Contact: Claudie Lemercier, E-Mail: Claudie.Lemercier Cea.Fr

S Elsen, V Collin-Faure, X Gidrol, C Lemercier « The opportunistic pathogen Pseudomonas aeruginosa activates the 1 DNA double strand break signalling and repair pathway in infected cells » Contact : Claudie Lemercier, e-mail : claudie.lemercier @cea.fr

Supplementary Table 1: Strains and plasmids used in this work

Strains or plasmids Description Reference Strains P. aeruginosa PAO1 Clinical isolate (exoS, exoT, exoY) Lab collection PAK Clinical isolate (exoS, exoT, exoY) Lab collection CHA Mucoid cystic fibrosis isolate (exoS, exoT, exoY) [1] CHAExsA exsA::Gm mutant of CHA (CHA-D1) [2] CHAExoS exoS::Gm mutant of CHA [3] CHAT CHA deleted of the exoT gene (CHATlox) [4] CHAST CHA deleted of exoS and exoT genes(CHASTlox) [4] CHAExoS/ExoS ∆ExoS with exoS in chromosome This study

CHAExoS/ExoSRK ∆ExoS with exoS-R146K in chromosome (ExoSRK) This study CHAExoS/ExoS2ED ∆ExoS with exoS-E379D-E381D in chromosome This study (ExoS2ED) Escherichia coli AN180 Derivative of K12 (argE3 thi-1 Smr) [5] Top10 Chemically competent cells Invitrogen

Plasmids pCR-Blunt II-TOPO Knr; Cloning vector Invitrogen pRK2013 Knr; Helper plasmid with conjugative properties [6] mini-CTX1 Tcr; Vector for single-copy integration onto the P. aeruginosa chromosomal attB site [7] pFLP2 Apr; Flp-recombinase expressing plasmid [8] pCTX-ExoS E/B mini-CTX1 vector carrying wild-type exoS gene This study pCTX-ExoSRK mini-CTX1 vector carrying exoS R146K gene This study pCTX-ExoS2ED mini-CTX1 vector carrying exoS E379D-E381D gene This study S Elsen, V Collin-Faure, X Gidrol, C Lemercier « The opportunistic pathogen Pseudomonas aeruginosa activates the 2 DNA double strand break signalling and repair pathway in infected cells » Contact : Claudie Lemercier, e-mail : claudie.lemercier @cea.fr

Supplementary Table 2: Oligonucleotides used in this work

Name Sequence (5’-3’) Comments ExoS/F-EcoRI GGGAATTCGTGCCAGCCCGGAGAGACTG Complementation ExoS/R-BamHI CGGATCCGCTGCCGAGCCAAG of exoS ExoS/F-R146K GATGGGGCGCTGAAATCGCTGAGCACC ExoS/R-R146K GGTGCTCAGCGATTTCAGCGCCCCATC Mutagenesis of exoS ExoS/F-E379-381D CGAACTACAAGAATGATAAAGATATTCTCTATAACAAAG ExoS/R-E379-381D CTTTGTTATAGAGAATATCTTTATCATTCTTGTAGT TCG

Recognition sequences for restriction enzymes are underlined and mutated nucleotides are in bold. S Elsen, V Collin-Faure, X Gidrol, C Lemercier « The opportunistic pathogen Pseudomonas aeruginosa activates the 3 DNA double strand break signalling and repair pathway in infected cells » Contact : Claudie Lemercier, e-mail : claudie.lemercier @cea.fr

SUPPLEMENTARY “MATERIALS AND METHODS”

Plasmid and strain construction To complement CHAExoS mutant, a fragment comprising the exoS coding sequence, 150 bp upstream from the start codon and 71 pb downstream from the stop codon, was amplified by PCR using CHA genomic DNA as template and the ExoS/F-EcoRI and ExoS/R-BamHI primers. The resulting 1592-bp fragment was cloned into pCR-BluntII-TOPO, leading to pTOPO-ExoS E/B plasmid, and sequenced. After cleavage with EcoRI and BamHI, the fragment was cloned into mini-CTX1 cut by the same enzymes, leading to pCTX-ExoS E/B. Generation of exoS mutations was performed using the QuickChange site-directed mutagenesis kit (Stratagen, Agilent Technologies, Basel, Switzerland). pTOPO-ExoS E/B was used as a template, and the two pairs of the following primers, ExoS/F-R146K and ExoS/R-

