Supplementary Information 1 s1

Namikawa, et al.

Supplementary information

Supplementary information 1

Plasmid constructions, transfections, and lusiferase assay. About 3.7 kb of rat SCG10 gene promoter region containing one endogenous NRSE was kindly provided by Dr. N.

Mori (Nagasaki Univ., Japan). The 0.45 kb minimal proximal promoter sequence (S0.4; -440

- +26) 1,2 was amplified by polymerase chain reaction, and ligated into pBS-KSII(+)

(Stratagene). Plasmids were selected for their orientation to create S0.4 (+)-pBS (the BamHI site in a multiple cloning site is located upstream of S0.4) and S0.4 (-)-pBS (that is located downstream of S0.4). Two complementary oligonucleotides (5'-

GATCTAGCTGCAAAGCCATTTCAGCACCACGGAGAGTGCCTCTGCAGCTGCAAA

GCCATTTCAGCACCACGGAGAGTGCCTCTGCAGCTG-3') and (5'-

GATCCAGCTGCAGAGGCACTCTCCGTGGTGCTGAAATGGCTTTGCAGCTGCAGA

GGCACTCTCCGTGGTGCTGAAATGGC

TTTGCAGCTA-3'), containing two NRSEs (underlined), were annealed and inserted into the BamHI site of S0.4 (+)-pBS, or S0.4 (-)-pBS for adding two NRSEs to S0.4 upstream

(2N-S0.4) or downstream sequence (S0.4-2N), respectively. Furthermore, one or two insertions into the BamHI site of 2N-S0.4 or S0.4-2N generated further multiple NRSE tagged promoters (4N-S0.4 and 8N-S0.4 or S0.4-4N and S0.4-8N). These S0.4-containing promoters were cloned into pGL3 Luc expression vector (Promega) to estimate promoter activity. In addition, about 3.7 kb SCG10 gene promoter (S3.7) or 2 kb fragment (-1986 -

+26) (S2) excised from S3.7 by Bgl II and Hind III were also subcloned into pGL3 (S3.7-

- 1 - Namikawa, et al.

Luc and S2-Luc, respectively). Further, S2 was subcloned into pBS-KS (Stratagene, S2- pBS), and one NRSE sequence (underlined; created by annealing of two complementary oligonucleotides 5'-

GATCTAGCTGCAAAGCCATTTCAGCACCACGGAGAGTGCCTCTGCAGCTG-3' and

5'-GATCCAGCTGCAGAGGCACTCTCCGTGGTGCTGAAATGGCTTTGCAGCTA-3') or two NRSE sequences (created using the oligonucleotide pair as above) were inserted into the BamHI site of S2-pBS to generate one or two NRSE tagged S2 in its downstream region

(S2-N or S2-2N, respectively). These S2 based promoters and the other promoters, the NSE

3 (kindly donated by Dr. J.G. Sutcliffe, The Scripps Research Institute, USA), human

Synapsin 1 promoter 4 (kindly donated by Dr. S. Kugler, University of Tübingen, Germany), and HSV-TK promoter (derived from phRL-TK; Promega) were also subcloned into pGL3.

These constructs were transfected into PC12 or NIH3T3 cells using lipofectamine 2000

(Invitrogen) according to the manufacturer’s protocol. Two days after transfection into PC12 or NIH3T3 cells, Luc activities were measured using a luciferase assay kit (Promega) according to the manufacturer’s protocols. Luc activities of these constructs were normalized against HSV-Luc.

Construction of adenoviruses and infection into cultured cells. S2-2N promoter (named as S2NP) or the 2.5 kb mouse GFAP promoter region 5 (-2500 - +12, kindly provided by Dr.

K. Ikenaka, (National Institute for Physiological Science, Japan) was cloned into

pAxAwNCre 6 (kindly provided by Dr. I Saito, Tokyo Univ. Japan), which is a cosmid vector without a promoter, for preparing cell type-specific Cre expressing adenoviruses (named as

AxS2NPNCre and AxGFAPNCre, respectively). In addition, we generated a cosmid vector,

AxAwLuc where Cre of AxAwNCre is replaced by luciferase (from pGL3). S2NP and HSV-

TK promoter were ligated to upstream of the lusiferase gene for preparing a Luc expression adenovirus directly driven by these promoters. On the other hand, lusiferase, or EGFP (from

EGFP-C1, BD Bioscience) was cloned into pAxCALNLw 6 (Takara, Japan), to prepare the

Cre-activating adenoviruses, AxCALNLLuc, or AxCALNLEGFP, respectively. The generated cosmid vectors were used as transfer vectors for adenoviral preparation. For obtaining recombinant adenovirus, we used Takara adenovirus expression kit, followed by

CsCl gradient centrifugation 7 for animal experiments. Viral titers (plaque forming unit

