Gene Expression Profiling During Conjugation of the Tetrahymena Thermophila Cyclin TTHERM

Gene expression profiling during conjugation of the Tetrahymena thermophila cyclin TTHERM_00698650 (CYC14)

Jenny Van Kirk

Department of Biology, BIO464 Lab 2009, Bradley University

Submitted December 8, 2009

Abstract:

TTHERM_00698650, named CYC14, is a cyclin gene found in the ciliate

Tetrahymena thermophila. Cyclins are known to be heavily involved in the ciliate sexual life cycle, conjugation, which follows a distinctive sequence including meiosis, nuclear fissions and fusions, postzygotic divisions, and cytoplasmic determination of nuclear fate.

In order to uncover additional information regarding the function of CYC14 in

Tetrahymena, RT-PCR gene expression profiling was used to reveal its level of expression at different periods in the life cycle of Tetrahymena, specifically during vegetative states, starved states, and at various time points after conjugation. This data was complemented with expression data from public databases. By incorporating expression pattern data from this study with studies regarding the events of conjugation in Tetrahymena, our results indicate that TTHERM_00698650 is potentially involved in

DNA synthesis and macronuclear development.

Introduction:

Tetrahymena thermophila is a ciliate commonly used in laboratory studies due to its unique events during conjugation. The cell contains both a macronucleus and a micronucleus, which have unique roles throughout conjugation, becoming duplicated, differentiated, and degraded. To begin the process, two starved cells of different mating types pair, go through meiosis, and exchange haploid nuclei. After postzygotic divisions and other developmental events, the cell is left with one micronucleus (MIC) and one macronucleus (MAC) (Miao et al., 2009). Much research has been devoted to this process, and there is evidence that a cyclin, or many cyclins, is involved in the

Tetrahymena commitment to division (Asai and Forney, 2000). Cyclins function by binding and activating cyclin-dependent kinases (CDKs) and subsequently instructing the

CDKs to phosphorylate certain cell cycle proteins to activate or inactivate them. Once the cell has completed the necessary step(s), that cyclin is destroyed and the next cyclin is expressed to continue directing the cell through the cell cycle. Despite the general knowledge available regarding the functions of cyclins, the exact functions of individual cyclins throughout the cellular division process in Tetrahymena have not yet been determined.

With this knowledge, we performed a search of the Tetrahymena Genome

Database (TGD) for cyclins, in order to perform further studies and attempt to elucidate their functions. CYC14 was identified as a cyclin through BLAST searches. Because of this homology with other cyclins and cyclin associated genes, we believe that it is involved in the cell cycle. Thus, conjugating cells were studied and analyzed to reveal the expression pattern and function of TTHERM_00698650.

In this study, RT-PCR was used for gene expression profiling of the CYC14 gene.

TTHERM_00698650 was found to be expressed at low levels at hours 8 and 11-14 after conjugation, and at higher levels at hours 9 and 10 of conjugation. This may suggest that

TTHERM_00698650 is important for processes that occur at these time points, such as

DNA synthesis and macronuclear development. Materials and Methods

Cyclin genes were identified at the Tetrahymena Genome Database (Stover et al.,

2006) by searching for proteins with the keyword “cyclin”. A BLAST search with a cyclin protein sequence ensured that all cyclin genes were identified using this method.

Microarray data during conjugation (Miao et al., 2009) were collected for each gene from the Tetrahymena Gene Expression Database (TGED; Miao et al., 2009). PCR primers flanking an intron were generated for each gene using Primer3 (Rozen and Skaletsky

2000) and ordered from Integrated DNA Technology (Coralville, IA). Oligo-dT-primed

M-MLV reverse transcription (RT; Ambion) was performed on RNA collected from control cells and from cells at various stages of conjugation using the Trizol reagent

(Invitrogen) according to the manufacturer’s protocol. 1 mL of cells (2.1 x 103 cell/mL) was collected at each time point, pelleted at 6k rpm, supernatant discarded, and cells resuspended in 1mL of Trizol. 180 ng of each template RNA was used per reverse transcription reaction. cDNA was diluted 1:5 and used as a template for PCR. PCR was performed in 25 µL reactions using GOTaq (Fisher, Hampton, NH) with 1µL of each primer (10 µM). 15µL of completed PCR reaction products were separated on a 2% agarose gel. DNA bands were visualized using ethidium bromide and photographed with a Kodak EDAS290 imaging system. Band intensities were determined using ImageJ

(Abramoff et al., 2004). Results

Gene Expression Profile

The Tetrahymena Gene Expression Database provides an expression profile

TTHERM_00698650 indicating that the protein is expressed most highly at hours 0, 6,

and 11 after conjugation (Figure 1). Additionally, lower levels of expression appear to

exist during hours 10 through 13 of conjugation.

QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture.

Figure 1: Tetrahymena Gene Expression Database expression profile. For growing cells, L-l, L-m and L-h correspond respectively to ~1´105 cells/ml, ~3.5´105 cells/ml and ~1´106 cells/ml. For starvation, ~2´105 cells/ml were collected at 0, 3, 6, 9, 12, 15 and 24 hours（referred to as S-0, S-3, S-6, S-9, S-12, S-15 and S-24). For conjugation, equal volumes of B2086 and CU428 cells were mixed, and samples were collected at 0, 2, 4, 6, 8, 10, 12, 14, 16 and 18 hours after mixing (referred to as C-0, C-2, C-4, C-6, C- 8, C-10, C-12, C-14, C-16 and C-18) (Miao et al., 2009).

Gel electrophoresis was performed on samples from RT-PCR with the designed

primers (Figure 2) in order to reveal the periods of the life cycle of Tetrahymena in which

the CYC14 gene is expressed. >TTHERM_00698650(gene) ATGGCTCAAATATTAAAGGGAAGGATGAAACTTCTGACTAAGGAAAGTTGGGAGTATAATCCGAACACTAAAGCAAATATAGAT TTAAAAAAGGAAGCTCAACTGCGTAAAGAATCAATTAAATTTATGATGAGTTTAGGAGTTGAATCTCTCCATTTGCCTTTAAGC ACTGTAAATATTAATAATAATAAAAATTTTACTTTGTGCAAATGAATATTGCTGAGATTTTGAAGCAATTTTTTATTTTAATTT GTTTGATCCTTAGCATTTATTTTCATTTATTAGTTAAAAGCTTTTTTTAAATGTTTATTTTATTGATAAAGGTATAAAAGGCCA TAGTTATTTTCTAAAGATTCTGCTAAAATGTTTCTTTCAAGAATTTTGATAGATTTTTGTATGGAACTGTTAGCATTTTATTAA TGGCTAAGGACGATTACCATTAAAGAAGATTGGAAGATACAATAAAATCTTTTCTAATTGTAGCATAAAAAATGAGACTTTAAT AATTCAATAAGTATGTAGATCCAAACCGCCTTGAAACCAAAGAATAATAGGAAGCTTATTTACAAAAGCTTGGTCCAAAGGCAA TCACAATGCATCATGAAAACTTTTAAACTGCAGAAATAGAAATATTATAAATGTCAGGTAATTAATTACAAAATTTATATTAAT TGGGTTCAAAATTTTTCAAAAAAAGATGCAAATCGAATTAAAATTTAGTTTTTTTGACATCATATAAATAGACACTTACTTGAA TTTATTTATTTAGCTTAGTATCTATATTCAATTAATAGTTTGCTGATAAGTAGATTTATCATTTAAAATTGTAAAATTAATAGG ATATGACTTGGTTGTTGAAGTAACTAGTAAGTACTTAGATATATTTAAAAAGAAATATAACGGCATTACAGATAAAATTGTCTT TTAAGACTTAATCTAGCTTGCAGAAGAAAATACCAATACAATTTATATGAGTAATTTGTGTTTGTACTTCCATCCTATGATCCT AACCATAGTTGCAATCCAAGCTGCTGCTGAAAAATTAAATTGTAATTTACCAAACATCCAAATAGAGTCTAATGAATAAAAACA AGAAGATGATGATTTTGGCGATATTGACATCCCTGCTTAGTAAGTAGAGTGGTGGTAAATGTTTTCCAAAAGAATACAAAAAGA AGATATAAATGACTGTATGTAATACTATCAAGATTTTATAAAACTTTTAAATTGAATGTTAATTTATTTATTTATTTACTCTGT TGAAGAAATTGTCAATTTCTTTTTAAAAATAAATTTAAAAATTCTACTTTTTTAATCATATTTATAATTTCAAAAAACAGCATT TATTACTGATAAAAATAAATGCAATTTAATAACTTTTGATATAAAGTTTTTATTTTACTATATTTTAAAGTAAAATAATTTATG TTCAATAAGTAAAATTTATTTTTAATTTTCTAATTCGTATTTATTATTTCCAAAAAATCAGGATAAAAAGAAATACAATTTAAT AAATTTTGATAAAAAGTATTCAAGATTTATTATTAATAAAAATAAATTCAATTTAATAACTTTTAATCTAAAAAATTTCATTAA AATGATTTTGATATTTTAAAGTAAAATAGTTAATATTGAATGGATAAAATTAATTTTAATTTTCTAATAATTATTTATTATTTC TAAAAACTATGAATATATTTTTATTGATTTAAAACCTAATATTATTACTAAAAAAAAAATATATCACACTTTAATAATAAAATA TTACTTGATTAGAATTTTTATTAAAAATTTTAAAAGAACAAAATAAAATTATTAATTATTTTTAAATTTAAGAATAAATTTGGA TTCTAAGTAGAAATTATAGTAAATATTTAATAACACACTATTTATTGTTTTCAAAGAAAAATAGTGTTTGAGTAATTAATAATA GGTAATCCAGAACTACTTACTCCTGAAATGAATAAGTAGTTCAATAAAGCTTCTTTTTTATAATCATAATTATTTATTTGATTA ATCCATTTAATCTCTTATGATGGTATTCTTTCTCATTTTTTTCTTAGTATTTATCAATCTAAACTAATTTTATTTTTGGTCATT AAGTTTTTTTGCATATAAAGTATCATTTAAGATAATCGATATCTTACATGAGTTTTTAAAAAATTTGATTATTTTAGAATTTAG AAGTTTAAAGTTTATATTAATTTATTGATTAATTATTCAATTGATTGATTGAGATAGAGAATCAAATTAATTGATATTTTTAGA AAAGAAGAATATTATTTGATTTTTAATTAATATTTTTGTAGAAATATGGATAAAGAGTAGCAGCAGAATTATTTGTAAAATCAT TAACAAGGAAGTAATTAGATGAATTAACAACAATAGGCTGCTTAAGGATAGATGACTGGAGGGATGTGGCTTTTAACAAAGGAA GATTGGGTGCTCATTAGGCCAGATAAAAGCAAGAAACAGTCAATAGAAGATGTGAAACAAGCAAATTCAGTAGCAAAATTTATA AAAATGTTTGCAGAGGAATTCGAGTATTATTTCAGCGATATGTTGAAGCTAGGGACACAA

