Novel Type of L-Arabinose Dehydrogenase: the First Step of L-Arabinose Degradation To

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Supplemental Fig. 1S Purified L-arabinose dehydrogenase from H. volcanii as analyzed by SDS- PAGE. Molecular mass standard (M), crude extract (1), fraction after Sepharose CL 4B (2), fraction after Phenyl sepharose (3), fraction after Superdex (4).

1 Supplemental Fig. 2S Determination of the 5’-end of the HVO_B0032 transcript from H. volcanii and depiction of its promoter region. Transcriptional start is indicated as +1. The two first coding triplets (bold) of the open reading frame and the deduced amino acid residues (methionine and alanine) are shown. The TATA box (centered at position -27) and the WW motif (-10/-11) are indicated in bold.

2 Supplemental Fig. 3S Rate dependence of recombinant L-arabinose dehydrogenase from H. volcanii on the concentrations of L-arabinose (a) and NADP+ (b). The inserts show double-reciprocal plots of the rates versus the corresponding substrate concentration.

3 Supplemental Fig. 4S Construction of the in-frame deletion mutant of HVO_B0032 encoding L- arabinose dehydrogenase. (a) HVO_B0032 (filled arrow) and surrounding bases (as line) are shown schematically for the wild type (upper panel), for “pop-in” variant (in the middle) and for the mutant (lower panel). NotI restriction sites and fragment sizes are shown. Hybridization probe is illustrated as small bar. (b) The sizes of restriction fragments were verified by Southern blot analysis.

4 Supplemental Table 1S Primer used for Northern blotting, RT-PCR and determination of 5’- end and 3’-end of HVO_B0032

Primer used for Northern blotting Gene Primer Sequence 5‘-3‘ Length of product [bp] HVO_B0027 HVO_B0027_s tcggcccgtgtgtggtgacgc 328 HVO_B0027_as ctcgacgatgtcggtgggggc

HVO_B0032 HVO_B0032_s cgtctacgaggcggcgctggc 490 HVO_B0032_as cgccgagttgtctcgcgggcg

HVO_B0039 HVO_B0039_s gagacgaccgaggtgacgaac 299 HVO_B0039_as gcggccttcgacgagaagtag

Primer used for RT-PCR and qRT-PCR Gene Primer Sequence 5‘-3‘ Length of product [bp] HVO_B0038A HVO_B0038A_s gaagttcggccagcggacgctgc 112 HVO_B0038A_as gtccgcgaggtcggcaatcttcc

RibLs RibLs10_F cctgaaggtcgaagaggaagtgc 128 RibLs10_R gcgggaacttgcgcagaatcatc

RibL RibL10_F acagcacaatatgggcgacctgc 337 RibL10_R gtcctcgacgtcgcagtagatgg

HVO_B0032 HVO_B0032_F gtgaggcgcttggcaactactac 123 HVO_B0032_R ccgactcctcttcgtccatcttc

Primer used for determination of 5’-end and 3’-end Gene Primer Sequence 5’-3’ HVO_B0032 PCR1 gctcgcgatgcgtgatgggcg PCR2 cgcttcccgattcgccgctcg NES1 gtggtccgacgccagcgcttc NES2 ctcacggagacgatgcgcgcc

5 Supplemental Table 2S Purification of L-arabinose dehydrogenase from H. volcanii

Protein Activity Specific activity Yield Purification Purification step (mg) (U) (U/mg) (%) (fold) Crude extract 353.4 273.6 0.77 100 1 Sepharose CL 4B 42.4 71.3 1.65 26 2 Phenyl Sepharose 1.94 51.9 26.8 19 35 Superdex 0.041 3.6 87.6 1.3 114

6

Recommended publications