Genetic Diversity Within Ancient Olives (Olea Europaea L.) in Palestine

An-Najah National University

Faculty of Graduate Studies

Genetic Diversity within Ancient Olives (Olea europaea L.)

in Palestine

By Mohammad Yousef Jaber

Supervisor Dr. Hassan Abu Qaoud Co- Supervisor

Dr. Rami Arafeh

This Thesis is Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Plant Production, Faculty of Graduate Studies, An-Najah National University, Nablus, Palestine. 2013

iii

Dedication

This work is dedicated to my father, mother, wife, brother, sisters and my friends; the completion of this work was not possible without their support and help.

Acknowledgments

I would like to express my deepest respect and most sincere gratitude to my supervisor Dr. Hassan Abu Qaoud and Dr. Rami Arafeh Co- Supervisor for his guidance and encouragement at all stages of my work.

In addition I would like to thank my committee members, Dr.Aziz Salameh and Dr.Heba El-fares.

Another word of special thanks goes for all members of the Department of Plant Production at the Faculty of Agriculture at An-Najah National University.

Last but not least my thanks and gratitude to my family, friends and colleagues in my work for their help and support.

اإلقرار

أنا الموقع أدناه مقدم الرسالة التي تحمل عنوان :

Genetic Diversity within Ancient Olives (Olea europaea L.) in Palestine

Declaration

The work provided in this thesis, unless otherwise referenced, is the researcher’s own work, and has not been submitted elsewhere for any other degree or qualification.

إسم الطالب: :Student’s Name

التوقيع : :Signature

التاريخ: :Date

Table of Contents Content Page Dedication iii Acknowledgment iv Table of contents vi List of figures vii List of tables viii List of abbreviations ix Abstract x Chapter One: Introduction 1 Introduction 1 Chapter Two: Literature review 7 The biology of olive 7 Studies on molecular markers in olive 8 Chapter Three: Materials and methods 15 Plant material 15 Isolation and quality measures of the total DNA 19 Microsatellite (SSR) analysis 19 Polymerase chain reaction (PCR) reagents and procedure 21 Visualization of PCR product 22 Microsatellite gel scoring, data collection and data analysis 23 Chapter Four: Results and discussion 25 Description of SSR data 25 SSR data analysis 27 Chapter Five: Conclusions and recommendations 34 References 36 Appendix 53 ب الملخص

vii

List of Figures No. Figure Page

Figure (1) Tow samples of ancient olive trees with 16 diameter more than 1.0 m. selected from ( A) A,B Assera elshamaliah and (B) bait leed.

Figure(2) Al-Badawi olive tree in the village Al-Walaja. 16

Figure(3) West Bank map and sample localities. 17

Figure(4) (A) +(B) photos of gel electrophoresis for 25 microsatellite markers with( new England bio laps DNA ladder Catalog #N3032S.

Figure(5) Two dimensional PCA plot of 101 individuals 28 and six SSR markers. Numbers represent the proportion of variation represented on each axis.

Figure(6) Three dimensional PCA plot of 101 individuals 28 and six SSR markers. Numbers represent the proportion of variation represented on each axis. Numbers in the plot refer to groups; 1) core ancient, 2) close to ancient, 3) Walaja and wild individuals, 4) cultivated Nabali Mohassan, 5) Souri cultivar.

Figure(7) A circle NJ tree of all individuals included 29 according to Saitou and Nei, 1987. Numbers indicate bootstrap values after 500 replicates

Figure(8) PCA analysis of assigned populations based on 32 square root distance in FAMD software.

Figure (9) UPGMA dendogram Based on Nei’s (1978) 33 Genetic distance of ancient, cultivated and wild olives

viii

List of Tables

No. Table Page

Table Countries of olive production according to FAOSTAT 2 (1) (2010).

Table main genetic markers used in olive studies and their 11 (2) use in this crop

Table Localities, geographical coordinates and sample size 18 (3) that were included in the study

Table List of SSR tailed primers along with forward and 20 (4) reverse sequences used in this study and the reference of each pair

Table The PCR program used for the amplification of SSR 22 (5) primers

Table Summary of Heterozygosity statistics for the six SSR 27 (6) markers analyzed

List of Abbreviations

Abbreviation Full Name 2D PCA plots Tow dimention plots 3D PCA plots Three dimention plots AFLP Amplified fragment length polymorphism cv. Cultivar dATP deoxyadenosine triphosphate dCTP deoxycytidine triphosphate dGTP deoxyguanosine triphosphate DNA Deoxyribonucleic Acid DNTPS Deoxynucleotide Triphosphates dTTP deoxythymidine triphosphate FAO Food and Agriculture Organization of the United Nations GDP Gross domiestic product Ha Hectare ISSR Inter-simple sequence repeat Ng Nanogram NJ Neighbor Joining PCA Principal component analysis PCBS Palestinian central bureau of statistics PCR Polymerase chain reaction pMol Picomoles (q/ha) Quantity per hectares (Ton/hectares) RAPD Random amplification of polymorphic DNA RFLP Restriction fragment length polymorphism SE Standard error SSR Simple Sequence Repeat Unweighted pair group method with arithmetic mean UPGMA (capital letter) UV Ultra violet W Width

Genetic Diversity within Ancient Olives (Olea europaea L.) in Palestine By Mohammad Yousef Jaber Supervised Dr. Hassan Abu Qaoud Co- Supervised Dr. Rami Arafeh Abstract

This study is conducted to explore the genetic variation using simple sequence repeat (SSR) microsatellite marker within ancient olive “Roumi” and some selected common cultivars across olive cultivation areas in Palestine. Ninety two ancient olive samples in addition to four Nabali Baladi, three Nabali Mohassan, one Souri, and one wild olive samples were included in the study. The famous olive tree of Al-Walaja village that is dated to 4500-5000 years was also included in the study (6 samples from the tree drip line). In six SSR loci screened (23) polymorphic alleles were observed. Cluster analyses by neighbour joining (NJ) and Principal Coordinate Analysis (PCA) in 2D and 3D plots reflected high genetic similarity within the group of ancient olive in addition to the “Nabali”. The

Nabali Mohassan and Souri were clustered in two separated groups. The “Al-Walaja” and the wild samples clustered closely in one group. Both individual and Population based analysis showed absence of geographical pattern within the ancient populations in addition to a clear separation from Nabali Mohassan and Souri from the remaining populations. The High similarity between Roumi and Nabali Baladi, and also between the wild and Al-Walaja tree was observed indicating common ancestral genetic

xi pool. In conclusion, the Roumi ancient olives in Palestine have very narrow genetic background suggesting that it was propagated from very similar genetic material.

CHAPTER 1

Introduction:

Olive, Olea europaea L. is the most cultivated plant in the world (FAO,

2004). and its one of the oldest known cultivated plant for human civilization in the region. Olive has shaped both the culture and the landscape of the Mediterranean for thousands of years. (Green, 2002;

Bartolini et al., 2002).

In 2010 more than 9.4 million hectares were planted with olive trees, which is more than twice the amount of devoted land of apples, bananas or mangoes. Only coconut trees and oil palms command more space. (FAO, 2012). Cultivation area tripled from 2,600,000 to 7,950,000 hectares (6,400,000 to 19,600,000 acres) between 1960 and 1998 and reached the peak in 2008 with 10 million ha. The ten largest producing countries, according to the Food and Agriculture Organization, are all located in the Mediterranean region and produce 95% of the world's olives and olive oil

(Table 1).

Table 1. The Production, Area, and Yield of olive in the largest Producing Countries in The World.

Rank Country\Region Production Cultivated area Yield (in tons) (in hectares) (q/ha) 01 Spain 6,940,230 2,330,400 2.9781

02 Italy 3,182,200 1,144,420 2.7806

03 Greece 2,000,000 850,000 2.3529

04 Turkey 1,750,000 798,493 2.1916

05 Morocco 1,364,690 597,513 2.2839

06 Syria 1,095,040 684,490 1.5997

07 Tunisia 863,000 1,779,950 0.4848

08 Egypt 459,650 52,668 8.7273

09 Portugal 443,800 343,200 1.2931

10 Algeria 420,000 295,000 1.4237

11 Argentina 170,000 62,498 2.72

12 Peru 160,914 12,962 12.4142

13 Libya 139,091 216,013 0.6439

14 Jordan 131,847 62,088 2.1235

15 Palestine 115,551 109,213 1.058

16 Australia 91,067 30,407 2.9949

— World 19,845,300 9,634,576 2.0598

FAOSTAT (2011).