R146K, and ExoS/F-E379-381D and ExoS/R-E379-381D, led to the pTOPO-ExoSRK and pTOPO-ExoS2ED, respectively. After cleavage with EcoRI and BamHI, the fragments were cloned into mini-CTX1 cut by the same enzymes, leading to pCTX-ExoSRK and pCTX-

ExoS2ED. The three mini-CTX-derived plasmids were introduced into the CHAExoS strain by triparental conjugation using the conjugative properties of the pRK2013. The transconjugants were selected on PIA plates containing tetracycline: plasmids were inserted at the chromosomal CTX attachment site (attB site). The pFLP2 plasmid was used to excise the Flp-recombinase target cassette. The complementation was checked by comparing the secreted ExoS toxins in the wild-type, mutated and complemented strains upon T3SS induction.

SUPPLEMENTARY FIGURE LEGENDS

Supplementary Fig. S1 Total extracts of cells infected by P. aeruginosa at a MOI ranging from 0 to 100 for 2 h 30. Western blot analysis of c-Jun. C: control undifferentiated HL60, M: macrophage HL60. Blots were quantified with ImageJ software. Relative total c-Jun (doublet) level and phospho c-Jun (upper band only) level were normalised to GAPDH level. Their relative intensity was set to 1 for mock macrophages (dark bar). Total c-Jun increased about 2 fold upon infection whereas phospho c-Jun increased more than 30 fold in these conditions. Their maximal levels were obtained at a MOI of 10.

Supplementary Fig. S2 Confocal sections of HL60 macrophages infected by P. aeruginosa (MOI 100, 1 h 30) and stained for H2AX (red), 53BP1 (green) and DNA (not shown). Section analysis confirmed the co-localisation of the two proteins (yellow) in the same foci. Top: single optical section, showing a perfect superposition of the red and the green signals in S Elsen, V Collin-Faure, X Gidrol, C Lemercier « The opportunistic pathogen Pseudomonas aeruginosa activates the 4 DNA double strand break signalling and repair pathway in infected cells » Contact : Claudie Lemercier, e-mail : claudie.lemercier @cea.fr the indicated foci. Bottom: analysis through a pile of sections, and cross-section through two different foci (left and right)

Supplementary Fig. S3 Confocal section of H1299 lung adenocarcinoma cells infected by P. aeruginosa (MOI 100, 1 h 30) and stained for H2AX (red), 53BP1 (green) and DNA (not shown). As a positive control, cells were also submitted to gamma-irradiation (2 Gy) and immunostained 1 h later. Section analysis confirmed the co-localisation of 53BP1 and H2AX in the same foci, after irradiation (top, 2 Gy) and after infection (bottom, P. aeruginosa).

SUPPLEMENTARY REFERENCES

1. Toussaint B, Delic-Attree I, Vignais PM (1993) Pseudomonas aeruginosa contains an IHF- like protein that binds to the algD promoter. Biochem Biophys Res Commun 196: 416-421.

2. Dacheux D, Attree I, Schneider C, Toussaint B (1999) Cell death of human polymorphonuclear neutrophils induced by a Pseudomonas aeruginosa cystic fibrosis isolate requires a functional type III secretion system. Infect Immun 67: 6164-6167.

3. Verove J, Bernarde C, Bohn YS, Boulay F, Rabiet MJ, et al. (2012) Injection of Pseudomonas aeruginosa Exo toxins into host cells can be modulated by host factors at the level of translocon assembly and/or activity. Plos One 7, e30488.

4. Quénée L, Lamotte D, Polack B (2005) Combined sacB-based negative selection and cre- lox antibiotic marker recycling for efficient gene deletion in Pseudomonas aeruginosa. Biotechniques 38: 63-67.

5. Butlin JD, Cox GB, Gibson F (1971) Oxidative phosphorylation in Escherichia coli K12. Mutations affecting magnesium ion- or calcium ion-stimulated adenosine triphosphatase. Biochem J 124: 75-81.

6. Figurski DH, Helinski DR (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci USA 76: 1648- 1652.

7. Hoang TT, Kutchma AJ, Becher A, Schweizer H.P (2000) Integration-proficient plasmids for Pseudomonas aeruginosa: site-specific integration and use for engineering of reporter and expression strains. Plasmid 43: 59-72.

8. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP (1998) A broad-host- range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212: 77-86.