A the Isolates Were Investigated Previously by PCR of the Maxicircle Divergent Region 20

Table 1 geographical strain designation (WHO-code) life cycle mono mono mono mono mono mono di 3 di 1 di 1 di 2 tri tri 2 tetra penta origin stage 1 tr 1 300 1 320 2 375 400 g 3 450 514 573 642 680 ~900 ~1000 ~1200 ~1500 MRHO/SU/59/P a pm-1 ● h MHOM/SU/73/5ASKH a, b, c, i pm-1 ● h Central Asia MRHO/TR/95/T9501 d pm-1 ● MRHO/UZ/87/BK-45 d pm-1 ● pm-1 ● h ○ ○ MHOM/UZ/87/BUR a, c am ● h ○ MRHO/UZ/87/KK-45 d pm-1 ● MRHO/UZ/87/KD525 d pm-1 ● MHOM/UZ/98/Isv M-01h a, c, e pm-1 ● MHOM/UZ/98/Isv M-08h c, d pm-1 ● MHOM/UZ/98/Isv M-09h c, d pm-1 ● pm-1 ● MHOM/UZ/2002/Isv M-10h c, d am ● ○ pm-1 ● MHOM/UZ/2002/Isv M-12h c, d am ● pm-1 ● MHOM/UZ/2002/Isv M-26h c, d am ● pm-1 ● ○ ○ MHOM/UZ/2002/Isv M-27h c, d am ● pm-1 ● MHOM/UZ/2002/Isv M-29h c, d am ● pm-1 ○ ● h ○ MHOM/UZ/2003/Isv T-03h a, c am ○ ● h MRHO/UZ/2003/Isv T-44g a, c pm-1 ● Iran MRHO/IR/76/Vaccine-strain a, c pm-1 ● Iraq MHOM/IQ/86/BH012 a, c, i pm-1 ● MHOM/IL/67/JerichoII (LRC-137) a, b, c pm-1 ● ○ MHOM/IL/80/Friedlin a, b, c pm-1 ● h ○ Israel MPSM/IL/83/LRC-L357 a, e pm-1 ● ● ● ○ pm-1 ● pm-1 ● ● ● ● ● ● ○ ○ ○ IPAP/IL/84/UVDA (LRC-465) a, b, c pm-1 ○ ● h IPAP/IL/98/LRC-L464 a, b, c, e pm-1 ● ○ IPAP/IL/98/LRC-L464 a, b, c, e pm-1 ● ● ● • ● ● ● ○ ○ ○ IPAP/IL/98/LRC-L746 a, c pm-1 ○ ● h pm-1 ● h MHOM/IL/2002/LRC-L943 a am ○ ● h pm-1 ○ ○ ● h MHOM/IL/2003/LRC-L949 a, c am ○ ● h pm-1 ● ● ● h ● ● ● ○ ○ ○ MHOM/IL/2003/LRC-L952 a, c, f, i am ● h Egypt IPAP/EG/89/RTC-13 a, b, c pm-1 ● h ○ ○ MMER/SA/84/JISH-233 a pm-1 ○ ○ ● MPSM/SA/84/JISH-244 a pm-1 ○ ○ ● Saudi pm-1 ○ ○ ○ ● MPSM/SA/89/SABIR-1 a, c, i Arabia Africa MTAT/KE/5?/T4 (LRC-119) b, c pm-1 ○ ○ ● MTAT/KE/8?/NLB089A (LRC-456) b, c pm-1 ● ● ○ MHOM/TN/94/GLC7 a, c pm-1 ○ ○ ● MHOM/TN/97/LPN162 a, c pm-1 ○ ○ ● MHOM/MA/95/LEM2983 a, c pm-1 ○ ○ ● MHOM/BF/96/LIPA538 a, c pm-1 ● ● ● ○ MHOM/DZ/98/LPS13 a, c pm-1 ○ ○ ●

Variants of the marker fragment in isolates from various geographical regions. Most isolates are represented by non-clonal promastigotes (pm-1) cultured in the

biphasic NNN-199 medium supplemented with blood. Some isolates are also represented by lesion-derived amastigote samples from hamsters (am) obtained by

