DOCSLIB.ORG

Cloning and Sequencing of the Pertussis Toxin Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cloning and Sequencing of the Pertussis Toxin Genes Proc. Nati. Acad. Sci. USA Vol. 83, pp. 4631-4635, July 1986 Biochemistry Cloning and sequencing of the pertussis toxin genes: Operon structure and gene duplication (bacterial toxins/Bordetella peflussis/ADP-ribosylation/trnshlaonal signals/secreted proteins) ALFREDO NICOSIA*, MARIA PERUGINI*, CARLO FRANZINI*, MARIA CRISTINA CASAGLI*, MARIA GIUSEPPINA BORRI*, GUIDO ANTONI*, MARCO ALMONIt, PAOLO NERIt, GIULIO RATTI*, AND RINO RAPPUOLI*t *Sclavo Research Center, Via Fiorentina, 1, 53100 Siena, and tCRISMA, University of Siena "Le Scotte," 53100 Siena, Italy Communicated by A. M. Pappenheimer, Jr., February 26, 1986 ABSTRACT Pertussis toxin, a protein composed of five A B different subunits (S1, S2, S3, S4, and S5), is the major virulence factor of Bordetela pertussis. We have cloned and * sequenced a DNA fragment of 4.7 kilobases that contains the SiP.~ genes coding for the 'five subunits. The genes are clustered S3C. , within 3.2 kilobases in the following order: S1, S2, SA, S5, and S3. A sequence closely resembling Escherichia coli promoters is found only before the S1 gene, and a possible termination S5S 0 S1~~~~~~~~~~~~ S4 signal is present at the end of the S3 gene, which suggests that S4 -- - S5 the pertussis toxin genes are organized in a single operon. A possible Shine-Dalgarno sequence is present before the S1 gene but not before the other four genes that 8-12 nucleotides FIG. 1. NaDodSO4/polyacrylamide gel electrophoresis of affin- upstream from the ATG codon show a new consensus sequence, ity-purified PT. The toxin in lane A has been treated with a reducing 5'TCC(T)GG3', possibly involved in the regulation'of trans- agent before loading the gel. The toxin in lane B has not been reduced. Note that although S2 and S3 have the same deduced lation. We have also found sequence homology between the S2 molecular weight (Fig. 2), they have a different mobility in and S3 genes and their protein products indicating that gene NaDodSO4/PAGE. Note also that S5 is stained rather poorly and duplication played a major role in the evolution of pertussis although its deduced molecular weight is smaller than that of S4 toxin. (Fig. 2) under reducing conditions, it migrates more slowly than S4. Pertussis toxin (PT), a protein of 105 kDa that is released into the extracellular medium by virulent (phase 1) Bordetella products of phospholipids. The variety of names given to PT pertussis (1-3), plays a major role in whooping cough (4, 5). reflects this multiplicity of effects: islet-activating protein, Purified PT is composed offive different subunits (S1, S2, S3, histamine-sensitizing factor, and lymphocytosis-promoting S4, and S5) (Fig. 1). Like other bacterial protein toxins, such factor. In addition, PT is also a mitogen and an adjuvant; it as cholera toxin, Escherichia coli heat-labile enterotoxin, releases fatty acids from fat cells, interferes with chemotactic diphtheria toxin, and pseudomonas exotoxin A (6, 7), PT can migration, changes the peripheral vascular permeability, and be divided into the following two functionally different modifies the growth pattern of CHO cells in vitro (18-20). moieties: A, which is the toxic subunit S1, and B (comprising PT is the major virulence factor of