CLIP Method to Study Protein-RNA Interactions in Intact Cells and Tissues

CLIP method to study protein-RNA interactions in intact cells and tissues.

James Tollervey1, Jernej Ule1*

Address:

1MRC-Laboratory of Molecular Biology, Hills Road, Cambridge, CB2 0QH, United

Kingdom.

Keywords: CLIP; UV cross-linking; Immunoprecipitation; RNA-protein interaction Abstract In order to understand the mechanisms by which RNA-binding proteins carry out their functions, it is important to identify where they bind their targets. To facilitate this, the UV-crosslinking and Immunoprecipitation (CLIP) method was developed which allows for in vivo identification of protein-RNA interactions. To identify the sequence of CLIP RNAs, these need to be ligated to adapters and amplified to a cDNA library, which can be an inefficient process that had been improved over the last years. In this chapter, we present the general CLIP protocol and describe how the individual steps in the protocol can be optimised depending on the protein studied and the cell type or tissue used.

Background Bioinformatic and experimental studies found that the position on nascent transcripts to which a protein binds often relates to its function in regulating alternative splicing (Dredge et al., 2005; Hui et al., 2005; Kanopka et al., 1996; Ule and Darnell, 2006). Therefore, to understand splicing regulation, it is important to profile the RNA sites bound by individual proteins on nascent transcripts with high positional resolution. Since intronic regions of nascent transcripts are rapidly degraded and therefore present in cells at very low abundance, it is important to crosslink the protein-RNA interactions in intact cells before purifying the RNA. This is achieved by in vivo UV cross-linking and immunoprecipitation (CLIP) (Ule et al., 2003), which purifies the RNA sites that crosslink to a particular RNA-binding protein. CLIP employs immunoprecipitation and SDS-PAGE analysis of the protein-RNA complex in a way that was originally developed for studies of IRE1-RNA complex in the mammalian unfolded protein response (Bertolotti and Ron, 2001). The RNA is then isolated from the protein-RNA complex and ligated to RNA adapters, similar to the way originally developed for cloning of small interfering RNAs (Elbashir et al., 2001). The original CLIP protocol ligates the 5` RNA adapter to phosphorylated CLIP RNA (Ule et al., 2003); this is potentially problematic, since it allows self- circularisation of the CLIP RNA, which tends to be more efficient than ligation to the RNA adapter. Therefore, a later protocol first ligated the 3` RNA adapter to dephosphorylated CLIP RNA (Ule et al., 2005). Since the original protocol ligated the RNA adapters sequentially to the isolated CLIP RNA, it often resulted in amplification of bacterial and yeast RNAs, or RNA adapter concatamer sequences. The solution to this problem was to perform the first RNA adapter ligation on-bead during immunoprecipitation (Ule et al., 2005). Ligation of 3` RNA adapter to CLIP RNA was inefficient in our hands when performed on-bead, therefore we have resorted to ligation of 5` RNA adapter on-bead (Wang et al., 2009). This was efficient when using 3' phosphatase minus T4 Polynucleotide Kinase to phosphorylate the CLIP RNA, since the 2`-3` phosphate that remains on the CLIP RNA after RNase cleavage blocks self- circularisation. Another approach was described in a study that used a pre-adenylated 3` DNA adapter (Granneman et al., 2009). Here we describe an alternative solution that increases the efficiency of 3` RNA adapter on-bead ligation by using PEG 400 in the ligation reaction. The CLIP protocol is comprised of seven basic steps. In this chapter, we will describe the protocol for each step, comment on the problems that can be encountered, and describe some of the potential solutions. Material and reagents

