Supplementary Tables s1

Supplementary Tables

GDNF induces RET-SRC-HER2-dependent growth in trastuzumab-sensitive but SRC-independent growth in resistant breast tumor cells Journal: Breast Cancer Research and Treatment Mossa Gardaneh*, Sahar Shojaei, Ahmad Kaviani , Babak Behnam *Corresponding author: Mossa Gardaneh, PhD Address: National Institute of Genetic Engineering and Biotechnology, Pazhoohesh Blvd, Tehran-Karaj HWY Kilometer 15, Tehran, Iran, PO BOX 14965/161. Email: [email protected], [email protected] Suppl. Table 1. Demographic characteristics of breast cancer patients

Patient Patient’s Tumor size Tumor Tumor Clinical ER/PR HER-2 group age (cm3) stage grade stage expression expression I 35 1.5 Primary III III +/+ - II 40 1.8 Primary III III -/- + III 42 2.2 Primary III III -/- + Suppl. Table 2. Primer sequences for RT-PCR Gene Primer Sequence Product Length NCBI Candidate (Forward, FW; Reverse, RV) (bp) Accession # HER2 FW: CGCTGCTGGGGAGAGAGTTC 676 NM_001005862.1 RV: GGTTCTGGAAGACGCTGAGG RET FW: GACTACTTGGACCTTGCGGC 182 NM_020975.4 RV: GGACTCTCTCCAGGCCAGTT hGPX-1 FW: CTTATCGAGAATGTGGCGTCCC 390 NM_000581.2 RV: GCCCACCAGGAACTTCTCAAAG Bax FW: GTGGTTGGGTGAGACTCCTC 216 NM_004324.3 RV: GCAGGGTAGATGAATCGGGG Bcl-2 FW: GAACTGGGGGAGGATTGTGG 211 NM_000633.2 RV: GAAATCAAACAGAGGCCGCA SRC FW: TGGAGCTCTGTGGGTCTCTG 141 NM_198291.1 RV: AGCTCTCGACATAGACCGGG HSP90 FW: GTCGCTATATAAGGCAGGCG 398 NM_005348.3 RV: CAGCCTTGGTCATTCCAATTCC SRC FW: GCTCGTTCATCCACATTGCC 372 NM_003743 RV: ACTACTTGTCATGCCAACGG AIB1 FW: CGTCCTCCATATAACCGAGC 258 NM_001174088 RV: TCATAGGTTCCATTCTGCCG MDM2 FW: GTAGAATTTGAAGTTGAATCT 216 NM_002392 RV: CTAGGGGAAATAAGTTAGCAC (PIK3CA) FW: GGACCCGATGCGGTTAGAG 446 NM_006218.2 (PI3K) RV: TCACGGTTGCCTACTGGTTC Akt FW: GAAGGACGGGAGCAGGC 344 NM_001014431.1 RV: TGTACTCCCCTCGTTTGTGC P53 FW: CCCCTCCTGGCCCCTGTCATCTTC 265 NM_001126118.1 RV:GCAGCGCCTCACAACCTCCGTCAT GAPDH1 FW: TTGCCATCAATGACCCCTTCA 173 BC083511 RV: CGCCCCACTTGATTTTGGA RNA samples were collected from treated cell samples, DNase treated and used for cDNA synthesis as described33. PCR reactions were carried out for 30 cycles consisting of denaturation at 94 °C for 45”, annealing at various temperatures (depending on primer set) for 1’ and extension at 72 °C for 45”. Suppl. Table 3. List of primary antibodies used for experiments Antibody MW Working Manufacturer (Catalog #) (KDa) Dilution c-RET 170 1:1000 Life Technologies (AHO1482) c-RET (pT1015) 175 1:1000 Cell Signaling (3221) HER2/ERBB2 185 1:500 Thermo Scientific (701399) HER2/ERBB2 (pT1248) 185 1:1000 Cell Signaling (2247) c-SRC 60 1:500 Santa Cruz (sc- 8056) c-SRC (pT416) 60 1:1000 Cell Signaling (2101) AKTps473 65 1:300 Invitrogen (700392) AKT (pS473) 65 1:500 Abcam (Ab18206) PI3K 85 1:1000 Abcam (Ab156109) PI3K (pY607) 85 1:500 Abcam (Ab182651) P53 53 1:400 Sigma (p5813) p53 (pS15) 53 1:400 Abcam (ab1431) Bcl2 26 1:1000 Sigma (p3170) BCL2 (pS87) 26 1:400 Abcam (ab73985 Bax 21 1:100 Invitrogen (336400) Bax (pS184) 21 1:300 Thermo Scientific (PA5-39778) MDM2 85 1:800 Thermo Scientific (MA1- 25896) MDM2 (pS166) 85 1:300 Abcam (ab58532) AIB1 160 1:1000 Thermo Scientific (MA5-15898) AIB1 (pT24) 160 1:1000 Cell Signaling (2979) Protein lysates were prepared and subjected to standard SDS-PAGE and Western blot analysis. Briefly, clarified protein lysates from each experimental condition (20–60 ng) were electrophoretically resolved on denaturing SDS polyacrylamide gels (8–12%), transferred to nitrocellulose membranes, blocked for 1 h in 5% non-fat dried milk, and then cut between determined molecular weight markers (Fermentas). The membranes were incubated with a primary anti-human antibody against each target molecule in the same blocking solution at 40 °C overnight. Antigen-antibody reactions were detected with horseradish peroxidase-conjugated secondary antibodies. Suppl. Table 3. Dose responses to each treatment in BC tumor cell liens

