MBMB 451A Nucleic and Gene Expression: Section1

Name______

MBMB 451A Nucleic and Gene Expression: Section1 Fall 2001 9-20-01 ------For each of the followingmultiple choice questions, choose the most appropriateanswer. ------1. Formation of Z-DNA is favored by a. high salt concentration b. alternating adenine and guanine residues c. methylation of guanosine d. increase in pH e. change in temperature 2. Which of the following single-stranded DNA molecules are likely to pair witheach other to form double-stranded molecules? You need to select two of the following. All are written in the5’-3’ direction. (a) GCTTAGCC (b) TAGTGAAT (c) ATGACCGGC (d) ATTCACTA (e) GCACGTAGG 3. Tm is the temperature at which all of a certain DNA issingle-stranded. a. true b.false 4. Type II restriction endonuclease is useful for molecularcloning. a. true b.false 5. Which statements about the yeast and mammalian genomes aretrue? a. Most yeast genes have several introns while most mammalian genes have manyintrons b. Most yeast proteins are about the samesize as the corresponding mammalian proteins even though the yeast genes are smaller c. Most yeast proteins are smallerthan the corresponding mammalian proteins d. Most genes in the yeast genome are the samesize as genes in mammalian genomes 6. When comparing genes that are conserved between species, theexons are more likely to be related to one another than the introns. a. True b. False 7. Whichof the following classifications is associated with most eucaryotic DNAsequences giving rise to mRNA? A. nonrepetitive B. moderatelyrepetitive C. highlyrepetitive D. noneof the above 8. Whichone of the following histones is a component of the core particle? A. H1 B. H2A C. H2B D. H5 E. H4 9. Globin genes: a. are organized differently in all highereukaryotes b. are organized into two clusters c. derive from a common ancestral gene d. are all expressed simultaneously 10. Which of the following statements about pseudogenes aretrue? a. They contain stop codons. b. They are not transcribed c. They are not translated d. They could eventually be lost from the genome bydeletion or other mechanism. e. They could evolve into new geneswith different functions 11. Regardingnucleosome structure, which of the following statements is correct? A. Nucleosomesare spherical structures comprised of RNA, nonhistone proteins and histoneproteins. B. Themajor histones comprising nucleosomes are H1 and H4. C. Nucleosomespermit efficient packing of DNA to about one seventh its normal length. D. Thehistone associated with the DNA in the linker region holding nucleosomes iscalled H2A. E. Allof the above. 12. Whichof the following is a part of the promoter of a tRNA gene in eucaryotes? A. INR B. boxA C. TATAbox D. upstreamcontrol element E. responseelements 13. MammalianRNA polymerase I: A. synthesizesrRNA B. synthesizesmRNA C. synthesizestRNA D. Noneof the other answers is correct 14. TheIIA form of RNA polymerase II is A. the form of the enzyme that is involvedin promoter recognition B. the form of the enzyme that is involvedin productive elongation C. caused by phosphorylation of theN-terminus of the largest subunit D. is also found as a feature of RNApolymerase III 15. The transcription factor called TFIID a a. is a gene-specific transcription factor b b. binds to the enhancer region c. helps recruit all the other generaltranscription factors to the DNA template c d. binds to the response element near thestart site of transcription 16. Zinc finger proteins bind zinc a. covalently b. in the presence of DNA c. by coordination between conservedcysteine and histidine residues d. in an alpha helical region of theprotein. 17. Homeodomain proteins: a. form a structure with three  sheets b. contact DNA primarily through  helix 3 and an N-terminal arm c. are similar in structure to prokaryotichelix-turn-helix protein d. are not present in the cell nucleus 18. Steroid receptor transcription factors a. all bind the same hormone b. do not bind DNA in a sequence specificmanner c. use a consensus sequence to bind zincdifferent from the on e used by the zinc finger d. have separate domains for transcriptionactivation, DNA binding, and hormone binding e. dimerize through amino acids in theC-terminal part of the second finger 19. Which of the general transcription factors have a DNAhelicase activity a. TFIIA b. TFIIB c. TFIID d. TFIIE e. TFIIH 20. bHLH proteins a. have conserved basic amino acids in theloop b. cannot homodimerize c. are always expressed d. interact with HLH through their basicregions e. bind DNA through their basic regions 21. All histones undergo post-translational modification ofspecific amino acids. These modifications: a. alter the amphipathicity of the histoneprotein b. are permanent c. occur in the core region of the histones d. occur at specific times during the cell cycle e. none of the above 22. Which of the following transcription factors are requiredfor RNA polymerase I transcription? a. TFIIB b. TFIIIA c. UBF d. TFIID e. TFIIIB 23. Which of the following protein complexes helps remodelchromatin in a covalent fashion: a. HDAC b. SP1 c. TFIIE d. SWI/SNF e. HAT

The following are a seriesof essay questions

24. What are four different protein modifications that occur onthe histone proteins and help regulate their function?

25. Describe the five forces that help stabilize the doublehelical structure of DNA.

26. One strand of double helical DNA has the sequence: 5'-GCGCAATATTCTCAAAATATTGCGC-3'

What special type of sequenceis contained in this DNA segment? Write the base sequence of the complementary strand. Does the double stranded DNA have thepotential to form any alternative structures - please diagram.

27. List the contents of anucleosome, the 10 nm fiber, and 30 nm fiber? 28. Diagram what are the promoter elementsfound in a typical eukaryotic (1) rRNA, (2) mRNA, and (3) tRNA genes and theirrelative position in DNA with regard to the transcription start site.

29. A new RNA polymerase activity is discovered in crudeextracts of cells derived from an exotic fungus. The RNA polymerase initiates transcription only from a single,highly specialized promoter. Asthe polymerase is purified its activity declines, and the purified enzyme iscompletely inactive unless crude extract is added to the reaction mixture. Suggest an explanation for theseobservations.

30. A biochemist replaces the DNA binding domain of the yeastGal4 protein with the DNA binding domain from the LexA repressor protein andfinds that the engineered protein no longer regulates transcription of the GAL genes in yeast. Draw a diagram of the different functional domains you would expect tofind in the Gal4 protein and in the engineered protein. Why does the engineered protein nolonger regulate transcription of the GAL genes? What might be doneto make this chimeric protein functional in the activation of transcription ofthe GAL genes.

31. The DNA molecule below is believed tocontain a binding site for protein X. It is labeled at the 5' end of the top strand (*), then subjected to a footprintingexperiment. In the idealized gelbelow, there is a band for every base of the labeled strand. On the DNA sequence, point out thebinding site for protein X.

*(5')GGATTCTAATAAAGTAACGCGTTACGACTTGG CCTAAGATTATTTCATTGCGCAATGCTGAACC

Also show to the left side of the gel what the dideoxysequencing lane for G (sample containing dideoxy GTP) if you were sequencingthe top strand with the bottom strand as the template.

32. It is possible to “reconstitute”nucleosomes by mixing DNA and histone octamers in 2M NaCl and then dialyzing tolow salt. When such experiments were carried out using a specific 225-bpfragment of DNA, the following results were obtained: Digestion of the productwith micrococcal nuclease gave quantitative production of 146 bp DNA. Upon cleavageof this DNA with the restriction endonuclease EcoRI at a single site 100 bpsfrom one end of the DNA, several sharp bands were obtained, with sizes asfollows: 38, 53, 64, 161, 172, and 187 bp. How would you interpret these data in terms of nucleosomepositioning on this DNA? Pleaseshow a diagram in which the distance of the ends of the nucleosome from theEcoRI cut site is indicated in base pairs.