1) UV cross-linking. membrane (Whatman, Protran), Novex wet transfer apparatus (Invitrogen), 20x Transfer buffer Cold PBS, Stratalinker (such as model 2400), 10 cm (Invitrogen, NP0006-1), methanol, BioMax XAR tissue culture dishes (Falcon). film (Kodak, 853 2665). 2) Immunoprecipitation. RNA isolation and precipitation. a) Lysis Buffer: 50 mM Tris-HCl, pH 7.4; 100 mM a) PK buffer: 100 mM Tris-HCl, pH 7.4; 50 mM NaCl; 1 mM MgCl2; 0.1 mM CaCl2; 1 % NP-40; 0.5 NaCl; 10 mM EDTA. % sodium deoxycholate; 0.1 % SDS; protease inhibitor and ANTI-RNase added fresh. b) PK+urea buffer: 100 mM Tris-HCl, pH 7.4; 50 mM NaCl; 10 mM EDTA, 7 M urea. b) High-salt wash: 50 mM Tris-HCl, pH 7.4; 1 M NaCl; 1 mM EDTA; 1 % NP-40; 0.5 % sodium Proteinase K (Roche, 1373196), RNA deoxycholate; 0.1 % SDS. phenol/chloroform (Ambion, 9722), glycoblue (Ambion, 9510), 3 M sodium acetate pH 5.5 c) PNK wash: 20 mM Tris-HCl, pH 7.4; 10 mM (Ambion, AM9740), absolute ethanol, Phase lock gel MaCl2; 0.2 % Tween-20. heavy 2ml (5 Prime, 2302830) Reagents: Protein A Dynabeads (Dynal, 100.02), 5) 5` adapter ligation. protease inhibitor cocktail (Calbiochem, 535140), ANTI-RNase (Ambion, AM2692), RNase I (Ambion, a) TE-buffer: 10mM Tris-HCL, pH 7.4; 1 mM AM2295), Turbo DNase (Ambion, AM2239), EDTA. 80% ethanol, L5 adapters (Dharmacon): Magnetic stand (Invitrogen), Thermomixer R L5: ACACGACGCUCUUCCGAUCU (Eppendorf) Gel purification of cDNA. 3) 3` RNA adapter ligation. 2x TBE-urea loading buffer (Invitrogen, LC6876), 15 Shrimp alkaline phosphatase (Promega, M820A), well 10% TBE-urea gel (Invitrogen, EC68755BOX), Shrimp alkaline phosphatase buffer (Promega, 1 ml syringe plunger, Costar SpinX column (Corning, M821A), RNA ligase (NEB, M0204L), 10x RNA 8161), 1 cm glass pre-filter (Whatman, 1823010). ligation buffer (NEB, B0204S), Polyethylene glycol (PEG) 400 (Sigma, 81170), RNasin Plus(Promega, 6) Reverse transcription. N2611), 4x Nupage loading buffer (Invitrogen, dNTP set (GE healthcare, 27 2035 01), Superscript NP0007), L3 adapters (Dharmacon): III, RT buffer and 0.1 M DTT (Invitrogen, 18080- L31: P-UGAGAUCGGAAGAGCGGUUCAG-Puro 093), PCR cycler (Biorad i-cycler). L32: P-GAAGAUCGGAAGAGCGGUUCAG-Puro RT primer: CTGAACCGC L33: P-CCAGAUCGGAAGAGCGGUUCAG-Puro 7) PCR amplification. L34: P-AUAGAUCGGAAGAGCGGUUCAG-Puro 2x Phusion flash high-fidelity PCR (Fermentas, F548), SYBR green II (Invitrogen, S7564), UV 5` RNA phosphorylation. imaging facility. 10x PNK buffer and T4 Polynucleotide Kinase (3` PE PCR primers phosphatase minus) (NEB, M0236L), 32P-γ- ATP, 10 mM ATP 5`: AATGATACGGCGACCACCGAGATCTACA 4) RNA Purification. CTCTTTCCCTACACGACGCTCTTCCGATCT SDS-PAGE electrophoresis and nitrocellulose 3`:CAAGCAGAAGACGGCATACGAGATCGGTC transfer. TCGGCATTCCTGCTGAACCGCTCTTCCGATCT Novex NuPAGE 4-12 % Bis-Tris gel (Invitrogen, Oligonucleotide sequences © 2006 and 2008 Illumina, NP0321), 20x MOPS Novex NuPAGE running Inc. All rights reserved. buffer (Invitrogen, NP0001), nitrocellulose