B. pertussis (4, 5), and S2, S3, S4, and S5), which is involved in binding the receptors it has been shown to induce protective levels of antibodies in on the surface of eukaryotic cells and in the translocation of animal models (20). A monoclonal antibody against PT was the toxic subunit S1 across the cell membrane. S2, S3, and S4 shown to protect mice from the challenge with virulent B. are arranged in the following two dimers: D1 (S2 and S4) and pertussis (21). Detoxified PT is a good candidate for a new D2 (S3 and S4), which are held together by S5 (3). Thus, PT acellular vaccine against pertussis (22). Manipulation of the contains a single copy of subunits S1, S2, S3, and S5 and two toxin gene by genetic engineering could be a way to produce copies of subunit S4; it is in fact the most complex bacterial large amounts of detoxified protein. As nothing was known toxin described so far. about the nature, structure, and expression ofthe PT gene(s), As described for diphtheria, cholera, and pseudomonas we have cloned and characterized it. toxins, the toxic subunit A of PT is an NAD-dependent ADP-ribosyltransferase (6, 8). The enzyme substrates are the GTP-binding protein Gi, which is involved in the receptor- MATERIALS AND METHODS mediated inhibition of adenylate cyclase (9, 10), and Strains. B. pertussis strain BP165 was obtained from the transducin, which is involved in the translocation of signals Office of Biologics, Bethesda, MD (2). The TnS mutant from the light receptor rhodopsin to a cyclic GMP phospho- BP356 (23) was obtained from Stanley Falkow. E. coli strains diesterase (11, 12). There is evidence that other GTP-binding JM101, Q359, and LE392 have been described (24, 25). proteins, also involved in the translocation of signals from Amino-Terminal Sequencing of PT Subunits. PT from 50 membrane receptors to phospholipase C, are affected by PT liters of BP165 culture supernatant was affinity purified by (13-17). PT action causes irreversible uncoupling of the Affi-Gel Blue and fetuin-Sepharose columns, as described by regulatory GTP-binding proteins from their membrane re- Sekura et al. (2). The five subunits were separated by ceptors and interferes with a variety of metabolic pathways preparative NaDodSO4/polyacrylamide gel electrophoresis having as secondary messengers cAMP and the breakdown (Fig. 1) and electroeluted (26). The amino-terminal sequences The publication costs of this article were defrayed in part by page charge Abbreviations: PT, pertussis toxin; bp, base pair(s); ORF, open payment. This article must therefore be hereby marked "advertisement" reading frame. in accordance with 18 U.S.C. §1734 solely to indicate this fact. tTo whom reprint requests should be addressed. 4631 Downloaded by guest on October 2, 2021 432 Biochemistry: Nicosia et al. Proc. Nati. Acad. Sci. USA 83 (1986) 10 30 50 70 90 110 ::9a130 150 170 190 210 230 250 270 290 310 330 350 370 390 410 430 ____450 470 490 _____ 510 530 550 -IS 570 -10 MetArgCysThrArgAlal leArgGlnThrAlaArgThr~lyTrpLeuThrTrpLeuAlaIleLeuAlaValThrAlaProValThrSerProA 610 630 650 670 690 710 8-SPS 50 8 70 8 90 9 10 93390 95 70 9 90 10 10 10 30 100507 1970 1110 1130 1150 1170 1107 129 110 1230 1250 1270 1201310 hr~h~luyr~rA~~la~g~y~aler~nMlThrorglaAsn~rqoysThroeuyshrS~erurgeSerVal~euaroer~lealeuGly~hrieuValArg~etAlajSrT~l 1450 1470 1490 1510 1530 1550 