Transcription and Translation Practice Exercise

1. Define: DNA Transcription –

DNA Translation –

2. Below is a picture of DNA splitting and going through transcription. Show how it is duplicated by writing in the appropriate complementary base pairs within the replication bubble depicted

3. You will now practice translating DNA code into chains of amino acids (proteins). Use the tables on the next page to translate each codon to the appropriate amino acid.

Example - Translate the following DNA sequence: GAAAATTGGCTTCTGTGTAGGTATACCTATGATTAG

Answer - Divide the sequence into triplets: GAA-AAT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-TAT-GAT-TAG And assign the correct amino acid for each triplet based on the table below: Glu-Asn-Trp-Leu-Leu-Cys-Arg-Tyr-Thr-Tyr-Asp-End

When you reach a terminator triplet, you need to end the amino acid chain and start a new one.

Try translating the following sequences yourself: a. GAT/AGT/TGT/CCT/CTG/CAT/CGA/TCG/GGG/TGA b. GACGTATAGACAGGTAGCTGAGGGATTTATCGATAG

4. Now let’s make translation fun and delicious. On the next page is the Standard Genetic Code Table that I have modified. You will again be translating genetic code, but instead of building proteins, you will be building graham cracker sandwiches. Translate the DNA sequence below :

a. If your last name starts with a letter A – M, translate this segment of DNA: GGGCCTCTTAGGTCCCAATAG List your “amino acid” (marshmallow sandwich) ingredients in order: ______.

b. If your last name starts with N – Z, translate this segment of DNA: ACACGTAGTGCTTGTGAATGA List your “amino acid” (marshmallow sandwich) ingredients in order: ______. Table of Standard Genetic Code

T C A G TTT Phe (F) TCT Ser (S) TAT Tyr (Y) TGT Cys (C) TTC Phe (F) TCC Ser (S) TAC TGC T TTA Leu (L) TCA Ser (S) TAA STOP TGA STOP TTG Leu (L) TCG Ser (S) TAG STOP TGG Trp (W) CTT Leu (L) CCT Pro (P) CAT His (H) CGT Arg (R) CTC Leu (L) CCC Pro (P) CAC His (H) CGC Arg (R) C CTA Leu (L) CCA Pro (P) CAA Gln (Q) CGA Arg (R) CTG Leu (L) CCG Pro (P) CAG Gln (Q) CGG Arg (R) ATT Ile (I) ACT Thr (T) AAT Asn (N) AGT Ser (S) ATC Ile (I) ACC Thr (T) AAC Asn (N) AGC Ser (S) A ATA Ile (I) ACA Thr (T) AAA Lys (K) AGA Arg (R) ATG Met (M) START ACG Thr (T) AAG Lys (K) AGG Arg (R) GTT Val (V) GCT Ala (A) GAT Asp (D) GGT Gly (G) GTC Val (V) GCC Ala (A) GAC Asp (D) GGC Gly (G) G GTA Val (V) GCA Ala (A) GAA Glu (E) GGA Gly (G) GTG Val (V) GCG Ala (A) GAG Glu (E) GGG Gly (G)

Key to the Table of Standard Genetic Code Alanine ALA A Arginine ARG R Asparagine ASN N Aspartic acid ASP D Cysteine CYS C Glutamic acid GLU E Glutamine GLN Q Glycine GLY G Histidine HIS H Isoleucine ILE I

Leucine LEU L Lysine LYS K Methionine MET M Phenylalanine PHE F Proline PRO P Serine SER S Threonine THR T Tryptophan TRP W Tyrosine TYR Y Valine VAL V STOP = Termination Signal START = Start codon (ATG)

Key to the Table of Making Delicious Treats Honey Graham ALA A Peanut Butter ARG R Marshmallow ASN N Honey Graham ASP D Marshmallow CYS C Choc Graham GLU E Honey Graham GLN Q Honey Graham GLY G M&Ms HIS H Marshmallow ILE I

Choc Graham LEU L Peanut Butter LYS K START MET M M&M PHE F Marshmallow PRO P M&Ms SER S Choc Graham THR T Choc Graham TRP W M&Ms TYR Y Honey Graham VAL V STOP = Termination Signal START = Start codon (ATG)