Chimeras Taking Shape: Potential Functions of Proteins Encoded by Chimeric RNA Transcripts

Supplementary RT-PCR Methods

Chimeras taking shape: potential functions of proteins encoded by chimeric RNA transcripts

Milana Frenkel-Morgenstern1, Vincent Lacroix2, Iakes Ezkurdia1, Yishai Levin3, Alexandra Gabashvili3, Jaime Prilusky4, Angela del Pozo1, Michael Tress1, Rory Johnson5, Roderic Guigo5 and *Alfonso Valencia1

Structural Biology and BioComputing Program, Spanish National Cancer Research 1 .Centre (CNIO), Madrid, 28029, Spain

UMR CNRS 5558, Laboratoire de Biométrie et Biologie Evolutive, INRIA Bamboo, 2 .Université Claude Bernard, Villeurbanne, 69100, France

.Mass-Spectrometry Unit, Weizmann Institute of Science, Rehovot, 76100, Israel 3

.Bioinformatics Unit, Weizmann Institute of Science, Rehovot, 76100, Israel 4

Centre for Genomic Regulation (CRG), C/ Dr Aiguader 88, 08003, Barcelona, 5 .Spain

Corresponding author: Alfonso Valencia, Structural Biology and* BioComputing Program, Spanish National Cancer Research Centre (CNIO), Madrid, 28029, Spain. Email: [email protected] Quantitative RT-PCR RNA samples were reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (PN 4368814) from Applied Biosystems. The apparatus was GeneAmp PCR System 9700, Applied Biosystems. The reaction cycles were: 25ºC – 5min, 42ºC – 30 min, 85ºC – 5 min, 4ºC - ∞. The resulting cDNAs were adjusted to 20ng/ul.

After reverse transcription, samples were subjected to pre-amplification. Briefly, samples (1-250 ng, 2-5 ul) were placed in a PCR tube and 5 ul TaqMan PreAmp Master Mix (2x) and pooled assay mix (2.5 nM, each assay) added such that the final volume was 10 ul. The apparatus was GeneAmp PCR System 9700, Applied Biosystems. The reaction cycles were: 95ºC – 10 min (for 14 cycles) then 95ºC – 15 sec, 60ºC – 4 min,

5 μl of 1:20 diluted pre-amplified cDNA (20 ng) was subjected to quantitative real- time PCR (RT-qPCR) using the LightCycler 480 and RT-qPCR SYBR GREEN (Ref 04887352001) or probe Master Reagents (04887301001) without ROX reference dye. Forward and reverse primer pairs were reconstituted in Nuclease Free Water (Ambion P/N: AM9932). Each RT-qPCR reaction had a final concentration of 250nM forward and reverse primer pairs in a final volume of 10ul. The cycling conditions were as follows for Mono Color Hydrolysis Probe (sequences DW, BY, CN30, CN31, BF, BM82 and BM83): pre-incubation 95ºC – 10 min and then 45 amplification cycles of 95ºC – 10s, 60ºC – 30s, 72ºC – 10s; finally, cooling was at 40ºC for 30s.When using SYBR Green (sequences CN43, DB, BM84, BE and BG), the following cycling conditions were employed: pre-incubation 95ºC – 5 min and then 45 amplification cycles of 95ºC – 10s, 60ºC – 10s, 72ºC – 10s. A melting curve of one cycle was generate as follows: 95ºC – 5s, 65ºC – 1 min, Cooling 40ºC – 30s.

Light Cycler 480 software release 1.5.0 SP4 was used to determine the crossing point (CP) for each amplification reaction using 2nd derivate analysis.

Analysis of RT-qPCR data All of the corresponding RT-qPCR data were analyzed using the ΔΔCP method and normalized against reference genes (housekeeping genes) - GAPDH for RNA samples and FTH1 for DNA samples.

Determination of Primer Pair Efficiency

We assumed that the efficiency was E=2.00.