lely~la~ys~euhr~lalhArgqnlGluerpSer~luleaeAla~leTyrsp~GlyuhrgyrleGlyGly~lautyralyLyVal Ieyr~yrGlu~er~le~layrlyerPhe~spL 1690 1710 13730 1750 1770 1790 eu~y~hrhr~h~ys le~t~h~hr~gMethrolyln~p~rogLyThr~spuiSyrsyrsOFAuleuVal~eu~ro~huAgLeuLeuS lySer~HiAsfalS&ArgLUCYalaVr 1810 1830 1850 1870 1890 1910 -i hrPro.Valrgeraly~lenPro~alnI~GluAln~yThr~l~slyerProT~rsCyrSly~rgrpCys~aet~yTyrArg~Leu~hr9LYSMatlCuTLeuI1TrVclyer1AspG1YI1 2050 20752902601130 21350 21570 qphlu~r~ouhArg~HiraThrAlarogllGly~r~rleyAla~rgurgSrAspgVy1ArgAaLUyarPLeulOl~uA1rSeyGlyA~al~et~hs~isplerProlyyAla~heAspL~V 2290 2310 2330 2350 2370 2390 2410 2430 2450 2470 2490 2510 al~e~a~rgarly~n~r~allely~a~y~hrerro~r~s~lyysyr~p~eMeTyrn~gGeAArgyLeuPFOLLysAetAeulyr~eule~~TyralCAl&SlyIleS 2530 2550 2570 2590 2610 2630 CysaleurA~alHis~etSer~yGlurgCrlCula1ArgyAspayCYlCuSAspAlaG1hr iGlu~hriyAlspThrG~rplhe~s~r~et~eu~lyPro~ly erSer~Leuys~lane 275 2702790 2810 2830 2850280 LysherohArgI~AaThrVCl~rGlySPClPnOTyrlylrOg1Yrg~rOrg1Y~g~aeASrULG1laUGrfLeueula~SeroleuAln~yTyr~is~Lu~ernd l~'~lis~~ 287 290292102930 2950 2970 299 aLeuo~yr~ly~eutarqThrAlasn~etalVAlahro~yerVal laet~ysPro~yr~lualeurPeroThrlnglntLyuyala~ysGly~lAla~ysarosneGly~hAlAla~laeu 313 210 23170 23190 23210 32390 rCAGCCCGlueACGCGCysACGGCGluLCTCuGCCAGCTCChGTCCLGUCAGClfTCCCAhGGFOGlrPeIeTyCAyeTyr=CGGCCTCThrTGCAAAACGCyCGClTyGlyGCATGTTT rer~roAspAla~risralyrolalysPhel ly~ysArpLeu~h~eyslrgroly~er~h~eyr~rysthGly~aln~tLeArAla~asPhe etyrnyrnergysraLeAlarg~ergLe 3370 3390 3410 3430 3450 3470 u~eula~rmrsn~e~rgeu~s~l~al~e~a~rgsp~l~lner~llMetClyAra~lnAla~errlyeuroGeuG~ysAlg~srgoMet~iThr~leAla~eurgle uClroySslneuhPheou~yiyarAla~e~ue~e~rglt~leCys~ernd'tslnbpWsro 3730 3750 3770 3790 381230 3850 3870 3897310 3930 3950 3970 3990 28__410 4030 4050 4070 4090 4110 413250 4170 4190 4210 4230 4250 4270 4290 43110 4330 4350 43170 43190 4410 4430 I3250 32~~470 4490 4510 4530 4550 4570 4590 34610 34630 34650 34670 4690ACCACGACTCCGTTCTAGAGGATGTACGACTCCACCTTAGCGGAAAAAGAGCCCGGC uATeuGACGerhAsneAgeTsl~lh~l~gs~yl~ra~el~a~sl~rr~rl~yr~rCgs~ty~pl~ur~ FIG. 2. Nucleotide sequence ofthe EcoRI fragment containing the five genes coding for PT. The deduced amino acid sequence ofthe five subunits of PT is reported. The arrows below the amino acid sequences indicate the beginning of the mature subunits, as identified by comparison with the amino-terminal sequences. In the case ofS5, the arrow indicates the putative beginning ofthe mature subunit. Before the sequences ofeach subunit, we report the amino acid sequence ofthe putative signal peptides. Upstream from the gene coding for S1, the proposed promoter sequence and the putative Shine-Dalgarno sequences are boxed. The sequence TCC(T)GG before the S2, S3, S4, and S5 genes is also boxed. At the end of the gene codingfor subunit S3, the arrows above the nucleotide sequence indicate the inverted repeat followed by the stretch ofthymidines (underlined), which is a possible transcription termination site. The beginning of four ORFs having the same codon usage of the PT genes are indicated. The molecular weights deduced for the five subunits are the following: S1, 26,220; S2, 21,920; S3, 21,860; S4, 12,060; S5, 10,940. Downloaded by guest on October 2, 2021 Biochemistry: Nicosia et al. Proc. Natl. Acad. Sci. USA 83 (1986) 4633 were determined using the 470-A gas-phase microsequencer amino acid composition of the deduced polypeptides are (Applied Biosystems, Foster City, CA).
