Supplementary Material and Methods s2

SUPPLEMENTARY MATERIAL AND METHODS:

Patient samples, clinical data, phenotypic and functional studies of CLL B-cells.

Peripheral Blood Mononuclear Cells (PBMC) were obtained from 26 patients with a typical diagnosis of CLL. The diagnosis of CLL relied on cytological features of mature lymphocytes and a characteristic phenotype (CD5+, CD23+, low expression of CD79b, and of immunoglobulin surface). Samples were also characterized at molecular level through CD38, LPL expression and IGHV mutational profile as well as Fluorescence In-situ Hybridization (FISH) analysis (Table 1). Blood collection was carried out in a period close to the diagnostic time. The PBMCs were isolated by centrifugation on Ficoll-Hypaque (Sigma Aldrich, USA) and cryopreserved in liquid nitrogen. Phenotypic analysis of leukemic cells was performed as described in(1). All patients were followed at the Hospital Maciel from Montevideo and provided an informed consent in accordance with the ethical regulations from Uruguay and the Helsinki Declaration.

RNA Extraction and analysis of LPL transcripts by PCR. Genomic DNA and RNA extraction were performed with TRIZOL reagent (Sigma Aldrich, USA). cDNA synthesis as well as reverse transcription–polymerase chain reaction (RT-PCR) and quantitative real-time PCR (QRT-PCR) for LPL amplification were performed as described in (2). Relative expression levels of LPL gene in CLL samples were obtained by calculated the Ct values using the mean Ct of the 5 healthy donor PBMC cell samples as a calibrator. In the case of 5-Aza-dC treatment as well as for the different activations by TLR1/2, TLR9, BCR, CD40/IL-4 receptors and activated autologous T-cells cultures, the Ct values were calculated with the mean Ct of treated and control cells.

Methylation Analysis. CpG island in the 5'-region of LPL gene was identified by EMBOSS/CpGPlot/CpGReport/Isochore software (http://www.ebi.ac.uk/Tools/emboss/). Two regions of the CpG island encompassing 52 CpG dinucleotides (R1 and R2 as it shown in figure 1) were chosen for bisulphite sequencing analysis. Five hundred ng of genomic DNA was treated with sodium bisulphite using the the Methylcode Bisulphite Conversion Kit (Invitrogen, USA) according to the manufacturer’s instructions. Bisulphite-sequencing primers (BSP) were designed with Methyl Primer Express Software V 1.0 (Applied Biosystem, USA). The PCR product was cloned in the pGEM T-Easy (Promega, USA) and sequenced. Five clones of each CLL patients were performed and the sequences analyzed by BiQ Analyzer software (Max-Planck Institut fur Informatik, Germany). Methylation specific Primer-PCR (MSP-PCR) were performed using two sets of specific primers for unmethylated and methylated LPL in order to amplify R1-LPL region. CLL B-cells stimulation with different microenvironment signals and co-cultures with activated T cells. Stimulation of PBMCs from Mut CLL patients without LPL expression were carried out on 2.5 x 106 cells/ml, cultured in RPMI 1640 media supplemented with 10% fetal bovine serum (FBS), 4mM glutamine, 100U/ml penicillin and 100mg/ml streptomycin. Activation with human soluble CD40L (Preprotech, Mexico, S.A.) and IL-4 (Preprotech, Mexico, S.A.) was performed for 4 days at 5g/ml and 5ng/ml, respectively. In turn, B cell receptor (BCR) stimulation was achieved by anti-IgM (Jackson ImmunoResearch, USA) immobilized to culture plates at 15µg/ml and the cells collected after 4 days. TLRs stimulation were performed by 3µM CpG-ODN (TCGTCGTTTTGTCGTTTTGTCGTT) via a TLR9 stimulus, or 500ng/ml of Pam3CSK4 (InvivoGen, USA), via TLR1/2 ligand. Cell harvest was achieved at 2 days. Samples were used for RNA and DNA extraction and for immunofluorescence and flow cytometry analysis. Cell- proliferation was evaluated by intracellular detection of Ki-67 protein through anti–human Ki-67 antibody. The success of TLRs activation was tested by flow cytometry evaluating the expression of CD25, CD80 and CD86 on CD19+ cells leukemic cells (supplemental figure). Autologous T cell activation has been performed as follows: after PBMC isolation, cells were cultured for 96hs (1 x 10 6 cells/ml) into a 48-well cell culture plate with immobilized anti-CD3 mAb (500 ng/well, clone UCHT1, kindly provided by Dr. Claire Hivroz from Institut Curie, Paris, France) (activated T cell cultures) or the corresponding isotype control antibody (control cultures). All collected cells fractions after stimulation (CD40L, BCR, TLRs and activated T-cells) were isolated by positive selection using the specific antibody anti-CD19 (clone HIB19, from Immunotech, Marseille, France) and magnetic beads (MagnaBind Beads, from Pierce, Rockford, IL, USA).

