Haeiii Restriction Endonuclease Was Used to Digest the Following DNA Piece from the Globin Gene

Name: SSN:

Cell Biology, FA 02. This problem set is worth 25 points and counts as two problem set grades, PS 3 and PS 4. Due Thursday, 12-12 at 9 am but use this as part of your review for the final exam. Answer these questions on separate sheets of paper and attach it to the exam

DraI restriction endonuclease was used to digest the following DNA piece from the globin gene. Note that only the 5’ to 3’ non-template sequences are shown. The 3' to 5' template sequence would be 3'taaatccaat…. Etc.

5’ATTTAGGTTATTTGCAGAAAACTGAGGCCTAATGGTAATAGCTTTTTAAATTAATTTATTTT TAATACAAGGAGAACAGATTTAGATGTAGTTCATACATACAATTTTAAGAATGTAATGATGG AGAGAGGCAGGGAGAAGGATAATGGTTTTTATTTTCTGGACTTGTACAACTCTGTATCTTATT CACTGTAACAGTATTTTTCAGGGCAGTAACCACAAAAAAATGTGAATTTACAAAAACTCAAC AAACCTGTTGTGAGTTAATCTATTGTAATTGTGAAGGTAAAAGGCACACTTCCCCAGTGAAT CACTTAAGCAGGAAAAACTGGACACATTTGAAAGAATAAATTCCTTGACTATTCTGCAAAGA TAAGCGCAGGGACCTGGGAAGAGGGGTATTGTCCTCAACTGGTATGAGGATTTGACTCAGA CAGCATCAAGTACAATTGCCTTGTGTTTACTTTTAGAATAAGAGAGTTTTGAGTCCCATAATC AAAAGAGGAGACCCAGGGTGCACATAGATCTCTGAATGCCTTCAGTGTGAGAAGAGATATG ACCTGAGTTCATCAGCCATAAGCCCTTTCCCCTCTCTCCCACTCAGCAGCCAGGTCAGAGTG AGCTTGATCACCCTGCCCCTGTGCTGGTTTGACTCACTCCTAGGCCCAGCCATGGAAGGAGG TCCTGTCTGGGCTCAGACAGCACTATCTGCAGGGCCAGGACTTAGGCGGGGCTGGTAGGCTC TAGAAAGTTTCCCTCCCAGCAAGTGAGGAAGGTTGGCTTATTTACATATTTAAGTGTCATAT GTATTTTTAAAGAAATAACTAGTAGCCTGCCCAACTTGGGCATAGACAGCACCTAGAAAATT TTACAATCCTTCTGTTCTGTCTCTCACAGGAGCACAATTAGAGGCAAAGGGCACTCTCGAAA GTGCCTGAGTCAGAGCCTG- 3’

1. (4 pts) You want to digest this DNA with the restriction enzyme, DraI. Your stock DNA concentration is 1 g/L; your stock DraI enzyme concentration is 1 unit/L, your enzyme stock

buffer (50 mM Tris buffer, pH 8.00; 50 mM MgCl2; 0.5 M NaCl; 50 mM Dithiothreitol) is 10X concentration. You want to make a final reaction mixture, to be incubated at 37oC, containing the following in a total volume of 100 L: 5 g of DNA, 10 units of restriction enzyme DraI and 1 X buffer.

A. Give the volume of each stock component and distilled water that would be added to give the final amounts and concentrations in the 100 L of your final reaction mixture.

B. What are the final concentrations, in ?g/mL of DNA; ?units/mL of restriction enzyme

DraI; ?mM Tris buffer; ?mM MgCl2; and ?mM Dithiothreitol, of these components in your final reaction mixture.

2. (4 pts) Using any of my catalogues, A. what is the DNA palindrome that DraI cuts the phosphodiester bonds at and where does it cut within the palindrome?

B. Does it give blunt ends or overhangs (“sticky ends”) ends in the pieces of DNA produced?

C. This enzyme originally came from what organism (genus and species)?

D. What is the purpose of this enzyme in this organism?

of 2 3. (2 pts) Circle the sites of cleavage for DraI enzyme in the partial DNA single strand gene above and label the fragments with numbers or letters. (Hint: Use the “find” function under the edit drop down menu and search for the 5’ – 3’ nucleotide palindrome sequence until you find all of the sites. I will post this problem set on the web or send it to each of you by email.)

4. (1.5 pt) Determine the sizes, in base pairs (bp) and kilobase pairs (kb), and mega base pairs (Mb) of each of the DNA double stranded pieces generated by the enzyme. Label each fragment with numbers or letters and give their sizes. (Hint: use the “word count” function under the tools drop down menu and count the number of letters from whatever to whatever. I will post this problem set on the web or send it to each of you by email.)

5. (2 pt) On a 1% agarose gel, draw, roughly, a representative gel with wells on a separate sheet of paper, illustrating the relative mobility of your labeled fragments from 3 and 4.

6. (2 pt) On a 2% agarose gel, draw, roughly, a representative gel wells on a separate sheet of paper, illustrating the relative mobility of your labeled fragments from 4. How does the mobility of the fragments here compare to the mobility of the fragments in 5?

7. (2 pt) Find any one start codon in a mRNA that could come from the above non-template sequence and give me the nucleotide sequence of the first ten (10) codons beginning with the first start codon in the partial mRNA sequence. (Hint: Find any ATG in the non-template strand: remember that, except for the T to U change for the RNA, it is the identical sequence as in the non-template strand!). Correctly label your mRNA, 5' end and 3' end.

8. (2 pt) Give me the partial amino acid sequence, 3 letter code and 1 letter code, of the polypeptide containing the ten (10) amino acids that would be specified by the mRNA that you put in 7. Correctly label your peptide, amino end to carboxyl end.

9. (2 pt) Give an additional different mRNA sequence that would code for the same amino acids in 8. Correctly label your mRNA, 5' end and 3' end.

10. (up to 1.5 pts, 0.5 pts each) Assuming that this is a eukaryotic mRNA:

A. What is one other non-translated RNa sequences that would be present in the primary mRNA as it is first transcribed from the template strand of the DNA?

B. What are 2 other non-translated RNA sequences, added after transcription (post- transcriptional) in the processed mRNA that is found in the cytoplasm?

11. (2 pts). Determine whether the restriction enzyme, SmaI, cuts this DNA fragment using the same procedure that you used in #3. Give its palindrome sequence and where it cuts within this sequence and whether it gives overhang or sticky ends or blunt ends.

12. Bonus: (2 pts). Determine whether the restriction enzyme, CfoI, cuts this DNA fragment using the same procedure that you used in #3. Give its palindrome sequence and where it cuts within this sequence and whether it gives overhang or sticky ends or blunt ends. Give the sizes in bp of the pieces of DNA that results from cutting with this enzyme.

of 2 Page 3 of 2