Load more

Recommended publications
  • Pertussis Toxin
    Pertussis Toxin Publication Number MAN0004270 Revision Date 09 May 2011 Catalog Number: PHZ1174 Quantity: 50 μg Lot Number: See product label. Appearance: Lyophilized solid. Origin: Bordetella pertussis. Purity: >99%. This preparation migrates as five distinct bands when analyzed by SDS–Urea PAGE. The five bands correspond to one A protomer subunit, designated S1 (Mr=26.2 kDa), and four B oligomer subunits, designated S2- S5 (Mr’s= 21.9, 21.9, 12.1, and 10.9 kDa, respectively). Summary: Islet-activating protein Pertussis toxin consists of an A protomer subunit (S1) which possesses both NAD+ glycohydrolase and ADP–ribosyltransferase activities, and B oligomer subunits (S2, S3, S4, and S5) which are responsible for attachment of the native toxin to eukaryotic cell surfaces. Pertussis toxin uncouples G proteins from receptors by ADP ribosylating a cysteine residue near the carboxyl terminus of the α subunit. Biological Activity: The lowest concentration which produces a clustered growth pattern with CHO cells is 0.03 ng/mL. The adenylate cyclase activity of this preparation is 20.1 picomoles/minute/μg in the presence of 1 μg calmodulin. Reconstitution Reconstitute the contents of this vial with 500 μL sterile, distilled water. The composition of the solution will be Recommendation: 50 μg Pertussis toxin, 10 mM sodium phosphate, pH 7.0, 50 mM sodium chloride. Because Pertussis toxin is relatively insoluble, the resulting suspension should be made uniform by gentle mixing prior to withdrawing aliquots. It is important to note that this suspension should not be sterile-filtered. This preparation is not activated. For use with intact cells or extracts, activation is not necessary.
    [Show full text]
  • Biological Toxins Fact Sheet
    Work with FACT SHEET Biological Toxins The University of Utah Institutional Biosafety Committee (IBC) reviews registrations for work with, possession of, use of, and transfer of acute biological toxins (mammalian LD50 <100 µg/kg body weight) or toxins that fall under the Federal Select Agent Guidelines, as well as the organisms, both natural and recombinant, which produce these toxins Toxins Requiring IBC Registration Laboratory Practices Guidelines for working with biological toxins can be found The following toxins require registration with the IBC. The list in Appendix I of the Biosafety in Microbiological and is not comprehensive. Any toxin with an LD50 greater than 100 µg/kg body weight, or on the select agent list requires Biomedical Laboratories registration. Principal investigators should confirm whether or (http://www.cdc.gov/biosafety/publications/bmbl5/i not the toxins they propose to work with require IBC ndex.htm). These are summarized below. registration by contacting the OEHS Biosafety Officer at [email protected] or 801-581-6590. Routine operations with dilute toxin solutions are Abrin conducted using Biosafety Level 2 (BSL2) practices and Aflatoxin these must be detailed in the IBC protocol and will be Bacillus anthracis edema factor verified during the inspection by OEHS staff prior to IBC Bacillus anthracis lethal toxin Botulinum neurotoxins approval. BSL2 Inspection checklists can be found here Brevetoxin (http://oehs.utah.edu/research-safety/biosafety/ Cholera toxin biosafety-laboratory-audits). All personnel working with Clostridium difficile toxin biological toxins or accessing a toxin laboratory must be Clostridium perfringens toxins Conotoxins trained in the theory and practice of the toxins to be used, Dendrotoxin (DTX) with special emphasis on the nature of the hazards Diacetoxyscirpenol (DAS) associated with laboratory operations and should be Diphtheria toxin familiar with the signs and symptoms of toxin exposure.
    [Show full text]
  • Pertussis Toxin
    PLEASE POST THIS PAGE IN AREAS WHERE PERTUSSIS TOXIN IS USED IN RESEARCH LABORATORIES UNIVERSITY OF CALIFORNIA, SAN FRANCISCO ENVIRONMENT, HEALTH AND SAFETY/BIOSAFETY PERTUSSIS TOXIN EXPOSURE/INJURY RESPONSE PROTOCOL Organism or Agent: Pertussis Toxin Exposure Risk; Multiple Endocrine/Metabolic Effects Exposure Hotline Pager: 415/353-7842 (353-STIC) (Available 24 hours) Office of Environment, Health & Safety: 415/476-1300 (Available during work hours) 415/476-1414 or 9-911 (In case of emergency, available 24 hours) EH&S Biosafety Officer 415/514-2824 EH&S Public Health Officer: 415/514-3531 UCSF Occupational Health Services: 415/885-7580 (Available during work hours) California Poison Control: 800/222-1222 SFDPH Emergency Number: 415/554-2830 CDC Emergency Operations: 770/488-7100 _________________________________________________________________________ PROTOCOL SUMMARY In the event of an accidental exposure or injury, the protocol is as follows: 1. Modes of Exposure: a. Skin puncture or injection b. Ingestion c. Contact with mucous membranes (eyes, nose, mouth) d. Contact with non-intact skin e. Exposure to aerosols f. Respiratory exposure from inhalation of toxin 2. First Aid: a. Skin Exposure, immediately go to the sink and thoroughly wash the skin with soap and water. If working with pertussis, decontaminate any exposed skin with an antiseptic scrub solution. b. Skin Wound, immediately go to the sink and thoroughly wash the wound with soap and water and pat dry. c. Splash to Eye(s), Nose or Mouth, immediately flush the area with running water for at least 5- 10 minutes. d. Splash Affecting Garments, remove garments that may have become soiled or contaminated and place them in a double red plastic bag.