Normalization Genes All the corresponding RT-qPCR data were normalized against using the reference housekeeping genes, GAPDH (NM_002046) for RNA samples and FTH1 (NM_002032.2) for DNA samples (Supplementary RT-PCR Results). Construction of species-specific primer pairs To generate species-specific primer pairs that detected only human mRNA chimeric sequences, the corresponding human chimeric sequences had to have a unique region of at least 20 bp or more. Blast-n http://blast.ncbi.nlm.nih.gov/Blast.cgi was used to compare the human FASTA mRNA sequences for 12 chimeras. A Primer 3 – based program was used when designing the primers pairs and included the matching position for UPL probes (Roche Applied Science, https://www.roche-applied- science.com/). The forward primer was taken from the first gene of the chimeras and the reverse primer was taken from the second gene, such that only the chimeric fusion should be detected as the amplicon (see Supplementary Primers Excel file). Note, we used the Universal Probe Library system that looks for PCR primer pairs and permits the Taqman UPL probe to be used inside the amplicon. In cases where we were unable to design TaqMan probes, we used SyberGreen probes, and to confirm the chimeras we required that they are expressed in the corresponding samples only, as in the Proteomics results. Mono Color Hydrolysis (TaqMan) probes from the Universal Probe Library (UPL) were used for chimeras: DW419036.1, BY796539.2, CN306050.1, CN310211.1, BF969911.1, BM827779.1 and BM838228.1. Since such probes cannot be designed for all sequences, SYBR Green was used for chimeras: CN430188.1, DB154094.1, BM842093.1, BE837730.1 and BG978110.1.

All primer pairs produced a single species-specific amplicon, with minimum off- target amplification. This was verified by assessing the melting curve of each amplification reaction. Positive amplicons were subjected to sequencing to confirm the identity of the detected fragments.

Purification of Total DNA from Animal Blood or cells (Spin-Column Protocol) QIAGEN – DNeasy Blood & Tissue Kit - Cat. No. 69504 The appropriate number of cells (maximum 5x106) were centrifuged for 5 min at 300 x g. the resulting pellet was resuspended in 200 μl PBS and 20 μl proteinase K added. Then, with vigorous vortexing, 200 μl Buffer AL was added and the mixture incubated at 56ºC for 10 min. Next, ethanol (96-100%) was added before each sample was applied to a DNeasy Mini spin column residing inside a 2 ml collection tube. The DNA was spun onto the column by centrifugation at ≥ 6000 x g (8000 rpm) for 1 min and the flow-through discarded. The DNA was washed by adding sequentially 500 μl Buffer AW1 followed by 500 μl Buffer AW2, the former removed by centrifugation at ≥ 6000 x g (8000 rpm) for 1 min and the latter by centrifugation at ≥ 20000 x g (14000 rpm) for 3 min. Finally, the DNA was eluted from each DNeasy Mini spin column into a clean microcentrifuge tube by incubating the column at room temperature for 1 min in 200 μl of Buffer AE before centrifuging for 1 min at ≥ 6000 x g (8000 rpm).

The RNA and DNA samples We prepared human RNA samples from breast cancer cells (MCF7), prostate cancer (DU145), ovary cancer (OVCAR3), embryonic lung fibroblasts (WI38), and the corresponding DNA as negative control samples (Supplementary RT-PCR Methods). For the second experiment we also used the RNA samples of the normal ovary and prostate tissues. Following the reverse transcription, samples were subjected to pre- amplification for 14 cycles. Pre-amplified samples were used for RT-qPCR. The verification assumptions For the verification of the chimeras we used the following criteria: chimera is detectable for the mean Cp<36, and was not detectable in the RNA:RT- samples (to avoid the DNA contamination of the samples). Next, the chimeras have been verified by sequencing. In the case, a low amount of the PCR product was found for a specific chimera, multiple experiments and positive/negative samples corresponding to the positive/negative proteomics results were used to confirm the chimeras.