Strelkova (unpublished) and Flegontov et al. [20]. Abundant variants are indicated by black circles, rare variants by white circles, variants with nonstable frequency, which are abundant in some culture samples and rare in others, are indicated by small black circles. MHOM, strains isolated from humans; MRHO, MPSM, MMER, from rodents Rhombomys opimus, Psammomys obesus, and Meriones libicus, respectively; IPAP, from sandflies Phlebotomus papatasi. a the isolates were investigated previously by PCR of the maxicircle divergent region [20]. b the isolates were investigated previously by PCR and sequencing of six nuclear genomic targets including ribosomal internal transcribed spacers [26]. c the isolates were investigated previously by multilocus microsattelite typing [27]. d the isolates were obtained by Strelkova (unpublished). e the isolates passed through an experimental life cycle as non-clonal cultures (Supplementary material, table 3). f the isolate was a source of all clonal cultures in this work. g unclassified (unsequenced) length variant. h sequences of the indicated variants were obtained in [20]. i the isolates were analyzed by PCR of maxicircle coding sequences (Supplementary material, table 6) and by sequencing of the cytochrome b gene (Supplementary material, alignment 2). Table 2

isolate stage hamster weeks after mono mono 1 mono 1 mono 2 mono 3 di 3 di 1 di 1 di 2 tri tri 2 tetra penta No. inf./passages 1 tr 300 320 375 450 514 573 642 680 ~900 ~1000 ~1200 ~1500 MHOM/UZ/98/Is pm-1 ● ○ am 1 2 ● ○ v M-01h pm-2 1 pas 2-8 ● ○ pm-2 1 pas 9 ● ○ ○ pm-2 1 pas 12 ● ○ am 2 3 ● ○ am 3 5* ● ○ pm-2 3 pas 2-6 ● ○ pm-2 3 pas 7-10 ● ○ ○ am 4 6* ● ○ am 5 9* ● MPSM/IL/83/LR pm-1 ● ● ● ● ● ● long variants am 1 5 ○ ○ ● ● ● ○ ○ long variants C-L357 pm-2 1 pas 2-11 ○ ○ ● ● ● ● long variants am 2 a 10 ○ ○ ○ ● ● am 3 11 ● ○ ○ ● ○ ○ am 4 11 ● ○ ○ ○ ○ am 5 11 ○ ○ ○ ● am 6 a 11 ● ● ● am 7 11 ○ ● ○ am 8 11 ○ ○ ○ ● ○ am 9 11 ● ● ● ○ ○ ○ MPSM/IL/83/LR pm-1 ● ● ● ● ● ● long variants am 1 13 ● ● ○ ○ ○ C-L357 am 2 16 ● ● ○ attenuated am 3 16 ○ ● ○ ○ pm-2 3 pas 2 ● ● ● ● ○ ○ long variants pm-2 3 pas 3-10 ● ● ● ● ● ● long variants am 4 16 ○ ● IPAP/IL/98/LRC pm-1 ○ ○ ● ● ● ● ● long variants am 1 4 ○ ● ○ ○ ○ ○ long variants -L464 pm-2 1 pas 2 ○ ○ ● ○ ● ● ● long variants pm-2 1 pas 6 ● ● ○ ● ● ● long variants pm-2 1 pas 10 ○ ○ ● ● ● ● ● long variants pm-2 1 pas 11 ● ● ○ ○ ● ● ● long variants am 2 7 ● ● ○ ○ am 3 10 ● ● ● ○ ○ ○ ○ long variants am 4 10 ● ● ○ am 5 11* ○ ● ● ○ ○ ○ ○ long variants pm-2 5 pas 2 ○ ○ ○ ● ● ● long variants pm-2 5 pas 6 ○ ○ ○ ● ● ● long variants pm-2 5 pas 7 ○ ○ ● ○ ○ ● ● ● long variants pm-2 5 pas 11 ○ ○ ○ ● ● ● long variants am 6 11* ● Variants of the marker fragment in the course of the experimental life cycle with non-clonal isolates: promastigotes (pm-1, NNN-199 medium) – amastigotes (am,

lesion) – promastigotes (pm-2, NNN-199 medium). Abundant variants are indicated by black circles, rare variants by white circles. Time span between infection and

taking of samples is indicated as weeks after infection; culture age expressed in number of passages is indicated for promastigotes (weeks after inf./passages).