Comment RNA adapters are designed for pair-end sequencing using Illumina Genome Analyser. The 3` adapter contains 5` phosphate and 3` puromycin to allow ligation to CLIP RNA, and prevent self- circularisation. The sequence of the 3` RNA adapter is reverse complementary to the last 20 nucleotides of the 3` sequencing primer. To allow multiplexing during sequencing, each adapter contains two additional nucleotides at the end. The different 3` adapters can be used for different experiments as well as for a control, allowing these to be sequenced in the same lane of a flowcell. The barcoding later allows identification of sequences specific for each experiment. The sequence of the 5` RNA adapter is identical to the last 20 nucleotides of the 5` sequencing primer. PE PCR primer sequences were as provided by Illumina for preparation of the Solexa paired-end libraries.

CLIP Protocol

1) UV cross-linking. For tissue: c) Split cell suspension into 2 ml tubes, and centrifuge at maximum speed in a tabletop centrifuge Instructions here are given for 50-100 mg of starting for 3 minutes. amount of tissue. d) Remove supernatant, snap freeze pellets on dry a) Add 10 volumes of cold PBS and partially ice, and store at -80°C until further use. dissociate the tissue by triturating using a 5 or 10 ml pipette. Add a 200 μl pipette tip to the end of 5 or 10 For cell culture: ml pipette, and further dissociate the tissue by a) For adherent cells, grow cells on 10 cm tissue passing through the tips several times. It is not culture dishes until 80% confluent. necessary to disrupt the tissue into single cells for tissue cross-linking, as UV light can penetrate a few b) Remove media, add 6 ml of cold PBS and place in cell layers. Stratalinker on ice with the lid off. Irradiate once for 150 mJ/cm2. b) Transfer to 10 cm tissue culture dish, place on a tray with ice and irradiate suspension 3 times on ice c) Scrape off the cells and split into three 2 ml tubes. for 100 mJ/cm2 in Stratalinker. Mix suspension Centrifuge at maximum speed in a tabletop centrifuge between each irradiation. for 3 minutes. d) Remove supernatant, snap freeze pellets on dry ice, and store at -80°C until further use.

Comment On a western blot of crosslinked cells, we have so far only been able to detect the protein migrating at its normal molecular weight, and not the crosslinked protein, suggesting that UV crosslinking between RNA and proteins is inefficient. Other methods have used formaldehyde to crosslink RNA to proteins with higher efficiency (Niranjanakumari et al., 2002), but this has the disadvantage of being less specific for the direct protein-RNA interactions and also requiring an incubation of the cells with a potentially toxic reagent.

2) Immunoprecipitation Prepare antibody-conjugated Dynabeads: d) Rotate at room temperature for 30-60 minutes. a) For each experiment use 100 μl of protein A e) Wash 3 times with lysis buffer and leave beads in Dynabeads. Resuspend the beads and transfer 100 μl last wash until you are ready to add the lysates. to a non-sticky 1.5 ml tube. Prepare RNase-treated cell extract: b) Wash beads 3 times with lysis buffer. f) Resuspend each pellet of cross-linked material in 1 c) Resuspend in 200 μl of lysis buffer and add 1-5 μg ml lysis buffer. It is optional to add 10 μl protease of antibody depending on the efficiency of the inhibitor and 1 μl ANTI-RNase (The ANTI-RNase antibody. inhibits RNase A, the predominant RNase in mammalian tissues, but does not inhibit RNase I. k) Make a dilution of RNase I at 1:1000 in lysis This allows for more standardised RNase conditions buffer (low-RNase). to be applied to diverse biologic source materials). l) Add 10 μl RNase dilution and 5 μl Turbo DNase g) Sonicate on ice until cells or tissue are dissociated. per 1 ml of lysates (Turbo DNase is used because it is Avoid foaming of the lysates. active in 100 mM NaCl). Incubate at 37°C for 3 minutes, then place on ice for 3 minutes. h) Centrifuge at maximum speed at 4oC for 3 minutes. Immunoprecipitate: i) Carefully collect the supernatant and transfer it to m) Add the solution to the antibody-conjugated a new 2 ml tube. Dynabeads. j) Optional: make a dilution of RNase I at 1:50 in n) Rotate at 4°C for 2 hours or overnight. lysis buffer (high-RNase). o) Discard the supernatant. Wash beads 2 times with high-salt buffer and 2 times with PNK buffer.