The verification of chimeras in human cells In order to verify the expression of the chimeric transcripts identified by mass- spectrometry in normal and cancerous human cells, we analyzed all 12 chimeras by Quantitative Real Time Reverse Transcription-Polymerase Chain Reaction (RT- qPCR). We found that the chimera, BM838228.1, was detectable in RNA samples from both normal and cancer cells (Supplementary RT-PCR Results and Figure S1 below) and confirmed by sequencing (Table S1 below). Moreover, we found that the chimera DB154094.1 was detectable in both RNA and DNA samples from the breast cancer cells (Supplementary RT-PCR Results). We surmise that this chimers may result from chromosomal translocations or rearrangements. Notably, the chimera CN306050.1 was identified in normal RNA sample, the chimera BE837730.1 in the breast cancer samples, and both are in two repeated experiments (Supplementary RT-PCR Results). Moreover, the chimera CN430188.1 is expressed in ovary cancer RNA samples only that correspond to the samples, where the junction peptide was identified. The percentage of the transcripts identified in the cell lines tested was similar to that reported by Li et al (Li et al. 2009) and as expected from the ENCODE project (Rosenbloom et al. 2012), given the tissue-specificity of the chimeric transcripts and their low abundance (Table 2). To exclude the possibility that these chimeric transcripts were artifacts of random mismatching during the PCR processes, we selected five cases confirmed by RT-PCR for additional verification. First, we amplified two DNA fragments of the parental genes corresponding to the 5' and 3' parts of one chimeric mRNA, and then these DNA fragments were used as templates for RT-PCR. Second, we transcribed two RNAs which contained the corresponding 5' and 3' part of a chimeric RNA, and we synthesized their corresponding cDNAs by reverse transcription in vitro. We also analyzed these two cDNAs by RT-PCR. If these chimeric mRNAs were RT-PCR artifacts, we would expect that we could also amplify them in these RT-PCR experiments and detect by the corresponding probs. However, our results showed that no such products were detected in any of the five cases tested, supporting the authenticity of these chimeric RNAs in cells. Taken together, these observations indicate that chimeras identified at the protein level by shotgun proteomics are indeed detectable at the RNA level by RT-PCR, and they exhibit low expression levels in human cells, as suggested by our analysis of RNA-seq reads. Table 1: The sequencing results for the chimeras verified by RT-PCR. Chimera Forward sequence Reverse sequence ESTid BM838228.1 CTCAAGGTGTTTGACGGCCACACTGT AGGANGGCATGGGGGAGGGC GCCCATCTACGAGGGGTATGCCCTCC ATACCCCTCGTAGATGGGCAC CCCATGCCATCCTGCGTCTGGACCTG AGTGTGG GCTGGCCG Table 2: The low concentration of chimeras identified by RT-PCR experiments. Concentracion Sample # Channel Chimera id Dilution Factor ng/ul 1 BLUE standard 1000ng/ml 1 0.978 2 BLUE standard 100ng/ml 1 0.135 3 BLUE standard 10ng/ml 1 0.020 4 BLUE standard 1ng/ml 1 0.002 5 BLUE blank 1 0.000 6 BLUE WI38 BE837730.1 100 0.201 Prostate Tissue 7 BLUE BG978110.1 100 0.062 8 BLUE WI38 DB154094.1 100 0.211 Ovary tissue 9 BLUE BE837730.1 100 0.068 10 BLUE MCF7 DB154094.1 100 0.250 Prostate tissue 11 BLUE DB154094.1 100 0.098 Figure 1: The example of amplification curves for the chimera BM838228.1. The threshold of 0.66 is depicted in cyan. The curves of GAPDH (used as a control) are above the threshold from the cycle 11, the curves of BM838228.1 are above the threshold from the cycle 28.

REFERENCES Li X, Zhao L, Jiang H, Wang W. 2009. Short homologous sequences are strongly associated with the generation of chimeric RNAs in eukaryotes. J Mol Evol 68(1): 56-65. Rosenbloom KR, Dreszer TR, Long JC, Malladi VS, Sloan CA, Raney BJ, Cline MS, Karolchik D, Barber GP, Clawson H et al. 2012. ENCODE whole-genome data in the UCSC Genome Browser: update 2012. Nucleic Acids Res 40(Database issue): D912-917.