TZMB: IC50 (µg/µL) HNTC 8 TSTC 1 ± 0.01 TRTC 8

rGDNF: DCrGDNF (ng/mL) HNTC 12 ± 0.08 TSTC 3 ± 0.001 TRTC 5 ± 0.002

SARC: IDSARC (nM) HNTC 5 TSTC 3 TRTC 5

Definitions: IC50: Inhibitory Concentration-50 which is a dose of TZMB that kills 50% of the cells, DCrGDNF: Duplicating Concentration is rGDNF concentration needed for duplication of cell number order to determine IDSARC: Inhibitory Dose is SARC concentration that causes maximum SRC inhibition in each line. Suppl. Table 5. The effect of GDNF and TZMB on pro-growth molecules in TSTC and TRTC cells A. TSTC Target NO SARC PLUS SARC Molecule rGDNF/CT TZMB/CT rGDNF+TZMB/CT rGDNF/CT TZMB/CT rGDNF+TZMB/CT HER-2 115.4(**,#) 66.9(†) 103 109.6(***) 22.3(††) 97.14 HER-2P 135.3(**,#) 13.7(††) 57 116.1(***,#) 13.6(†††) 96.6 RET 178.2(**,##) 52.8(†) 128 116.7 125.6(†) 105 RETP 100.9(**) 60(††) 84 128.3(***) 3.5(††) 120.8 SRC 124.2(**) 57.8(†††) 121.1 107(*) 86.6 97.4 SRCP 277.3(**,##) 78.7(†) 178 98(*) 43.1(††) 97.4 AKT 190.7(***,###) 31.2(†††) 256 95(***) 54.9(†) 87.3 AKTP 126.2(**) 40.9(†††) 156.7 94.6(***,###) 7.3(†††) 48.2 PI3K 138(*,##) 95.3(†††) 221.6 83.6 75.7 68.6 PI3KP 152.7(**) 58.3(††) 170.3 96.3(***,##) 2.5(†††) 41.1 B. TRTC Target NO SARC PLUS SARC Molecule rGDNF/CT TZMB/CT rGDNF+TZMB/CT rGDNF/CT TZMB/CT rGDNF+TZMB/CT

