Chloroflexus Aurantiacus 3581

Home , Chloroflexus aurantiacus

Role of the AcsF Protein in Chloroﬂexus aurantiacusᰔ† Kuo-Hsiang Tang, Jianzhong Wen, Xianglu Li, and Robert E. Blankenship* Departments of Biology and Chemistry, Campus Box 1137, Washington University, St. Louis, Missouri 63130

Received 26 January 2009/Accepted 27 March 2009

The green phototrophic bacteria contain a unique complement of chlorophyll pigments, which self-assemble efficiently into antenna structures known as chlorosomes with little involvement of protein. The few proteins found in chlorosomes have previously been thought to have a primarily structural function. The biosynthetic pathway of the chlorosome pigments, bacteriochlorophylls c, d, and e, is not well understood. In this report, we used spectroscopic, proteomic, and gene expression approaches to investigate the chlorosome proteins of the green filamentous anoxygenic phototrophic bacterium Chloroflexus aurantiacus. Surprisingly, Mg-protoporphyrin IX monomethyl ester (oxidative) cyclase, AcsF, was identified under anaerobic growth conditions. The AcsF protein was found in the isolated chlorosome fractions, and the proteomics analysis suggested that significant Downloaded from portions of the AcsF proteins are not accessible to protease digestion. Additionally, quantitative real-time PCR studies showed that the transcript level of the acsF gene is not lower in anaerobic growth than in semiaerobic growth. Since the proposed enzymatic activity of AcsF requires molecular oxygen, our studies suggest that the roles of AcsF in C. aurantiacus need to be investigated further. jb.asm.org The unique chlorosome antenna complexes found in green monomethyl ester anaerobic cyclase (BchE). The roles of the phototrophic bacteria are the most densely packed pigmented AcsF and BchE proteins have been suggested to be conversion of light-harvesting complexes known and contain self-assembled Mg-protoporphyrin IX monomethyl ester into Mg-divinyl-proto- bacteriochlorophyll (BChl) c, d,ore aggregates (1). Chloro- chlorophyllide (PChlide) by catalyzing the isocyclic ring formation at Washington University in St. Louis on May 13, 2009 somes are central to the ability of green bacteria to carry out under aerobic and anaerobic conditions, respectively (Fig. 1) (21, photosynthesis under very low light conditions (2). While most 22). The acsF-like gene can be detected in diverse organisms, of the enzymes that contribute to the biosynthesis of BChl in from bacteria to algae and higher plants, whereas the gene en- protein-pigment light-harvesting antenna complexes have been coding BchE is found strictly in anaerobic bacteria. Interestingly, investigated in detail, there have been few studies of the en- both the acsF and bchE genes exist in C. aurantiacus. As a result, zymes involved in synthesis of chlorosome pigments. alternative roles for AcsF in the chlorosomes and in anaerobic Chlorosomes contain relatively few proteins compared to growth need to be considered, and some hypotheses are reported other photosynthetic antenna systems. The functions of most in this work. of the chlorosome proteins remain to be understood. For ex- ample, while Chloroflexus aurantiacus is one of the most inves- MATERIALS AND METHODS tigated green filamentous anoxygenic phototrophic (FAP) bac- Materials. DNA oligomers used in this work were purchased from Integrated teria, the functions of the chlorosome proteins are completely DNA Technologies and used without further purification. Enzymes and kits for unknown, except for CsmA, which is known to function as the the reported molecular biology studies are described below. baseplate pigment-binding protein and to mediate energy Cell cultures. Chloroflexus aurantiacus J-10-fl cells were cultured in “D” me- transfer from BChl c to BChl a in the integral light-harvesting dium as reported previously (7) under anaerobic and semiaerobic growth conditions at 48°C in low-intensity light (6 W/m2). Only one small air bubble in the complexes (13, 25). incubation bottle was allowed for anaerobic growth, whereas approximately half The genome of C. aurantiacus has been completely sequenced of the volume in the 200-ml bottle was filled with medium for semiaerobic growth (http://genome.jgi-psf.org/finished_microbes/chlau/chlau.home (see Fig. 2A). The cultures were harvested after 3 days, when the A863 and A742 .html), so combinations of biochemical and genetic studies have values were 0.46 and 1.57 for anaerobic growth and 0.48 and 0.97 for the semiaerobic growth, respectively. recently become possible. In this work, we used spectroscopic, Isolation and characterization of chlorosomes. C. aurantiacus cells were har- proteomic, and gene expression approaches to investigate the vested by centrifugation at 5,471 ϫ g for 15 min. After sonication and removal of chlorosome proteins and unexpectedly identified Mg-protopor- the cell debris by centrifugation at 20,000 ϫ g for 30 min, the membrane fraction phyrin IX monomethyl ester aerobic cyclase (AcsF) in chloro- was separated from the soluble fraction by ultracentrifugation at 200,000 ϫ g for somes under anaerobic growth conditions. Two cyclase enzymes 2 h. The chlorosomes, located in the membrane fractions, were fractionated using a 15 to 45% sucrose density gradient as reported earlier (4, 26). The are capable of forming the isocyclic ring (“E ring”) that is found purified chlorosome fraction was characterized by the UV/visible spectrum and in all (bacterio)chlorophylls: AcsF and Mg-protoporphyrin IX also subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis (12% Tris-glycine). SDS-PAGE analysis. For SDS-PAGE analysis, the chlorosome fraction was incubated in methanol at room temperature for 10 min and centrifuged, and the * Corresponding author. Mailing address: Departments of Biology supernatant liquid was removed to release the pigments and soluble components and Chemistry, Campus Box 1137, Washington University, St. Louis, from the chlorosome envelope. The pellet (the chlorosome envelope) was then MO 63130. Phone: (314) 935-7971. Fax: (314) 935-4432. E-mail: subjected to SDS-PAGE analysis. [email protected]. Protein identification by MALDI-TOF fingerprinting. In-gel protein digestion † Supplemental material for this article may be found at http://jb by trypsin for matrix-assisted laser desorption ionization–time-of-flight (MALDI- .asm.org/. TOF) analysis was used, following the procedure reported previously (6, 23). ᰔ Published ahead of print on 3 April 2009. Briefly, the Coomassie G-250-stained SDS-PAGE (12.5% Tris-glycine) gel was