Samples from ulcerated lesions are marked by an asterisk. If PCR patterns are identical in lesion-derived promastigotes at successive passages, a range of sampled

passages is given. In some cases abundance of tri-, tetra-, and pentameric variants was not analyzed in detail due to non-optimal PCR conditions, and they are

collectively identified as “long variants”.

a the samples were analyzed by PCR of maxicircle coding sequences (Supplementary material, table 6) and by sequencing of the cytochrome b gene (Supplementary

material, alignment 2). Table 3

clone stage hamster weeks after mono 1 tr mono 1 mono 1 mono 2 mono 3 di 3 di 1 di 1 di 2 tri tri 2 tetra penta No. inf./passages 300 320 375 450 514 573 642 680 ~900 ~1000 ~1200 ~1500 1H2 pm-1 ● ● ● ● ● ● long variants EU588996 EU588995 EU589003 EU589014 3A3 pm-1 ● ● ● ● ● ● long variants 4B4 pm-1 ● ● ● ● ● ● long variants EU589005 EU589015 EU589016 am 1 17 a ● EU589006 am 1 17 a ● ○ ○ ○ am 2 17 ● ○ ○ ○ am 2 17 ○ ○ ● EU589022 am 3 17 ○ ● ● ○ am 3 17 a PCR-negative 5A11 pm-1 ● ● ● EU589012 ● ● ● long variants EU588997 EU588999 EU589004 EU589017 EU589020 tetra: EU589043, EU589044 am 1 17 ● ○ ○ EU589000 EU589013 am 1 17 a ● ○ ○ am 2 17 ○ ● am 2 17 a ● ○ ○ ○ 5C12 pm-1 ● ● ● ● ● ● long variants am 1 17 a ● ○ ○ ○ am 1 17 ● ○ ○ ● ○ am 2 17 ● am 2 17 ● am 3 17 a ● ○ ○ ○ am 3 17 ● ○ ○ ○ 7C7 pm-1 ● ● ● ● ● ● long variants 7D4 pm-1 ● ● ● ● ● ● long variants am 1 24 a PCR-negative am 1 24 a PCR-negative am 2 24 a ● ○ ○ ○ am 2 24 a ● ○ am 3 27 ○ ● ● ○ am 3 27 a PCR-negative 7G3 pm-1 EU588993 ● ● ● EU589011 ● ● ● long variants EU588998 EU589007 EU589018 am 1 15 ○ ○ ● ○ ○ ○ long variants pm-2 1 pas 1 ○ ● ○ long variants EU589019 pm-2 1 pas 2-10 ● ● ● ● ● ● long variants am 2 24 a ● ○ ○ ○ ○ ○ ○ EU588994 EU589039 EU589040 am 2 24 a ○ ● am 3 24 a ● ○ ○ am 3 24 a ● ○ ○ 7G4 pm-1 ● ● ● ● ● ● long variants 7H1 pm-1 ● ● ● ● ● ● long variants 7H12 pm-1 ● ● ● ● ● EU589033 EU589002 EU589034- EU589038 10A2 pm-1 ○ ○ ● ● ● EU589008 EU589021 EU589026 am 1 9 ● ● ○ ○ ○ ○ ○ pm-2 1 pas 1 ● am 1 9 a ○ ○ ● am a 2 12 ○ ● pm-2 2 pas 1 ○ ● ○ ○ ○ EU589009 EU589023 am 2 12 a PCR-negative am 3 16 a ● am 3 16 a ● 11A2 pm-1 ○ ● EU589024 am 1 6 ○ ○ ○ ● ● ○ ○ ● ○ ○ pm-2 1 pas 1 ○ ○ ○ ● ○ ○ ● ○ ○ am 1 6 ○ ○ ● ● ○ ○ ● ○ ○ pm-2 1 pas 1 ● am 2 6 ○ ● ○ EU589001 am 2 6 ○ ● ● ● ○ EU589025 11A4 pm-1 ● ○ am 1 16 ● ○ ○ ○ am 1 16 ○ ○ ○ ○ ● ○ ○ pm-2 1 pas 1 ● ○ ● ● ● ● long variants pm-2 1 pas 2-10 ● ○ ● ● ● ● long variants am 2 16 a ● ○ ○ ○ am 2 16 a ● ○ ○ ○ am 3 16 a ○ ○ ● EU589028 EU589029 am 3 16 a ● ○ ○ ○ 11A5 pm-1 ● am 1 10 ● pm-2 1 pas 1 ○ ● am 1 10 ○ ○ ● am 2 10 ○ ● ○ pm-2 2 pas 1 ○ ● am 2 10 ○ ● pm-2 2 pas 1 ○ ● am 3 12 ○ ○ ● ○ ○ long variants am 3 12 ○ ○ ○ ○ ○ ● EU589031 EU589046 EU589047 12A2 pm-1 ● ○ am 1 9 ● am 1 9 ● pm-2 pas 1 ● ● ● ● ● ● long variants am 2 16 a ● am 2 16 a ● am 3 16 a ● am 3 16 a ● 15B3 pm-1 ● ● ● ● ● ● long variants 15C4 pm-1 ● ● ● ● ● ● long variants 15C9 pm-1 ● ● ● ● ● ● long variants 15D8 pm-1 ● ● ● ● ● ● long variants 15E1 pm-1 ● ● ● ● ● ● long variants 15E7 pm-1 ● ● ● ● ● ● long variants 15F8 pm-1 ● ● ● ● ● ● long variants 15G3 pm-1 ● ● ● ● ● ● long variants 15G6 pm-1 ● ● ● ● ● ● long variants 15H10 pm-1 ● ● ● ● ● ● long variants Variants of the marker fragment in the course of the experimental life cycle with clonal cultures of isolate MHOM/IL/2003/LRC-L952: clonal promastigotes