Comment

RNase I is advantageous relative to other RNAses since it has no nucleotide bias. This avoids sequence biases that could be introduced by other RNases. For instance, micrococcal nuclease preferentially cleaves 5` of A or T, RNAse A cleaves 3` of C or U and RNAse T1 3` of Gs. The protocol also uses Turbo DNase instead of standard DNase I, since Turbo DNase is active in conditions of up to 200 mM NaCl.

3) 3` RNA adapter ligation 3` RNA dephosphorylation and adapter ligation (low e) Incubate in cooled Thermomixer R at 16°C for 16 RNase experiment only, high RNase experiment go to hours with intermittent shaking. step 3g) f) Wash beads once with PNK buffer. a) Remove the PNK wash buffer and resuspend the 5' RNA phosphorylation beads in 10 μl of the following: g) Remove wash buffer and add 5 μl of hot PNK mix • 1 μl Shrimp alkaline phosphatase to the beads: • 1 μl 10x Shrimp alkaline phosphatase buffer • 0.5 μl T4 Polynucleotide Kinase (3' phosphatase

• 8 μl dH2O minus) b) Incubate in Thermomixer R at 37°C for 20 min, • 0.5 μl 32P-γ-ATP with intermittent shaking on 1000 rpm. • 0.5 μl 10x PNK buffer c) Discard the supernatant. Wash beads 2 times with • 3.5 μl dH O high-salt buffer and 2 times with PNK buffer. Rotate 2 the second high-salt wash at 4oC for 1 minute. Incubate in a Thermomixer R at 37°C for 5 minutes at 1000 rpm. d) Remove supernatant from remaining beads and resuspend in the following mix: h) To low RNase experiment add 5 μl of cold PNK mix to the beads: • 3.5 μl dH2O • 1 μl 10mM ATP • 0.75 μl 10x RNA ligation buffer • 0.5 μl 10x PNK buffer • 2.5 μl PEG 400 • 3.5 μl dH O • 0.25 μl RNA ligase 2 i) Incubate in a Thermomixer R at 37°C for 10 • 0.1 μl RNasin plus minutes at 1000 rpm. • 3 μl L3 adapter (20 μM) j) Remove supernatant and discard as radioactive k) Incubate in a Thermomixer R at 70°C for 10 waste appropriately. Add 20 μl 1x Nupage loading minutes at 1000 rpm, place on magnet and collect the buffer. supernatant.

Comment PEG 400 is used in the ligation mixture because we found it increases ligation efficiency dramatically (up to a hundred fold). If paired-end sequencing will be carried out, different L3 adapters can be used for each experiment. Each adapter contains a different barcode sequence, allowing for easy identification of experiments after sequencing. Instead of labelling the CLIP RNA using T4 Polynucleotide Kinase, and alternative is to radiolabel the L3 RNA adapter. This might be necessary in some cases to confirm that RNA is being visualised, especially if this can not be tested by comparing the high and low RNAse conditions. For instance, when analysing the micro-RNA bound to Argonoute proteins, the protein-RNA complex migrates as a sharp band regardless of the RNase concentration, therefore using radiolabelled L3 RNA adapter was advantageous (Chi et al., 2009).

