng Department of Biology, York University, Toronto, Ontario, Canada Correspondence should be addressed to C Peng; Email: [email protected] Abstract MicroRNAs (miRNAs) are small non-coding single-stranded RNAs that are integral to a wide range of cellular processes mainly through the regulation of translation and mRNA stability of their target genes. The placenta is a transient organ that exists throughout gestation in mammals, facilitating nutrient and gas exchange and waste removal between the mother and the fetus. miRNAs are expressed in the placenta, and many studies have shown that miRNAs play an important role in regulating trophoblast differentiation, migration, invasion, proliferation, apoptosis, vasculogenesis/angiogenesis and cellular metabolism. In this review, we provide a brief overview of canonical and non-canonical pathways of miRNA biogenesis and mechanisms of miRNA actions. We highlight the current knowledge of the role of miRNAs in placental development. Finally, we point out several limitations of the current research and suggest future directions. Reproduction (2018) 155 R259–R271 Introduction and nutrient demands required by the growing fetus to be met throughout gestation (Wooding & Burton MicroRNAs (miRNAs) have been established as major 2008). Improper placental formation gives rise to many regulators of gene expression and are involved in pregnancy-associated conditions such as preeclampsia many biological processes (Vasudevan 2012, Jonas and intrauterine growth restriction (Genbacev et al. & Izaurralde 2015). Since their discovery in 1993, 1996, Rossant & Cross 2001, Fu et al. 2013a). In recent miRNAs have been of great interest to researchers and years, the role of miRNAs in placentation has been many new advances have been made in understanding increasingly recognized.
    [Show full text]
  • Exportin-5 Functions As an Oncogene and a Potential Therapeutic Target in Colorectal Cancer Kunitoshi Shigeyasu1,2, Yoshinaga Okugawa1,3, Shusuke Toden1, C
    Published OnlineFirst August 23, 2016; DOI: 10.1158/1078-0432.CCR-16-1023 Biology of Human Tumors Clinical Cancer Research Exportin-5 Functions as an Oncogene and a Potential Therapeutic Target in Colorectal Cancer Kunitoshi Shigeyasu1,2, Yoshinaga Okugawa1,3, Shusuke Toden1, C. Richard Boland1, and Ajay Goel1 Abstract Purpose: Dysregulated expression of miRNAs has emerged as a Results: XPO5 is upregulated, both at mRNA and protein hallmark feature in human cancers. Exportin-5 (XPO5), a karyo- levels, in colorectal cancers compared with normal tissues. High pherin family member, is a key protein responsible for transport- XPO5 expression is associated with worse clinicopathologic fea- ing precursor miRNAs from the nucleus to the cytoplasm. tures and poor survival in colorectal cancer patient cohorts. The Although XPO5 is one of the key regulators of miRNA biogenesis, siRNA knockdown of XPO5 resulted in reduced cellular prolifer- its functional role and potential clinical significance in colorectal ation, attenuated invasion, induction of G1–S cell-cycle arrest, and cancer remains unclear. downregulation of key oncogenic miRNAs in colorectal cancer Experimental Design: The expression levels of XPO5 were cells. These findings were confirmed in a xenograft animal model, initially assessed in three genomic datasets, followed by determi- wherein silencing of XPO5 resulted in the attenuation of tumor nation and validation of the relationship between XPO5 expres- growth. sion and clinicopathologic features in two independent colorectal Conclusions: XPO5actslikeanoncogeneincolorectal cancer patient cohorts. A functional characterization of XPO5 in cancer by regulating the expression of miRNAs and may be colorectal cancer was examined by targeted gene silencing in a potential therapeutic target in colorectal cancer.
    [Show full text]
  • A Microrna‑Related Single Nucleotide Polymorphism of the XPO5 Gene Is Associated with Survival of Small Cell Lung Cancer Patients
    BIOMEDICAL REPORTS 1: 545-548 2013 A microRNA‑related single nucleotide polymorphism of the XPO5 gene is associated with survival of small cell lung cancer patients ZHANJUN GUO1, HONGJING WANG2, YANTAO LI2, BIN LI2, CUIQIAO LI2 and CUIMIN DING2 Departments of 1Gastroenterology and Hepatology and 2Respiratory Medicine, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050011, P.R. China Received February 1, 2013; Accepted March 20, 2013 DOI: 10.3892/br.2013.92 Abstract. MicroRNA (miRNA)-related single nucleotide ~3.5 months for the limited stage group and 6 weeks for the polymorphisms (miR-SNPs) in miRNA processing machinery extensive stage group (4-6). Although genetic factors have genes affect cancer risk, treatment efficacy and patient prog- been identified as prognostic factors for SCLC, the underlying nosis. A miR-SNP of rs11077 located in the 3'UTR of miRNA mechanism of this cancer remains unknown (7-9). processing machinery gene XPO5 was examined in small MicroRNAs (miRNAs) are RNA molecules that are cell lung cancer (SCLC) patients to evaluate its association ~22 nucleotides long and are involved in various biological with cancer survival. A total of 42 patients were enrolled in processes, such as embryonic development, cell differentia- the present study and genotyped for rs11077 and survival was tion, proliferation, apoptosis, cancer development and insulin assessed using the Kaplan-Meier method, as well as univariate secretion (10,11). More than 700 miRNAs have been identified and multivariate analyses. The AA genotype of rs11077 was in humans and these miRNAs are responsible for regulating identified for its significant association with better survival at least 30% of protein-coding gene expressions (12).
