Supplemental Information
Survival Factor NFIL3 Restricts FOXO-induced Gene Expression in Cancer
Megan Keniry1, Maira M. Pires1,2, Sarah Mense2, Celine Lefebvre1,3, Boyi Gan4, Karen Justiano1, Ying-Ka Ingar Lau1, Ben Hopkins1, Cindy Hodakoski1,2, Susan Koujak1, Joseph Toole1, Franklyn Fenton1, Ashley Calahan1, Andrea Califano1,3, Ronald A. DePinho5, Matt Maurer1, 6, and Ramon Parsons2*
1Institute for Cancer Genetics and Herbert Irving Comprehensive Cancer Center, Columbia University, 1130 St. Nicholas Avenue, NY, NY 10032, USA. 2Department of Oncological Sciences, Icahn School of Medicine at Mount Sinai, 1470 Madison Ave HCSM 6-117, New York, NY 10029, USA. 3Department of Biomedical Informatics Columbia University, 1130 St Nicholas Ave, ICRC, New York, NY, 10032, USA. 4Department of Experimental Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA. 5Department of Cancer Biology, University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA. 6Department of Medicine, Columbia University Medical Center 630 W. 168th Street, NY, NY 10032, USA. Street, NY, NY 10032, USA.
*Correspondence: [email protected] (R.P.)
*Contact: Ramon Parsons email: [email protected]
1 Itemized List of Supplemental Information Supplemental Figures 1-8: Supplemental Figure 1 accompanies main text Figure 1. Supplemental Figure 2 accompanies main text Figure 2. Supplemental Figure 3 accompanies main text Figure 3. Supplemental Figure 4 accompanies main text Figure 4. Supplemental Figure 5 accompanies main text Figure 5. Supplemental Figure 6 accompanies main text Figure 6. Supplemental Figure 7 accompanies main text Figure 7. Supplemental Figure 8 accompanies main text Figure 8.
Supplemental Table 1 Legend (Accompanying Word File): Supplemental Table 1 accompanies main text Figure 4.
Supplemental Tables 2-6: Supplemental Table 2 accompanies main text Figure 4. Supplemental Table 3 accompanies main text Figure 4. Supplemental Table 4 accompanies main text Figure 4. Supplemental Table 5 accompanies main text Figure 4. Supplemental Table 6 accompanies main text Figure 6. Supplemental Table 7 accompanies main text Figure 8. Supplemental Table 8 Legend (Accompanying Word File) Supplemental Table 8 is included as a Word file.
Supplemental Materials and Methods This section includes additional Materials and Methods.
Supplemental References
2 Supplemental Figure 1. Genes Examined in Reporter Screen and Validation of the
TRAIL Reporter as an Indicator of PI3K/PTEN Output.
3 (A) Graph depicts the differential expression of genes in the presence of exogenous
PTEN from previously published microarray studies; more detailed descriptions of these previously published studies (cell lines utilized and experimental designs) can be found in the Supplemental Experimental Procedures . Genes from these microarray studies that were differentially expressed by at least two-fold and had available cDNAs in the human Orfeome Library 1.1 were chosen as candidates for our screen (in blue on the graph). (B) Side by side comparison of PTEN-induction of six FOXO-regulated luciferase reporters in HEK293 cells, * significantly induced by exogenous PTEN. The
TRAIL reporter was most strongly induced. (C) TRAIL reporter assays with exogenous
PTEN, with or without DN-FOXO1, *significantly induced, **significantly lower than control vectors. PTEN induced reporter activity, except in the presence of DN-FOXO1.
(D) TRAIL reporter assays were performed with 100 nM wortmannin (an inhibitor of
PI3K), added 8 hours prior to assays, *significantly induced. (E) TRAIL reporter assays performed with exogenous Myr-AKT, which encodes constitutively membrane localized
AKT, *significantly lower than control. (F) TRAIL eporter assays with exogenous NFIL3 and/or exogenous FOXO1, ** significantly less induced than exogenous FOXO1 alone sample. (G) U87MG cells with control vector or a retroviral PTEN vector were treated with control or NFIL3 shRNA; endogenous TRAIL expression was measured by qRT-
PCR, *significantly different than control shRNA, ** significantly different than induction observed with both control vectors and control vector with exogenous PTEN. (H) ChIP analysis with FOXO1 antibody. DNA was subjected to quantitative PCR for proximal region of INSR promoter or control -actin; FOXO1 associated with the INSR promoter. Data are means ± SEM of three experiments.
4 5 Supplemental Figure 2. Sixty Base Pairs of the TRAIL Promoter are Sufficient for
PTEN and NFIL3 Regulation
(A) Luciferase assays were performed using the reporters TRAIL-165 and TRAIL-60 that contain 165 and 60 base pairs of the TRAIL promoter, respectively, *significantly different than control, ** significantly less well induced by exogenous PTEN. Both of these reporters were regulated by PTEN and NFIL3. (B) Predicted NFIL3 and FOXO binding sites (underlined) based on published consensus sequences and mutant luciferase reporter sequences (used in Fig. 2C-D) are shown; the bold letters for the
NFIL3 consensus are given a higher weight . (C) Putative FOXO and NFIL3 binding sites were mutated in TRAIL reporter as indicated and were tested for regulation by
FOXO1 and NFIL3; FOXO1 induction was reduced with the mutant FOXO site,
*significantly less induced by exogenous FOXO1 in comparison to the wildtype TRAIL reporter. Deletion of the NFIL3 site led to a significant (*) reduction in regulation by
NFIL3. Data are means ± SEM of three experiments.
6 Supplemental Figure 3. Role of HDACs in NFIL3/FOXO1 Transcriptional
Regulation
7 (A-B) NFIL3 and HDAC2 physically associate. Co-immunoprecipitations were performed with HEK293 cell extracts that expressed FLAG-HDAC2 and V5-NFIL3. Faint background bands are present in input samples due to pre-clearing reactions with normal mouse IgG. (C)
TRAIL reporter assays with samples that were treated with or without 2 M SAHA for 24 hours. HDAC inhibition reduced the NFIL3-mediated repression of the TRAIL reporter in the presence of exogenous PTEN. (D) TRAIL reporter assays were performed with the FOXO1 acetylation deficient mutant (6KR) or the acetylation mimetic mutant (6KQ) with or without exogenous NFIL3. The acetylation mutants had no effect on NFIL3- mediated regulation of reporter activity, *significantly different than control vector sample, **significantly less well induced than with exogenous FOXO1 or 6KR mutant, respectively. Data are means ± SEM of three experiments.