In palestine, olive is the most important economic crop value. Olive occupied about 45% of cultivated area in Palestine and in a good years can contribute as much as 15-19% of agriculture output (PCBS,2004). Given

3 that agriculture accounts for nearly 25 percent of GDP, Olive sector is an important element of the Palestinian economy and estimates suggest that about 100,000 families depend to some extent upon the olive harvest for their livelihoods (The World Bank, 2012). In Palestine, about 90- 95% of the harvested olive fruits are used to produce olive oil, and the average of olive oil production ranged between 20,000-25,000 tons in the last decade ,According to PCBS(2012) the production of olive oil exceed 22,951 tons.

They are several olive cultivars in Palestine but the most common are Nabali Baladi, Nabali Mohassan and Souri. Ancient olive trees are with centennial or even millennial ages that have being dated back to the crusade time are known with the cultivar name “Roumi”. The Roumi cultivar can be found in many olive orchards among Palestinians areas as well as other eastern Mediterranean countries like Syria, Lebanon and Jordan.

Until recent times, the discrimination between the olive cultivars is difficult because of the high similarities in morphological characters. There are more than 1250 cultivars that have been described for Olea europaea L using morphologic analyses (Bartolini, 2008), Differences within and between olive cultivars was determined by assessing differences in olive tree, namely leaf shape and colour, and other morphological characters regarding fruit shape. These measures based on phenotypic characters revealed to be problematic, especially in early stages of tree

4 development, but they are readily available and does not require sophisticated equipment and is the most direct measure of phenotypes. However, these morphological and phonological markers have the disadvantage of the small number of polymorphism detected and of being environmentally dependent (Mohan et al., 1997; Tanksley & Orton, 1983). Besides that, some of the morphological characteristics are available for short period (e.g., olive fruits) or when the olive tree achieves a mature stage, which may delay the correct identification. Due to the high genetic diversity observed in olive germplasm and the presence of homonyms and synonyms cases, efficient and rapid discriminatory methods are described to identify cultivars and to determine the relationships between them. (Fabbri et al. 2009).

The olive tree (Olea europaea var. europaea) is thought to have been domesticated from the wild oleaster species Olea europaea var. sylvestris at a minimum of nine different times. The earliest probably dates to the Neolithic migration into the Mediterranean basin, about 6000 years ago.

Propagating olive trees is a vegetative process; that is to say, successful trees are not grown from seeds, but rather from cut roots or branches buried in the soil and allowed to root, or grafted onto other trees. Regular pruning helps the grower keep access to the olives in the lower branches, and olive trees are known to survive for centuries, some reportedly for as much as 2,000 years or more. The first domesticated olives are likely from the eastern end of the Mediterranean Sea, although some debate persists about

5 its origins and spread. Archaeological evidence suggests that the domestication of olive trees spread into the western Mediterranean and North Africa by the Early Bronze Age, 4500 years ago. (Hirst, 2013).

A lot of ancient olive trees are found in Palestine and they have similar morphological characteristics implying that cultivar identity based on morphology is inefficient. but the characterization and conservation of the ancient olive germplasm is a priority task because these trees are progressively cut and used for their ornamental value, and to the progressive transformation of traditional olive groves into new commercial orchards or other crops (Muñoz-Diez, 2008; Rallo and Muñoz-Díez, 2010).

Additionally, the outstanding performance of ancient olives may also be helpful in understanding history of olive domestication.

With the help of moluclar markers, the classification and characterization of this large number of ancient olives in Palestine is possible and also efficient method to identifiying possible unknown morphotypes in this group.

The general objective of this study is to provide an insight into the genetic diversity of olives in Palestine with high focus on ancient olives by using microsatellite marker.

The specific objectives are:

1- to explore the genetic variation and relationships within and among different ancient olive growing areas in Palestine.

2- To use microsatellite marker (SSR) for highlighting the relationship between ancient, wild and some common cultivated olive cultivars in Palestine.

CHAPTER 2

Literature review:

1- The biology of olive

Olive belongs to the Oleaceae family that includes 30 genera and 600 species (Cronquist 1981), olive is a diploid species having 46 chromosomes (2n = 46) (Reale et al., 2006). within the genus Olea, there are 30 species exist throughout the Mediterranean basin (Reale et al., 2006; Taamalli et al., 2006) in which Olea europaea is only cultivated species. Wild olive or oleaster (Olea europaea subsp. europaea var. sylvestris) and the cultivated olive (Olea europaea subsp. europaea var. europaea) are the two forms of the subspecies europaea exist (Green 2002).

The cultivated olive is an evergreen, out-crossing, vegetatively propagated tree with a very wide genetic patrimony that is the result of both plant longevity and the scarcity of genotype turnover through centuries of cultivation (Bracci et al., 2011).

In another side The large number of cultivars, added to the many cases of synonymous and homonymous name, makes the description and classification of olive varieties is extremely difficult (Fabbri et al.

2009),The size of cultivated olive germplasm based on about 1,250 varieties, cultivated in 54 countries, conserved in over 100 collections, were included in the FAO olive germplasm database. (Bartolini, 2008), but

8 the fact is certainly much more because the lack of information on many local cultivars (Cantini et al., 1999).

Due to this richness of the germplasm, olive is an unusual case among horticultural crops and its biodiversity can represent a rich source of variability for the genetic improvement of this plant (Baldoni and Belaj,

2009).

2- Studies on molecular markers in olive:

Exploring the variation between olive cultivars has long history. Several methods were implemented in the early studies questioned the genetic variation indirectly such as isozyme analysis by Trujillo et al., (1995), they studied the isozyme variation in 155 olive cultivars by analysing pollen samples there results showed discrimination between 85% of the studied cultivars. The remainder were separated into groups of two or three cultivars that could be identified using morphological characteristics. No intracultivar polymorphisms were observed.

DNA-based markers revealing polymorphisms at the DNA level are very useful tools in genetic studies and in the improvement of crop plants, and present numerous advantages over conventional phenotype based methods, they can be applied to a variety of purposes including DNA fingerprinting, genetic screening and chromosomal mapping (Bracci et al., 2011).

Molecular markers according to Kahl (2004) are any specific DNA segment whose base sequence is polymorphic in different organisms. Such markers can be visualized by hybridization-based techniques such as restriction fragment length polymorphism (RFLP) or by polymerase chain reaction (PCR)-based methods.

Several molecular markers have been recently used to characterize and discriminate the olive cultivars such as chloroplast DNA RFLP (Besnard et al., 2011), chloroplast DNA SSR (Baali-Cherif and Besnard, 2005), AFLP (Hagidimitriou et al., 2005; Owen et al., 2005; Grati-Kamoun et al., 2006;

Ercisli et al., 2009), RAPD (Belaj et al., 2004; Soleimani et al., 2006; La Mantia et al., 2006; Sesli and Yegenoglu, 2009; Durgac et al., 2010), mitochondrial DNA RFLP (Besnard and Berville, 2000), mitochondrial

DNA AFLP and RAPD (de Caraffa et al., 2002), ISSR markers (Terzopoulos et al., 2005; Essadki et al., 2006), chloroplast DNA SSR (Mariotti et al., 2010), ISSR and SSR (Gomes et al., 2009), SSR and RAPD

(La Mantia, 2006), SSR (Díaz et al., 2006; Ganino et al., 2007; Muzzalupo et al., 2009; Baldoni et al., 2009; Alba, et al., 2009; Roubos et al., 2010; Mariotti et al., 2010).

A Two inter-simple sequence repeat (ISSR) markers were effeciently used for the differentiation among 31 Olea europaea L. cultivars grown in Greece (Terzopoulos et al., 2005). A wide intra-varietal genetic variability among 120 clones of the Portuguese olive ‘Cobrançosa’ cultivar was observed using RAPD and ISSR techniques (Martins-Lopes et al., 2009).

Using AFLP analysis, significant genetic diversity was revealed among the main Italian olive cultivars (Sensi et al., 2003). RAPD analysis of Eighty-four olive accessions in Tunisia indicated coefficient of smiliraty ranges between 0.98 and 0.40 estimated by simple matching algorithm (Zitoun et al., 2008 ). Belaj et al. (2003) compared the usefulness of RAPD, AFLP, and SSR markers for identification and genetic differentiation of 32 Spanish and Italian olive cultivars. They concluded that SSR markers, due to their co-dominant nature, high levels of polymorphism and reproducibility, have a higher discriminating power for cultivar identification, and are ideal for olive genome mapping and genetic studies. A description of the main genetic markers used in olive studies and their use in this crop is presented below and summarized in table 2.