3580 VOL. 191, 2009 AcsF IN CHLOROFLEXUS AURANTIACUS 3581

Mascot, with methionine, tryptophan, and histidine oxidation as the variable modiﬁcations. Atomic absorption spectrum measurements. The iron concentrations in the isolated chlorosome fraction were measured on an AA600 atomic absorption spectrometer (Perkin-Elmer, Ueberlingen, Germany) with a wavelength of 248.3

nm and Mg(NO3)2 as a modifier (9). The calibration was performed with 50, 16.6, and 5.5 ␮g/liter of Fe in the standard containing 100 ␮g/liter various metal ions. The chlorosome samples for the atomic absorption measurements were dialyzed against the metal-free distillation water before the measurements. The amount of Fe in the metal-free water is under the instrumental detection level (1.2 pg/liter or 0.0044 absorbance/s). Each measurement was carried out in triplicate, and the mean of triplicates was used. RNA isolation and purification. C. aurantiacus cells were harvested after 3 days’ growth under semiaerobic or anaerobic conditions. RNA was isolated from the cell pellets using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol, and possible DNA contamination was further removed by DNase treatment. The genomic DNA contamination in the RNA samples was examined by PCR (data not shown). The RNA samples were quantified using a Nano- Photometer UV/visible spectrophotometer (Implen, Munich, Germany) and had Ͼ Downloaded from an A260/A280 ratio of 1.95 prior to being subjected to the subsequent experi- ments. Two independent preparations of RNA samples under each growth condition were used to collect gene expression data (described below). Quantitative real-time PCR (QRT-PCR). QRT-PCR was carried out to profile FIG. 1. Proposed isocyclic ring formation catalyzed by AcsF and the gene expression under different growth conditions of C. aurantiacus. cDNA BchE under aerobic and anaerobic conditions. The oxygen sources for was synthesized from 1 ␮g RNA and 100 ␮M random 9-mer DNA using Super- AcsF and BchE are molecular oxygen and water molecule, respec- script III reverse transcriptase (Invitrogen). The QRT-PCRs were performed via tively. the ABI 7500 real-time PCR system (Applied Biosystems). The primers for jb.asm.org QRT-PCRs (shown in Table 1) were designed using the Primer Express 2.0 software program (PE Applied Biosystems) and analyzed by using the Oligo- Analyzer 3.0 software program (Integrated DNA Technologies). The Power 3 destained, and bands were excised and minced into ϳ1.0-mm pieces. After the SYBR green master mix (PE Applied Biosystems) was used to amplify DNA with at Washington University in St. Louis on May 13, 2009 Coomassie blue dye was removed, each gel sample was digested with ϳ6 ␮gof the following thermal cycles: an initial denaturation step (15 min at 95°C), proteomic-grade trypsin (Sigma) in either 500 ␮l of 50 mM ammonium bicar- followed by 40 amplification cycles (15 s at 95°C, 30 s at 60°C, and 45 s at 72°C) bonate or 20 mM Tris-HCl buffer (pH 8.0) at 37°C overnight. The digested and then 1 dissociation cycle (15 s at 95°C, 1 min at 60°C, and then 15 s at 95°C). peptides were extracted from the gel using 60% CH3CN and 1% trifluoroacetic The data were analyzed as suggested in the manufacturer’s protocol (Applied acid solution and analyzed using MALDI-TOF (Applied Biosystems 4700 pro- Biosystems). The threshold cycle (CT) was calculated as the cycle number at teomics analyzer) measurements. The MALDI-TOF samples were prepared by which ⌬Rn (the magnitude of the fluorescence intensity generated by the given ␣ ⌬ ϭ mixing a 1:1 volume of sample:matrix (10 mg/ml -cyano-4-hydroxycinnamic acid set of PCRs) crossed the baseline. Data were normalized by calculating CT Ϫ in 50% CH3CN, 0.1% trifluoroacetic acid) on an ABI-192-AB stainless steel CT of the target gene CT of the internal control gene (16S rRNA). Normalized ⌬ plate. Reflection positive mode was used for sample measurements. Each spec- CT data from C. aurantiacus cells growing in the anaerobic condition were trum was averaged by summing 40 measurements with 50 laser shots/measure- compared to data from C. aurantiacus cells growing in the semiaerobic condition, ⌬⌬ ϭ⌬ anaerobic Ϫ⌬ semiaerobic ment. The proteins were identified by searching the peptide masses against the in which CT CT CT . Each experiment was repeated bacterial entries in the NCBI database using the Mascot software program six times for validation, and the mean value was reported (Table 2). Further, the (Matrix Science, London, United Kingdom). The oxidation of methionine, tryp- amplified DNA fragments were verified by 1% agarose gel electrophoresis (see tophan, and histidine and the acrylamide adduct (C3H5NO) of cysteine were Fig. S1 in the supplemental material). included as variable modifications during the database search. In-solution trypsin digestion. Purified chlorosomes (80 ␮l) were incubated with trypsin (6 ␮g) in 180 ␮l (final volume) of 20 mM Tris-HCl buffer (pH 8.0) RESULTS at room temperature for 2 days. At the end of the incubation, the digested peptides were filtered by a Microcon YM-10 concentrator (Millipore) (28). The Growth of C. aurantiacus cultures under various conditions. flowthrough fraction was colorless, indicating that the chlorosome envelope In contrast to the strictly anaerobic environment required for remains largely undisrupted after protease digestions. The digested peptides growing green sulfur bacteria (GSB), green FAP bacteria, such were desalted by using ZipTip C18 (Millipore), dried, and resuspended in dou- as C. aurantiacus, are more tolerant of oxygen and are known ble-distillation water. The liquid chromatography-tandem mass spectrometry to grow under anaerobic, semiaerobic, and aerobic conditions (MS) studies were conducted using an LTQ-FT ICR machine (Thermo Fisher, San Jose, CA). Peptides were identified by searching the peptide accurate mass (7). The FAP bacteria function as phototrophs under anaero- (accuracy Ͻ 10 ppm) and the tandem mass against the NCBI database using bic and semiaerobic growth conditions in the presence of light