    [Show full text]
  • Human Peptides -Defensin-1 and -5 Inhibit Pertussis Toxin
    toxins Article Human Peptides α-Defensin-1 and -5 Inhibit Pertussis Toxin Carolin Kling 1, Arto T. Pulliainen 2, Holger Barth 1 and Katharina Ernst 1,* 1 Institute of Pharmacology and Toxicology, Ulm University Medical Center, 89081 Ulm, Germany; [email protected] (C.K.); [email protected] (H.B.) 2 Institute of Biomedicine, Research Unit for Infection and Immunity, University of Turku, FI-20520 Turku, Finland; arto.pulliainen@utu.fi * Correspondence: [email protected] Abstract: Bordetella pertussis causes the severe childhood disease whooping cough, by releasing several toxins, including pertussis toxin (PT) as a major virulence factor. PT is an AB5-type toxin, and consists of the enzymatic A-subunit PTS1 and five B-subunits, which facilitate binding to cells and transport of PTS1 into the cytosol. PTS1 ADP-ribosylates α-subunits of inhibitory G-proteins (Gαi) in the cytosol, which leads to disturbed cAMP signaling. Since PT is crucial for causing severe courses of disease, our aim is to identify new inhibitors against PT, to provide starting points for novel therapeutic approaches. Here, we investigated the effect of human antimicrobial peptides of the defensin family on PT. We demonstrated that PTS1 enzyme activity in vitro was inhibited by α-defensin-1 and -5, but not β-defensin-1. The amount of ADP-ribosylated Gαi was significantly reduced in PT-treated cells, in the presence of α-defensin-1 and -5. Moreover, both α-defensins decreased PT-mediated effects on cAMP signaling in the living cell-based interference in the Gαi- mediated signal transduction (iGIST) assay.
    [Show full text]
  • Release of Pertussis Toxin and Its Interaction with Outer-Membrane Antigens
    Journal of General Microbiology (1987), 133, 2427-2435. Printed in Great Britain 2427 Release of Pertussis Toxin and Its Interaction With Outer-membrane Antigens ByV. Y. PERERA, A. C. WARDLAW AND J. H. FREER* Department of Microbiology, University of Glasgow, Alexander Stone Building, Garscube Estate, Bearsden, Glasgow G61 IQH, UK (Received 16 December 1986 ;revised 22 April 1987) The absence of subunit S3 in cell-associated pertussis toxin (PT) from a mutant of Bordetella pertussis which failed to produce cell-free toxin suggested that this subunit was involved in the release of PT into the culture medium. The addition of methylated P-cyclodextrin (MCD) to the culture medium caused a small but consistent increase in the release of lipopolysaccharide (LPS) by four wild-type strains of B. pertussis. Since previous studies have shown that MCD also enhances the levels of PT in culture supernates, it seemed probable that the increased shedding of outer-membrane vesicles (OMV) may explain the increased levels of both cell-free PT and LPS. Release of PT was inhibited in media buffered with HEPES but was unaffected in Tris/HCl buffer. This suggested that in addition to shedding of the outer membrane, increased permeability and greater destabilization of the outer membrane, as caused by Tris/HCl buffer, may be important in the release of PT. Our data do not support the idea that PT is packaged into OMV because only an insignificant proportion (0.01 %) of the total cell-free PT was associated with LPS. The association of PT with small micelles derived from outer-membrane amphiphiles may be more important since the LPS content of PT purified from culture supernates (containing no large OMV) was nearly 18% by weight.