The choice and selection of an adequate molecular marker systems depends upon the type of study to be undertaken and whether it will fulfil at least a few of the mentioned criteria like: (a) highly polymorphic between two organisms, inherited co-dominantly, (b) evenly distributed throughout the genome and easily visualized, (c) occurs frequently in the genomes, (d) stable over generations, (e) simple, quick and inexpensive technique, (f) small amounts of DNA samples required, and(g) no prior information about the sample’s genome is required (Agarwal et al., 2008; Hatzopoulos et al., 2002).

Table (2) - main genetic markers used in olive studies and their use in this crop. RFLP RAPD SSR AFLP ISSR Developers Botstein et al. Williams et al. Morgante and Vos et al. (1995) Zietkiewicz et al. (1980) (1990) Olivieri (1993) (1994) Application in Olea -Phylogenetic studies. -DNA fingerprinting of cultivars -DNA fingerprinting -DNA fingerprinting of -Phylogenetic studies. europea L. (Baldoni et al. 2009) (Fabbri et al. 1995), of cultivars. cultivars. (Hess et al. 2000), (Baldoni et al. 2009) ( Angiolillo et al. 1999) -Genetic correspondence of plant -Detection of intra- -Male sterility analysis. material from nursery(Belaj et al. 1999) -Construction of linkage map. -Detection of intra-cultivar cultivar variability. (Besnard et al. 2000) -Detection of intra-cultivar variability (De la Rosa et al. 2003) variability. (Gemas et al. 2004) (Belaj et al. 2004) (Belaj et al. 2004) -Cultivar traceability in -Construction of linkage map -Phylogenetic studies. olive oil. (De la Rosa et al. 2004) -Paternity analysis. (Baldoni et al. 2006) (Martins-Lopes et al. ( De la Rosa et al. 2004) 2008) -Cultivar traceability in olive oil -Cultivar traceability in olive (Martins-Lopes et al. 2008) oil. (Busconi et al. 2003) -Phylogenetic studies (Hess et al. 2000), -Construction of linkage map. ( De la Rosa et al. 2003) Principle Southern blotting of PCR of random mprimers PCR of Microsatellite Detection of DNA PCR of inter simple restricted fragments Restriction fragments by Sequence repeats PCR Level of polymorphism Medium Medium Very high Medium Medium

Codominance Codominant Dominant Codominant Dominant Dominant of alleles Number of loci 1-2 3-15 1 04-150 3-12 analyzed per assay DNA required per 2-10 µg 10-20 ng 20-50 ng 20-500ng 10-20ng assay

Prior Yes No Yes No No sequence information Developmental cost High Low High Medium Low

Running costs per Medium Low Medium Medium Low assay Repeatability Very high Fair Very high Very high Medium-high Ease of use Labour intensive Easy Easy Difficult initially Low

Microsatellites (Simple Sequence Repeats -SSRs), consists of short, (1-6 base pairs long), with tandem repeated sequences mono-,di-,tri-,tetra-or penta-nucleotide units occurring in the genomes of many higher organisms

(Rafalski &Tingey,1993; Wu & Tanksley, 1993), SSR is co-dominant and hyperallelic. The number of repetitions of these nucleotide units generates a polymorphism among genotypes, and they are widely used in plant genetic research for diversity studies; namely in olive tree because of their high polymorphism, reproducibility, and ideal for genetic map development, linkage analysis, marker-assisted selection and fingerprinting studies

(Bracci et al., 2009; Cipriani et al., 2002; De la Rosa el al., 2004; Gomes et al., 2009; Karp et al., 1996; Muzzalupo et al., 2009; Rallo et al., 2002; Sefc et al., 2000).

When compared with RAPD or AFLP markers, the SSR have the advantage of their co-dominant nature, as two alleles may be identified at each locus. The main constrain of SSR markers is the development requires previous DNA sequencing for primer designing. Many authors have reported on SSR development in olive and several of them are currently available for DNA analysis (Sefc et al. 2000; Cipriani et al. 2002; De la

Rosa et al. 2002; Sabino Gil et al. 2006; Sefc et al., 2000; Bandelj et al., 2004).

These markers have been used for different applications such as cultivar discrimination (Sarri et al. 2006; Fendri et al., 2010), study of relationships between wild and cultivated olive tree (Belaj et al., 2007), construction of

14 association maps (De la Rosa et al., 2003), paternity analysis (Mookerjee et al., 2005) and identification of olive oil varietal composition (Alba et al. 2009;Ayed et al. 2009). Doveri et al. (2008) and Baldoni et al. (2009) have listed SSR markers and protocols for olive genotyping aimed at developing a robust method for accurate and precise olive genotyping.

CHAPTER 3

Materials and methods

1- Plant material:

Ninety six olive trees were selected from different geographical regions of the West Bank area from north to south. Geographical coordinated and sample size of each locality is presented in Table (3).

Since this study is focusing more on the genetic construction of ancient olives, the size age relationship appears to be the most suitable methods to identify the age of trees and only trees with diameter more than 1.0 m

(circumference about 3.0 m) were selected (figure 1) for taking leaf samples (Rozas, 2003; 2004).

The diameter of 96 ancient olives was measured at 1.0 m height from the ground surface. Trees with seriously damaged trunks were excluded from this analysis. The diameter of the ancient olives ranged between 1m to 6 m. long.

Figure 1. A photograph of tow ancient olive trees with diameter more than 1.0 m sampled from (left) Assera Al-Shamaliah and (right) Bait Leed.

An olive tree in the village of “Al-Walaja” between Jerusalem and

Bethlehem, called “Al-Badawi” tree, figure (2) was given a special attention in this study. It is a mass of trunks with a total diameter around 6.0 meters. The tree was aged between 4000-5000 years old. (ARIJ, 2010).

Six DNA samples from this tree were included in the study collected from the circumference of the tree’s drip line.

Figure (2). Al-Badawi olive tree in Al-Walaja village. The tree is about 6.0 meters diameter with many trunks. From (ARIJ,. 2010).

In total, 101 sample of fresh leaf material were collected then dried with silica gel beads to use for DNA extraction. Within the samples, eight olive trees were also included from cultivated Nabali Baladi(4 trees), Nabali muhassan(3 trees) and souri(1 tree). A map for all localities sampled is shown in figure (3).

Figure (3) localities were the leaves samples of ancient olive trees where collected.

Table (3). Localities, geographical coordinates and sample size that were included in the study.

No. Location District N E # of # of Trees samples 1 Tayaser- Tubas 32 20 32 82 35 23 33 43 6 6 Tobas 2 Berqeen Jenin 32 27 55 85 35 15 06 60 6 6 3 Faqouaa Jenin 32 29 36 49 35 24 09 30 3 3 4 Anin jenin 32 30 21 03 35 10 35 64 6 6 5 Bait Amin Qalqilia 32 07 50 41 35 01 34 29 6 6 6 Kufrqadom 1 Qalqilia 32 12 53 85 35 08 28 87 6 6 7 Aqraba Yanon Nablus 32 08 40 90 35 21 51 86 6 6

8 Assera Nablus 32 15 06 81 35 15 55 12 6 6 elshamaliah 9 Salfeet Salfeet 32 04 43 84 35 10 17 03 6 6

10 Bedya Salfeet 32 06 35 86 35 04 09 83 6 6

11 Bait leed Tulkarem 32 14 55 36 35 08 40 84 6 6

12 Jerusalem Jerusalem 31 46 42 31 35 14 11 11 6 6

13 Walajah Baitlahem 31 44 03 43 35 09 04 66 1 6

14 Hebron Hebron 31 31 40 52 35 05 47 86 12 12

15 Tafouh Hebron 31 32 12 51 35 02 47 67 5 5

16 Kufrqadom Qalqilia (0) Nabali Baladi ,(3) 8 8 Nabali Mohassan, (1) Souri 17 Al-Junaidi Nablus wild olive trees 1 1 nursery Total 96 101

2- Isolation and quality measures of the total DNA:

Leaves samples were grinded into a powder using mortar and pestle with sterile sea sand. DNA extraction and purification was carried out with

Qiagen, DNeasy total genomic extraction kit following manufacturer’s instructions.