TABLE 1. Primers used for QRT-PCR studies

Gene Forward primer(s) (5Ј–3Ј) Reverse primer(s) (3Ј–5Ј) 16S rRNA AGATGTTGGGTTCAGTCCCG TTACTAGCAACTCCGCCTTCAC acsF (1) TCTATGCCGAGATGGTTAAGCA (1) CGCGGCTCATATACTTGAAAATG (2) CACGCCGGCTTTCTCAA (2) GCTTCTGCAACACCGTCAGA bchE (1) GCCGTCGCCATGACAAC (1) CTGCCTGACGAGAAGCTACGT (2) GGTCACCCGCGTGTTGAT (2) CACTGCCCTCTGCGAAGAAT csmM (1) TGATGTACGCCTTTGCTTCACT (1) CTTCCGCCCATTTCTCGAT (2) TGATGTACGCCTTTGCTTCACTA (2) CTTCCGCCCATTTCTCGAT csmN (1) CGGGCGATGGCTGAAGT (1) AGAGACGTTGGCCAGCTCTTT (2) GTCTCTGAACGGGTGGTTGAC (2) GGGCTGGGCAGGTTGATC 3582 TANG ET AL. J. BACTERIOL.

⌬ a ⌬⌬ b TABLE 2. CT and CT values for selected genes The formation of chlorosomes in green phototrophic bacte- c in QRT-PCRs ria (both GSB and FAP) has been routinely detected by the ⌬ CT A740 absorption of BChl c in the cell cultures. Figure 2B indi- ⌬⌬ cates that less chlorosome pigment is produced in semiaerobic Gene Anaerobic Semiaerobic CT growth growth growth (optical density at 740 nm [OD740] of 0.97) than in anaerobic growth (OD of 1.57), indicating that chlorosome 16S rRNA 0 0 0 740 acsF (1) 10.3 Ϯ 0.3 (1) 11.1 Ϯ 0.3 (1) Ϫ0.8 Ϯ 0.3 formation is sensitive to the oxygen level in the cultures. In (2) 10.9 Ϯ 0.2 (2) 11.6 Ϯ 0.2 (2) Ϫ0.7 Ϯ 0.2 contrast to the decrease of BChl c and chlorosomes, the reac- bchE (1) 7.8 Ϯ 0.4 (1) 12.3 Ϯ 0.3 (1) Ϫ4.5 Ϯ 0.3 tion center BChl a (with absorbance at 865 nm and OD sin Ϯ Ϯ Ϫ Ϯ 865 (2) 7.6 0.3 (2) 11.8 0.2 (2) 4.2 0.2 the anaerobic and semiaerobic cultures of 046 and 0.47, re- csmM (1) 6.4 Ϯ 0.2 (1) 11.6 Ϯ 0.3 (1) Ϫ5.2 Ϯ 0.3 (2) 6.0 Ϯ 0.2 (2) 11.6 Ϯ 0.5 (2) Ϫ5.6 Ϯ 0.4 spectively) and the carotenoid level (shown in the blue-green csmN (1) 5.1 Ϯ 0.3 (1) 10.5 Ϯ 0.3 (1) Ϫ5.4 Ϯ 0.3 region [400 to 500 nm] of the spectrum) are comparable in the (2) 3.6 Ϯ 0.5 (2) 11.2 Ϯ 0.6 (2) Ϫ7.6 Ϯ 0.6 semiaerobic cultures to those in the anaerobic cultures a ⌬ ϭ Ϫ CT CT of target gene CT of the internal control gene (16S rRNA). (Fig. 2B). b ⌬⌬ ϭ⌬ anaerobic Ϫ⌬ semiaerobic CT CT Ct . Characterization of the chlorosome. The chlorosomes de- c ⌬ ⌬⌬ The values for CT and CT in Table 2 were obtained from the various Downloaded from primer sets listed in Table 1. scribed in this work were isolated from the anaerobic cultures grown in low-intensity light, while the spectral features are similar between the chlorosomes puriﬁed from anaerobic and and as chemotrophs in the dark under aerobic growth condi- semiaerobic cultures (data not shown). Figures 2C and D show tions. In low-intensity light (6 W/m2), C. aurantiacus cultures that the reaction center BChl a, with absorbance at 865 nm, are dark green and are orange-red under anaerobic and semi- embedded in the cytoplasmic membrane (Fig. 2C), was clearly jb.asm.org aerobic conditions, respectively (Fig. 2A). The orange-red ap- absent in the puriﬁed chlorosome fraction of C. aurantiacus pearance in the semiaerobic culture can be partially explained (Fig. 2D). The disappearance of the 865-nm peak, along with by the presence of various isoforms of carotenoids, since C. au- the absorption at 740 nm, has been commonly used as a spec- rantiacus is known to contain large amounts of carotenoids (8). troscopic probe for identifying the isolated chlorosomes of C. at Washington University in St. Louis on May 13, 2009