    [Show full text]
  • Safe Handling of Acutely Toxic Chemicals Safe Handling of Acutely
    Safe Handling of Acutely Toxic Chemicals , Mutagens, Teratogens and Reproductive Toxins October 12, 2011 BSBy Sco ttBthlltt Batcheller R&D Manager Milwaukee WI Hazards Classes for Chemicals Flammables • Risk of ignition in air when in contact with common energy sources Corrosives • Generally destructive to materials and tissues Energetic and Reactive Materials • Sudden release of destructive energy possible (e.g. fire, heat, pressure) Toxic Substances • Interaction with cells and organs may lead to tissue damage • EfftEffects are t tilltypically not general ltllti to all tissues, bttbut target tdted to specifi c ones • Examples: – Cancers – Organ diseases – Inflammation, skin rashes – Debilitation from long-term Poison Acute Cancer, health or accumulation with delayed (ingestion) risk reproductive risk emergence 2 Toxic Substances Are All Around Us Pollutants Natural toxins • Cigare tte smo ke • V(kidbt)Venoms (snakes, spiders, bees, etc.) • Automotive exhaust • Poison ivy Common Chemicals • Botulinum toxin • Pesticides • Ricin • Fluorescent lights (mercury) • Radon gas • Asbestos insulation • Arsenic and heavy metals • BPA ((pBisphenol A used in some in ground water plastics) 3 Application at UNL Chemicals in Chemistry Labs Toxin-producing Microorganisms • Chloro form • FiFungi • Formaldehyde • Staphylococcus species • Acetonitrile • Shiga-toxin from E. coli • Benzene Select Agent Toxins (see register) • Sodium azide • Botulinum neurotoxins • Osmium/arsenic/cadmium salts • T-2 toxin Chemicals in Biology Labs • Tetrodotoxin • Phenol
    [Show full text]
  • Cellular Activity of Salmonella Typhimurium Artab Toxin and Its Receptor-Binding Subunit
    toxins Article Cellular Activity of Salmonella Typhimurium ArtAB Toxin and Its Receptor-Binding Subunit Elise Overgaard 1, Brad Morris 2, Omid Mohammad Mousa 2 , Emily Price 3, Adriana Rodriguez 2, Leyla Cufurovic 2, Richard S. Beard 4 and Juliette K. Tinker 1,2,* 1 Biomolecular Sciences Graduate Program, Boise State University, Boise, ID 83725, USA; [email protected] 2 Department of Biology, Boise State University, Boise, ID 83725, USA; [email protected] (B.M.); [email protected] (O.M.M.); [email protected] (A.R.); [email protected] (L.C.) 3 Idaho Veterans Research and Education Foundation, Infectious Diseases Section, Boise, ID 83702, USA; [email protected] 4 Biomolecular Research Center, Boise State University, Boise, ID 83725, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-208-426-5472 Abstract: Salmonellosis is among the most reported foodborne illnesses in the United States. The Salmonella enterica Typhimurium DT104 phage type, which is associated with multidrug-resistant disease in humans and animals, possesses an ADP-ribosylating toxin called ArtAB. Full-length artAB has been found on a number of broad-host-range non-typhoidal Salmonella species and serovars. ArtAB is also homologous to many AB5 toxins from diverse Gram-negative pathogens, including cholera toxin (CT) and pertussis toxin (PT), and may be involved in Salmonella pathogenesis, however, in vitro cellular toxicity of ArtAB has not been characterized. artAB was cloned into E. coli and initially isolated using a histidine tag (ArtABHIS) and nickel chromatography. ArtABHIS was found to bind to African green monkey kidney epithelial (Vero) cells using confocal microscopy and to Citation: Overgaard, E.; Morris, B.; interact with glycans present on fetuin and monosialotetrahexosylganglioside (GM1) using ELISA.