DNA quality and concentration were measured with DNA spectrophotometer (Eppendorf A.G., Hamburg, Germany). Another test for DNA quality and concentration was conducted with agarose gel electrophoresis. Samples with poor quality DNA were excluded and the extraction was repeated. Concentration and quality of the used DNA are listed in table 1. in the appendix. For each SSR reaction, DNA concentration was adjusted at around 50.0 ng/µl.

3- Microsatellite (SSR) analysis

A set of six microsatellite (SSR) primer pairs were used to explore the polymorphism in 101 ancient and some cultivated olive samples (Table 0).

Table (4). List of (SSR) primers along with forward and reverse sequences used in this study and the reference of each pair.

No Marker Forward and reverse primer pair Reference

1 U99-35 5’ AATTTAATGGTCACACACAC 3’ (Cipriani et al., 2002)

3’ ATTGCGAAATAGATCTACGA 5’

2 U99-28 5’ CTGCAGCTTCTGCCCATAC 3’ Capriani et al (2002)

3’ GCAGCTCATCATTTGGCACT 5’

3 GAPu- 5’ TGAATTTAACTTTAAACCCACACA 3’ (Cipriani et al., 2002)

103 3’ GCATCGCTCGATTTTATCC 5’

4 DCA9 5’ AATCAAAGTCTTCCTTCTCATTTCG 3’ Sefc et al., 2000;

Bandelj et al., (2004) 3’ GATCCTTCCAAAAGTATAACCTCTC 5’

5 DCA16 5’TTAGGTGGGATTCTGTAGATGGTTG 3’ Sefc et al., 2000;

Bandelj et al.,( 2004) 3’ TTTTAGGTGAGTTCATAGAATTAGC 5’

6 DCA3 5’ CCCAAGCGGAGGTGTATATTGTTAC 3’ Sefc et al., 2000;

Bandelj et al., (2004) 3’ TGCTTTTGTCGTGTTTGAGATGTTG 5’

4- Polymerase chain reaction (PCR) reagents and procedure:

Amplifications were performed in polymerase chain reactions (PCRs) tubes with total volume of 25.0 μl containing 1.0 μl of genomic DNA template

(30-60 ng), 22.0 μl of master mix containing (H2O; 15.0 μl, 10X buffer; 2.5

μl; MgCl2 (25 mM) 2.5 μl; dNTPS (5mM)1.0 μl; and 1.0 μl of Taq polymerase enzyme produces in Biotechnology Research Center BRC at

Palestine Polytechnic University. PCR-PPU master mix contained 1.25 unit of Thermoprime Plus DNA Polymerase, 75 mM Tris-HCl, 20 mM

(NH4)2SO4, 3.0 mM MgCl2, 0.01% (V/V) Tween® 20 and 0.2 mM each of dATP, dCTP, dGTP and dTTP respectively. PCR PPU- Master mix also contains dye to facilitate the electrophoresis. Forward and reverse primers were added at 1.0 μl of each (15 pmol/μl). The PCR reactions were setup in

0.2 ml PCR tubes. The PCR was carried out in the thermal cycler from Applied Biosystems.

Thermocycler details used for SSR amplifications are listed in table (5).

Table (5). The PCR program used for the amplification of SSR primers.

PCR profile for SSR analysis Process

Step -1 94oC for 5 minutes Initial Denaturation

Step -2 94oC for 1 minute Denaturation

Step -3 55oC for 1 minute Annealing

Step -4 72oC for 2 minutes Extension

Step -5 35 times repeated 35 Cycles

Step -6 72oC for 7 minutes Final extension

Step -7 4oC for ever End

5- Visualization of PCR product:

The PCR product (25.0 μl) of each sample was loaded in 2.0% w/v agarose gel dissolved in 1X TBE buffer. Ten microliters of ethedium bromide at a concentration of 10.0 μg/μl was mixed with the gel solution after being dissolved. The samples were loaded into gel pockets for electrophoresis at (100-110) volt for about 1.5 hours. A hundred basepair ladder was added in every gel to facilitate the scoring procedure. After electrophoresis, the gels were photographed with a digital camera provided with UV filter.

6- Microsatellite gel scoring, data collection and data analysis:

Microsatellite amplicons were scored as a co-dominant marker on the number of alleles (11, 22,… NN for homozygous and 12 for heterozygous..etc) and according to the amplicon’s size in base pairs as viewed on agarose gel. Furthermore, allelic data was transformed into a binary (0/1) matrix to carry out other dominant marker based analysis including Neighbour Joining (NJ) clustering and population PCA analysis.

Principal Component Analysis (PCA) was carried out to explore the individual genetic grouping in 2D and 3D PCA plots. Genetix v 4.05 software (Belkhir et al. 2004) was used to generate 2D and 3D plots for individuals. A population based PCA analysis was also carried out with FAMD software (Schlueter and Harris, 2006) according to the Square root distance method between populations. The PCA analyzes a data table representing observations described by several dependent variables, which are, in general, inter-correlated. Its goal is to extract the important information from the data table and to express this information as a set of new orthogonal variables called principal components (Abdi and Williams 2010).

The SSR data were analyzed using several genetic parameters such as number of alleles per locus; observed heterozygosity (Ho, calculated as the number of heterozygotes per locus divided by the number of individual typed). Expected heterozygosity (He) or gene diversity (Nei 1987).

Neighbor Joining (NJ) phenogram (Saitou and Nei, 1987) was generated using the software MEGA v.5.1 in order to examine the clustering of individuals. Bootstrap statistical support was calculated from 500 replicates. Heterozygosity measures were carried out with Popgene v.1.32 software (He and Genetic diversity). Samples from each location were treated as one populations and a population dendogram was generated in

TFPGA software according to Nei and Li (1979) population distance.

In other approach, the banding pattern was read as dominant marker in a (0) absent to (1) present to generate the similarity matric according to standard Jaccard Coefficient with FAMD.

Jaccard’s similarity coefficient for a pair of individuals i and j is defined as

Sij= p / p+q+r where:

S: similarity.

p: is the number of variables that are positive for both ith and jth.

q: is the number of variables that are positive for the i and negative for the jth object.

r: is the number of variables that is negative for the ith and positive for the jth.

So the Jaccard’s distance (d=1-Sij).

CHAPTER 4

Results and discussion:

1- Description of SSR data:

The six SSR primers used in this study produced in total 23 polymorphic SSR loci. The sizes of amplicons ranged from 120 base pair in the primer pair SSR-DC16 and the largest amplicon was 620 base pair in the primer

SSR-DCA3.

Figure (4) A: GAPu-103 microsatellite markers with( new England bio laps DNA ladder Catalog #N3032S ), were shortcut’s backs to origin of leaves sampled in the study, (FQ= Faqoa’a, HE= Hebron , WD= wild, RA1-4 = Nabali baladi ,RA5-7=Nabali Muhassan,RA8= souri).

Figure (4) B: SSR-UA99-28 microsatellite markers with( new England bio laps DNA ladder Catalog #N3032S ), were shortcut’s backs to origin of leaves sampled in the study, (FQ= Faqoa’a, HE= Hebron , WD= wild, RA1-4 = Nabali baladi ,RA5-7=Nabali Muhassan,RA8= souri, BD= bidya,WA= walajah).

Heterozygosity statistics are presented in table (6). The average observed heterozygosity equals to 0.63± 0.49 St. Dev.

Table (6). Summary of Heterozygosity statistics for the six SSR markers analyzed.

2- SSR data analysis

The PCA analyses of the 101 individuals with the 6 SSR markers are presented in 2D and 3D plots (figure 5, 6). In the 3D plot, the first three principal coordinates accounted for 27.44%, 16.68% and 14.30% of the total variation respectively. Most (81 accession) of the ancient olives in addition to the Nabali Baladi were found in one close group (number 1). It is noted that ancient accessions group show no geographical structure. The genetic distance among the ancient individuals ranges from 0.0 – 0.1. Few individuals positioned close to the large ancient group (2) include samples

JE3, JE4, HE6, HE11, TU5. Another group (3) consisted of the wild individual and the Al-Walaja samples (6 samples) in addition to KQ3, KQ4, KQ5, and BD6. Accessions, RA5, RA6 and RA7 (group 4) which represent the Nabali Mohassan variety are grouped together. Interestingly, the cultivar Souri (group 5) is located distantly from all the groups described.

Figure 5. Two dimensional PCA plot of 101 individuals and six SSR markers. Numbers represent the proportion of variation represented on each axis. Numbers in the plot refer to groups; 1) core ancient, 2) close to ancient, 3) Walaja and wild individuals, 4) cultivated Nabali Mohassan, 5) Souri cultivar.