8 Supplemental Figure 4. GSEA with Microarray Data from BT549 cells with NFIL3 shRNA and HDAC Inhibition in the Burkitt’s Lymphoma Cell Line (RJ225)
9 (A-C) BT549 cells with lentiviral GFP or Nfil3 (not targetable by human NFIL3 shRNA) were treated with human NFIL3-targeting shRNA or control; q-RT-PCR analysis was performed for GADD45, TRAIL and NFIL3 expression,*significantly different than control shRNA, ** significantly different than induction observed with GFP. (D) GSEA was performed with microarray data obtained from BT549 samples that had NFIL3 expression diminished by shRNA. Gene sets induced by exogenous FOXO1, treatment with LY294002, and exogenous PTEN were significantly enriched in the NFIL3 knockdown samples. (E) Gene Set Enrichment Analysis (GSEA) was performed with data from the Burkitt’s lymphoma cell line RJ225 that was treated with the HDAC inhibitor Trichostatin A (TSA) and PTEN pathway gene sets. Gene sets induced by the
PI3K inhibitor LY294002, by exogenous FOXO1 and by exogenous PTEN were up- regulated by HDAC inhibition in a Burkitt’s lymphoma cell line. Abbreviations: ES= enrichment score and NES= normalized enrichment score. Data are means ± SEM of three experiments.
10 Supplemental Figure 5. FOXO Subcellular Localization in Cell Lines and MEFs
11 (A) Subcellular fractionations with HEK293, MDA-MB-468 (labeled as 468) and BT549 cell lines probed with additional FOXO1 (C29H4) and FOXO3 (75D8) antibodies. MAX and tubulin are markers for the nuclear (N) and cytoplasmic (C) fractions respectively; the MAX and tubulin panels for HEK293 and MDA-MB-468 cells are same as those depicted in the main text Figure 5A. FOXO1 and FOXO3 were in the nucleus and cytoplasm. (B) Western blot analysis of subcellular fractionations with Large T antigen- immortalized MEFs (floxed/floxed, Rosa26CreERT2, FoxO1, FoxO3 and FoxO4 that were treated with Ad-GFP or Ad-Cre); samples were probed for FOXO1, FOXO3, and control antibodies. The detected FoxO bands were diminished in Ad-Cre treated samples showing the specificity of these antibodies. (C) Subcellular fractionations with control or Pten -/- MEFs; residual FoxO is detected in the nuclear fraction of Pten -/-
MEFs. (D-E) The indicated FOXO transcription factor was targeted with siRNA in
HEK293 cells; western blots are shown, indicating the specificity of each antibody
(molecular weights in kD are indicated). (F) The expression of NFIL3 was diminished with shRNA hairpins (KD1 or KD2) in BT549 cells; nuclear and cytoplasmic fractions were prepared. Fractions were probed for indicated antibodies. NFIL3 diminishment did not alter FOXO localization.
12 Supplemental Figure 6. NFIL3 transcription is induced by H2O2 and NFIL3
Regulates Transcription through FOXO.
(A) NFIL3 expression was assessed with qRT-PCR from BT549 extracts that were either
treated with 250M H2O2 for 18 hours or water; NFIL3 was induced by H2O2. (B) Primary
MEFs were treated with Ad-GFP or Ad-Cre; qRT-PCR was performed to confirm the loss of FoxO expression in Cre treated samples; the PCR only detects recombinants. (C)
Primary MEFs (Rosa26CreERT2, floxed/floxed FoxO1, FoxO3 and FoxO4) of the indicated genotype were infected with lentivirally delivered control or Nfil3-targetting
13 shRNA; qRT-PCR was performed with samples. Data are means ± SEM of three experiments.
Supplemental Figure 7. NFIL3 and HDAC2 are Expressed in Poor Prognosis
Cancers and a Series of FOXO1 Targets are Associated with Poor Breast Cancer
Prognosis.
14 The Oncomine database was queried for NFIL3 expression . (A) NFIL3 and HDAC2 expression were elevated in basal-like breast cancer and GBM . (B-D) Kaplan Meier analysis with NFIL3/FOXO target genes in breast cancer using NKI 295 data from luminal A and basal subtypes; NFIL3 expression is associated with poor prognosis. (E-
H) Kaplan Meier analysis was done with previously published FOXO targets using NKI data. Twenty-seven known FOXO targets that showed no evidence of NFIL3 regulation in our microarray studies were tested for their relationship to breast cancer prognosis and 11 trended towards poor prognosis and 4 were significantly associated to poor prognosis with p value < 0.05. (I) The ratio of expression of indicated FOXO target genes plus or minus the standard deviation of NFIL3 KD samples versus control shRNA samples is shown. Data are extracted from 293 microarray data from Figure 4, (left column) and ChIP for FOXO1 with the promoters of these genes in HEK293 cells (right column), *significantly different than rabbit IgG control binding, ^ChIPs were performed in BT549 cells for this gene.
15 Supplemental Figure 8. HDAC2 and NFIL3 Regulate Cell Viability in Basal-like
Breast Cell Lines.
16 (A) HDAC2 was diminished in MCF10A cells using shRNA (KD1 or KD2). A western blot is shown. (B) The MCF10A samples with and without HDAC2 knockdown were subjected to apoptosis analysis as described in the Supplemental Materials and
Methods. HDAC2 shRNA induced cell death. (C-D) Cell lines with NFIL3 reduced by shRNA were analyzed by western analysis and these cells were examined for cell death/apoptosis as described in the Supplemental Materials and Methods. The percent of apoptotic cells equals the propidium iodide and Annexin V single and double positive cells divided by the total number of cells. (E) MCF10A cells with either lenti-viral GFP or mouse Nfil3 (not targetable by human NFIL3 shRNA) were treated with control or human NFIL3-targeting shRNA. Cells remaining after treatment were stained with crystal violet, plates were scanned with UMAX PowerLook 1100 scanner and Image J was utilized to quantify cell density. Mouse Nfil3 partially rescued the cell death induced by human NFIL3 shRNA. (F-G) qRT-PCR with MCF10A samples treated with
NFIL3 shRNA or control, *significantly different than control shRNA, ** significantly different than induction observed with GFP, *** significantly lower detected expression than samples with lentivirally delivered mouse Nfil3; note that the control samples only have human NFIL3. (H) Colony assays in presence of NFIL3 shRNA with or without
TRAIL shRNA). The TRAIL KD1 had 41% of endogenous TRAIL by q-RT-PCR with
1.5% error and the KD2 for TRAIL had 63% of endogenous TRAIL with 1.0% error; both
TRAIL KDs were significant. Data are means ± SEM of three experiments.