    [Show full text]
  • Intracerebroventricular Antisense Knockdown of Gαi2 Results in Ciliary
    BMC Neuroscience BioMed Central Research article Open Access α Intracerebroventricular antisense knockdown of G i2 results in ciliary stasis and ventricular dilatation in the rat Kati S Mönkkönen*1, Juhana M Hakumäki2, Robert A Hirst3, Riitta A Miettinen4, Christopher O'Callaghan3, Pekka T Männistö5 and Jarmo T Laitinen6 Address: 1Department of Pharmacology & Toxicology, University of Kuopio, Kuopio, FIN-70211, Finland, 2Department of Biomedical NMR, National Bio-NMR Facility, A.I. Virtanen Institute for Molecular Sciences, University of Kuopio, Kuopio, FIN-70211, Finland, 3Department of Infection, Immunity and Inflammation, University of Leicester, Leicester LE2 7LX, UK, 4Department of Neuroscience and Neurology, University of Kuopio, Finland and Department of Neurology, Kuopio University Hospital, Kuopio, FIN-70211, Finland, 5Division of Pharmacology & Toxicology, University of Helsinki, Helsinki, FIN-00014, Finland and 6Institute of Biomedicine, University of Kuopio, Kuopio, FIN-70211, Finland Email: Kati S Mönkkönen* - [email protected]; Juhana M Hakumäki - [email protected]; Robert A Hirst - [email protected]; Riitta A Miettinen - [email protected]; Christopher O'Callaghan - [email protected]; Pekka T Männistö - [email protected]; Jarmo T Laitinen - [email protected] * Corresponding author Published: 12 April 2007 Received: 7 September 2006 Accepted: 12 April 2007 BMC Neuroscience 2007, 8:26 doi:10.1186/1471-2202-8-26 This article is available from: http://www.biomedcentral.com/1471-2202/8/26 © 2007 Mönkkönen et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
    [Show full text]
  • Differential Cholera-Toxin- and Pertussis-Toxin-Catalysed ADP-Ribosylation of G-Proteins Coupled to Formyl-Peptide and Leukotriene B4 Receptors Theresa M
    Biochem. J. Biochem. J. (1(1993)993) 289, 469-473 (Printed in Great Britain) 469 Differential cholera-toxin- and pertussis-toxin-catalysed ADP-ribosylation of G-proteins coupled to formyl-peptide and leukotriene B4 receptors Theresa M. SCHEPERS* and Kenneth R. McLEISHt Departments of Medicine and Biochemistry, University of Louisville Health Sciences Center and the Veterans Administration Medical Center, Louisville, KY 40292, U.S.A. N-Formylmethionyl-leucyl-phenylalanine (fMet-Leu-Phe) and imido]triphosphate and GDP in a concentration-dependent leukotriene B4 (LTB4) induce disparate second-messenger manner. Addition of fMet-Leu-Phe, but not LTB4, re-established generation and functional responses in neutrophils and HL-60 cholera-toxin labelling of a40 in the presence of either guanine granulocytes. Receptors for these chemoattractants couple to a nucleotide. In the absence of guanine nucleotides, fMet-Leu-Phe common pool of G-proteins which are substrates for both and C5a enhanced cholera-toxin-catalysed labelling of cc40, pertussis-toxin- and cholera-toxin-catalysed ADP-ribosylation. whereas LTB4 and platelet-activating factor had no effect. The hypothesis that formyl-peptide and LTB4 receptors induce Preincubation with fMet-Leu-Phe, but not LTB4, inhibited different receptor-specific conformations of activated G- pertussis-toxin labelling of a40 in the presence of guanosine 5'- proteins was tested. The ability of pertussis toxin and cholera [y-thio]triphosphate and in the absence of guanine nucleotides. toxin to ADP-ribosylate Gi proteins coupled to formyl-peptide Preincubation with fMet-Leu-Phe or LTB4 enhanced pertussis- or LTB4 receptors in membranes isolated from HL-60 toxin labelling of a40 in the presence of GDP.
