Supplementary Table 1: Crystallographic Statistics

Recognition of a functional peroxisome type 1 target

by the dynamic import receptor Pex5p

Will A. Stanley1, Fabian V. Filipp2, Petri Kursula1, Nicole Schüller1, Ralf

Erdmann3, Wolfgang Schliebs3, Michael Sattler2, Matthias Wilmanns1*

1 EMBL-Hamburg Outstation, c/o DESY, Notkestrasse 85, 22603 Hamburg, Germany

2 Structural and Computational Biology Unit, EMBL-Heidelberg, Meyerhofstrasse 1,

69117 Heidelberg, Germany

3 Institute for Physiological Chemistry, Department of Systems Biology, Faculty of

Medicine, Ruhr University of Bochum, 44780 Bochum, Germany.

Supplementary Material

1 Table S1: Oligonucleotides used in this contribution.

Construction Sequence (5´-3´)* Subcloning of sites

Q586R GAGGCCCTGAACATGAGGAGGAAAAGCCGGGG (sense) CCCCGGCTTTTCCTCCTCATGTTCAGGGCCTC (antisense)

S589Y AACATGCAGAGGAAATACCGGGGCCCCCGGGG (sense) CCCCGGGGGCCCCGGTATTTCCTCTGCATGTT (antisense)

S600W GGAGGTGCCATGTGGGAGAACATCTGG (sense) CCAGATGTTCTCCCACATGGCACCTCC (antisense)

N382A GTACCACCCAGGCAGAGGCTGAACAAGAACTATTAG (sense) CTAATAGTTCTTGTTCAGCCTCTGCCTGGGTGGTAC (antisense)

GFP-SCP2 GATCTCGAGCCATGGGCTCTGCAAGTG (sense) XhoI TGAATTCAGAGCTTAGCGTTGCCTG (antisense) EcoRI

* Mutation sites are bold. Restriction sites are underlined.

2 Supplementary Figure S1: NMR data characterizing SCP2-Pex5p(C) binding.

3 Legend of Supplementary Figure S1: NMR data characterizing SCP2-Pex5p(C) binding. (A, B) Chemical shift difference () vs. residue number between the free and Pex5p(C) bound state of 0.5 mM 15N, 2H-labeled preSCP2 (A) and mSCP2 (B) were monitored at a 1:1.2 cargo/receptor ratio. The PTS1 and secondary interactions sites are depicted by red and blue bars, respectively. Residues with  > 0.1 ppm are colored red or blue in Figure 2D. Secondary structure elements of SCP2 are shown on top. (C) Comparison of 15N T1 relaxation times (measured at 600 MHz with a spin- lock field strength of 2 kHz) for free mSCP2 and when bound to Pex5p(C) measured at 22˚ C at 600 MHz 15N frequency. The T1 values of flexible terminal regions are significantly higher than the average values of residues in the core of the domain. Due to the interaction with Pex5p(C), T1 values of residues in the PTS1 tail are strongly reduced, indicating that they become highly ordered. The large increase in the molecular weight of mSCP2 bound to Pex5p(C) (49.6 kDa) versus free mSCP2 (13.4 kDa) results in slower molecular tumbling, which is reflected in a general reduction of the average T1 values. (D) Strong chemical shift perturbations of N-H NMR signals

( >0.1 ppm) are colored on a surface representation of mSCP2. The PTS1 interaction site is shown in red; the secondary binding surface is shown in blue.

4 Supplementary Figure S2: (A, B) Relative peak intensities in 1H,15N TROSY experiments recorded on free preSCP2 (A) and when bound to Pex5p(C) (B), indicating that the pre-sequence remains highly flexible even when SCP2 is bound to

Pex5p(C). (C) {1H}-15N heteronuclear NOE data for free preSCP2 at 295 K as described (Farrow et al. 2003). Chemical shift assignments for residues 1-25 were obtained from triple resonance experiments on free preSCP2 and 15N-edited NOESY experiments on free and Pex5p(C) bound preSCP2. Spectra were processed with

NMRPipe and analysed using NMRVIEW.

5 6 Supplementary Figure S3: Structural mobility changes in the Pex5p receptor

and mSCP2 upon receptor/cargo complex formation. (A), sequence/B-factor

plot of the structures of Pex5p(C) in the absence (gray, black) and in the presence

of the mSCP2 cargo (red). The residue B factors of the two Pex5p(C) molecules

with well defined N-terminal TPR segments 1-4 are shown by filled symbols.

The residue B factors of the two other Pex5p(C) molecules, in which the N-

terminal TPR domains 1-4 are mobile, are displayed with open symbols. (B),

sequence/B-factor plot of the structures of mSCP2 in the absence (black) and in

the presence (red) of the Pex5p(C) receptor. The residue B factors of the cargo-

unloaded mSCP2 structure have been taken from the coordinates of the PDB

entry 1C44 (Choinowski et al., 2000). In (A) and (B), the B factors of the

Cpositions have been used for display. (C), ribbon representations of the

conformations of mSCP2 loaded onto the Pex5p(C) receptor (left) and unloaded

(right). The residue B factors are mapped on the two ribbons in rainbow colors,

ranging from blue (B = 15 Å2) to red (B = 60 Å2). While the N-termini of mSCP2

are flexible in both conformations, the C-terminus bearing the PTS1 motifs

becomes the most rigid part of the structure upon loading onto the Pex5p(C)

receptor. The C-terminus of mSCP2 straightens into an extended conformation

pointing away from the remaining structure.

7 Supplementary Figure S4: Expression of Pex5 variants in human fibroblasts. Equal amounts of whole cell lysates (10 ug protein) from Pex5-deficient human fibroblasts transfected transiently for 24 hours with plasmids expressing (1) PEX5L, (2) S600W,

(3) Q586R, (4) S589Y, (5) N382A, (6) empty pcDNA vector and from wild-type cells (7) were subjected to Western-Blot analysis using antibodies directed against human PEX5 and GFP. Monoclonal anti-GFP (JL-8) antibodies were obtained from

BD Biosciences, Pharmingen, Germany.