17 Supplemental Table 1 Legend (See accompanying Microsoft Word file):
Supplemental Table 1. Differentially Expressed Genes in NFIL3 Knockdown
Samples
Gene expression profiling was performed with NFIL3 knockdown samples and scramble shRNA controls (HEK293 cells). One-Way ANOVA analysis was used to detect 399 differentially expressed genes with an FDR=0.05 and at least a two-fold change in gene expression. 289 of these genes were up regulated.
18 Supplemental Table 2. Gene Expression in HEK293 and U87MGs Cells
Differentially expressed genes from HEK293 microarray analysis (with NFIL3 shRNA) were confirmed by qRT-PCR analysis in (A) HEK293 samples (treated with NFIL3 shRNA) and (B) U87MG samples (treated with NFIL3 shRNA). In addition, qRT-PCR analysis was performed with HEK293 samples that had diminished HDAC2 (mediated by shRNA) or over expression of activated FOXO1-AAA (transfected). The ability of NFIL3 to bind target genes was tested by ChIP; significant binding to target promoters is indicated by a + sign. The numbers presented are normalized units (gene of interest/GAPDH); these samples are also normalized to controls (the shRNA samples are normalized to a control shRNA and the activated FOXO1 is normalized to the vector alone). * Difference in expression was statistically significant by Student’s t test. Data are means of three experiments. A. Gene expression in HEK293 cells
Gene NFIL3 shRNA HDAC2 shRNA FOXO1-AAA NFIL3 ChIP
TSGA10 4.8* 2.0* 2.0* + FAS 3.2 * 2.1* 1.7* + CDKN1A 1.8 * 0.7* 1.6* + FGF7 4.5* 1.8 5.5* + KIAA1600 3.5* 1.1 2.2* - SERTAD1 2.8* 2.2* 2.5* - GADD45 21.0 * 1.5* 2.0* + MKX 1.5* 0.8 1.4* + TRAIL 2.7* 1.3 39.0* + GADD45 2.3 * 0.8 1.6* + STK31 4.9* 2.3* 1.3 - ATF3 7.8* 3.6* 0.9 - HS3ST5 5.8* 2.4* 0.9 - ADCY10 2.9* 3.8* 0.5 + GPR137C 3.5* 0.9 1.3 + KGFLP1 2.8* 2.0* 1.0 + KLHL32 4.0* 0.9 1.2 + OTP 1.6* 2.5* 1.2 + BLZF1 1.6* 1.5* 1.3* + BMPR1B 2.0* 0.5* 1.3* +
B. Gene expression in U87MG cells
Genes NFIL3 shRNA CDKN1A 9.5* FAS 8.7* GADD45 5.3*
19 Supplemental Table 3. Differentially Expressed Genes in BT549 Cells NFIL3 expression was diminished in BT549 cells with shRNA (a PTEN mutant basal-like breast cancer cell line). Genes from the microarray analysis depicted in Figure 4A were confirmed by qRT-PCR analysis. In addition, qRT-PCR analysis for these genes was performed with samples that had diminished HDAC2 (mediated by shRNA) or over expression of activated FOXO1-AAA (transfected). Genes were also analyzed in samples that were treated with or without hydrogen peroxide (250 M for 18 hours). The numbers presented are normalized gene expression units (gene of interest/GAPDH control); these samples are also normalized to controls (the shRNA samples are normalized to a control shRNA, the activated FOXO1 is normalized to the vector alone and the hydrogen peroxide is normalized to water control). Empty boxes were not tested. The * mark means that the difference in expression was statistically significant by Student’s t test. Data are means of three experiments.
Gene qRT-PCR qRT-PCR qRT-PCR qRT-PCR NFIL3 shRNA HDAC2 shRNA +FOXO1AAA +H2O2 TSGA10 10.4* 3.3* STK31 108.0 * 86.0 * 4.6 * 0.2 ATF3 17.0 * 2.9 * 22.2 * 12.4* FAS 1.8 * 1.5 * 1.1 0.9 HS3ST5 0.7 1.2 ADCY10 4.0* 2.9* 3.4* 4.5* GPR137C 5.5* 4.8* TCHH 0.8 29.3* KGFLP1 2.7* 5.7* 1.2 2.9* KLHL32 1.6 1.5* BC064586 0.9 0.9 CDKN1A 6.2 * 1.0 1.8 * 6.9 * FGF7 2.0* 8.6* 2.2* 5.0* KIAA1600 6.1* 5.7* SERTAD1 1.9* 4.8* 0.8 0.1 GADD45 2.5* 2.1* 1.2 2.0* ZNF383 3.5* 3.4* PRDM12 1.2 0.8 MKX 1.5 0.5 SOD2 0.2* 0.4 5.7 * 1.4 FASLG 0.2 5.6 * TRAIL 11.8 * 6.4 * 6.2 * 0.7 GADD45 14.6 * 4.4 * 7.9 * 10.4 * P27 3.5* 5.7* 1.0 0.3
20 Supplemental Table 4. Gene Set Enrichment Analysis with Curated Broad Institute Molecular Signatures Database Sets and PTEN Pathway Sets
Gene set enrichment analysis was performed with 1,679 gene sets that are curated by the Broad Institute Molecular Signatures Database and the NFIL3 knockdown microarray data from HEK293 cells. The experimentally derived PTEN-pathway gene sets were included in this analysis for comparison. Of these gene sets tested, 1403 were enriched to some degree in the NFIL3 knockdown samples. Enriched gene sets were ranked based on the normalized enrichment score (NES). The PTEN pathway gene sets and corresponding rankings are shown; three of these are in the top tenth percentile of enriched gene sets.
NES Rank (out p- of 1403 gene Gene Set Name SIZE ES NES value sets) TERRAGNI- GENE SET INDUCED BY LY294002 21 0.64 1.70 0.03 49 RAMASWAMY- FOXO1 INDUCED SET [CLASS 2A] 31 0.46 1.60 <0.001 94 MATSUSHIMA-NISHIU- GENE SET INDUCED BY PTEN 84 0.45 1.54 0.03 134 GOMIS GENE SET INDUCED BY FOXO- SMAD 10 0.70 1.43 0.08 234 MATSUSHIMA-NISHIU- GENE SET REPRESSED BY PTEN 54 0.29 1.01 0.43 1038 RAMASWAMY- FOXO1 REPRESSED SET [CLASS 3] 25 0.29 0.86 0.68 1229 TERRAGNI- GENE SET REPRESSED BY LY294002 42 0.28 0.82 0.69 1279 RAMASWAMY- FOXO1 INDUCED SET [CLASS 1] 22 0.17 0.54 0.95 1395
21 Supplemental Table 5. The Top 50 Gene Sets that were Enriched in NFIL3 Knockdown Microarray Data GSEA was performed with microarray data from HEK293 cells that were treated with NFIL3 shRNA as described in the Supplemental Experimental Procedures. The gene sets utilized were curated on the Molecular Signatures Database, Broad Institute, and were rank ordered by Normalized Enrichment Score (NES). The top 50 most enriched gene sets (out of over 1400 examined gene sets) are included in this table. Abbreviations: ES=Enrichment Score and NES=Normalized Enrichment Score. Eight of these gene sets (genes induced by HDAC inhibition) are also included in Figure 4G.