    [Show full text]
  • Nucleocytoplasmic Transport: Regulatory Mechanisms and the Implications in Neurodegeneration
    International Journal of Molecular Sciences Review Nucleocytoplasmic Transport: Regulatory Mechanisms and the Implications in Neurodegeneration Baojin Ding * and Masood Sepehrimanesh Department of Biology, University of Louisiana at Lafayette, 410 East Saint Mary Boulevard, Lafayette, LA 70503, USA; [email protected] * Correspondence: [email protected] Abstract: Nucleocytoplasmic transport (NCT) across the nuclear envelope is precisely regulated in eukaryotic cells, and it plays critical roles in maintenance of cellular homeostasis. Accumulating evidence has demonstrated that dysregulations of NCT are implicated in aging and age-related neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer’s disease (AD), and Huntington disease (HD). This is an emerging research field. The molecular mechanisms underlying impaired NCT and the pathogenesis leading to neurodegener- ation are not clear. In this review, we comprehensively described the components of NCT machinery, including nuclear envelope (NE), nuclear pore complex (NPC), importins and exportins, RanGTPase and its regulators, and the regulatory mechanisms of nuclear transport of both protein and transcript cargos. Additionally, we discussed the possible molecular mechanisms of impaired NCT underlying aging and neurodegenerative diseases, such as ALS/FTD, HD, and AD. Keywords: Alzheimer’s disease; amyotrophic lateral sclerosis; Huntington disease; neurodegenera- tive diseases; nuclear pore complex; nucleocytoplasmic transport; Ran GTPase Citation: Ding, B.; Sepehrimanesh, M. Nucleocytoplasmic Transport: Regulatory Mechanisms and the Implications in Neurodegeneration. 1. Introduction Int. J. Mol. Sci. 2021, 22, 4165. As a hallmark of eukaryotic cells, the genetic materials are separated from the cyto- https://doi.org/10.3390/ijms plasmic contents by a highly regulated membrane, called nuclear envelope (NE), which 22084165 has two concentric bilayer membranes, the inner nuclear membrane (INM), and outer nuclear membrane (ONM).
    [Show full text]
  • Exportin-5 Functions As an Oncogene and a Potential Therapeutic Target in Colorectal Cancer Kunitoshi Shigeyasu1,2, Yoshinaga Okugawa1,3, Shusuke Toden1, C
    Published OnlineFirst August 23, 2016; DOI: 10.1158/1078-0432.CCR-16-1023 Biology of Human Tumors Clinical Cancer Research Exportin-5 Functions as an Oncogene and a Potential Therapeutic Target in Colorectal Cancer Kunitoshi Shigeyasu1,2, Yoshinaga Okugawa1,3, Shusuke Toden1, C. Richard Boland1, and Ajay Goel1 Abstract Purpose: Dysregulated expression of miRNAs has emerged as a Results: XPO5 is upregulated, both at mRNA and protein hallmark feature in human cancers. Exportin-5 (XPO5), a karyo- levels, in colorectal cancers compared with normal tissues. High pherin family member, is a key protein responsible for transport- XPO5 expression is associated with worse clinicopathologic fea- ing precursor miRNAs from the nucleus to the cytoplasm. tures and poor survival in colorectal cancer patient cohorts. The Although XPO5 is one of the key regulators of miRNA biogenesis, siRNA knockdown of XPO5 resulted in reduced cellular prolifer- its functional role and potential clinical significance in colorectal ation, attenuated invasion, induction of G1–S cell-cycle arrest, and cancer remains unclear. downregulation of key oncogenic miRNAs in colorectal cancer Experimental Design: The expression levels of XPO5 were cells. These findings were confirmed in a xenograft animal model, initially assessed in three genomic datasets, followed by determi- wherein silencing of XPO5 resulted in the attenuation of tumor nation and validation of the relationship between XPO5 expres- growth. sion and clinicopathologic features in two independent colorectal Conclusions: XPO5actslikeanoncogeneincolorectal cancer patient cohorts. A functional characterization of XPO5 in cancer by regulating the expression of miRNAs and may be colorectal cancer was examined by targeted gene silencing in a potential therapeutic target in colorectal cancer.