    [Show full text]
  • Bordetella Virulence Factors
    Product Information Bordetella Virulence Factors Filamentous hemagglutinin (FHA) & Fimbriae 2/3 (Fim) The initial step in establishing a Bordetella pertussis infection is attachment of the bacteria to the epithelial lining of the host respiratory tract. Two B. pertussis virulence factors are key in this process, filamentous hemagglutinin (FHA)1 and fimbriae (Fim).2 FHA, which is both surface-associated and secreted by B. pertussis, is a multifunctional protein which promotes the attachment of the bacteria through several binding domains. Because FHA is highly immunogenic, it is included in many of the acellular vaccines. Additionally, FHA acts through multiple pathways to modulate the host immune response; an example of this type of activity is induction in macrophages of the secretion of both pro-inflammatory and anti-inflammatory cytokines.3,4 Fimbriae are extracellular proteins which, like FHA, participate in the attachment of bacteria to substrates. Based on their recognition by specific antisera, there are two fimbriae serotypes present in B. pertussis, fimbriae 2 (Fim 2) and fimbriae 3 (Fim 3).5 Both FHA, a large, 220 kDa -helical protein, and Fim 2/3 are produced by List Labs. FHA is from the native Bordetella pertussis strain 165 and the Fim 2/3 is isolated from cultures of a Pertactin (PRN) negative mutant derived from the Bordetella pertussis Wellcome strain 28 expressing a mixture of fimbriae 2 and fimbriae 3. Fimbriae are long structures which serve to tether the bacteria to surfaces. They are composed of subunits which dissociate in SDS producing components with apparent molecular weights of 22,500 and 22,000 Da for Fim 2 and Fim 3, respectively.5 Pertactin (PRN) and Lipopolysaccharide (LPS) Virulence factors located on the surface of Bordetella pertussis include pertactin and LPS.
    [Show full text]
  • The Immunological Basis for Immunization Series: Module 4: Pertussis (Immunological Basis for Immunization Series ; Module 4)
    WHO Immunological Basis for Immunization Series Module 4: Pertussis Update 2017 Department of Immunization, Vaccines and Biologicals World Health Organization 20, Avenue Appia CH-1211 Geneva 27, Switzerland [email protected] http://www.who.int/immunization/en/ Immunization, Vaccines and Biologicals The immunological basis for immunization series: module 4: pertussis (Immunological basis for immunization series ; module 4) ISBN 978-92-4-151317-3 © World Health Organization 2017 Some rights reserved. This work is available under the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 IGO licence (CC BY-NC-SA 3.0 IGO; https://creativecommons.org/licenses/by-nc-sa/3.0/igo). Under the terms of this licence, you may copy, redistribute and adapt the work for non-commercial purposes, provided the work is appropriately cited, as indicated below. In any use of this work, there should be no suggestion that WHO endorses any specific organization, products or services. The use of the WHO logo is not permitted. If you adapt the work, then you must license your work under the same or equivalent Creative Commons licence. If you create a translation of this work, you should add the following disclaimer along with the suggested citation: “This translation was not created by the World Health Organization (WHO). WHO is not responsible for the content or accuracy of this translation. The original English edition shall be the binding and authentic edition”. Any mediation relating to disputes arising under the licence shall be conducted in accordance with the mediation rules of the World Intellectual Property Organization. Suggested citation. The immunological basis for immunization series: module 4: pertussis.
    [Show full text]
  • Toxin Instability and Its Role in Toxin Translocation from the Endoplasmic Reticulum to the Cytosol
    Biomolecules 2013, 3, 997-1029; doi:10.3390/biom3040997 OPEN ACCESS biomolecules ISSN 2218-273X www.mdpi.com/journal/biomolecules/ Review Toxin Instability and Its Role in Toxin Translocation from the Endoplasmic Reticulum to the Cytosol Ken Teter Burnett School of Biomedical Sciences, College of Medicine, University of Central Florida, 12722 Research Parkway, Orlando, FL 32826, USA; E-Mail: [email protected]; Tel.: +1-407-882-2247; Fax: +1-407-384-2062 Received: 4 November 2013; in revised form: 26 November 2013 / Accepted: 27 November 2013 / Published: 10 December 2013 Abstract: AB toxins enter a host cell by receptor-mediated endocytosis. The catalytic A chain then crosses the endosome or endoplasmic reticulum (ER) membrane to reach its cytosolic target. Dissociation of the A chain from the cell-binding B chain occurs before or during translocation to the cytosol, and only the A chain enters the cytosol. In some cases, AB subunit dissociation is facilitated by the unique physiology and function of the ER. The A chains of these ER-translocating toxins are stable within the architecture of the AB holotoxin, but toxin disassembly results in spontaneous or assisted unfolding of the isolated A chain. This unfolding event places the A chain in a translocation-competent conformation that promotes its export to the cytosol through the quality control mechanism of ER-associated degradation. A lack of lysine residues for ubiquitin conjugation protects the exported A chain from degradation by the ubiquitin-proteasome system, and an interaction with host factors allows the cytosolic toxin to regain a folded, active state. The intrinsic instability of the toxin A chain thus influences multiple steps of the intoxication process.
    [Show full text]