(pm-1, FBS-199 medium) – amastigotes (am, lesion) – promastigotes (pm-2, FBS-199 medium). Abundant variants are indicated by black circles, rare variants

by white circles. Accession numbers for sequenced variants are provided in respective columns. Time span between infection and taking of samples is indicated

as weeks after infection; culture age expressed in number of passages is indicated for promastigotes (weeks after inf./passages). Samples from asymptomatic ears

are marked by letter “a”. If PCR patterns are identical in lesion-derived promastigotes at successive passages, a range of sampled passages is given. In some cases abundance of tri-, tetra-, and pentameric variants was not analyzed in detail due to non-optimal PCR conditions, and they are collectively identified as

“long variants”. a the samples were analyzed by PCR of maxicircle coding sequences (Supplementary material, table 6) and by sequencing of the cytochrome b gene

(Supplementary material, alignment 2). Table 4

clone culture culture passage mono 1 mono 1 mono 1 mono 2 mono 3 di 3 di 1 di 1 di 2 tri tri 2 tetra penta composition No. tr 300 320 375 450 514 573 642 680 ~900 ~1000 ~1200 ~1500 15H10 pm 1-3 1-5 ● ● ● ● ● ● long variants am 1 6 ● ● ● ● long variants am 1 7 ● ● ● ○ ○ ○ am+pm 1 8 ● ● ● ● ● long variants am+pm 2 6 ● ● ● ● ● ● long variants am 3 6 ○ ○ ● ● ○ ○ 15G3 pm 1-4 1-5 ● ● ● ● ● ● long variants am 1 6 ● ● ● ● ● ● ● long variants am 1 7 ○ ● am 1 8 ● pm 1 9 ● ● ● ● ● ● long variants am+pm 2 6 ● ● ● ● ● ● long variants am+pm 2 7 ● ● ● ● ● ● long variants am 2 8 ○ ● ● ● ● ● ● ● EU589010 EU589027 EU589030 EU589041 EU589045 EU589032 EU589042 am+pm 3 6 ● ● ● ● ● ● long variants am+pm 3 7 ● ● ● ● ● ● long variants am 3 8 ● am+pm 4 6 ● ● ● ● ● ● long variants am+pm 4 7 ● ● ● ● ● ● long variants am+pm 4 8 ● ● ● ● ● ● long variants 15E1+G3 pm 1-2 1-4 ● ● ● ● ● ● long variants am+pm 1 5 ● ● ● ● ● ● long variants +H10 am 1 6 ● ● ● ● ● ● ● long variants am 1 7 ○ ○ ● ● ● ○ ○ ○ ○ pm 1 8 ● ● ● ● ● ● long variants am+pm 2 5 ● ● ● ● ● ● long variants am+pm 2 6 ● ● ● ● ● ● long variants am+pm 2 7 ○ ○ ● ○ ○ ○ long variants am 2 8 ○ ● ○ Variants of the marker fragment in the course of the experimental life cycle with the amastigote stage in vitro, clonal cultures of isolate MHOM/IL/2003/LRC-