4) RNA purification SDS-PAGE electrophoresis and nitrocellulose transfer. f) Make a 2 mg/ml proteinase K solution in PK buffer and incubate at 37°C for 2 min to digest any a) Load a 9 or 10 well Novex NuPAGE 4-12% Bis- contaminating RNAse. Tris gel. Use 500 ml 1x MOPS running buffer. g) Add 200 μl of proteinase K solution to each tube b) Run gel at 200 V, and afterwards transfer to of isolated membrane and incubate at 37°C for 20 nitrocellulose membrane using Novex wet transfer min. apparatus. h) Add 200 μl of PK/7M urea buffer and incubate for c) Rinse the membrane in 1xPBS, and gently blot a further 20 minutes at 55°C. dry. Wrap in plastic wrap and expose to autoradiogram overnight. If the signal is i) Transfer the solution to a 2 ml Phase lock gel tube overexposed, then also expose for one hour or less. and add 400 μl RNA phenol/chloroform. Incubate in Thermomixer R at 37°C for 5 min at 1000 rpm. RNA isolation j) Centrifuge for 5 min at maximum speed in a d) Analyse the autoradiogram, and use the high- tabletop centrifuge at room temperature and pour the RNase sample to determine the specificity of the aqueous phase into a clean 1.5 ml tube. RNA-protein complexes. See the comment below to decide where to cut out a band corresponding to the k) Add 1 μl of glycoblue and 50 μl of 3 M sodium protein-RNA complex. acetate, pH 5.5 and mix well. Add 1 ml of absolute ethanol, mix well and precipitate at -20°C for 1 hour e) Use a clean scalpel blade to excise a piece of or overnight. Centrifuge precipitating RNA samples membrane into a 1.5 ml tube. for 10 minutes at full speed in a 4oC tabletop centrifuge. Remove supernatant and carefully was pellet twice with 80% ethanol. Leave pellet to dry at room temperature for 3 minutes

Comment Analyse the autoradiogram to determine if the signal corresponds to a specific protein-RNA complex, and if the RNA is of the desired size distribution. Control experiments that lack the protein-RNA complex are crucial in initial optimisations; these include experiments that lack the antibody during immunoprecipitation, cell extract that lacks UV crosslinking, and cell extracts that lacks the RNA-binding protein (alternatively, knockdown cells, or cells overexpressing a tagged version of the protein can be used). In addition, comparison of the high and low RNase can test if the band representing bound RNA shifts up following low-RNase treatment. Based on the control experiments, calculate the distance of the specific band from the closest contaminating band. If your protein band migrates less than 10 kDa away from other contaminating protein band, then it will be difficult to isolate specific RNA targets – in this case, it is worth spending more effort in optimising immunoprecipitation (increasing the stringency by raising the amount of salt and detergents during the washes). If no contaminating bands are present on the gel, or if they are far from the specific band, then a band can be excised from the gel of 20 to 40 kDa above the MW of the protein of interest. In the RNA-protein complexes less than 20 kDa above the MW of the protein, the insert RNA might be too short to map to the genome, but these can still be excised for comparative purposes. The phase lock gel tubes are advantageous in separating RNA from the protein-containing phenol phase (step 4i). These tubes ensure that no phenol is carried over, which could inhibit the following RNA ligation reaction.

5) 5` RNA adapter ligation RNA Ligation b) Heat samples in Thermomixer R at 70oC for 5 minutes. a) Resuspend RNA pellet in the following mix: c) Load samples in a 10 or 15 well precast 10% • 5 μl dH O 2 TBE-urea gel in 1x TBE running buffer. • 0.75 μl 10x RNA ligation buffer d) Run gel at 180 V for 40 minutes. • 2.5 μl PEG 400 e) Cut out 2 bands per lane corresponding to 50-90 • 0.25 μl T4 RNA ligase nucleotide and 90-150 nucleotide products (see comment below) and transfer each to a 1.5 ml tube. • 0.25 μl RNasin plus f) Add 400 µl of TE-buffer to each gel piece and • 1.5 μl L5 adapter (20 μM) crush with a 1 ml syringe plunger. b) Incubate in cooled PCR cycler at 16°C for 16 g) Incubate in a Thermomixer R at 37°C for 2 hours hours. at 1100 rpm. c) Add TE buffer to a volume of 350 μl and h) Centrifuge tubes at full speed in a tabletop precipitate as in step 4k. centrifuge for 2 minutes at room temperature. Gel purification of cDNA i) Transfer the supernatant onto a Costar SpinX