Gene Set Name ES NES p-value JECHLINGER_EMT_DN 0.63 2.01 <0.01 GERY_CEBP_TARGETS 0.55 2 <0.01 AD12_ANY_DN 0.62 2 <0.01 WERNERONLY_FIBRO_UP 0.56 1.99 <0.01 EMT_DN 0.59 1.96 <0.01 STRESS_GENOTOXIC_SPECIFIC_UP 0.66 1.95 <0.01 WERNER_FIBRO_UP 0.48 1.93 <0.01 AD12_32HRS_DN 0.78 1.93 <0.01 HDACI_COLON_TSABUT_UP 0.53 1.91 <0.01 CMV_UV-CMV_COMMON_HCMV_6HRS_UP 0.67 1.9 <0.01 TAKEDA_NUP8_HOXA9_3D_DN 0.6 1.89 <0.01 STAEGE_EFTS_UP 0.57 1.88 <0.01 BRENTANI_TRANSCRIPTION_FACTORS 0.54 1.88 <0.01 TGZ_ADIP_UP 0.71 1.87 <0.01 VEGF_HUVEC_30MIN_UP 0.57 1.87 <0.01 ZMPSTE24_KO_UP 0.59 1.85 <0.01 CMV_HCMV_6HRS_UP 0.64 1.85 <0.01 BROCKE_IL6 0.51 1.84 <0.01 KRETZSCHMAR_IL6_DIFF 0.51 1.84 <0.01 DNMT1_KO_UP 0.52 1.84 <0.01 LVAD_HEARTFAILURE_UP 0.55 1.83 0.01 ADIP_DIFF_CLUSTER2 0.68 1.82 <0.01 HDACI_COLON_BUT_UP 0.43 1.81 <0.01 UVC_LOW_ALL_UP 0.69 1.8 0.02 UEDA_MOUSE_SCN 0.46 1.79 <0.01 MANALO_HYPOXIA_UP 0.51 1.78 0.01 HDACI_COLON_TSA2HRS_UP 0.55 1.78 <0.01 JISON_SICKLE_CELL 0.53 1.78 <0.01 RORIE_ES_PNET_DN 0.56 1.78 <0.01 TSA_PANC50_UP 0.62 1.78 <0.01 HYPERTROPHY_MODEL 0.68 1.77 <0.01 MARSHALL_SPLEEN_BAL 0.6 1.77 0.01 UVC_HIGH_ALL_UP 0.65 1.76 <0.01 NI2_MOUSE_UP 0.46 1.76 <0.01
22 GATA3PATHWAY 0.68 1.75 <0.01 HDACI_COLON_BUT12HRS_UP 0.57 1.75 <0.01 HDACI_COLON_TSA_UP 0.43 1.75 <0.01 FRASOR_ER_UP 0.57 1.74 <0.01 MENSE_HYPOXIA_UP 0.49 1.73 <0.01 HSA01510_NEURODEGENERATIVE_DISEASES 0.57 1.73 <0.01 HDACI_COLON_BUT48HRS_UP 0.47 1.73 <0.01 ST_JNK_MAPK_PATHWAY 0.53 1.72 <0.01 AD12_24HRS_DN 0.59 1.72 0.03 FLECHNER_KIDNEY_TRANSPLANT_WELL_DN 0.55 1.72 <0.01 HSA04520_ADHERENS_JUNCTION 0.48 1.72 <0.01 STRESS_ARSENIC_SPECIFIC_UP 0.48 1.71 <0.01 UVB_NHEK4_24HRS_DN 0.64 1.71 0.05 BRCA_PROGNOSIS_POS 0.55 1.71 <0.01 HDACI_COLON_CUR24HRS_DN 0.6 1.7 <0.01 HDACI_COLON_BUT2HRS_UP 0.41 1.7 <0.01
23 Supplemental Table 6. ChIP qPCR: HEK293 and BT549 cells with NFIL3 shRNA
ChIPs were performed in HEK293 and BT549 cells that were treated with a control shRNA or NFIL3 targeting shRNA (KD1 or KD2). Promoter binding was quantified by q- PCR using -actin sequence as a control (promoter of interest/-actin control); these samples are also normalized to the IgG control. * The difference between the control shRNA and NFIL3 targeting shRNA was significant by Student’s t test. All ChIPs were performed at least twice and qPCR samples were analyzed in triplicate.