HER-2 123 130 128.6 115.4(#) 123.1(†) 109.1

HER-2P 94.4 98.4 98.1 91.8 94.8 103

RET 149.1(***) 76.4(††) 154.5 115.6(*,#) 132.9(†) 96.8

RETP 151.7 144.2(†) 120.6 196.8(**,#) 87.5(†††) 210.1

SRC 155.2(*) 103.3(††) 173.5 100.2(*) 182.6(†) 149.9

SRCP 414.2(*,##) 232(††) 99.8 84.4(*, #) 95.6 94.5

AKT 221.9(*,#) 166 168.4 85.3 55.8(††) 73.6

AKTP 431.7(***,##) 104.3 344.3 71.8(#) 96.8(†) 105.9

PI3K 165(*) 131(††) 147.8 90.8(#) 89.3 93.9

PI3KP 161.8(**) 87.1(††) 159.5 93.5(*,#) 82.5(†) 105.2

The numbers in Tables (4) and (5) were collected by analyzing western blot gel images, as outlined in the Materials and Methods. Each number indicates the average percentage of three clones from the same tumor sample analyzed in triplicates. Significances of differences within single treatments and between single and GDNF+TZMB co- treatments are shown as below: ***, rGDNF/CTL versus TZMB/CTL; ###, rGDNF/CTL versus rGDNF+TZMB/CTL; †† TZMB/CTL versus rGDNF+TZMB/CTL. CT, untreated control. Suppl. Table 6. The effect of GDNF and TZMB on apoptosis molecules in TSTC and TRTC cells. A. TSTC Target NO SARC PLUS SARC Molecule rGDNF/CT rTZMB/CT rGDNF+TZMB/CT rGDNF/CT rTZMB/CT rGDNF+TZMB/CT AIB1 628.5(***, ###) 47.5(†††) 184.4 140.3(***, ###) 66.1(††) 48.2 AIB1P 418.5(***, ###) 46.2(††) 233.5 86.2(**, ###) 20.3 24.5 MDM2 293.2(***, #) 80.7(†††) 313.4 144.5(**, ##) 39 36.1 MDM2P 451.5(***, #) 98.8(†††) 327.5 245(**, ##) 40.1(†) 42.9 Bcl-2 309(***, ###) 91.7(††) 175.2 139.9(**, ###) 76.3 67.1 Bcl-2P 153(**,#) 57(††) 139.3 138.2(***, ###) 40.8(†) 57.1 BAX 62(***,###) 357.8(†††) 192.01 270.6(***, #) 118.6 102.1 BAXP 56.1(***, ###) 191.6 190.6 155.7(***,###) 859.6(†) 994 P53 99.5(**, ###) 265.4 180.2 183.4(***, ##) 672.1(†) 600.4 P53P 75.2(**, ##) 267.9 (†) 352.4 117.6(**, ##) 248(†) 266.2 B. TRTC Target NO SARC PLUS SARC Molecule rGDNF/CT TZMB/CT rGDNF+TZMB/CT rGDNF/CT TZMB/CT rGDNF+TZMB/CT

AIB1 168(**) 120(††) 158.46 137.8(#) 146.6(†) 154.3

AIB1P 185.4(*) 133.5(†) 187.74 120.9(##) 127.07 132.4

MDM2 117.5(*, #) 96.5(†) 103.7 104.35(**) 58.8(††) 101.8

MDM2P 92.5(**) 116.3(††) 94.68 306.7(**, ##) 96.12 105.3

Bcl-2 136.3(**) 64.4(††) 115.92 113.78 115.9 109.8

Bcl-2P 218(*, #) 143.6(†) 243.06 79.7(*, ##) 92.4(†) 103.2

BAX 42.2(**, ###) 91.4(†) 115.75 122.2(##) 123.3(†) 140.6

BAXP 98(#) 92.7 88.3 121.4 119.6(†) 130.5

P53 88.51(*, ###) 106.2(†) 130.8 251.9 239.2 230

P53P 56.7(***, ###) 106.3(†††) 217.64 191.8(*, #) 121.3(†) 174.6