Supplemental Material and Methods s1

Supplementary Material and Methods

Gene targeted mouse models

Mice harboring the Mdr2 null allele were obtained from Dr. Ilan Stein, Hebrew University,

Tel Aviv, Israel. Mdr2 null mice were crossed to p19ARF null mice for at least 5

generations to obtain a recombinant inbred strain with a homogenous genetic

background (Kamijo et al., 1997; Smit et al., 1993).

Isolation of myofibroblasts from Mdr2 null and Mdr2/p19ARF double null mice

Livers of four week old Mdr2 null and Mdr2/p19ARF double null mice were perfused to isolate myofibroblasts as described (Schausberger et al., 2003). Briefly, mice were sacrificed and the liver was pre-perfused through the portal vein with pre-perfusion buffer containing 250 mM

NaCl, 20 mM KCl, 40 mM HEPES, 20 mM NaHCO3, 50 mM glucose, 100 U/ml penicillin,

100 µl/ml streptomycin and 1.9 U/ml heparin for 3 min. Subsequently, the liver was perfused in pre-perfusion buffer containing 100-166 U/ml (collagen) collagenase type I, (Sigma,

St.Louis, USA) and 0.02 mM CaCl2 without heparin. The perfused liver tissue was resuspended in DMEM, filtered through a 70 µm cell strainer (Becton Dickinson, Franklin

Lakes, NJ, USA) and centrifuged at 50g for 5 min to separate parenchymal cells.

Subsequently, the supernatant was centrifuged at 300g for 6 min to enrich non-parenchymal cells in the pellet that was gently resuspended in 4 ml DMEM. The resulting cell suspension was placed on top of a Percoll gradient consisting of 4 ml 25% Percoll underlain with 6 ml

50% Percoll (Sigma, St.Louis, USA) and centrifuged at 1000g at 4°C for 30 min with deactivated brakes. Two different cell populations were isolated, i.e. Kupffer cells enriched between 25% and 50% Percoll and myofibroblastoid cells from the layer above. All cells were washed twice with DMEM and centrifuged at 300g for 6 min. Subsequently, all cells were plated on tissue culture plastic which disabled endothelial cells to attach. Propagation and

1 immortalization of myofibroblasts was performed by passaging cells at a ratio of 1:3 twice a week in the indicated medium.

Confocal immunofluorescent microscopy of freshly isolated myofibroblasts

Cells were grown on collagen-coated slides (SuperFrostPlus, Menzel-Gläser, Braunschweig,

Germany), fixed in 4% formaldehyde/PBS for 20 min at room temperature and permeabilized in 0.5% Triton X-100/PBS for 5 min. The following primary antibodies were used at a dilution of 1:100: anti--SMA (Dako, Glostrup, Denmark), anti-desmin (Clone D33, Dako,

Glostrup, Denmark), anti-fibulin-2 (kindly provided by T. Sasaki) and anti-GFAP (Dako,

Glostrup, Denmark). Corresponding cye-dye conjugated secondary antibodies (Jackson

Laboratories, West-Grove, USA) were applied in a dilution of 1:100 and nuclei were counterstained with Hoechst in a dilution of 1:10.000 (Sigma, St. Louis, USA).

Proliferation kinetics

1 x 105 myofibroblastoid cells isolated from Mdr2 null or Mdr2/p19ARF double null mice were seeded in triplicate on six well plates. Cell numbers of corresponding cell populations were determined periodically using a multichannel cell analyzer (CASY; Schärfe Systems,

Reutlingen, Germany). Cumulative cell numbers were generated from absolute cell counts and their calculated dilution factors (Gotzmann et al., 2002). Proliferation kinetics have been performed in triplicate of which one representative is shown.

Quantitative RT PCR

PCR reactions were performed with Fast SYBR Green Master Mix in duplicates according to the recommendations of the manufacturer and quantified with the 7500 Fast Real Time PCR

System (Applied Biosystems, California, USA). The following forward (fw) and reverse (rv) primers were used: mouse Rho-A, fw 5’-AATGAAGCAGGAGCCGGTAA-3’, rv 5’-

2 CCCAAAAGCGCCAATCC-3’ and mouse Smad-7, fw 5' CAGGCTGTCCAGATGCTGTA

3', rv 5' CCAGGCTCCAGAAGAAGTTG 3'.

References to Supplementary Material

Gotzmann J, Huber H, Thallinger C, Wolschek M, Jansen B, Schulte-Hermann R et al.

(2002). Hepatocytes convert to a fibroblastoid phenotype through the cooperation of

TGF-beta1 and Ha-Ras: steps towards invasiveness. J Cell Sci 115: 1189-1202.