ChIP qPCR: HEK293 cells with NFIL3 shRNA or control
GADD45 IgG FOXO1 NFIL3 Histone Acetyl Histone Acetyl Histone Promoter H3 H3 H4 Control shRNA 1.0 1.2 2.4 1.3 0.9 56.0 NFIL3 KD1 1.2 2.1* 1.2* 0.8* 2.1* 500.0* NFIL3 KD2 0.9 1.6* 1.0* 0.85 1.6* 140.0*
GADD45 IgG FOXO1 NFIL3 Histone Acetyl Histone Acetyl Histone Promoter H3 H3 H4 Control shRNA 1.1 1.1 1.9 0.65 1.0 2.6 NFIL3 KD1 1.0 1.9* 0.7 * 0.5 1.9* 29.3* NFIL3 KD2 0.9 3.3* 0.6* 0.2* 3.2* 10.4*
FAS Promoter IgG FOXO1 NFIL3 Histone Acetyl Histone Acetyl Histone H3 H3 H4 Control shRNA 1.2 1.1 2.8 0.9 1.0 217.3 NFIL3 KD1 0.8 1.8* 1.1 * 0.8 2.3* 912.7* NFIL3 KD2 0.9 1.8* 0.4* 0.9 2.2* 456.3*
TRAIL IgG FOXO1 NFIL3 Histone Acetyl Histone Acetyl Histone Promoter H3 H3 H4 Control shRNA 1.1 0.9 4.6 0.7 1.0 1.4 NFIL3 KD1 1.0 4.1* 2.5* 0.8 1.7* 3.5* NFIL3 KD2 0.9 1.7* 1.8* 0.9 2.0* 3.7*
GAPDH IgG FOXO1 NFIL3 Histone Acetyl Histone Acetyl Histone Promoter H3 H3 H4 Control shRNA 1.0 0.8 1.1 1.1 9.8 20.8 NFIL3 KD1 0.9 0.6* 0.3* 0.7 5.5* 20.1 NFIL3 KD2 0.9 1.0 1.2 1.3 7.8 10.1*
24 Supplemental Table 6 continued:
ChIP qPCR: BT549 cells with NFIL3 shRNA or control
GAPDH IgG FOXO1 NFIL3 Histone Acetyl Histone Acetyl Histone Promoter H3 H3 H4 Control shRNA 0.9 0.6 0.5 1.3 11.1 5.5 NFIL3 KD1 0.9 0.9 0.7 1.0 12.9 2.5* NFIL3 KD2 1.1 0.9 1.6* 1.5 10.5 3.6*
ChIP qPCR: BT549 cells with NFIL3 shRNA or control
GADD45 IgG Histone Promoter H3 Control shRNA 1.2 2.1 NFIL3 KD1 0.8 2.3 NFIL3 KD2 1.2 0.66*
TRAIL IgG Histone Promoter H3 Control shRNA 1.2 2.4 NFIL3 KD1 0.9 0.8* NFIL3 KD2 1.0 1.7*
25 Supplemental Table 7. FOXO Target genes were differentially expressed in MCF10A, MDA-MB-468 and U87MG cells. NFIL3 expression was diminished in MCF10A and MDA-MB-468 cells via shRNA; the expression of indicated genes was analyzed by qRT-PCR. Genes were also analyzed in samples that were treated with or without hydrogen peroxide (250 M for 18 hours). The numbers presented are normalized gene expression units (gene of interest/GAPDH control); these samples are also normalized to controls (the shRNA samples are normalized to a control shRNA and the hydrogen peroxide is normalized to water control). Empty boxes were not determined. The * mark means that the difference in expression was statistically significant by Student’s t test. Data are means of three experiments.
Cell Line Gene qRT-PCR NFIL3 qRT-PCR NFIL3 qRT-PCR shRNA (KD1) shRNA (KD2) +H2O2 MCF10A NFIL3 0.8* 0.4* MCF10A TRAIL 1.9* 3.9* MCF10A GADD45 3.4* 3.8* MCF10A GADD45 8.9* 9.2* MCF10A FAS 25.4* 1.4* MDA-MB-468 NFIL3 0.2* 0.6* 1.3 MDA-MB-468 TRAIL 2.9* 5.2* 0.7 MDA-MB-468 GADD45 0.5* 0.8* 3.1* MDA-MB-478 GADD45 0.7* 1.0 0.9 MDA-MB-468 FAS 2.0* 3.3* 1.2
Cell Line Gene qRT-PCR +H2O2 U87MG TRAIL 0.4* U87MG GADD45 6.2* U87MG GADD45 4.8* U87MG FAS 2.4*
26 Supplemental Table 8 Legend (See accompanying Microsoft Word file):
Supplemental Table 8. Gene-specific PCR primers
The primers used for gene expression analysis, ChIP analysis (qPCR), PCR primers for ABCD assays, and mutagenesis primers for TRAIL reporter mutants are detailed.
Supplemental Materials and Methods
Plasmid Constructs
The TRAIL (1523 bp and 165 bp) reporters were from J. Millbrant. The TK-Renilla control reporter was from Promega (Madison, WI). The pCEP4 PTEN vector was previously described . D. Accili donated the DN-FOXO1 vector and FOXO1AAA. Myr-
AKT was obtained from T. Franke. The pCDNA3-FOXO1 was from W. Sellers. The pME18S-FLAG-HDAC2 vector, used in co-immunoprecipitations, was from R. Dalla-
Favera. Expression vectors for candidate regulators of the PTEN pathway were prepared by using the LR Clonase and pDEST40 destination vector (Invitrogen,
Carlsbad, CA) with intermediate vectors from the human Orfeome collection1.1 (Open
Biosystems, Huntsville, AL). The pBABE-hygro p53 DD vector for MEF immortalization was a gift from M. Oren. MSCVpuro-NFIL3 was made as follows: the NFIL3 gene was amplified using the primers (P170: 5’-
GCGCGGATCCACATGCAGCTGAGAAAAAATGCAG-3’) and (P171:5’-
CGCGCGCTCGAGTTACCCAGAGTCTGAAGCAGA); the corresponding PCR product was cut with BamHI and XhoI and was ligated into the BglII/XhoI sites of MSCVpuro.
MSCVneo-PTEN vector was previously described . The HDAC2 expression vector utilized in reporter assays was prepared by amplifying the full-length cDNA from
27 HEK293-derived cDNA with the primers: 5’ATGCGCTCACCTCCCTGCGG and
3’CGCGGATCCGCGGTCAGGGGTTGCTGAGCTGT. The HDAC2 PCR product was cloned into the TOPO TA vector pcDNA3.1/V5-HIS TOPO (Invitrogen, Carlsbad, CA) according to the Invitrogen protocol. The FOXO1 acetylation mutants were obtained from Addgene (plasmid numbers 17562, 12148, and 17560). The lentiviral Nfil3 vector and GFP control lenti-vector were gifts from S.E. Plevy.
Mission lentiviral shRNA vectors targeting NFIL3 were obtained from Sigma:
Clone ID: NM_005384.1-1746s1c1, used for gene expression analysis and ChIPs in
HEK293 cells, denoted as KD2 in figures, sequence:
CCGGGCACAGATTATGATGAAGATTCTCGAGAATCTTCATCATAATCTGTGCTTTTT
Clone ID: NM_005384.1-1216s1c1, used for reporter assays in HEK293 cells, gene expression analysis and ChIPs in HEK293 and BT549 cells, subcellular fractionation with BT549 cells, signaling analyses with HEK293 cells and BT549 cells and apoptosis assays in each cell line utilized, denoted as KD1 in figures; sequence:
CCGGCAGATCAAAGTAGAAGCCTTTCTCGAGAAAGGCTTCTACTTTGATCTGTTTTT
Clone ID: NM_005384.1-290s1c1, used for reporter assays in HEK293 cells, qRT-PCR and ChIP analysis with BT549 cells, signaling analyses with HEK293 and BT549 cells and apoptosis assays with each cell line used, denoted as KD2 in figures; target sequence:
CCGGTGGTCCTTAATTCTGCTTTAACTCGAGTTAAAGCAGAATTAAGGACCATTTT.
Clone ID: NM_017373.2-395s1c1, was utilized to diminish Nfil3 in MEFs, denoted as
KD1 in figures; sequence:
28 CCGGGACGCCATGTATTGGGAGAAACTCGAGTTTCTCCCAATACATGGCGTCTTTT
TG.