Figure 6. Three dimensional PCA plot of 101 individuals and six SSR markers. Numbers represent the proportion of variation represented on each axis. Numbers in the plot refer to groups; 1) core ancient, 2) close to ancient, 3) Walaja and wild individuals, 4) cultivated Nabali Mohassan, 5) Souri cultivar.

The two dimensional (2D) PCA plot confirms the same finding revealed by the 3D PCA plot. The main principle coordinates in the 2D plot accounted for 27.44% and 16.7% from the total variation respectively (figure 5).

Neighbor joining (NJ) analysis of the 101 accessions is shown in figure (7). The pattern shows a clear large cluster of individuals of ancient and Nabali Baladi accessions, the other clear clusters of individuals of Nabali

Mohassan ,

souri , walaja and wild , some of closed individuals to Nabali Baladi and ancient group was clustered also.

Figure 7. A NJ phenogram of all included individuals according to Saitou and Nei, (1987). Numbers above the branches indicate bootstrap values after 500 replicates.

There is a huge mass of literature addressed the genetic diversity in olives and because of the wide distribution of this crop and the huge number of cultivars studied, part of the studies focused on exploring the genetic relationships in accessions within a restricted area. Perhaps the study that is very similar to this one was conducted by (Wiesman et al.,1998) focused on molecular characterization of the traditional and introduced olive cultivars in Israel and three locations in the West Bank area planted with Nabali cultivar. They also included accessions from Souri cultivar in the study. A high similarity among Souri accessions was , and to lesser extent among Nabali. On the other hand, the Jaccard’s similarity coefficient was calculated between Nabali and Souri ranged from 0.635 to 0.738. These results are in agreement with the findings in this study despite using different marker system. A clear discrimination between Souri and Nabali Mohassan acessions was observed in the 2D, 3D and NJ analysis. Genetic distance between Souri and Nabali Mohassan accessions ranged from 0.538 to 0.824 (table 2, Appendix).

Olive trees have been grown either for oil or table olive production in the Mediterranean basin since ancient time. There is enormous number of olive cultivars distributed in its cultivation range. The genetic diversity of them is also abundant and characterized by a huge number of locally cultivated and propagated germplasm by farmers. In a large scale study conducted by

(Bartolini et al., 1993), more than 1,208 cultivars from 52 countries, conserved in 94 collections were addressed. However, the number of

31 cultivars is probably much higher bearing in mind the lack of information on minor cultivars in different olive growing regions.

Cultivar surveys have been initiated in many olive growing countries in order to describe existing cultivars, thus obtaining information for germplasm preservation, description of cultivars of specific growing regions and for breeding purposes. For the description and management of the existing genetic diversity in olives, molecular markers have been found to be particularly valuable because of such characteristics as high genetic informativeness, environmental independence, relatively easy use and the possibility of accumulating large amount of data.

Olive cultivars were further genotyped for identification purposes or for assessment of genetic diversity on international (world germplasm collections), national (Spain, Italy, Tunis, Morocco, Turkey, Greece, Croatia, Slovenia, Portugal, Lebanon, Alger) and regional scales (olive growing region with characteristic variety structure). There have been numerous publications from these studies and we present here only a few examples. Sarri et al. (2006) genotyped 118 olive cultivars from several Mediterranean countries by use of twelve SSR markers showing high discrimination power among the included samples.

The present study provided insight into the genetic variation in the ancient “Roumi”olive that is cultivated in Palestine with centennial or even millennial age. Microsatellites analysis indicated high genetic similarity

32 within ancient olives regardless of their geographic location from where they collected (Jaccard coofeccient 0.0 – 0.1). As revealed by the population based PCA, population from distant locations like Hebron in the

South and Faquo’a in the North, Tubas in the East and Salfeet in the West grouped close to each other, figure (8).

Figure 8. PCA analysis of assigned populations based on square root distance in FAMD software.

The same result can be visualized in the UPGMA dendogram regarding these populations in figure 9. The tree has three clusters of ancient olives in addition to another cluster of wild and Al-Walaja tree and the last cluster with the Souri and Nabali Mohassan. Interestingly, the common cultivated varieties the Nabali Mohassan and Souri fell in the same cluster apart from the ancient and wild material. Wild olive and Al-walaja olive share similar subcluster.

Figure 9. UPGMA dendogram based on Nei's (1978) genetic distance of ancient, cultivated and wild olives treated as populations.

This study also provides vital information about similarity between the wild olive Olea oleaster and Al-Walaja tree (0.200 -0.455 Jaccard distance). Being clustered close to each other and distant from common cultivated and ancient cultivars indicates common ancestry and relatedness to the same genetic pool.

CHAPTER 5

Conclusions:

Molecular characterization of native germplasm followed by clear cultivar identification in olives is important to confirm true-to-type denominated cultivars and solve problems relating to synonyms, homonyms and mislabelled planting material. This is, to the best of my knowledge, the first study that addressed, in a comprehensive sampling approach, ancient olives across their geographical distribution in Palestine as a part of the eastern Mediterranean region.

One of the main concluding remarks in this study is the high genetic similarity within the “Roumi” or ancient olives that are grown in Palestine since centuries and the newly cultivated Nabali Baladi cultivar. Being one close group implies formulating easier conservation strategy as well as easier treatment for future breeding programs.

The high similarity between wild olive and Al-Walaja tree is noteworthy. It was always believed that the ancient tree of Al-Walaja belongs to the ancient Roumi cultivar. This study showed clearly the close relationship between the wild and Al-Walaja tree. A closer look into the botanical and horticultural characteristics of this tree in needed.

Relationships could also be established regarding common cultivated varieties, Nabali, Nabali Mohassan and Souri.

Finally, SSR marker is a useful molecular tool for screening genetic polymorphism and highlighting relationships within the olive material in Palestine. Adopting variable SSRs that can be visualized and scored easily would help to identify other cultivars which are propagated in Palestine.

References

 Abdi H, Williams LJ. Jackknife. In: Salkind NJ, ed. Encyclopedia of Research Design. Thousand Oaks: Sage Publications; 2010.

 Agarwal, M.; Shrivastava, N. & Padh H. (2008). Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Reports, Vol.27, pp. 617–631.

 Alba, V., Montemurro, C., Sabetta, W., Pasqualone, A. & Blanco, A. (2009a). SSR-based identification key of cultivars of Olea europaea L. diffused in Southern-Italy. Scientia Horticulturae, No. 123, pp. 11–16.

 ARIJ. 2010. Al Walaja Village Profile. Palestinian Localities Study. Bethlehem governorate. http://proxy.arij.org/vprofile

 Angiolillo A, Mencuccini M, Baldoni L. Olive genetic diversity assessed using amplified fragment length polymorphisms. Theoretical and Applied Genetics. 1999;98:411–421.

 Ayed, R.B.; Grati-Kamoun, N.; Moreau, F. & Rebaï, A. (2009).

Comparative study of microsatellite proWles of DNA from oil and leaves of two Tunisian olive cultivars, Eur Food Res Technol. Vol. 229, pp. 757–762.

 Baali-Cherif, D. and G. Besnard. 2005. High genetic diversity and clonal growth in relict populations of Olea europaea sub sp. laperrinei (Oleaceae) from Hoggae, Algeria. Annals of Botany, 96: 823-830.

 Baldoni, L. & Belaj, A. (2009). Olive, In: Vollmann J, Rajean I (eds) Oil crops. Handbook of plant breeding, vol 4. Springer Science Business Media, New York, pp. 397–421. doi 10.1007/978-0-387-77594-4_13

 Baldoni, L.; Nicolò, G.C.; Mariotti, R.; Ricciolini, C.; Arcioni, S.; Vendramin, G.V.; Buonamici, A.; Porceddu, A.; Sarri, V.; Ojeda, M.A.; Trujillo, I.; Rallo, L.; Belaj, A.; Perri, E.; Salimonti, A.; Muzzalupo, I.;

Casagrande, A.; Lain, O.; Messina, R. & Testolin, R. (2009). A consensus list of microsatellite markers for olive genotyping. Molecular Breeding, Vol.24, pp. 213–231.

 Bandelj, D., Jakse, J., Javornik, B. 2004. Assessment of genetic variability of olive varieties by microsatellite and AFLP markers. Euphytica, 136: 93–102. Olive germplasm (Olea europaea L.) 2008.