a) Resuspend RNA in 8 μl of dH2O and 8 μl of 2x colum to which you have added two 1 cm glass pre- TBE-urea loading buffer. filters and spin at full speed for 1 minute in a tabletop centrifuge. j) Precipitate as in step 4k.

Comment The upper (lighter blue) dye runs at 120-150 nucleotides, and the lower (darker blue) dye runs at 20 nucleotides, and these can be used to guide excision: cut the lower band (50-90 nucleotides) from 2 cm below the bottom of the upper dye to 1 cm below, cut the upper band (90- 150 nucleotides) from 1 cm below to the middle of the upper light blue dye. Cutting lower than this is not advised as free linker could be incorporated into the sample, which could potentially contaminate the further steps.

6) Reverse transcription a) Resuspend RNA in the following mix: • 2 μl 5x RT buffer

• 6.25 μl dH2O • 0.5 μl DTT (0.1 M) • 0.5 μl RT primer (0.5 μM) • 0.25 μl Superscript III RT enzyme (200 U/μl) • 0.5 μl dNTP mix (10 μM) e) Incubate tubes for 5 minutes at 25oC, 20 minutes at 42oC, 40 minutes at 50oC and then hold at 4oC. d) Transfer solution to a 0.2 ml PCR tube and incubate in a PCR cycler at 70oC for 5 minutes, then f) Mix the samples to be multiplexed (see comment hold at 25oC whilst you add the following mix: below) and add TE-buffer to a total volume of 350 μl. Precipitate as in step 4k.

Comment A few amino acids remain covalently attached to the RNA at the crosslink site after the proteinase K digestion. Primer extension assays have shown that the majority of cDNAs prematurely truncate immediately before the 'crosslink nucleotide' (Urlaub et al., 2002). Such truncated cDNAs will not contain the sequence of the 5` adapter, therefore CLIP requires that reverse transcription passes over the residual amino acids.

7) PCR a) Resuspend cDNA in the following mix: f) Heat samples in PCR cycler at 70oC for 5 minutes.

• 9.5 µl of dH2O g) Load samples in a 10 or 15 well precast 6% TBE- urea gel in 1x TBE running buffer, along with DNA • 0.5 µl PE PCR primer mix (10 µM each) size ladder. • 10 µl 2x Phusion Flash High-Fidelity PCR h) Run gel at 180 V for 40 minutes. Master Mix i) Stain gel in 1x SYBR green II solution for 5 d) Run in PCR cycler with the following settings: minutes and visualise with UV. 95°C for 10 minutes, 25-35 cycles of 95°C for 10 seconds, 65°C for 10 seconds and 72°C for 20, then j) If clean products of expected sizes can bee seen 72°C for 3 minutes. (relating to high and low cuts on cDNA purification gel), submit samples for Illumina high-throughput e) Mix 5 µl of PCR product with 5 µl 2x TBE-urea sequencing. loading buffer.