Clone ID: NM_017373.2-694s1c1, was utilized to diminish Nfil3 in MEFs, denoted as
KD2 in figures; sequence:
CCGGCGGAAGTTGCATCTCAGTCATCTCGAGATGACTGAGATGCAACTTCCGTTTT
TG.
Mission lentiviral shRNA vectors targeting HDAC2 were obtained from Sigma:
Clone ID: NM_001527.1-1678s1c1, denoted as KD1 in figures, sequence:
CCGGCAGTCTCACCAATTTCAGAAACTCGAGTTTCTGAAATTGGTGAGACTGTTTTT
Clone ID: NM_001527.1-508s1c1, denoted as KD2 in figures, sequence:
CCGGCCAGCGTTTGATGGACTCTTTCTCGAGAAAGAGTCCATCAAACGCTGGTTTT
T.
Variations of the TRAIL luciferase reporters were made by performing site directed mutagenesis using the vectors and primers described in Supplemental Table 7 with the
Stratagene Quikchange XL site directed mutagenesis kit (La Jolla, CA).
Cell culture and Chemicals
Cell lines were obtained from ATCC and propagated under suggested conditions.
SAHA and TSA were purchased from Sigma (St. Louis, MO). FOXO1, FOXO3 and
FOXO4 were diminished in HEK293 cells with the respective siRNA sequences (GCC
CUG GCU CUC ACA GCA AUU, CGAAUCAGCUGACGACAGUUU, and
29 GGACUGGACUUCAACUUUGUU) that were transfected with Lipofectamine 2000
(Invitrogen, Carlsbad, CA). FOXO1AAA was transfected into HEK293 and BT549 cells using the Amaxa nucleofector technology kit V (program P20 for BT549 cells and X-001 for HEK293 cells) with one million cells/transfection in order to prepare RNA for gene expression analysis (Lonza, Cologne, Germany).
Reporter Screen Design
The goal of the reporter screen was to identify which (if any) of the PTEN regulated genes from previously published microarray studies were novel components/regulators of the PI3K/PTEN pathway. We assembled a list of PTEN-regulated genes from four published gene expression microarray experiments . Each microarray study was set-up in a slightly different manner: Simpson et al. infected the PTEN mutant breast cancer cell line MDA-MB-468 with Ad-PTEN and collected time points for microarray analysis.
PTEN was greatly overexpressed in this setting, leading to growth arrest and cell death.
Stolarov et al. employed a retroviral-mediated ecdysone-inducible system in the glioblastoma cell line (U87MG, PTEN null) to exogenously express PTEN; this level of expression was enough to halt the growth of U87MG cells. Matsushima-Nishiu et al. infected the PTEN mutant endometrial cancer cell line HEC-151 with Ad-PTEN; samples were collected 24 hours after infection and expressed high levels of PTEN by western blot that induced cell death. Hong et al. transfected the human lung adenocarcinoma cell line CL1-5 with pCEP4-PTEN to obtain stable clones that overexpressed PTEN; these clones expressed 20 fold higher PTEN and were utilized
30 for microarray analysis. In order for a gene to be utilized in our screen, it needed to be differentially expressed by at least two fold upon the addition of exogenous PTEN in the published microarray study and it needed to be included in the Human Orfeome 1.1
Library (Open Biosystems, Huntsville, AL) in order to easily prepare a cDNA expression vector for screening. The prepared expression vectors were utilized in TRAIL luciferase reporter assays as described in the Experimental Procedures in the main text. The amount of PTEN expression vector transfected into the log phase HEK293 cells was enough to hinder cellular growth (data not shown).
Isolation of Pten KO mouse embryonic fibroblasts (MEFs)
Ptenflox/+ mice in a mixed 129S4 backcrossed to C57B1/6 background were mated to obtain Ptenflox/flox embryos . Genotypes were determined by PCR using DNA from either the tail or yolk sac. PCR primer sequences were obtained from the Jackson Laboratory
(primer stock number 006440) and are as follows: forward oIMR6260 5’-ACT CAA GGC
AGG GAT GAG C-3’ and reverse oIMR6261 5’-AGC TGT GGT GGG TTA TGG TC-3’.
Mouse embryonic fibroblasts (MEFs) were isolated from E13.5 mouse embryos.
Pregnant mice were sacrificed by exposure to CO2 and embryos were surgically harvested. For MEF isolation the head and visceral organs were removed, and the remaining tissue was minced and then digested using 0.05% trypsin at 37°C. MEFs were cultured in 5% CO2 at 37°C in DMEM supplemented with 10% fetal bovine serum and 2 mM glutamine. MEFs were immortalized by infection with a retrovirus expressing dominant negative p53 (pBABE-hygro p53 DD), and infected MEFs were selected with
31 100 μg/ml hygromycin. Immortalized Ptenflox/flox MEFs were infected with adenovirus expressing either Cre recombinase or GFP (catalog numbers 1045 and 1060, Vector
Biolabs). Infections were performed overnight in MEF growth medium containing 2 x 107
PFU/ml adenovirus and 4 μg/ml polybrene. Western blot confirmed loss of Pten in Ad-
Cre infected MEFs and normal Pten expression in Ad-GFP infected MEFs.
Infections
Retroviruses (MSCVpuro-NFIL3 and MSCVneo-PTEN) were prepared using Phoenix-
HEK293 cells transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Titers were collected 48 hours post-transfection, were filtered with a 0.45 M filter and were then utilized with growth media along with a final concentration of 5 g/mL polybrene
(hexadimethrine bromide) (Sigma, St. Louis, MO). Lentiviral shRNA viruses were obtained by transfecting HEK293T cells with a ratio of 1.3:1:0.01 of shRNA vector to
CMV8.9 to VSV-G using Lipofectamine 2000. Titers were collected 48 hours post- transfection, were filtered using a 0.45 M filter and were utilized with growth media along with a final concentration of 12 g/mL polybrene. Infected cell lines were selected accordingly with puromycin and/or neomycin. Samples from shRNA experiments were collected 96 hours post-infection with the exception of those samples derived from
Clone ID: NM_005384.1-1746s1c1 for NFIL3, which were collected 48 hours post- infection (along with proper control samples) due to cell death induction.
32 Subcellular Fractionation
Log phase cells were scraped from 10 cm plates into ice cold PBS with 1X protease inhibitor (PI), (from 100 X mammalian protease inhibitor cocktail, Sigma, St. Louis, MO).
