Supplemental Figure Legend

Figure S1. Deletion of FoxO1/3/4 in primary MEFs. Relative expression levels of FoxO1/3/4 were detected by quantitative RT-PCR in FoxO1/3/4 L/L, Rosa26-CreERT2 MEFs with or without 4OHT treatment.

Figure S2. FoxO deletion does not affect amino acid or serum deprivation-induced mTORC1 inactivation. (A) FoxO WT and KO MEFs were cultured in medium with or without amino acids, or re-added with amino acids after amino acid deprivation, and then subjected to western blotting analysis. (B) FoxO WT and KO MEFs were cultured in serum free medium for different hours as indicated, and then subjected to western blotting analysis.

Figure S3. FoxO regulation of S6K and S6 phosphorylation is mTORC1-dependent. FoxO WT and KO MEFs were cultured in glucose containing or free medium, with or without 20 nm rapamycin, for 24 hours and subjected to western blotting analysis.

Figure S4. FoxO regulation of energy stress-induced apoptosis is mTORC1-independent. (A) Representative FACS analysis showing Annexin V staining of FoxO WT and KO MEFs which were cultured in glucose containing or free medium with or without rapamycin treatment. (B) Bar graph showing the percentages of Annexin V positive cells of FoxO WT and KO MEFs which were cultured in glucose containing or free medium with or without rapamycin treatment.

Figure S5. The representative images of various RCC cells after glucose deprivation for 48 hours.

Figure S6. FoxO knockdown renders cells more resistant to glucose starvation-induced apoptosis. Bar graph showing the percentages of Annexin V positive cells of UOK101 cells infected with control shRNAs or FoxO1 and FoxO3 shRNAs cultured in glucose free medium for different hours as indicated.

Figure S7. FoxO knockdown does not affect energy stress-induced AMPK, Raptor or TSC2 phosphorylation. 786-O cells infected with control shRNAs or FoxO1 and FoxO3 shRNAs

1 were treated with 1mM AICAR with different hours, and subjected to western blotting as indicated.

Figure S8. FoxO regulation of BNIP3 expression in response to energy stress is mTORC1- independent. FoxO WT and KO MEFs were cultured in glucose containing or free medium, with or without 20 nm rapamycin, for 24 hours and subjected to western blotting analysis to detect BNIP3 expression. The S6 and S6K phosphorylation levels are shown in Figure S3.

Figure S9. FoxO and BNIP3 are not involved in energy stress-induced autophagy. (A and B) FoxO WT and KO MEFs were either deprived of glucose for 24 hours (A) or treated with 1mM AICAR for 2 hours (B), and subjected to western blotting analysis. (C and D) Cells infected with control shRNA or BNIP3 shRNA were either deprived of glucose for 24 hours (C) or treated with 1mM AICAR for 2 hours (D), and subjected to western blotting analysis.

Figure S10. AMPK or Lkb1 deficiency does not affect glucose starvation-induced BNIP3 expression. (A and B) AMPK WT and KO MEFs were cultured in glucose containing or glucose free medium for 24 hours, and then subjected to either western blotting (A) or real time PCR analyses (B) to detect BNIP3 expression. (C and D) Lkb1 WT and KO MEFs were cultured in glucose containing or glucose free medium for 24 hours, and then subjected to either western blotting (C) or real time PCR analyses (D) to detect BNIP3 expression.

Figure S11. Reexpression of BNIP3 in p38β KO cells suppress mTORC1 activation under energy stress condition. p38β WT and KO MEFs with stable expression of either empty vector (EV) or BNIP3 were treated with 1 mM AICAR for 2 hours, and then subjected to western blotting analysis.

Figure S12. FoxO deficiency does not affect TSC1/Rictor expression or AKT phosphorylation under energy stress conditions. (A and B) FoxO WT and KO MEFs were either deprived of glucose for 24 hours (A) or treated with 1mM AICAR for 2 hours (B), and subjected to western blotting analysis as indicated.

Table S1. The list of genes which are regulated by FoxO under glucose starvation condition. The table is provided as an Excel file, showing the genes with information including

2 gene ID, gene symbol, gene type (up- or down-regulated), expression levels under different cell lines/conditions as indicated. + G: cells cultured in glucose containing medium; - G: cell cultured in glucose free medium.

Supplemental Experimental Procedures

Constructs and primers. The mouse BNIP3 cDNA was amplified from BNIP3 expression plasmid (gift from Dr. Hsiao-Sheng Liu) and then subcloned into pBabe vector. The mouse BNIP3 promoter region was amplified by PCR from mouse genomic DNA, and then subcloned into pGL3-Basci vector.

The primer sequences used in this study are:

Primer name Primer sequence BNIP3-Prom-F1 CCTCCTTCTAAATTAAGCTGTTCTT BNIP3-Prom-R1 GGGAGGCTGTTGTAATTCCTC BNIP3-Lucfe-kpnF1 GGCATCCATTCTTGAAGTGC BNIP3-Lucfe-xoh1R1 CTTCAGGGCTGAAAGGGTTT BNIP3-mut#1-promF1 GACATTGTCTGGGAAAACACGAAACACCAAATGAAGCTG BNIP3-mut#1-promR1 CAGCTTCATTTGGTGTTTCGTGTTTTCCCAGACAATGTC BNIP3-mut#2-promF2 GTATAACCTTAGCACTCCAcACgAAACAAACGGAAATCAAG BNIP3-mut#2-promR2 CTTGATTTCCGTTTGTTTcGTgTGGAGTGCTAAGGTTATAC BNIP3-RV-F-Bamh1 CGGAATTCCGTCAGAAGGTGCTAGTGGAAGT BNIP3-RV-R-Ecor1 CGGGATCCCGATGGACTACAAAGACGATGAC

BNIP3-Prom-F1 and BNIP3-Prom-R1 are used for BNIP3 Chip-qPCR; BNIP3-Lucfe- kpnF1 and BNIP3-Lucfe-xoh1R1 are used for PGL3-BNIP3 promoter vector construction; BNIP3-mut#1-promF1, BNIP3-mut#1-promR1, BNIP3-mut#2-promF2, and BNIP3-mut#2- promR2 are used for mutation of FoxO binding sites in the pGL3-BNIP3 promoter vector; BNIP3-RV-F-Bamh1 and BNIP3-RV-R-Ecor1 are used to construct pBABE-BNIP3 vector; The mouse BNIP3 cDNA was amplified from BNIP3 expression plasmid (Gift from Dr. Hsiao-Sheng Liu) and then subcloned into pBabe vector.

The mouse BNIP3 shRNAs sequences (Open Biosystems) used are as below: m-BNIP3 shRNA#2: CCCAGCATGAATCTGGACGAA

3 m-BNIP3 shRNA#3: AGAAGTTGAAAGTATCCTGAA

The human BNIP3 shRNAs sequences (Thermo Scientific) used are as below: h-BNIP3 shRNA#1:ATGGCCAGCAAATGAGAGAGC h-BNIP3 shRNA#5:AATAAACACAAGTGACGTGGC