Figure 2: TTHERM_00698650 gene sequence. The introns are highlighted in red and the primers designed and used in PCR are highlighted in yellow. Note that the size of the expected PCR product is 355 base pairs.

By correlating the levels of expression with the processes occurring in conjugation at specific time points, the processes in which the protein is involved can be ascertained.

The gel provides a qualitative display of our results. It appears that expression of

TTHERM_00698650 begins at hour 8 after conjugation and continues to be expressed through hour 14 after conjugation (Figure 3). The highest levels of expression occur at hours 9 and 10. Primers used for RT-PCR amplification were expected to yield a product of 355 bp of DNA, which is confirmed by the results of the gel. In comparing the 500 bp band of genomic DNA with the 1 kb DNA ladder, we find that this is approximately the size of the PCR product. M G v7 v8 s7 s8 0 1 2 3 4 5 6 7 M 8 9 10 11 12 13 14 15 16 17 18

Figure 3 – Gel electrophoresis of cDNA (RT-PCR product) at all hours of conjugation and different time points in the Tetrahymena life cycle. RT-PCR with designed primers (Figure 2) indicated that TTHERM_00698650 is transcribed during hours 8-14 after conjugation. It seems to be transcribed at the highest levels 8 and 9 hours after conjugation. v, vegetatively growing; s, starved; numbers indicate hours into conjugation. V and S with subscripts indicate the different strains used, 427 and 428, respectively. Lanes labeled M are DNA markers, for which a Fisher full scale 1 KB ladder was used. Band size is 500 bp from the genomic template, G (gDNA), and 355 bp from cDNA .