L952: clonal promastigotes (pm, supplemented FBS-199 medium) – amastigote-like cells (am) or mixed culture of amastigote-like cells and promastigotes

(am+pm, supplemented FBS-199 medium, high temperature, low pH) – promastigotes (pm, supplemented FBS-199 medium). Each clone was represented by several parallel cultures. Abundant variants are indicated by black circles, rare variants by white circles. Accession numbers for sequenced variants are provided in respective columns. If PCR patterns are identical at successive passages, a range of sampled passages is given. In some cases abundance of tri-, tetra-, and pentameric variants was not analyzed in detail due to non-optimal PCR conditions, and they are collectively identified as “long variants”. Table 5

isolate hamster passage culture mono mono 1 mono 1 mono 2 mono 3 di 3 di 1 di 1 di 2 tri tri 2 tetra penta No. composition 1 tr 300 320 375 450 514 573 642 680 ~900 ~1000 ~1200 ~1500 MHOM/UZ/98/Isv 1 7-8 pm ● ○ 7 am+pm ● ○ M-01h 8 am+pm ● ○ 9 pm ● ○ ○ 9 am+pm ● ○ ○ 3 5-6 pm ● ○ 5 am+pm ● ○ ○ 6 am+pm ● ○ 7-10 pm ● ○ ○ 7 am+pm ● ○ ○ 8 am+pm ● ○ ○ 10 am+pm ● ○ ○ 2-8 pm-r ● ○ ○ MPSM/IL/83/LRC 1 3-10 pm ○ ○ ● ● ● ● long variants 3 am+pm ● ○ ○ ○ long variants -L357 4 am+pm ● ● ● ○ ● ● ● long variants 5 am+pm ● ● ● ○ ● ● ● long variants 6 am+pm ● ● ● ○ ● ● ● long variants 7 am+pm ● ● ● ○ ● ● ● long variants 8 am+pm ● ● ● ○ ● ● ● long variants 9 am+pm ● ● ● ○ ● ● ● long variants 10 am+pm ● ● ● ○ ● ● ● long variants 2-5 pm-r ● ● ● ● ● ● long variants 6 pm-r a ○ ● ○ ○ ○ long variants MPSM/IL/83/LRC 3 1-10 pm ● ● ● ● ● ● long variants 1 am+pm ● ● ○ ○ ○ -L357 2 am+pm ● ● ● ○ ● ● ● long variants attenuated 3 am+pm ● ● ● ○ ● ● ● long variants 4 am+pm ● ● ● ○ ● ● ● long variants 5 am+pm ● ● ● ○ ● ● ● long variants 6 am+pm ● ● ● ○ ● ● ● long variants 7 am+pm ● ● ● ● ● ● ● long variants 8 am+pm ● ● ● ● ● ● ● long variants 9 am+pm ● ● ● ● ● ● ● long variants 10 am+pm ● ● ● ○ ● ● ● long variants 2-5 pm-r ● ● ● ● ● ● long variants IPAP/IL/98/LRC- 1 3-10 pm ● ● ● • ● ● ● long variants 3 am+pm ○ ● L464 4 am+pm ● ● ● ○ ○ ○ ○ 5 am+pm ○ ○ ○ ● 6 am+pm ● ● ● ● ● ● ● long variants 7 am+pm ● ● ● ● ● ● ● long variants 8 am+pm ● ● ● ● ● ● ● long variants 10 am+pm ● ● ● ● ● ● ● long variants 2-7 pm-r ○ ○ ○ ● ● ● long variants 5 1-10 pm ● ● ● • ● ● ● long variants 1 am+pm ○ ○ ○ ● ○ ○ ○ long variants 2 am+pm ○ ● ○ ● 4 am+pm ○ ○ ○ ● ○ ○ ○ long variants 5 am+pm ○ ○ ○ ● ○ ○ ○ long variants 6 am+pm ● ● ● ● ○ ○ ○ long variants 7 am+pm ○ ● 8 am+pm ● ○ 9 am+pm ○ ● ○ ○ 2 pm-r ● ● ● ● ● ● ● long variants MHOM/IL/2003/L – 1-9 pm ● ● ● ● ● ● long variants 1 am+pm ● RC-L952 2 am+pm ● ● ● ○ ● ● ● long variants 3 am+pm ● ● ● ○ ○ long variants 4 am+pm ○ ● 5 am+pm ○ ● ● ● ● long variants 6 am+pm ● ● ● ● ● long variants 7 am+pm ● ○ ○ ○ 8 am+pm ● ● ○ ○ 9 am+pm ○ ○ ● ○ ○ ○ long variants clone 3A3 – 1-3 pm ● ● ● ● ● ● long variants 1 am+pm ○ ● ○ ○ 2 am+pm ● ● ● ○ ○ ○ 3 am+pm ○ ○ ● clone 4B4 – 1-5 pm ● ● ● ● ● ● long variants 1 am+pm ● 2 am+pm ● 3 am+pm ● ○ ○ ○ 4 am+pm ○ ● ● ○ long variants 5 am+pm ● ● ● ○ ● ● ● long variants Variants of the marker fragment in clonal and non-clonal cultures subjected to incubation at 4°C: promastigotes (NNN-199 or FBS-199 medium) – aberrant promastigotes and amastigote-like cells (NNN-199 or FBS-199 medium, low temperature) – promastigotes (NNN-199 medium). Promastigotes were subjected to cold treatment after successive passages in culture. Abundant variants are indicated by black circles, rare variants by white circles. If PCR patterns are identical at successive passages, a range of sampled passages is given. In some cases abundance of tri-, tetra-, and pentameric variants was not analyzed in detail due to non-optimal PCR conditions, and they are collectively identified as “long variants”. a the samples were analyzed by PCR of maxicircle coding sequences (Supplementary material, table 6) and by sequencing of the cytochrome b gene (Supplementary material, alignment 2). Table 6