(PFU) /ml) were determined using a plaque-forming assay on 293 cells as described previously 7. Fifty microliters of DMEM supplemented 5% FCS (5% FCS-DMEM) was dispensed into each well of a 96-well tissue-culture plate, and then eight rows of three fold serial dilution of the virus starting from 10-4 dilution were prepared. Then, 3 × 105 of 293 cells in 50 ml of 5% FCS-DMEM was added to each well. The plate was incubated in 5%

CO2 in air, and 50 ml of 10% FCS-DMEM was added to each well every three days. Twelve days later, the endpoint of the cytopathic effect was determined by microscopy, and 50%

tissue culture infectious dose (TCID50) was calculated. TCID50/ml approximately corresponds to one PFU /ml as described in the previous work 7.

For Luc expressing adenoviral infection, confluent cultures of PC12 cells were infected

with AxmSCGLuc or AxCALNLLuc plus AxS2NPNCre to obtain a multiplicity of infection

(MOI; PFU/cells) as indicated in Figure 2b, according to the procedures described elsewhere

7. Luc assay was carried out two days after infection as above. For the virus infection into neuron-glia co-cultures, primary cultures were prepared from tissues of Wistar rats.

Dissociated cultures were prepared from cerebral cortex of embryonic day 18, SCG of postnatal day 0, or lumber DRG of adult animals using standard procedures 8. Since we found intense Luc gene expressions when virus concentrations were used at MOI = 40 of

AxS2NPNCre and MOI = 20 of AxCALNLLuc in PC12 cells (Figure. 2b), the same MOIs were used for subsequent in vitro double infection experiments using primary cultures. Two days after co-culture preparation, double infection with AxCALNLEGFP (at MOI = 20) and cell type specific Cre expressing viruses (AxS2NPNCre or AxGFAPNCre at MOI = 40, respectively) into cultured cells was performed as described previously 7. 48 h later, immunostaining with anti-neurofilament antibody against rat 165KDa isoform (for staining of neurons; 1:10 dilution of cell supernatant of 2H3 hybridoma) or anti-GFAP antibody

(Sigma, 1:500), followed by reaction with Alexa 594-labeled secondary antibodies

(Molecular Probes) and staining with Hoechst 33258 (Wako, Japan) was performed.

Adenoviral infection into rat brain and visualizations of injection areas. Adenoviral infection into brain areas consisted of stereotactically injecting AxCALNLEGFF (0.7µl of

1×107 pfu/µl) and each Cre expressing virus (AxS2NPNCre or AxGFAPNCre; 1.4µl of

1×107 pfu/µl each) into brains of 2 month old Wistar rats. The following coordinates were used: dorsal cortex (bregma 0 mm, lateral 3 mm, dorsoventral 2 mm), striatum (bregma 0 mm, lateral 3 mm, dorsoventral 5.5 mm), cerebellum (bregma –4.5 mm, lateral 3 mm, dorsoventral 3.5 mm), hypoglossal nucleus (1.5 mm depth from Rhomboid fossa). Injection speed was at a rate of 0.25µl/min. Rats were anesthetized with pentobarbital seven days after viral infections, and perfused with phosphate-buffered saline (PBS) containing 4% paraformaldehyde (PFA). Brains were postfixed for 24 h in 4% PFA, and cryoprotected in

20% sucrose for 2 days. The virus-injected brain areas were sectioned (16 m thick), and mounted onto gelatin-coated slides. Thirty minutes after blocking in 5% bovine serum albumin (BSA) in PBS containing 0.3% Triton-X-100 (PBS-T) for 10 min at room temperature, sections were incubated with anti-NeuN monoclonal antibody (Chemicon;

1:1000) or anti-GFAP monoclonal antibody (Sigma; 1:1000) in 1% BSA in PBS-T overnight at 4°C. The next day, sections were rinsed three times in PBS, Brain sections were rinsed three times in PBS, then incubated in blocking solution containing 5% BSA in PBS-T for 10 min at room temperature. The primary antibodies were diluted in 1% BSA in PBS-T. After overnight incubation with the primary antibodies at 4ºC, the sections were washed three times in PBS for 10 min at room temperature. The secondary antibodies, anti-mouse IgG conjugated with Alexa-592 (1:500; Molecular Probes) in 1% BSA in PBS-T were applied for 30 min at room temperature. Sections were washed several times in PBS, and coverslipped using 50% glycerol in PBS for microscopic analysis. The number of EGFP positive cells or double-stained EGFP/NeuN cells was assessed for rats infected with neuron

specific adenovirus (AxCALNLEGFP+ AxS2NPNCre) on the sections of the cortex and striatum. The percentage of EGFP/NeuN-positive neurons of total EGFP positive cells were calculated. Ten sections prepared from five different animals were studied.

References for Supplementary information