Available at: http://www.oleadb.it/olivodb.html.

 Bartolini, G. and Petruccelli, R. (2002) Classification, Origin, Diffusion and History of the Olive. Food and Agriculture Organization of the United Nations, Rome.

 Bartolini, G., Messeri, C. and Prevost, G. 1993. Acta Horticulturae, 356: 116-118.

 Belaj, A., Satovic, Z., Cipriani, G., Baldoni, L., Testolin, R. and Rallo, L. 2003. Comparative study of the discriminating capacity of RAPD,

AFLP and SSR markers and of their effectiveness in establishing

 genetic relationships in olive. Theoretical and Applied Genetics, 107: 736–744.

 Belaj A, Muñoz-Díez C, Baldoni L, Porceddu A, Barranco D, SatovicZ.

 Genetic diversity and population structure of wild olives from the north-western Mediterranean assessed by SSR markers. Annals of Botany 2007;100:449-458.

 Belaj A, Rallo L, Trujillo I, Baldoni L. Using RAPD and AFLP markers to distinguish individuals obtained by clonal selection of ‘Arbequina’ and ‘Manzanilla de Sevilla’ olive. Hortscience.

2004;39:1566–1570.

 Belaj A, Trujillo I, De la Rosa R. and Rallo L.1999. Marcadores de ADN para identificacion de variedades de olivo. Agricultura 799:166–

167.

 Belkhir, K.; V. Castric and F. Bonhomme. 2002. IDENTIX, a software to test for relatedness in a population using permutation methods. Molecular Ecology Notes 2(4): 611-614

 Bronzini de Caraffa, V., Maury, J., Gambotti, C., Breton, C., Berville´, A.,Giannettini, J., 2002. Mitochondrial DNA variation and RAPD mark oleasters, olive and feral olive from Western and Eastern Mediterranean.Theor. Appl. Genet. 104, 1209–1216.

 Besnard, G.; Khadari, B.; Villemur, P. & Bervillé, A. .2000. A cytoplasmic male sterility in olive cultivars (Olea europaea L.): phenotypic, genetic and molecular approaches.Theoretical and Applied

Genetics, Vol.100, pp.1018–1024.

 Besnard, G., & Berville, A. (2000). Multiple origins for

Mediterranean olive (Olea europaea L. ssp europaea) based upon mitochondrial DNA polymorphisms. CR Acad Sci Paris Sci de la Vie, 323, 173-181.

 Besnard G, Hernandez P, Khadari B, Dorado G, Savolainen V (2011)

Genomic profiling of plastid DNA variation in the Mediterranean olive tree. BMC Plant Biol. 2011 May 10;11:80. doi: 10.1186/1471-2229-11-80.

 Botstein, D., R.L. White, M. Skolnick, and R.W. Davis. 1980.

Construction of genetic linkage map in man using restriction fragment length polymorphism. Amer. J. Hum. Genet. 32:314–331.

 Bracci, T.; Sebastiani, L.; Busconi, M.; Fogher, C.; Belaj, A. & Trujillo,

I. (2009). SSR markers reveal the uniqueness of olive cultivars from the Italian region of Liguria. Scientia Horticulturae, Vol.122, pp. 209-215.

 Burley AL, Phillips S, Ooi MKJ . Can age be predicted from diameter for the obligate seeder Allocasuarina littoralis (Casuarinaceae) by using dendrochronological techniques? Australian Journal of Botany 2007;55:433-438.

 Busconi M, Foroni C, Corradi M, Bongiorni C, Cattapan F, Fogher C (2003) DNA extraction from olive oil and its use in the identification of the production cultivar. Food Chem 83:127–134

 Cantini, C., Cimato, A. and Sani, G. 1999. Morphological evaluation of olive germplasm present in Tuscany region. Euphytica, 109: 173–181.

 Cipriani, G., Marrazzo, M.T., Marconi, R., Cimato, A., Testolin, R.

2002. Microsatellite markers isolated in olive (Olea europaea L.) are suitable for individual fingerprinting and reveal polymorphism within ancient cultivars. Theoretical and Applied Genetics,104: 223-228.

 Corpas, F. J., Fernańdez-Ocanã, A., Carreras, A., Valderrama, R., Luque, F., Esteban, F. J.,Rodrı´guez-Serrano, M., Chaki, M., Pedrajas, J. R., Sandalio, L. M., del Rıó, L. A., and Barroso, J. B. (2006). The expression of different superoxide dismutase forms is cell-type dependent in olive (Olea europaea L.) leaves. Plant Cell Physiol. 47, 984–994.

 Cronquist,A., 1981. An integrated system of classification of flowering plants.Columbia Univ. press.New York, USA.

 De la Rosa R, Angiolillo A, Guerrero M, Pellegrini M, Rallo L, Besnard

G, Berville´ A, Martin A, Baldoni L (2003) A first linkage map of olive

(Olea europaea L.) cultivars using RAPD, AFLP, RFLP and SSR markers. Theor Appl Genet 106:1273–1282

 De la Rosa R, James CM, Tobutt KH (2004) Using microsatellites for paternity testing in olive progenies. HortScience 39:351–354

 De la Rosa R, James CM, Tobutt KR (2002) Isolation and characterisation of polymorphic microsatellites in olive (Olea europaea L.) and their transferability to other genera in the Oleaceae. Mol Ecol 2:265–267.

 Díaz, A., Martín, A., Rallo, P., Barranco, D., De la Rosa, R. (2006) Self- incompatibility of ‘Arbequina’ and ‘Picual’ olive assessed by SSR markers. J. Amer. Soc. Hort. Sci. 131:250–255.

 Durgac, C., Kiyga, Y., Ulas, M., 2010: Comparative molecular analysisof old olive (Olea europaea L.) genotypes from Eastern Mediterranean region of Turkey. Afr. J. Biotechnol. 9, 428-433.

 Doveri S, Sabino Gil F, Diaz A, Reale S, Busconi M, da Camara Machado A, Martin A, Fogher C, Donini P, Lee D (2008).

Standardization of a set of microsatellite markers for use in cultivar identification studies in olive (Olea europaea L.). Sci. Hortic. (Amsterdam) 116: 367-373.

 Essadki M, Ouazzani N, Lumaret R, Moumni M (2006). ISSR variation in olive-tree cultivars from Morocco and other western countries of the Mediterranean Basin. Genet. Resour. Crop. Evol. 53(3): 475-482.

 Ercisli S and Barut EA (2009). Molecular characterization of olive cultivars using amplified fragment length polymorphism markers. Genet. Mol. Res., 8(2): 414-419.

 Fabbri A, Lambardi M, Ozden-Tokatli Y. (2009). Olive Breeding. In:Breeding Plantation Tree Crops: Tropical Species, Springer Science+Business Media, LLC. Cp.12, p.423-465.

 Fabbri, A., Hormaza, J.I. and V.S. Polito. 1995. Random amplified polymorphic DNA analysis of olive (Olea europaea L.) cultivars.

 J. Am. Soc. Hortic. Sci., 120: 538-542

 Fendri M, Trujillo I, Trigui A and Rodriguez-Garcia IM (2010). Simple sequence repeat identification and endocarp characterization of olive tree accessions in a Tusinian germplasm collection. HortScience 45:

1429-1436.

 Food and Agriculture Organization of the United Nations ,Faostat.fao.org (2012-02-23). Retrieved on 2012-07-08

 Food and Agriculture Organization of the United Nations ,Seed and Plant Genetic Resources Service – AGPS,OLIVE GERMPLASM cultivars and world-wide collections,Edition 2005.

 http://apps3.fao.org/wiews/olive/intro.jsp.

 Ganino, T., Beghe` , D., Valenti, S., Nisi, R., Fabbri, A., 2007. RAPD and SSR markers for characterization and identification of ancient cultivars of Olea europaea L. in the Emilia region, Northern Italy. Genet. Resour. Crop Evol. 54, 1531–1540.

 Gemas VJ, Almadanim MC, Tenreiro R, Martins A, Fevereiro P (2004)

Genetic diversity in the Olive tree (Olea europaea L. subsp. europaea) cultivated in Portugal revealed by RAPD and ISSR markers. Genet Resour Crop Evol 51:501–511

 Gomes, S.; Martins-Lopes, P.; Lopes, L. & Guedes-Pinto, H. (2009).

Assessing genetic diversity in Olea europaea L. using ISSR and SSR markers. Plant Molecular Biology Reports, Vol.123, pp. 82-89.