samples, predominant variants oligonucleotides amplified PCR product

gene(s) length, kbp 1) LRC-L952 pm; s960, GGTACAGAAAAGTTATGYGAATATAAAASWGTWGARCARTGTYTWCCGA ND7 1.2 COIIIRev, TCTATAAAAATAAAACTACCAAAC mono 1, 2; di 1573+642, 2; multi ND7Fend, GGAAATGTWGRTGTTGTWTTTG COIII 1 s961, CCTAAACTAAAYCCWACMCCATAYAYTCKWWATARACAWCCTGAMRTTA 2) LRC-L952 clone 10A2 am, hamster 2 ear 1; s960 ND7, COIII 2 s961 di 1573 LCybF2, GTATGCAGATTATTTGTGGTG cyt b 1 LCybR1, TCTAATCTACATACAAYYAAC 3) LRC-L357 am, hamster 2; LMurfF1, CTCARAATCCTATAAATTG MURF1 1.2 LMurf1R1, ATCTTATGTGAYTAYANYTCWC tri, tri 2 LsND1F, GACAGCTTAGGGATTTTGAG ND1, COII 1.2 Murf2R1, TTTAAGCTTATCAAAWACACGACTC 4) LRC-L357 am, hamster 6; COIF8, TTTGGATCCAATCATTTTATGAGAAAC G4 0.7 ND4R5, TTTAAGCTTTCAAAYAAWATCATAAAC mono 2; tri 2; tetra

5) LRC-L357 pm-r, passage 6;

mono 2

6) 5ASKH pm;

mono 3

7) BH012 pm;

di 1573

8) SABIR-1 pm

tetra Oligonucleotides used for amplification of maxicircle coding region sequences. Samples that were analyzed and variants of the marker fragment characteristic for them are listed in the left column (am, amastigotes; pm, promastigotes; pm-r, promastigote culture restored after cold treatment). Designations of amplified genes and PCR product lengths are also shown.