Kamijo T, Zindy F, Roussel MF, Quelle DE, Downing JR, Ashmun RA et al. (1997). Tumor

suppression at the mouse INK4a locus mediated by the alternative reading frame

product p19ARF. Cell 91: 649-659.

Mikula M, Proell V, Fischer AN, Mikulits W. (2006). Activated hepatic stellate cells induce

tumor progression of neoplastic hepatocytes in a TGF-beta dependent fashion. J Cell

Physiol 209: 560-567.

Schausberger E, Eferl R, Parzefall W, Chabicovsky M, Breit P, Wagner EF et al. (2003).

Induction of DNA synthesis in primary mouse hepatocytes is associated with nuclear

pro-transforming growth factor alpha and erbb-1 and is independent of c-jun.

Carcinogenesis 24: 835-841.

Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L et al.

(1993). Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a

complete absence of phospholipid from bile and to liver disease. Cell 75: 451-462.

3 Supplementary Figure legends

Supplementary Figure 1 Detection of exogeneous myofibroblasts after co-transplantation in experimental tumors. Immunohistochemical staining of tumors generated by co- transplantation of MIM-R hepatocytes with M-HT myofibroblastoid cells. (a) Consecutive tissue slices were stained with trichrome (blue, collagen deposits; pink, cytoplasm), GFP and

PCNA. In some but not all areas of the tumor, proliferating fibroblasts are detected by positive PCNA staining of GFP-negative cells. Black boxes indicate regions of higher magnification. Black lines mark the tumor-stroma border. Insets show staining at higher magnification. (b) Staining of markers specific for hepatic myofibroblasts (desmin, fibulin-2 and GFAP) to validate the persistency of co-injected M-HT cells. Insets show staining of tumor sections at higher magnification. (c) Immunofluorescence of a tumor section arising from co-transplantation of GFP-expressing MIM-R cells with RFP-expressing M-HT cells at corresponding wave lengths. Arrows indicate the presence of exogenous myofibroblasts after

21 days of tumor growth.

Supplementary Figure 2 Isolation and establishment of Mdr2/p19ARF double null myofibroblastoid cells termed Mdr2-p19. (a) Serial sections of isolated livers from 4 week old mice are shown after histochemical analysis with trichrome, H&E and anti--SMA. Bile ducts (BD) of p19ARF null livers show cholangiocytes lacking -SMA-positive staining. In contrast, BDs of Mdr2 null and Mdr2/p19ARF double null livers display a comparable accumulation of -SMA-positive cells around the BD. Black boxes indicate regions of higher magnification. (b) Immunofluorescence staining of isolated Mdr2/p19ARF double null myofibroblastoid cells (Mdr2-p19) with anti--SMA, anti-GFAP, anti-desmin or anti-fibulin-

2 specific for hepatic myofibroblasts. (c) Proliferation kinetics of isolated Mdr2 null myofibroblasts compared to Mdr2/p19ARF double null myofibroblasts (Mdr2-p19). Whereas

4 Mdr2 null myofibroblasts continuously die after 5 days in culture, Mdr2-p19 cells show proliferation and immortalization.

Supplementary Figure 3 Expression of PDGF-Rα is elevated at the invasive front. (a)

Tumors derived from either MIM-R (R) or MIM-R-dnP (R-dnP) hepatocytes alone or with co-transplantated M-HT or Mdr2-p19 myofibroblastoid cells were collected after 21 days.

Immunohistochemical staining of serial sections was performed with anti-PDGF-Rα. Boxes indicate the magnification area of the tumor-host border. Elevated levels of PDGF-Rα are detected at the tumor-host interface rather than in the center of the tumor. Overexpression of

Smad7 in MIM-R hepatocytes abolishes expression of PDGF-R at the. Insets show staining of tumor sections at higher magnification. (b) Quantitative RT-PCR shows elevated levels of

Smad 7 in cells overexpressing exogenous Smad7. MIM, parental p19ARF null hepatocytes; R,

MIM cells overexpressing Ha-Ras; RT, MIM-R cells long-term treated with TGF-; R-S7,

MIM-R hepatopcytes overexpressing Smad7; RT-S7, RT cells overexpressing Smad7 (Mikula et al., 2006).