 Grati-Kamoun, N., Mahmoud, F., Rebaï, A. and Gargouri, A. 2006.

Genetic diversity of Tunisian Olive Tree (Olea europaea L.) cultivars assessed by AFLP markers. Genet. Resour. Crop Evol., 53: 265-275.

 Green, P.S. (2002) A revision of Olea L. (Oleaceae). Kew Bulletin,

57(1): 91-140.

 Hagidimitriou M, Katsiotis A, Menexes G, Pontikis C, Loukas M (2005). Genetic diversity of major Greek olive cultivars using molecular (AFLPs and RAPDs) markers and morphological traits. J. Am. Soc. Hort. Sci. 130: 211-217.

 Hatzopoulos, P.; Banilas, G.; Giannoulia, K.; Gazis, F.; Nikoloudakis, N.; Milioni, D. & Haralampidis, K. (2002). Breeding molecular markers and molecular biology of the olive tree. European Journal of Lipid

Science and Technology, Vol.104, pp. 574-586.

 Hess J, Kadereit W, Vargas P (2000) The colonization history of Olea europea L. in Macaronesia based on internal transcribed spacer 1

(ITS-1) sequences, randomly amplified polymorphic DNAs (RAPD) and intersimple sequence repeats (ISSR). Mol Ecol 9:857–868

 Hirst, K K.. 2013. Olive history: domistication of Olea europea L. http://archaeology.about.com/od/oterms/qt/Olive-History.htm

 Kahl, G. (2004). The dictionary of gene technologies. Genomics, transcriptomics, proteomics.3rd Edition. Volume 1 and 2 Wiley – VCH

Verlag, Gmb H &Co. KGaA, Weinheim.

 Karp, A.; Seberg, O. & Buiatti, M. (1996). Molecular techniques in the assessment of botanical diversity. Annals of Botany, Vol.78, pp. 143-149.

 La Mantia M, Lain O, Caruso T, Testolin R (2005) SSR-based DNA fingerprints reveal the genetic diversity of Sicilian olive (Olea europaea L.) germplasm. J Hortic Sci Biotech 80:628–632.

 M. Morgante, A. M. Olivieri, Plant J. 3 (1993) 175– 182.

 Martins-Lopes P, Gomes S, Santos E, Guedes-Pinto H (2008). DNA markers for Portuguese olive oil fingerprinting. J Agric Food Chem 56:11786–11791.

 Mariotti R, Cultrera NG, Díez CM, Baldoni L and Rubini A.(2010).

Identification of new polymorphic regions and differentiation of cultivated olives (Olea europaea L.) through plastome sequence comparison. BMC Plant Biol. 2010 Sep 24;10:211. doi: 10.1186/1471- 2229-10-211.

 Mohan, M.; Nair, S.; Bhagwat, A.; Krishna, T.G.; Yano, M.; Bhatia,

C.R. & Sasaki, T. (1997). Genome mapping, molecular markers and markers-assisted selection in crop plants. Molecular Breeding, Vol.3, pp. 87-103.

 Mookerjee, S., Guerin, J., Collins, G., Ford, C., Sedgley, M. (2005).

Paternity analysis using microsatellite markers to identify pollen donors in an olive grove. Theor. Appl. Genet. 111:1174–1182.

 Muñoz-Díez C. Spain; 2008. Prospección, diversidad genética y conservación de ejemplares monumentales y poblaciones silvestres de olivo (Olea europaea L.). PhD Thesis, University of Cordoba.

 Muzzalupo, I., Stefanizzi, F., Salimonti, A., Falabella, R. and Perri, E. 2009. Microsatellite markers for identification of a group of Italian olive accessions. Sci Agric (Piracicaba, Braz), 66: 685- 690.

 Nei M. (1978) Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89:583-590

 Nei M. (1987) Molecular Evolutionary Genetics. Columbia University

Press, New York, NY, USA.

 Owen CA, Bita EC, Banilas G, Hajjar SE, Sellianakis V, Aksoy U, et al.. 2005. AFLP reveals structural details of genetic diversity within cultivated olive germplasm from the Eastern Mediterranean. Theor. Appl. Genet. 110: 1169-1176.

 Ozkaya, M.T., Cakir, E., Gokbayrak, Z., Ercan, H. and Taskin, N. 2006.

Morphological and molecular characterization of Derik Halhali olive (Olea europaea L.) accessions grown in Derik–Mardin province of Turkey. Scientia Horticulturae, 108: 205–209.

 Palestinian Central Bureau of Statistics (PCBS), The Statistical Report about the Olive Presses Survey 2012.

 Pelestinian Central Bureau of Statistics, (2004) Agricultural statisitical data. Palestine.

 Pontikis, C.A., M. Loukas, and G. Kousounis. 1980. The use of biochemical markers to distinguish olive cultivars. J. Hort. Sci.

55(4):333-343.

 Rafalski, J.A. & Tingey, S.V. (1993). Genetic diagnostics in plant breeding: RAPD, microsatellites and machines. Trends in Genetics, Vol.9, pp. 275-279.

 Rallo L, Muñoz-Díez C. Olive growing in a time of change. In: Verheye H, editor. Soils, plant growth and crop production. 2010. In: Encyclopedia of life support systems (EOLSS), developed under the auspices of the UNESCO. Oxford: Eolss Publishers. http://www.eolss.net. (accessed 8 February 2011

 Rallo, P.; Dorado, G. & Martin, A. (2002). Application of

Microsatellite Markers in olive Breeding. Acta Horticulturae, Vol.586, pp. 69-71.

 Reale, S., S. Doveri, A. Dı´az, A. Angiolillo, L. Lucentini, F. Pilla, A.

Martı´n, P. Donini, and D. Lee. 2006. SNP-based markers for discriminating olive (Olea europaea L.) cultivars. Genome 49:1193– 1205.

 Roubos, K., Moustakas, M., Aravanopoulos, F.A., 2010: Molecular identifi cation of Greek olive (Olea europaea) cultivars based on microsatellite loci. Genet. Mol. Res. 9, 1865-1876.

 Rozas V. A dendroecological reconstruction of age structure and past management in an old-growth pollarded parkland in northern Spain. Forest Ecology and Management 2004;195:205-219.

 Rozas V. Tree age estimates in Fagus sylvatica and Quercus robur: testing previous and improved methods. Plant Ecology 2003;167:193- 212.

 Rugini, E. & Lavee, S. (1992). Olive. In: F.A. Hammerschlag and R.E. Litz (eds.).Biotechnology of perennial fruit crops. CAB Intl., Wallingford, U.K. pp. 371-382.

 Sabino Gil, F., Busconi, M., Da Camara Machado, A., Fogher, C., 2006.

Development and characterization of microsatellite loci from Olea europaea. Mol. Ecol. Notes 6, 1275–1277.

 Saitou N and Nei M (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406- 425.

 Sarri, V., Baldoni, L., Porceddu, A. and Cultrera, N.G. 2006 .

Microsatellite markers are powerful tools for discriminating among olive cultivars and assigning them to geographically defined populations. Genome 49: 1606-1615.

 Sarri, V., Baldoni, L., Porceddu, A., Cultrera, N.G.M., Contento, A., Frediani, M., Belaj, A., Trujillo, I., Cionini, P.G., 2006. Microsatellite markers are powerful tools for discriminating among olive cultivars and assigning them to geographically defined populations. Genome 49, 1606–1615.

 Schlüter, P. M. & Harris, S. A., 2006. Analysis of multilocus fingerprinting data sets containing missing data. Mol. Ecol. Notes: 6: 569-572.

 Sensi, E., Vignani R, Scali, M. and Masi, E. 2003. DNA fingerprinting and genetic relatedness among cultivated varieties of Olea europaea L. estimated by AFLP analysis. Sci. Hort., 97: 379-388.

 Sefc, K.M., Lopes, M.S., Mendonc¸ D., Rodrigues, D., Santos, M., Laimer, M. and Machado, A. 2000. Identification of microsatellite loci in olive (Olea europaea) and their characterization in Italian and Iberian olive trees. Molecular Ecology, 9: 1171–1173.

 Soleimani, A., Zamani, Z., Talaei, A. R. and Naghavi, M. R. 2006.

Molecular Characterization of Unknown Potentially Salt Tolerant Olive Genotypes Using RAPDMarkers. J. Sci. Islamic Rep. Iran, 17: 107-112.