    [Show full text]
  • Regulatory Mechanism of Microrna Expression in Cancer
    International Journal of Molecular Sciences Review Regulatory Mechanism of MicroRNA Expression in Cancer Zainab Ali Syeda 1,2, Siu Semar Saratu’ Langden 1,2, Choijamts Munkhzul 1,2, Mihye Lee 1,2,* and Su Jung Song 1,2,* 1 Soonchunhyang Institute of Medi-bio Science, Soonchunhyang University, Cheonan 31151, Korea; [email protected] (Z.A.S.); [email protected] (S.S.S.L.); [email protected] (C.M.) 2 Department of Integrated Biomedical Science, Soonchunhyang University, Cheonan 31151, Korea * Correspondence: [email protected] (M.L.); [email protected] (S.J.S.) Received: 4 February 2020; Accepted: 28 February 2020; Published: 3 March 2020 Abstract: Altered gene expression is the primary molecular mechanism responsible for the pathological processes of human diseases, including cancer. MicroRNAs (miRNAs) are virtually involved at the post-transcriptional level and bind to 30 UTR of their target messenger RNA (mRNA) to suppress expression. Dysfunction of miRNAs disturbs expression of oncogenic or tumor-suppressive target genes, which is implicated in cancer pathogenesis. As such, a large number of miRNAs have been found to be downregulated or upregulated in human cancers and to function as oncomiRs or oncosuppressor miRs. Notably, the molecular mechanism underlying the dysregulation of miRNA expression in cancer has been recently uncovered. The genetic deletion or amplification and epigenetic methylation of miRNA genomic loci and the transcription factor-mediated regulation of primary miRNA often alter the landscape of miRNA expression in cancer. Dysregulation of the multiple processing steps in mature miRNA biogenesis can also cause alterations in miRNA expression in cancer. Detailed knowledge of the regulatory mechanism of miRNAs in cancer is essential for understanding its physiological role and the implications of cancer-associated dysfunction and dysregulation.
    [Show full text]
  • The RNA Binding Protein Mip6, a Novel Cellular Partner of Mex67 Export Factor with Implications in Mrna
    The RNA binding protein Mip6, a novel cellular partner of Mex67 export factor with implications in mRNA export ALBERT O MARINA MORENO, Doctor en Ciencias Bi ol ógi cas e Investigador Científico en el Instituto de Biomedicina de Va len ci a del Consejo Superior de Investigaciones Científicas Nada Mohamad INFORMA: que Jordi Donderis Martínez, Licenciado en Biología por la Universitat de València, ha realizado bajo su di r ecci ón el trabajo que con el título “Ba ses moleculares de Director: Dr. Jerónimo Bravo Sicilia la actividad señal i zado de dUTPasas” presenta para optar al grado de Doctor por la Tutor: Dr. María Adelaida García Gimeno Universitat de València. Doctoral thesis, September 2017 Va len ci a , Octubre de 2016 Doctor ado en Bioquímica y Biomedicina Depar tament de Bioquímica i Biologia Molecular Dr. Alberto Marina Moreno Bases moleculares de la actividad señalizadora de dUTPasas Jorge Donderis Martínez Tesis Doctoral 2016 Director: Dr. Alberto Marina Moreno Dr. Jerónimo Bravo Sicilia certifies that the doctoral thesis under the title “The RNA binding protein Mip6, a novel cellular partner of Mex67 export factor with implications in mRNA export” done by Ms. Nada Mohamad under his supervision in the Institute of Biomedicine of Valencia (IBV- CSIC), fulfils the requirements to obtain the PhD in Biotechnology and authorizes the request for the deposition of the final version of thesis. Valencia, July 2017 Signature: Acknowledgements Acknowledgements This journey was not without challenges, I’m thankful for every single person on the way that helped me go through it every day. To Dr. Jerónimo Bravo Sicilia, the director of my thesis, I would like to express my sincere gratitude for accepting me in your lab in the first place, for the continuous support during my PhD, for the trust, the scientific guidance and the knowledge you provided me.
    [Show full text]
  • Proteomics of Nucleocytoplasmic Partitioning
    Available online at www.sciencedirect.com ScienceDirect Proteomics of nucleocytoplasmic partitioning Thao Nguyen, Nishant Pappireddi and Martin Wu¨ hr The partitioning of the proteome between nucleus and activation. Kinase activity can also be regulated via sub- cytoplasm affects nearly every aspect of eukaryotic biology. cellular localization: cyclin B needs to relocalize into the Despite this central role, we still have a poor understanding of nucleus to induce NE breakdown, which is required for which proteins localize in the nucleus and how this varies in the transition from G2 to mitosis [3]. Considering the different cell types and conditions. Recent advances in importance of subcellular localization in encoding impor- quantitative proteomics and high-throughput imaging are tant cellular information, it is not surprising that mis- starting to close this knowledge gap. Studies on protein regulation of nuclear transport has been associated with interaction are beginning to reveal the spectrum of cargos of multiple diseases, including developmental defects and nuclear import and export receptors.We anticipate that it will cancer [4–6]. Targeting mis-regulation of NC partitioning soon be possible to predict each protein’s nucleocytoplasmic has emerged as a promising therapeutic approach, partic- localization based on its importin/exportin interactions and its ularly for cancer treatment [7–11]. estimated diffusion rate through the nuclear pore. This insight is likely to provide us with a fundamental understanding of Many previous studies have reported this subcellular how cells use nucleocytoplasmic partitioning to encode and localization of individual proteins. Recent technological relay information. advances in methods such as mass spectrometry (MS) now allow us to look at the entire proteome at once.
    [Show full text]