FIG. 2. The appearance and spectra of C. aurantiacus cultures. The cultures were grown under semiaerobic (right) or anaerobic (left) conditions in low-intensity light (6 W/m2) (A). The spectra of C. aurantiacus cultures grown under anaerobic (solid line) or semiaerobic (dash line) conditions are shown (B). The spectrum of unfractionated chlorosomes and membrane (C) or the isolated chlorosome (D) is shown. The insets in panels C and D show the 800- to 900-nm spectral regions of the unfractionated chlorosome and puriﬁed chlorosome fraction, respectively. Abs., absorbance. VOL. 191, 2009 AcsF IN CHLOROFLEXUS AURANTIACUS 3583

fragments (sequence coverage, 49%) were found to match the predicted trypsin-digested patterns, with a score of 108 reported by Mascot (http://www.matrixscience.com/), which de- ﬁnes the sequence coverage as signiﬁcant when the score is Ͼ71. The acsF gene in C. aurantiacus encodes a 45-kDa peptide (375 amino acid residues). Several secondary structure prediction programs were used to provide the structure information of AcsF, CsmM, and CsmN (see Fig. S4 in the supplemental material), and most portions of these proteins are predicted to have either an ␣-helix or random coil conformation. To acquire the topology and more structural information for the three chlorosome proteins, we also subjected the isolated chlorosomes to in-solution trypsin digestion. The chlorosome envelope is a special lipid monolayer, in contrast to the lipid bilayer in other cellular membranes, so the transmembrane

prediction programs available at the website www.expasy.org Downloaded from are not suitable for predicting the topology of the chlorosome proteins. All of the chlorosome proteins are predicted to be soluble proteins. The MS for the in-solution digestion can identify only a few peptide fragments from AcsF in the isolated chlorosome samples (Table 3), suggesting that a signiﬁcant

portion of the AcsF protein is not accessible to protease. In jb.asm.org contrast, more peptide fragments for the chlorosome proteins CsmM and CsmN can be identiﬁed by in-solution digestion (Ta- FIG. 3. SDS-PAGE analysis of the isolated chlorosome fraction. ble 3), indicating that a large part of CsmM and CsmN is exposed

Mw, molecular size. at Washington University in St. Louis on May 13, 2009 to the solvent. Together, our studies suggest that the detected AcsF protein is associated with the chlorosome envelope. This observation is consistent with findings in previous studies that aurantiacus (4). The purified chlorosomes were also analyzed AcsF homologs and aerobic cyclases are found in the membranes by SDS-PAGE (Fig. 3), in which the most dominant bands on of Chlamydomonas reinhardtii (14, 15), Arabidopsis thaliana (30), the SDS-PAGE gel were excised and subjected to in-gel diges- barley (24), and Synechocystis sp. strain PCC 6803 (12). tion followed by MS analysis. In contrast to the GSB Chloro- Iron detected in the chlorosome fraction. A significant bium tepidum, in which 10 chlorosome proteins have been amount of Fe, 1.5 ␮g/ml in the chlorosome fraction with an identified (10), only three chlorosome proteins, CsmA (ϳ6 OD of ϳ20 per cm at 740 nm, was detected in the isolated kDa), CsmM (ϳ11 kDa), and CsmN (ϳ18 kDa), in C. auran- chlorosomes by atomic absorption spectroscopy (see Materials tiacus were reported previously by Fuller, Feick, and coworkers and Methods). Although Li and coworkers suggested that a (4, 16). As expected, our proteomics data confirmed that the putative iron-sulfur cluster protein, CsmY, is likely to locate in low-molecular-mass 11- and 16-kDa bands in SDS-PAGE (Fig. the chlorosome of C. aurantiacus (10), our SDS-PAGE data 3) are the CsmM and CsmN proteins, respectively (Fig. 4; see showed that even if CsmY does exist in our chlorosome frac- also Tables S1 and S2 in the supplemental material). The tions, the protein expression level is minor at best. Our data smallest chlorosome protein reported previously, CsmA, is not suggest that the detected Fe ions are most likely associated shown in the 12% SDS-PAGE gel in Fig. 3 but was detected in with abundant AcsF proteins in the chlorosome, since AcsF is an 18% SDS-PAGE gel instead (data not shown). Since CsmA proposed to contain the putative binuclear iron motif by se- is arguably the chlorosome protein whose structure and func- quence alignments and no Fe-binding motif can be identified tion have been most investigated (3, 11, 20, 29), studies de- in other reported chlorosome proteins from C. aurantiacus. scribed in this report focused on other relatively unknown Gene expression of acsF, bchE, csmM, and csmN. In addition chlorosome proteins in C. aurantiacus. to biochemical studies, we also applied gene expression anal- Identification of the AcsF protein in the chlorosome prepa- ysis to investigate the genes encoding the proteins described ration. In contrast to the low-molecular-mass peptides CsmA, above. RNA was extracted from the anaerobic and semiaero- CsmM, and CsmN, no higher-molecular-mass proteins in the bic cultures grown in low-intensity light and was analyzed using chlorosome were reported by Sprague and coworkers (26), so reverse transcription followed by QRT-PCRs. The data analyses we decided to identify the dominant ϳ40-kDa band on our for gene expression for acsF (caur_2590), bchE (caur_3676), SDS-PAGE gel by MS. Although a 0.95-kb RNA resulting csmM (caur_0139) and csmN (caur_0140) were performed us- from a cotranscribed csmM-csmN gene was found in Northern ing the 16S rRNA gene (caur_R0008) as the internal standard. blot analysis by Niedermeier et al. (17), the molecular mass of Two different primer sets were used for studying the expression the possible cotranslated product would have been around 30 of each target gene. As shown in Table 2, all of the targeted kDa. However, to our surprise, the dominant 40-kDa band was genes were upregulated under the anaerobic conditions com- identified by MS to be the magnesium-protoporphyrin IX pared to results under the semiaerobic conditions, except that monomethyl ester (oxidative) cyclase, AcsF (Fig. 4C; see also the expression levels of the acsF gene are rather similar in Table S3 in the supplemental material). Twenty-one digested response to different oxygen levels. The upregulation of the Downloaded from jb.asm.org at Washington University in St. Louis on May 13, 2009