Flow cytometry analysis. Briefly, 1x106 PBMCs were fixed in phosphate-buffered saline (PBS) 3,7% paraformaldehyde and permeabilized with PBS containing 0.5% saponin and 4% FBS before the addition of the specific antibody. Anti–human Ki-67 Alexa Fluor 647, (Santa Cruz Biotechnology, Inc. USA), Anti-CD19- PerCP, clone SJ25C1, anti-CD25-PE, clone M-A251, anti-CD80-PE, clone 2331 and anti-CD86- FITC, clone L307-4 (BD Biosciences, CA, USA), were incubated for 45 minutes at 4°C. Following, the cells were washed twice and analyzed by flow cytometry. Negative isotype controls were performed by incubating the cells with irrelevant antibody in the same experimental conditions. Results were analyzed by Summit v4.3 software from Dako Inc., Carpinteria, CA, USA.

Demethylation treatment with 5-aza-2´-deoxycytidine. Daudi cell line was cultured in RPMI 1640 media supplemented with 10% FBS, 4mM glutamine, 100 U/ml penicillin and 100 mg/ml streptomycin. Cells were then subdivided to contain approximately 2 million cells/mL 12 hours before treatment. Follow this, cells were maintained over 3 and 5 days in supplemented RPMI media containing 5-Aza-2´-deoxycytidine (5-Aza-dC) (Sigma Aldrich, USA) at final concentration of 10µM. Medium was changed every 24 hours. Control cells were cultured in similar way with no drugs added.

Epifluorescence microscopy. For intracellular detection of LPL, indirect immunofluorescence technique was performed using mAb anti-LPL, 5D2 antibody (kindly provided by Dr. J. Brunzell, University of Washington). For this, CLL B-cells from PBMC were isolated by B Cell Isolation Kit for B-CLL (http://www.miltenyibiotec.com), using MS Column and MiniMACS™ Separator (MiltenyiBiotec, Bergisch GERMANY). Isolated CLL B-cells were washed with PBS and 5U/ml heparin (Sigma Aldrich, USA) and fixed with 3.7% paraformaldehyde in PBS for 15 min at room temperature. Cells were washed and dropped on adhesion slides and permeabilized with 0.1% Triton X-100 in PBS. Nonspecific binding was blocked with 5% FBS in PBS. Preparations were first incubated with anti- LPL antibody in PBS/FBS overnight at 4ºC, and next with Alexa® Fluors 488-labeled goat anti- mouse antibody (Invitrogen, Carlsbad, CA, USA) for 1hr. Nucleolus were stained with 4',6- diamidino-2-phenylindole (DAPI). After three washes in PBS, preparations were visualized (100X magnification) and photographed in an Olympus inverted microscope CKX31, with U-MNIBA3 (Alexa ® Fluors 488) and U-MNUA2 (DAPI) filters.

Statistical analyses. Expression of LPL mRNA, Ki-67, CD25, CD80 and CD86 proteins as well as methylation percentage of R1-LPL region were compared between control samples and different activations subsets using either paired Wilcoxon Signed Rank Test or two tailed unpaired Student's t-test. Variables with P values of less than 0.05 were considered to be significant. The Spearman rank correlation coefficient was calculated to determine the strength of association between LPL expression and methylation percentage. P values ≤ 0.001 in this case are considered significant. Analyses were done using GraphPad Prism, version 5.0 (GraphPad Software, San Diego, CA).

BIBLIOGRAPHY 1. Oppezzo P, Magnac C, Bianchi S, Vuillier F, Tiscornia A, Dumas G, et al. Do CLL B cells correspond to naive or memory B-lymphocytes? Evidence for an active Ig switch unrelated to phenotype expression and Ig mutational pattern in B-CLL cells. Leukemia 2002; 16(12): 2438-2446. 2. Oppezzo P, Vasconcelos Y, Settegrana C, Jeannel D, Vuillier F, Legarff-Tavernier M, et al. The LPL/ADAM29 expression ratio is a novel prognosis indicator in chronic lymphocytic leukemia. Blood 2005 Jul 15; 106(2): 650-657.