Cells were washed twice with ice cold PBS (containing 1 X PI). Then cells were incubated in Buffer A (10 mM Hepes pH 7.4, 10 mM KCL, 100 M EDTA, 1 X PI) for 15 minutes on ice. After this, 10% NP-40 was added to the Buffer A mixture at a 1:20 dilution. Samples were vortexed and rotated end over end for 2 minutes; then samples were centrifuged at 1000 x g for 5 minutes. The cytoplasmic fraction is comprised of the supernatant. The pellet was washed with Buffer A and then extracted with Buffer C (20 mM Hepes pH 7.4, 400 mM NaCl, 1 mM EDTA, 1 X PI) to obtain the nuclear fraction.
Avidin-Biotin Complex DNA (ABCD) Assays
Nuclear lysates were prepared from transfected HEK293 cells as detailed above in the subcellular fractionation section. Lysates were diluted 1:3 in Buffer M (25 mM Hepes pH 7.5, 20% glycerol, 0.4% Triton X-100, 0.5 mM EDTA and 1X mammalian protease inhibitor cocktail) and incubated for one hour with biotinylated PCR products corresponding to the TRAIL promoter that were bound to M-280 streptavidin-coupled dynabeads (Invitrogen, Carlsbad, CA). Primer sequences for biotinylated DNA can be
33 found in the Table S8. Isolated DNA-protein samples were washed four times in Buffer
M, eluted with 2X sample buffer, and used for western blotting.
Immunoprecipitations
Epitope-tagged proteins:
Nuclear protein lysates were prepared as described for subcellular fractionations, except transfected cells were treated with 5 M bortezomib for 18 hours prior to harvesting cells. Lysates were diluted 1:4 in buffer M. Samples were pre-cleared with 2
g of normal mouse IgG and 25 L ProteinA/G agarose (Santa Cruz Biotechnology,
Santa Cruz, CA). Input samples were collected and pre-cleared lysates were incubated with either 20 L of anti-V5 agarose affinity gel (antibody produced in mouse (Sigma, St.
Louis, MO)) or 20 L of anti-FLAG M2-agarose from mouse (Sigma, St. Louis, MO) overnight. After this, samples were washed three times with buffer M and eluted overnight. V5 agarose purifications were eluted overnight with 750 g/mL V5 peptide
(Sigma, St. Louis, MO) in PBS with 0.1% SDS. FLAG agarose purifications were eluted overnight with 9 g/mL FLAG peptide (Sigma, St. Louis, MO) in buffer M. After overnight incubations, samples were centrifuged at 8000 x g for 15 minutes, then filtered using 0.35 M filters (USB, Cleveland, OH), then centrifuged at 16.1 x g for 15 minutes and were analyzed by western blotting.
Endogenous proteins:
34 100 million cells were washed with ice cold PBS and lysed in 1mL IP buffer (20mM Tris pH 7.5, 150mM NaCl, 1mM EDTA, 1% TritonX-100, 1mM EGTA, 2.5mM sodium pyrophosphate, 1mM B-glycerophosphate, 1mM NaVo4 and 1X mammalian PI) on ice for 30 minutes with several brief intervals of vortexing. Samples were then sonicated for
5 seconds three times using a Fisher Scientific sonic dismembrator 60 at setting 3.5.
Then, samples were centrifuged for 10 minutes and pre-cleared with 7 g of normal rabbit IgG and 25 L ProteinA/G agarose (Santa Cruz Biotechnology, Santa Cruz, CA).
Input samples were collected and pre-cleared lysates were incubated with 7g of indicated antibody (NFIL3 antibody (Santa Cruz H300), HDAC2 (Santa Cruz H-54) or normal rabbit IgG (Santa Cruz)) overnight. Samples were washed three times with lysis buffer and western blotting was performed using the IP/Western Blot ReliaBlot Kit
(Bethyl Laboratories, Montgomery, TX) according to the manufacture’s protocol. The
HDAC1 antibody was from Santa Cruz Biotechnology (H51).
Microarray Analysis
Total RNA was prepared from HEK293 or BT549 cells that were either treated with control virus (scramble shRNA) or virus enabling the knockdown of NFIL3. RNA was labeled using RNA Spike in Kit for Two color v4.0 and analyzed with Whole Human
Genome Oligo Microarray Kit (Agilent, Santa Clara, CA). The microarray data was imported into the Base database for filtering and normalization . Microarray data was extracted using Mean FG- Median BG (ch1=G, ch2=R), filtered: log (ch (1)*ch
(2))/2>=.1, and normalized using Lowess normalization. Data was then exported from
35 the Base database and analyzed using Partek software (St Louis, MO.). Gene set enrichment analysis (GSEA) was done using the Broad Institute platform and Base- filtered microarray data . Samples were analyzed with the default GSEA settings
(weighted, Signal2Noise), except the Burkitt’s lymphoma samples and the BT549 NFIL3 knockdown samples, which were analyzed using log2 ratio of classes and the differences or classes respectively due to the number of samples.
Statistical Analysis
Student’s t tests were two sided with the statistical significance set at P < 0.05.
Quantitative Real Time PCR
Total RNA was prepared using the Qiagen RNeasy kit, which was then used to generate cDNA using Superscript Reverse Transcriptase II (Invitrogen, Carlsbad, CA).
DNA preparations from ChIPs were also analyzed by quantitative PCR. Samples were analyzed using SYBR green reagents and the AB7500 Real-time system from Applied
Biosystems (Foster City, CA). Expression levels were normalized to GAPDH in gene expression experiments and -actin for chromatin immunoprecipitations.
Chromatin Immunoprecipitations
36 Chromatin immunoprecipitation (ChIP) analysis was performed as previously described . Pre-cleared chromatin preparations (prepared from 10 million cells) were incubated overnight with 7 g of one of the following antibodies: normal rabbit IgG,
FOXO1 antibody (H128), NFIL3 antibody (H300), HDAC2 (H-54), from Santa Cruz
Biotechnology (Santa Cruz, CA); Acetyl histone H3 (06-0599) and acetyl histone H4
(06-866) from Upstate/Millipore (Billerica, MA); the total histone H3 antibody (ab1791) was from AbCam (Cambridge, MA) . Samples were then incubated with Protein G agarose for one hour and then extensively washed. DNA was then eluted, crosslinks were reversed and the DNA was purified using phenol: chloroform extraction and sodium acetate/ethanol precipitation. The purified DNA was subjected to quantitative real-time PCR. RNA samples were prepared in parallel to chromatin samples to ensure that target genes were induced by at least five fold.