FIG. 4. Mass spectra of CsmM (A), CsmN (B), and AcsF (C) after in-gel digestions. The data were collected by MALDI-TOF mass spectrometry. For clarity, not all of the identiﬁed peptides are labeled. The peptides including oxidation of methionine, tryptophan, or histidine .and with the acrylamide adduct of cysteine (∧) are shown (ء)

3584 VOL. 191, 2009 AcsF IN CHLOROFLEXUS AURANTIACUS 3585

TABLE 3. In-solution trypsin digestion of chlorosome samples

Protein name % Sequence coverage Peptide fragment sequencesa CsmM 54 MTESEGEVRV RSVPVRRNDS FVESAMEFGG GIVRLGFSIF TLPLALLPPE SRQHMHNATK ELMYAFASLP RDFAEIAGKS IEKWAEEGEE PKGEAK

CsmN 70 MSNETTNERD GLFEMAAGFV GGATRIGLTV ASVPLVLLPR NSRRRVRRAM AEVAMAVVAF PKELANVSER VVDDIFAADP PQINLPSPQR VGEQVRSFTE RLARAAEELG TSFSRAAGRA ADAVEQGAAK VDEWVETPPK TPPAP

AcsF 16 MFWINPLMME MPGEFSRTTR HALKEAILSP RFYTTDFKAI DRLEIDRNGL RDEFDWIRDE FAYDYNRTHF RRTDEFLQDF DDMPERDSFI DFLERSCTAE FSGCLLYAEM VKHLHDPTLR AIFKYMSRDE GRHAGFLNRT MADLNVALDL TVLQKRKKYT YFQPKFIFYS VYLSEKIGYS RYITIYRHLE RNPQYCIHPI FKWFEQWCND EYRHGEFFAL LMRSQPEMLE GVNRRWIRFF LLAVYATMYL NDARRSNFYA ALGLDWRDYD QTVIRLCNDI ATQVYPETMN LDDPRFFAYM DKLVEYDRAL RALESRKDPI AMAHSTRLKA AIALRLLAIY RLPTRKTTEA IRWKGLPGFP NYPGPNRPQR VVAAD Downloaded from a Matched peptides are shown in bold. The peptides were identified by peptide accurate mass (accuracy, Ͻ10 ppm) and tandem mass with methionine, histidine, and tryptophan oxidations included. bchE gene in anaerobic growth is consistent with the assump- anaerobic conditions (Fig. 1), as suggested in the studies of the tion that BchE, the anaerobic cyclase, is responsible for the purple bacterium Rubrivivax gelatinosus (18). formation of the isocyclic ring (the “E” ring) of BChls in Location of AcsF. Previous studies of AcsF in different or- jb.asm.org anaerobic bacteria. Since chlorosome formation is enhanced in ganisms demonstrated that AcsF is membrane associated (12, anaerobic growth, upregulated gene expression is also ex- 14, 15, 24, 30). It is interesting to note that Chl27, an AcsF pected for the chlorosome-associated proteins CsmM and analogue in Arabidopsis, is found to be equally distributed in at Washington University in St. Louis on May 13, 2009 CsmN (Table 2). It is not expected, however, that the acsF both the inner-envelope and thylakoid membranes (30). Thus, gene, encoding the “aerobic” cyclase, would be expressed un- it is possible that the AcsF proteins may also be present in the der both anaerobic and semiaerobic conditions, and the gene cytoplasmic membrane of C. aurantiacus. Work is in progress expression level is not lower under anaerobic conditions than to test this hypothesis. Nevertheless, it has been generally ac- under semiaerobic conditions. cepted that many plasma membrane protein complexes are absent from the chlorosome envelope, so if the AcsF protein is DISCUSSION present in the chlorosome envelope, some special features of AcsF may lead to its location there. Significance of this work. Although both the acsF and bchE Possible roles of AcsF in (the chlorosome of) C. aurantiacus. genes can be identified in the genome of C. aurantiacus,no If the roles of AcsF and BchE in C. aurantiacus are to catalyze studies of these proteins in C. aurantiacus or any green pho- isocyclic ring formation under different oxygen growth condi- totrophic bacteria have been reported. Two unexpected results tions, as proposed for some of the facultative bacteria (18), the were discovered in our studies. First, under anaerobic growth presence of abundant AcsF in anaerobic cultures and compa- conditions, when the bchE gene product is responsible for rable gene expression levels of acsF in anaerobic and semi- pigment synthesis, the AcsF proteins were detected by SDS- PAGE and the acsF gene was not downregulated. Second, the aerobic growth would not be expected. The fact that the AcsF AcsF proteins were detected in our isolated chlorosome frac- protein is abundant in anaerobic growth is puzzling, because tions. the function of AcsF has been suggested to be catalyzing iso- Coexistence of acsF and bchE genes in some phototrophs. cyclic ring formation under aerobic conditions with molecular 1 Our studies suggested the coexistence of the acsF and bchE oxygen as the oxygen source for installing the C-13 keto moi- gene products in the FAP bacterium C. aurantiacus under ety in the isocyclic ring of (bacterio)chlorophylls (22). Further, anaerobic conditions. In addition to C. aurantiacus, BLAST if the AcsF proteins in the chlorosome are directly or indirectly search and previous studies suggest the coexistence of the acsF involved in the formation of PChlide without the participation and bchE genes in several phototrophs, such as Roseiflexus sp. of oxygen molecules, one may expect that significant amounts (FAP), Roseiflexus castenholzii (FAP), Bradyrhizobium sp. of BchE would have been detected in the chlorosome. No such (purple bacterium), Rhodopseudomonas palustris (purple bac- results were observed in our studies, even though reverse tran- terium), Methylobacterium sp. (purple bacterium), Synechocys- scription-PCR data suggested that the bchE gene is upregu- tis sp. PCC 6803 (cyanobacterium) (12), Rubrivivax gelatinosus lated under anaerobic conditions (Table 2). (purple bacterium) (18), Rhodobacter sphaeroides (purple bac- Related to our work, an unexpected function was also dis- terium), and Roseobacter denitrificans (purple bacterium). covered in one of the BchE homologs in Synechocystis sp. strain Other than Synechocystis sp. strain PCC 6803, most of the PCC 6803, in which three bchE-like genes were suggested from bacteria mentioned above are facultative bacteria and can be the bacterial genome (12). Minamizaki et al. demonstrated grown under both aerobic and anaerobic conditions. The AcsF that none of the bchE genes have significant effects on PChlide and BchE proteins in those facultative bacteria have been formation and chlorophyll a biosynthesis under either aerobic proposed to catalyze isocyclic ring formation under aerobic or or “micro-oxic” growth conditions and found that one of the 3586 TANG ET AL. J. BACTERIOL. bchE mutants, the ⌬sll1242 mutant, can grow only on agar are responsible for iron storage, oxygen transport, phosphoryl plates and not in liquid medium (12). The authors suggested transfer, and other unidentified biological functions, comprise that that the sll1242 gene may play some important roles in hemerythrin, bacterioferritin, rubrerythrin, purple acid phos- Synechocystis sp. strain PCC 6803. Similarly, our presented phatases, etc. In the first type, the R2 subunit of the class I studies may also suggest additional roles for the putative AcsF ribonucleotide reductase is known to function as a proton- and/or BchE proteins in such facultative bacteria as C. auran- coupled electron transfer protein (27). It is possible that the C. tiacus. The sequence alignments indicate that in contrast to the aurantiacus AcsF protein may function as an electron transfer 70% or higher sequence identity detected between the BchE protein under anaerobic conditions and as an oxidoreductase protein in C. aurantiacus and those in other FAP, GSB, and with oxygen available. Some residues, such as three Cys resi- purple bacteria (see Fig. S2 in the supplemental material), dues in C. aurantiacus AcsF in the vicinity of the putative 50% or lower identity can be found between the AcsF protein binuclear iron binding sites, may directly or indirectly be in- in C. aurantiacus and those in most other organisms (except for volved in electron transfer. The functions of C. aurantiacus ϳ70% identity with that of Roseiflexus sp.) (see Fig. S3 in the AcsF under anaerobic and semiaerobic conditions may or may supplemental material), implying that AcsF in C. aurantiacus not be related. may have different properties. Taken together, it is likely that Vassilieva and coworkers found three [2Fe-2S] cluster chlo-