Comment PE PCR primers prepare libraries that can either be sequenced from only a single end (SE) or both ends (PE). Current GA2 protocols can generate over 50 nucleotide sequences with SE sequencing, which is generally sufficient for the CLIP method. However, these primers allow PE sequencing, which can be advantageous in some cases. The number of PCR cycles needs to be optimised for each experiment. It primarily depends on the amount of starting RNA, and that depends on the efficiency of the RNA-protein cross-linking by the UV light, and the amount of starting tissue or cells used. For initial experiments, 30 and 35 cycles can be done, and the minimal number of cycles necessary to obtain a product is then used for further experiments. When analyzing the data of individual CLIP experiments, multiple sequences mapping to the same position in the genome can only be counted once, since it is not possible to know whether these are a result of PCR amplification of the same or different cDNA molecules. However, if the sequence coverage on the RNA was good enough, the methods using high-throughput sequencing (referred to as HITS-CLIP or CLIP-Seq) were able to identify the primary binding sites on RNAs by analyzing clusters of overlapping sequences (Licatalosi et al., 2008; Yeo et al., 2009).

Acknowledgments

We thank our lab members for their advice and comments. This work was supported by Medical Research Council UK and European Research Council.

References

Bertolotti, A., and Ron, D. (2001). Alterations in an IRE1-RNA complex in the mammalian unfolded protein response. J Cell Sci 114, 3207-3212. Chi, S. W., Zang, J. B., Mele, A., and Darnell, R. B. (2009). Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature 460, 479-486. Dredge, B. K., Stefani, G., Engelhard, C. C., and Darnell, R. B. (2005). Nova autoregulation reveals dual functions in neuronal splicing. Embo J 24, 1608-1620. Elbashir, S. M., Lendeckel, W., and Tuschl, T. (2001). RNA interference is mediated by 21- and 22- nucleotide RNAs. Genes Dev 15, 188-200. Granneman, S., Kudla, G., Petfalski, E., and Tollervey, D. (2009). Identification of protein binding sites on U3 snoRNA and pre-rRNA by UV cross-linking and high-throughput analysis of cDNAs. Proc Natl Acad Sci U S A 106, 9613-9618. Hui, J., Hung, L. H., Heiner, M., Schreiner, S., Neumuller, N., Reither, G., Haas, S. A., and Bindereif, A. (2005). Intronic CA-repeat and CA-rich elements: a new class of regulators of mammalian alternative splicing. Embo J 24, 1988-1998. Kanopka, A., Muhlemann, O., and Akusjarvi, G. (1996). Inhibition by SR proteins of splicing of a regulated adenovirus pre-mRNA. Nature 381, 535-538. Licatalosi, D. D., Mele, A., Fak, J. J., Ule, J., Kayikci, M., Chi, S. W., Clark, T. A., Schweitzer, A. C., Blume, J. E., Wang, X., et al. (2008). HITS-CLIP yields genome-wide insights into brain alternative RNA processing. Nature 456, 464-469. Niranjanakumari, S., Lasda, E., Brazas, R., and Garcia-Blanco, M. A. (2002). Reversible cross- linking combined with immunoprecipitation to study RNA-protein interactions in vivo. Methods 26, 182-190. Ule, J., and Darnell, R. B. (2006). An RNA map predicting Nova-dependent splicing regulation. Nature. Ule, J., Jensen, K., Mele, A., and Darnell, R. B. (2005). CLIP: A method for identifying protein- RNA interaction sites in living cells. Methods 37, 376-386. Ule, J., Jensen, K. B., Ruggiu, M., Mele, A., Ule, A., and Darnell, R. B. (2003). CLIP identifies Nova-regulated RNA networks in the brain. Science 302, 1212-1215. Urlaub, H., Hartmuth, K., and Luhrmann, R. (2002). A two-tracked approach to analyze RNA- protein crosslinking sites in native, nonlabeled small nuclear ribonucleoprotein particles. Methods 26, 170-181. Wang, Z., Tollervey, J., Briese, M., Turner, D., and Ule, J. (2009). CLIP: construction of cDNA libraries for high-throughput sequencing from RNAs cross-linked to proteins in vivo. Methods 48, 287-293. Yeo, G. W., Coufal, N. G., Liang, T. Y., Peng, G. E., Fu, X. D., and Gage, F. H. (2009). An RNA code for the FOX2 splicing regulator revealed by mapping RNA-protein interactions in stem cells. Nat Struct Mol Biol 16, 130-137.