Prediction of Transcription Factor Binding Sites for ChIPs
TFSEARCH software was utilized to identify putative FOXO and NFIL3 binding sites using a threshold of 75% for consensus sites to aid in the design of ChIP primers and search for NFIL3 binding sites in FOXO regulated genes . The consensus for the forkhead box transcription factor HNF3 was employed to identify FOXO binding sites as the FOXO consensus was not included in this software and the consensus sites for these proteins are nearly identical. For comparison the HNF3 site from the
TFSEARCH database is: NNNT(A/G)TTT(A/G)(T /C)T(T/C) compared to the complement of the FOXO consensus: T(A/G)TTTA(T/C) .
37 Immunofluorescence
Cells were grown on coverslips, washed twice with PBS and fixed in 2% paraformaldehyde in PBS pH 7.4 for 30 minutes. Samples were washed four times with
PBS and then permeablized with 0.1% Triton X-100 plus 1% goat serum for 15 minutes.
Samples were washed twice with PBS and incubated with primary (1:100) antibody for 2 hours. Samples were washed three times (5 minutes each) with PBS and were then incubated with Alexa 488–conjugated goat anti–rabbit secondary antibody (Invitrogen) at 1:600 dilution in PBS for one hour. Samples were washed three times (5 minutes each) with PBS, were mounted with Gold polymount.
Cell Death Assays
The NFIL3 (or HDAC2) shRNA targeted samples (in MCF10a, MDA-MB-468 and BT549 cells) were collected at 96 hours post infection and were stained with propidium iodide and Annexin V FITC using the ApoAlert Annexin V Apoptosis Kit (Clontech, Mountain
View, CA) according to manufacturer’s protocol. Cells were sorted with an LSRII flow cytometer (BD Biosciences, San Jose, CA). 30,000 cells were analyzed per sample and this experiment was repeated several times. Seventy percent confluent U87MG cells that were transduced to express NFIL3 and/or PTEN were treated with water or 250 M
38 H2O2 for 18 hours (St. Louis, MO); samples were analyzed using the ApoAlert Annexin
V Apoptosis Kit as described above for cell death. Data are means ± SEM of three experiments.
The apoptosis assays for MDA-MB-468 and BT549 cells transduced to express NFIL3
were performed by treating seventy percent confluent cells with 250 M H2O2 for 18 hours. After treatment, the remaining cells were stained with 0.5% crystal violet in 10% buffered formalin solution for 15 minutes. Samples were washed several times with
PBS. The dye remaining on the plate was solubilized into 10% acetic acid solution for
30 minutes with agitation and the OD565 was measured. Data are means ± SEM of three experiments.
The MCF10A cell death rescue experiments were performed by infecting cells (20,000 cells in a well of a six well plate) that harbor either lentivirally-delivered
0.5% crystal violet in 10% buffered formalin solution for 15 minutes. Samples were washed several times with PBS. Plates were scanned using the UMAX PowerLook
1100 scanner and Image J was utilized to quantify reduced cell numbers.
39 SUPPLEMENTAL REFERENCES
Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, Greenberg ME. 1999. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96: 857-868. Farmer P, Bonnefoi H, Becette V, Tubiana-Hulin M, Fumoleau P, Larsimont D, Macgrogan G, Bergh J, Cameron D, Goldstein D et al. 2005. Identification of molecular apocrine breast tumours by microarray analysis. Oncogene 24: 4660-4671. Fine B, Hodakoski C, Koujak S, Su T, Saal LH, Maurer M, Hopkins B, Keniry M, Sulis ML, Mense S et al. 2009. Activation of the PI3K pathway in cancer through inhibition of PTEN by exchange factor P- REX2a. Science 325: 1261-1265. Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA et al. 1998. Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic acids research 26: 362-367. Hong TM, Yang PC, Peck K, Chen JJ, Yang SC, Chen YC, Wu CW. 2000. Profiling the downstream genes of tumor suppressor PTEN in lung cancer cells by complementary DNA microarray. Am J Respir Cell Mol Biol 23: 355-363. Lesche R, Groszer M, Gao J, Wang Y, Messing A, Sun H, Liu X, Wu H. 2002. Cre/loxP-mediated inactivation of the murine Pten tumor suppressor gene. Genesis 32: 148-149. Li J, Simpson L, Takahashi M, Miliaresis C, Myers MP, Tonks N, Parsons R. 1998. The PTEN/MMAC1 tumor suppressor induces cell death that is rescued by the AKT/protein kinase B oncogene. Cancer research 58: 5667-5672. Macgillavry HD, Cornelis J, van der Kallen LR, Sassen MM, Verhaagen J, Smit AB, van Kesteren RE. 2011. Genome-wide gene expression and promoter binding analysis identifies NFIL3 as a repressor of C/EBP target genes in neuronal outgrowth. Mol Cell Neurosci 46: 460-468. . Matsushima-Nishiu M, Unoki M, Ono K, Tsunoda T, Minaguchi T, Kuramoto H, Nishida M, Satoh T, Tanaka T, Nakamura Y. 2001. Growth and gene expression profile analyses of endometrial cancer cells expressing exogenous PTEN. Cancer research 61: 3741-3749. Niu H, Cattoretti G, Dalla-Favera R. 2003. BCL6 controls the expression of the B7-1/CD80 costimulatory receptor in germinal center B cells. The Journal of experimental medicine 198: 211-221. Rhodes DR, Kalyana-Sundaram S, Mahavisno V, Varambally R, Yu J, Briggs BB, Barrette TR, Anstet MJ, Kincead-Beal C, Kulkarni P et al. 2007. Oncomine 3.0: genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles. Neoplasia 9: 166-180. Saal LH, Troein C, Vallon-Christersson J, Gruvberger S, Borg A, Peterson C. 2002. BioArray Software Environment (BASE): a platform for comprehensive management and analysis of microarray data. Genome Biol 3: SOFTWARE0003. Shai R, Shi T, Kremen TJ, Horvath S, Liau LM, Cloughesy TF, Mischel PS, Nelson SF. 2003. Gene expression profiling identifies molecular subtypes of gliomas. Oncogene 22: 4918-4923.
40 Simpson L, Li J, Liaw D, Hennessy I, Oliner J, Christians F, Parsons R. 2001. PTEN expression causes feedback upregulation of insulin receptor substrate 2. Molecular and cellular biology 21: 3947- 3958. Stolarov J, Chang K, Reiner A, Rodgers L, Hannon GJ, Wigler MH, Mittal V. 2001. Design of a retroviral- mediated ecdysone-inducible system and its application to the expression profiling of the PTEN tumor suppressor. Proceedings of the National Academy of Sciences of the United States of America 98: 13043-13048. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES et al. 2005. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences of the United States of America 102: 15545-15550. Unoki M, Nakamura Y. 2001. Growth-suppressive effects of BPOZ and EGR2, two genes involved in the PTEN signaling pathway. Oncogene 20: 4457-4465.
41