AcsF in C. aurantiacus has unrevealed biological functions, Downloaded from rosome proteins, CsmI, CsmJ, and CsmX, in C. tepidum and irrelevant to isocyclic ring formation, in the chlorosome enve- proposed that these proteins are important for the energy and lope during anaerobic growth. Here we discuss three working electron transfer in C. tepidum chlorosomes (31, 32), because hypotheses based on the data presented in this report and previous studies by other groups, as follows. [2Fe-2S] clusters play important roles in electron transfer and (i) AcsF and BchE in C. aurantiacus may be responsible for cellular signaling for a variety of organisms (19). At least two of the three genes encoding [2Fe-2S] proteins have been iden- biosynthesis of different BChls. The absorption spectra in Fig. jb.asm.org 2B suggest that the levels of the reaction center BChl a is tiﬁed for the GSB strains with sequence information available. almost the same in semiaerobic and anaerobic growth cultures, The authors postulated that in the presence of oxygen, the whereas the chlorosome level is signiﬁcantly lower in the semi- excitation energy quencher (likely to be chlorobiumquinone in at Washington University in St. Louis on May 13, 2009 aerobic cultures. Table 2 indicates that the gene expression GSB [2]) is activated by transfer of an electron directly or levels of acsF are comparable in anaerobic and semiaerobic indirectly to O2 and that [2Fe-2S] cluster proteins can inacti- growth and that gene expression of bchE is downregulated vate the quencher by transferring an electron to the quencher, under semiaerobic conditions. Thus, it is possible that AcsF so the excitation energy can be transferred from BChl c to the and BchE are responsible for biosynthesis of BChl a and BChl reaction center. However, it has been demonstrated that the c, respectively. However, several questions cannot be resolved redox-dependent quenching effect observed in GSB is not ob- with this hypothesis: (i) GSB, containing only the bchE gene, served in FAP bacteria (2). Thus, if AcsF functions as an can produce BChl a and BChl c, d,ore; (ii) some FAP bacteria electron transfer protein in the C. aurantiacus chlorosomes, the can generate only BChl a yet contain both the acsF and bchE role is probably not similar to the proposed roles of [2Fe-2S] genes; (iii) the difference in Fig. 1B could be due to down- proteins in C. tepidum or other GSB. stream gene expression being repressed for BChl c, but not (iii) The AcsF protein may serve as an iron transport pro- BChl a, biosynthesis under semiaerobic conditions; and (iv) tein. Most of the characterized binuclear iron center proteins more importantly, if AcsF is responsible for the isocyclic ring are involved in redox chemistry, but not the ferritin protein. A formation of BChl a under anaerobic conditions, a different BLAST search shows that AcsF proteins belong to the ferritin- reaction mechanism needs to be used by AcsF because molec- like superfamily, the class of binuclear iron center proteins ular oxygen is no longer available. Together, as with the roles responsible for iron storage and nonredox biological functions suggested for other photosynthetic bacteria (5), it is likely that (described above). Since iron is required for the function of BchE, a putative cobalamin and oxygen-sensitive [4Fe-4S] cytochromes in the electron transport chain, it is possible that cluster/S-adenosylmethionine-dependent enzyme, is responsi- AcsF is important for transporting the iron to the reaction ble for various isoforms of BChl biosynthesis in C. aurantiacus center and associated proteins near the chlorosome envelope. in anaerobic growth and that AcsF and/or BchE is required for If this hypothesis holds true, one may expect that different iron the biosynthesis of BChls under semiaerobic conditions. (ii) The AcsF protein in C. aurantiacus may be important for transport pathways are adopted in C. aurantiacus versus the electron transfer under anaerobic growth conditions. The non- case for the GSB and other anaerobic bacteria, in which the heme binuclear iron center proteins can be divided into two acsF gene is absent. major types. First,the oxidoreductase-type enzymes, catalyzing Altogether, it is clear that even for the most investigated the oxidation of chemical insertion hydrocarbons, include the FAP bacterium, C. aurantiacus, the role(s) of AcsF is far from soluble methane monooxygenase family, the stearoyl-ACP de- being understood. Additionally, since no studies have been saturase family, class I ribonucleotide reductase, etc. Electron described previously for AcsF and BchE in any green bacteria, transfer, dioxygen cleavage, and oxygen insertion are common which have a specialized photosynthetic compartment—the themes in these binuclear iron proteins, and such a mechanism chlorosome—caution is needed when comparing the proper- was proposed for the isocyclic ring formation catalyzed by ties and mechanism of action of AcsF and BchE in GSB and AcsF in the presence of oxygen (Fig. 1) (12). None of the FAP bacteria with the studies of high plants, algae, and other known binuclear iron oxidoreductases are functional without bacteria. We are currently investigating these two enzymes oxygen participation. Second, the ferritin-like proteins, which with both in vitro and in vivo studies. VOL. 191, 2009 AcsF IN CHLOROFLEXUS AURANTIACUS 3587