Supplementary Figure 4 Structure and epithelial characteristic in the center of MIM-R tumors. 1 x 105 MIM-R cells were subcutaneously injected either alone (R) or in combination with fibroblasts (R+M-HT, R+Mdr-p19). Tumors were collected after 21 days. Consecutive slices of tumor tissues were immunohistochemically stained with trichrome and H&E to investigate the structure of the tumor tissues. Co-transplantation with fibroblasts shows more collagen deposition (blue areas in trichrome staining). Staining with anti-GFP was performed to outline the border between tumor cells (GFP-positive) and fibroblasts (GFP-negative).

Immunohistochemical staining with anti-E-cadherin, anti--catenin and with non-destructible, active -catenin (ABC) indicates the epithelial characteristic of tumors. MIM-R derived tumors show rather epithelial characteristics whereas co-transplantations with myofibroblasts

5 show both a partial epithelial phenotype as well as accumulation of nuclear -catenin. Insets show staining of tumor sections at higher magnifications.

Supplementary Figure 5 Molecular analysis of the tumor-host border. (a)

Immunohistochemical staining of serial sections was performed with anti-p16INK4A antibody.

Co-transplanted tumors derived from either MIM-R (R) or MIM-R-dnP (R-dnP) hepatocytes with M-HT or Mdr2-p19 myofibroblastoid cells were collected after 21 days. Nuclear staining of p16INK4A is in accordance to active -catenin expression (Figure 4, 5 and 6). Black boxes represent regions analyzed at higher magnifications. (b) Induction of EMT at the tumor-host border. The mesenchymal marker alpha-smooth muscle actin (-SMA) and the epithelial marker p120-catenin (p120ctn) are depicted in MIM-R and MIM-R-dnP-derived tumors. MIM-

R cells undergo EMT whereas expression of dnP sustains an epithelial phenotype. Dashed line, tumor-host border; S, skin; T,t, tumor.

Supplementary Figure 6 Structure and epithelial characteristic in the center of MIM-RdnP tumors. 1 x 105 MIM-Rdn-P cells were subcutaneously injected either alone (R-dnP) or in combination with fibroblasts (RdnP+M-HT, RdnP+Mdr2-p19). Tumors were collected after

21 days and consecutive slices of tumor tissues were immunohistochemically stained as outlined in Supplementary Figure 4. A prominent epithelial structure depicted by plasma membrane-bound E-cadherin and -catenin can be found in all tumor centers. Insets show staining of tumor sections at higher magnifications.

Supplementary Figure 7 Myofibroblasts provoke invasion of malignant hepatocytes. MIM-

R spheroids comprising 100 cells each were co-cultured with adjacent myofibroblasts (Mdr2- p19) in 3D collagen gel for four days. Immunofluorescent staining was performed with anti-

E-cadherin, anti--catenin and anti-ZO-1 antibodies (red) and counterstained with Hoechst 6 (blue) to visualize cell nuclei. Cellular expressed GFP is depicted in green and each merge of all three colors is shown in the lower right picture. Incubation with the TGF- inhibitor

LY02109761 (20 µM) abrogated EMT formation at the invasive front and treatment with

PDGF inhibitor STI 571 (Imatinib, 5 µM) resulted in persistant epithelial structures and a partial inhibition of invasion. One spheroid out of a minimum of 200 spheroids is shown.

Supplementary Figure 8 Immunoediting function of myofibroblasts. The secretion of

VEGF-AA, CCL-2/MCP-1 and CCL-5/RANTES was determined in triplicate measurements using ELISA and calculated per ml supernatant per 106 cells. (a,c) In vivo activated myofibroblasts (Mdr2-p19) might stimulate an early immune response by attracting macrophages and inducing angiogenesis by secretion of VEGF-AA and CCL2/MCP1 whereas

(d) in vitro activated myofibroblasts (M-HT) rather stimulate a late immune response by secreting CCL5/RANTES to attract T-cells and other immune cells. (b) Upon stimulation with TGF- in vitro, malignant hepatocytes (R, R-dnP) secrete elevated levels of VEGF-AA, independent on interfering with PDGF signaling. *** p < 0.005;

Supplementary Figure 9 Model of reciprocal hepatic tumor-stroma interaction. Stimulation of portal fibroblasts and HSCs by the immune system leads to activated myofibroblasts which have the ability to proliferate and secrete cancer-promoting factors such as TGF-. Neoplastic hepatocytes undergo EMT upon TGF-resulting in autocrine and paracrine secretion of TGF-

 and PDGF, which maintains their mesenchymal phenotype and activates and recruits myofibroblasts. Activated myofibroblasts secrete immune cells-recruiting factors such as

CCL2/MCP1 or CCL5/RANTES for an early or a late immune response, respectively.

Activation of the immune system leads to further secretion of tumor-promoting cytokine secretion such as MMPs, VEGF and TNF.