The intensity of the bands in the gel quantifies the levels of expression. The more mRNA present at a given time point, the more cDNA that will be produced and amplified in RT-PCR. Results indicate that TTHERM_00698650 is not expressed until eight hours after conjugation. At eight hours post-conjugation, TTHERM_00698650 is expressed at low levels, and it is subsequently expressed at higher levels during hours nine and ten, as indicated by the large areas displayed in the intensity graph (Figure 4). Low levels of expression continue through hour fourteen post-conjugation, at which point

TTHERM_00698650 expression is stopped. 1200

Arbitrary Units of Intensity 200

0 427V428V 427S 428S C0 C1 C2 C3 C4 C5 C6 C7 C8 C9 C10 C11 C12 C13 C14 C15 C16 C17 C18

RNA Collection Time Points Figure 4: Intensity graph of bands in agarose gel (Figure 3). The arbitrary units indicate the intensity of the respective band on the electrophoresis gel. X-axis values C8-C14, corresponding to hours 8 through 14 after conjugation show the highest band intensities, indicating high levels of protein expression during those time points of the Tetrahymena life cycle.

Discussion

By considering what is occurring in the cells during hours eight through fourteen

post-conjugation, it is possible to identify possible processes in which the product of the

CYC14 gene is involved. The Tetrahymena Gene Expression Database shows an

expression pattern for TTHERM_00698650 in which the highest levels of expression are

during hours 0, 6, and 11 of conjugation. This seems to suggest that

TTHERM_00698650 has a role in DNA synthesis. At hour 0 of conjugation, the cell is

just beginning S phase. Thus, DNA replication is necessary at this time, and is necessary

again at 6 hours after mixing, as the cell has to begin mitosis once more. A role in DNA

replication is supported by the BLAST results that this cyclin may be a cyclin H subunit,

as cyclin H is annotated as being involved in cell division, chromosome partitioning, and

DNA replication. After running RT-PCR of the gene and analyzing the results on an agarose gel, different results were obtained. This experiment provided data that suggested the cyclin portion of the gene is only expressed between hours 8 and 14 of conjugation. At C-8, eight hours after mixing, macronuclear development is continuing in the cell. From hours 10 to 14, the loss of the old macronucleus and one micronucleus occurs. This data supports a theory that TTHERM_00698650 is involved in stopping the amplification of the new macronucleus and signaling the cell to proceed with the destruction of the old macronucleus. This would be the function of the cyclin portion of the gene. Perhaps the other part of the gene encodes a protein that is coincidentally active during hours 0 and 6 of conjugation, but has no specific role in conjugation.

Despite the two possible functions suggested by the TGED and RT-PCR results, the homologs discovered as the result of a BLAST search suggest a third, different function. CYC14 is a homolog of Cyclin K in many organisms, such as

Strongylocentrotus purpuratus and Aedes aegypti. Cyclin K and cyclin H are both involved in the regulation of RNA polymerase II. Thus, TTHERM_00698650 could have a role in transcriptional regulation. Additionally, cyclin K has a proposed role of integrating cell growth with cell cycle progression in metazoans. Therefore, it would be reasonable to consider this a possible role for TTHERM_00698650 as well.

The combination of the three pieces of evidence detailed above leads to a reasonable putative function of the gene: the cyclin turns on to allow RNA polymerase into the developing macronucleus. Localization of the protein is the next step in this experiment. Data from this project will be utilized to update TGC annotations, and will also be submitted to the Ciliate Genomics Consortium website at the Claremont colleges. References

Abramoff, M.D., Magelhaes, P.J., Ram, S.J. "Image Processing with ImageJ". Biophotonics International, volume 11, issue 7, pp. 36-42, 2004.

Asai, D.J. and Forney, J.D. 2000. Methods in Cell Biology. Volume 62: 78-79.

Miao, W., Xiong, J., Bowen, J., Wang, W., Liu, Y., Braguinets, O., Grigull, J., Pearlman, R.E., Orias, E., Gorovsky, M.A. 2009. Microarray analyses of gene expression during the Tetrahymena thermophila life cycle. PLoS ONE 4(2):e4429.

Rozen, S. and Skaletsky, H.J. .2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386.

Stover, N.A., Krieger, C.J., Binkley, G., Dong, Q., Fisk, D.G., et al. Tetrahymena Genome Database (TGD): a new genomic resource for Tetrahymena research. Nucleic Acids Res. 2006; 34:D500-503.