ACKNOWLEDGMENTS protein in the organization of bacteriochlorophyll c in chlorosomes of Chlo- roﬂexus aurantiacus. Eur. J. Biochem. 204:685–692. We thank the members of the Blankenship group for valuable tech- 17. Niedermeier, G., J. A. Shiozawa, F. Lottspeich, and R. G. Feick. 1994. The nical advice and Himadri B. Pakrasi for assistance with atomic absorp- primary structure of two chlorosome proteins from Chloroﬂexus aurantiacus. tion spectroscopy. We are grateful for the assistance of the Washington FEBS Lett. 342:61–65. University Mass Spectrometry Resource Center, supported by NIH 18. Ouchane, S., A. S. Steunou, M. Picaud, and C. Astier. 2004. Aerobic and NCRR grant no. 2P41RR000954. anaerobic Mg-protoporphyrin monomethyl ester cyclases in purple bacteria: This work was supported by U.S. Department of Energy Basic En- a strategy adopted to bypass the repressive oxygen control system. J. Biol. Chem. 279:6385–6394. ergy Sciences grant DE-FG02-07ER15846 to R. E. Blankenship. 19. Page, C. C., C. C. Moser, X. Chen, and P. L. Dutton. 1999. Natural engi- neering principles of electron tunnelling in biological oxidation-reduction. REFERENCES Nature 402:47–52. 20. Pedersen, M. O., L. Pham, D. B. Steensgaard, and M. Miller. 2008. A 1. Blankenship, R. E. 2002. Molecular mechanisms of photosynthesis. Black- reconstituted light-harvesting complex from the green sulfur bacterium well Science Ltd., Oxford, United Kingdom. Chlorobium tepidum containing CsmA and bacteriochlorophyll a. Biochem- 2. Blankenship, R. E., and K. Matsuura. 2003. Antenna complexes from green istry 47:1435–1441. photosynthetic bacteria, p. 195–217. In B. R. Green and W. W. Parson (ed.), 21. Pinta, V., M. Picaud, F. Reiss-Husson, and C. Astier. 2002. Rubrivivax ge- Anoxygenic photosynthetic bacteria. Kluwer Academic Publishers, Dor- latinosus acsF (previously orf358) codes for a conserved, putative binuclear- drecht, The Netherlands. iron-cluster-containing protein involved in aerobic oxidative cyclization of 3. Bryant, D. A., E. V. Vassilieva, N. U. Frigaard, and H. Li. 2002. Selective Mg-protoporphyrin IX monomethylester. J. Bacteriol. 184:746–753. protein extraction from Chlorobium tepidum chlorosomes using detergents. 22. Porra, R. J., W. Schafer, N. Gad’on, I. Katheder, G. Drews, and H. Scheer.

Evidence that CsmA forms multimers and binds bacteriochlorophyll a. Bio- 1996. Origin of the two carbonyl oxygens of bacteriochlorophyll a. Demon- Downloaded from chemistry 41:14403–14411. stration of two different pathways for the formation of ring E in Rhodobacter 4. Feick, R. G., M. Fitzpatrick, and R. C. Fuller. 1982. Isolation and charac- sphaeroides and Roseobacter denitriﬁcans, and a common hydratase mech- terization of cytoplasmic membranes and chlorosomes from the green bac- anism for 3-acetyl group formation. Eur. J. Biochem. 239:85–92. terium Chloroﬂexus aurantiacus. J. Bacteriol. 150:905–915. 23. Rosenfeld, J., J. Capdevielle, J. C. Guillemot, and P. Ferrara. 1992. In-gel 5. Gough, S. P., B. O. Petersen, and J. O. Duus. 2000. Anaerobic chlorophyll digestion of proteins for internal sequence analysis after one- or two-dimen- isocyclic ring formation in Rhodobacter capsulatus requires a cobalamin sional gel electrophoresis. Anal. Biochem. 203:173–179. cofactor. Proc. Natl. Acad. Sci. USA 97:6908–6913. 24. Rzeznicka, K., C. J. Walker, T. Westergren, C. G. Kannangara, D. von

6. Granvogl, B., P. Gruber, and L. A. Eichacker. 2007. Standardisation of rapid Wettstein, S. Merchant, S. P. Gough, and M. Hansson. 2005. Xantha-l jb.asm.org in-gel digestion by mass spectrometry. Proteomics 7:642–654. encodes a membrane subunit of the aerobic Mg-protoporphyrin IX mono- 7. Hanada, S., and B. K. Pierson. 2006. The family chloroflexaceae. Pro- methyl ester cyclase involved in chlorophyll biosynthesis. Proc. Natl. Acad. karyotes 7:815–842. Sci. USA 102:5886–5891. 8. Imhoff, J. F., and U. Bias-Imhoff. 1995. Lipids, quinones and fatty acids of 25. Sakuragi, Y., N. Frigaard, K. Shimada, and K. Matsuura. 1999. Association anoxygenic phototrophic bacteria, p. 179–205. In R. E. Blankenship, M. T. of bacteriochlorophyll a with the CsmA protein in chlorosomes of the pho- at Washington University in St. Louis on May 13, 2009 Madigan, and C. E. Bauer (ed.), Anoxygenic photosynthetic bacteria. Ad- tosynthetic green filamentous bacterium Chloroflexus aurantiacus. Biochim. vances in photosynthesis and respiration, vol 2. Springer, Dordrecht, The Biophys. Acta 1413:172–180. Netherlands. 26. Sprague, S. G., L. A. Staehelin, M. J. DiBartolomeis, and R. C. Fuller. 1981. 9. Keren, N., M. Liberton, and H. B. Pakrasi. 2005. Photochemical competence Isolation and development of chlorosomes in the green bacterium Chlo- of assembled photosystem II core complex in cyanobacterial plasma mem- roflexus aurantiacus. J. Bacteriol. 147:1021–1031. brane. J. Biol. Chem. 280:6548–6553. 27. Stubbe, J., D. G. Nocera, C. S. Yee, and M. C. Chang. 2003. Radical initiation 10. Li, H., N. U. Frigaard, and D. A. Bryant. 2006. Molecular contacts for in the class I ribonucleotide reductase: long-range proton-coupled electron chlorosome envelope proteins revealed by cross-linking studies with chloro- transfer? Chem. Rev. 103:2167–2201. somes from Chlorobium tepidum. Biochemistry 45:9095–9103. 28. Tang, K. H., A. Harms, and P. A. Frey. 2002. Identification of a novel pyridoxal 11. Milks, K. J., M. Danielsen, S. Persson, O. N. Jensen, R. P. Cox, and M. 5Ј-phosphate binding site in adenosylcobalamin-dependent lysine 5,6-amin- Miller. 2005. Chlorosome proteins studied by MALDI-TOF-MS: topology of omutase from Porphyromonas gingivalis. Biochemistry 41:8767–8776. CsmA in Chlorobium tepidum. Photosynth. Res. 86:113–121. 29. Theroux, S. J., T. E. Redlinger, R. C. Fuller, and S. J. Robinson. 1990. Gene 12. Minamizaki, K., T. Mizoguchi, T. Goto, H. Tamiaki, and Y. Fujita. 2008. encoding the 5.7-kilodalton chlorosome protein of Chloroflexus aurantiacus: Identification of two homologous genes, chlAI and chlAII, that are differ- regulated message levels and a predicted carboxy-terminal protein extension. entially involved in isocyclic ring formation of chlorophyll a in the cyanobac- J. Bacteriol. 172:4497–4504. terium Synechocystis sp. PCC 6803. J. Biol. Chem. 283:2684–2692. 30. Tottey, S., M. A. Block, M. Allen, T. Westergren, C. Albrieux, H. V. Scheller, 13. Montanõ, G. A., H. M. Wu, S. Lin, D. C. Brune, and R. E. Blankenship. 2003. S. Merchant, and P. E. Jensen. 2003. Arabidopsis CHL27, located in both Isolation and characterization of the B798 light-harvesting baseplate from envelope and thylakoid membranes, is required for the synthesis of proto- the chlorosomes of Chloroflexus aurantiacus. Biochemistry 42:10246–10251. chlorophyllide. Proc. Natl. Acad. Sci. USA 100:16119–16124. 14. Moseley, J., J. Quinn, M. Eriksson, and S. Merchant. 2000. The Crd1 gene 31. Vassilieva, E. V., M. L. Antonkine, B. L. Zybailov, F. Yang, C. U. Jakobs, encodes a putative di-iron enzyme required for photosystem I accumulation J. H. Golbeck, and D. A. Bryant. 2001. Electron transfer may occur in the in copper deficiency and hypoxia in Chlamydomonas reinhardtii. EMBO J. chlorosome envelope: the CsmI and CsmJ proteins of chlorosomes are 19:2139–2151. 2Fe-2S ferredoxins. Biochemistry 40:464–473. 15. Moseley, J. L., M. D. Page, N. P. Alder, M. Eriksson, J. Quinn, F. Soto, S. M. 32. Vassilieva, E. V., V. L. Stirewalt, C. U. Jakobs, N. U. Frigaard, K. Inoue- Theg, M. Hippler, and S. Merchant. 2002. Reciprocal expression of two Sakamoto, M. A. Baker, A. Sotak, and D. A. Bryant. 2002. Subcellular candidate di-iron enzymes affecting photosystem I and light-harvesting com- localization of chlorosome proteins in Chlorobium tepidum and character- plex accumulation. Plant Cell 14:673–688. ization of three new chlorosome proteins: CsmF, CsmH, and CsmX. Bio- 16. Niedermeier, G., H. Scheer, and R. G. Feick. 1992. The functional role of chemistry 41:4358–4370.