 Taamalli, W., Geuna, F., Bassi, D., Daoud, D. and Zarrouk, M. 2008.

SSR marker based DNA fingerprinting of Tunisian olive (Olea europaea L.) varieties. Journal of agronomy, 7: 176-181.

 Tanksley, S.D. & Orton, T.J. (1983). Isozymes in plant genetics and breeding. Elsevier, Amsterdam.

 Terzopoulos, P.J., Kolano, B., Bebeli, P.J. and Kaltsikes, P.J. 2005.

Identification of (Olea europaea L.) cultivars using inter simple sequence repeat markers. Scientia Hortic., 105: 45-51.

 Trujillo, I, L. Rallo And Arús, Pere (1995). Identifying Olive Cultivars by Isozyme Analysis. J. AM ER. SOC. HO RT. SCI. 120(2):318–324.

 Vos, P.; Hogers, R.; Bleeker, M.; Reijans, M.; van de Lee, T.; Hornes,

M.; Friters, A.; Pot, J.; Paleman, J.; Kuiper, M. & Zabeau, M. (1995).

AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research, Vol.21, pp. 4407-4414.

 Wiesman, Z., N. Avidan, S. Lavee, and B. Quebedeaux. 1998.

Molecular characterization of common olive cultivars in Israel and the West Bank using randomly amplified polymorphic DNA (RAPD) markers. J.Amer. Soc. Hort. Sci. 123:837–841.

 Williams, J.G.K., A.R. Kubelik, K.J. Livak, J.A. Rafalski, and S.V. Tingey. 1990. DNA polymorphism amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18:6531–6535.

 World bank, Brief Overview of the Olive and the Olive Oil Sector in the Palestinian Territories.2012.http://go.worldbank.org/MBK9GU1TD0

 Wu, K.S. & Tanksley, S.D. (1993). Abundance, polymorphism and genetic mapping of microsatellites in rice. Molecular General Genetics, Vol. 241, pp. 225-235.

 Zitoun B, Bronzini de Caraffa V, Giannettini J, Breton C. 2008. Genetic diversity in Tunisian olive accessions and their relatedness with other Mediterranean olive genotypes. Sci. Hortic. 115: 416-419.

 Zohary, D. (1994). The wild genetic resources of the cultivated olive. Acta Horticulturae,Vol.356, pp. 62-65.

 Zohary, D., and Spiegel-Roy, P. (1975). Beginning of fruit growing in the world. Science 187, 319–327.

Appendix

Table (1): Concentration and quality of the used DNA:

Concentration V. DNA Stock V. TE buffer # Sample ng/µl Purity (µl) (µl) 1 FQ3 77.8 1.93 64.26735219 35.73264781 2 FQ2 78 2.21 64.1025641 35.8974359 3 FQ1 84 2.4 59.52380952 40.47619048 4 TF1 77.9 1.94 64.18485237 35.81514763 5 TF2 58.8 1.67 85.03401361 14.96598639 6 TF3 180.9 1.73 27.63957988 72.36042012 7 TF4 131.3 2.2 38.08073115 61.91926885 8 TF5 35 3.46 142.8571429 -42.85714286 9 RA1 73.4 1.83 68.11989101 31.88010899 10 RA2 45 2.23 111.1111111 -11.11111111 11 RA3 149.5 1.8 33.44481605 66.55518395 12 RA4 83.1 1.84 60.16847172 39.83152828 13 RA5 74 1.64 67.56756757 32.43243243 14 RA6 71.1 2.82 70.32348805 29.67651195 15 RA7 72.7 1.81 68.77579092 31.22420908 16 RA8 58.3 1.93 85.76329331 14.23670669 17 HE11 141.5 1.42 35.33568905 64.66431095 18 HE10 165.3 1.51 30.24803388 69.75196612 19 HE9 166.3 1.73 30.06614552 69.93385448 20 HE8 83.9 1.54 59.59475566 40.40524434 21 HE1 59.5 2.95 84.03361345 15.96638655 22 HE12 80.3 2.28 62.26650062 37.73349938 23 HE7 326.6 1.91 15.30924679 84.69075321 24 HE6 167.5 1.88 29.85074627 70.14925373 25 HE2 58.7 3.86 85.17887564 14.82112436 26 HE4 76.5 1.69 65.35947712 34.64052288 27 HE5 142.7 1.49 35.0385424 64.9614576 28 HE3 71.1 1.77 70.32348805 29.67651195 29 WD2 108 1.33 46.2962963 53.7037037 30 BD1 94.4 1.26 52.96610169 47.03389831 31 WA1 175.7 1.36 28.45759818 71.54240182 32 BD2 74.6 1.65 67.02412869 32.97587131 33 WA6 104.3 1.62 47.93863854 52.06136146 34 WA5 92 1.65 54.34782609 45.65217391 35 BD6 99.1 2.46 50.45408678 49.54591322 36 WA4 75 1.87 66.66666667 33.33333333 37 WA2 69.9 2.31 71.53075823 28.46924177 38 BD4 56.2 1.86 88.96797153 11.03202847 39 WA4 190 1.75 26.31578947 73.68421053 40 BD3 35 1.99 142.8571429 -42.85714286 41 BD5 75.8 2.15 65.96306069 34.03693931 42 KQ6 53.5 1.77 93.45794393 6.542056075

43 KQ5 61.2 1.52 81.69934641 18.30065359 44 KQ4 207.7 1.54 24.07318247 75.92681753 45 KQ3 196.9 1.69 25.39360081 74.60639919 46 KQ2 87.1 1.51 57.40528129 42.59471871 47 KQ1 227 1.59 22.02643172 77.97356828 48 YA6 134 1.17 37.31343284 62.68656716 49 YA5 45 1.12 111.1111111 -11.11111111 50 YA4 81.3 1.15 61.50061501 38.49938499 51 YA3 70.2 2.45 71.22507123 28.77492877 52 YA2 73.4 1.25 68.11989101 31.88010899 53 YA1 94.2 1.31 53.07855626 46.92144374 54 BL6 151.1 1.31 33.09066843 66.90933157 55 BL5 89.4 1.18 55.92841163 44.07158837 56 BL4 87.5 1.66 57.14285714 42.85714286 57 BL3 35 2.3 142.8571429 -42.85714286 58 BL2 63.9 1.23 78.24726135 21.75273865 59 BL1 52.9 1 94.51795841 5.482041588 60 BR1 66.5 1.89 75.18796992 24.81203008 61 BR2 51.7 1.71 96.71179884 3.288201161 62 TU6 45.9 1.7 108.9324619 -8.932461874 63 TU2 69.7 2.31 71.73601148 28.26398852 64 BR3 74 1.4 67.56756757 32.43243243 65 TU4 10 0 500 -400 66 BR6 67.7 1.5 73.85524372 26.14475628 67 TU3 10 0 500 -400 68 TU5 10 0.4 500 -400 69 AS6 68 0 73.52941176 26.47058824 70 BR5 69.6 2.3 71.83908046 28.16091954 71 SA3 86.3 1.91 57.93742758 42.06257242 72 AN5 40 3.95 125 -25 73 AN2 30 2.3 166.6666667 -66.66666667 74 AS4 40 2.49 125 -25 75 AS5 30 1.73 166.6666667 -66.66666667 76 SA4 89 1.7 56.17977528 43.82022472 77 BA3 40 1.29 125 -25 78 BA2 145.4 2.08 34.38789546 65.61210454 79 SA6 64.1 4.21 78.00312012 21.99687988 80 JE2 25 0.7 200 -100 81 JE4 30 0 166.6666667 -66.66666667 82 JE1 20 1.9 250 -150 83 JE5 65.8 1.5 75.98784195 24.01215805 84 JE6 51 1.45 98.03921569 1.960784314 85 AS2 64.4 1.64 77.63975155 22.36024845 86 BA5 35 1.79 142.8571429 -42.85714286 87 BA4 38 1.59 131.5789474 -31.57894737 88 AS1 60 1.32 83.33333333 16.66666667 89 SA1 68 1.34 73.52941176 26.47058824 90 TU1 20 1.49 250 -150 91 AN4 40 2.01 125 -25 92 AS3 20 1.99 250 -150

93 SA2 100.3 1.57 49.85044865 50.14955135 94 BA6 20 1.66 250 -150 95 AN6 40 1.59 125 -25 96 JE3 75.4 1.52 66.31299735 33.68700265 97 SA5 72.4 1.8 69.06077348 30.93922652 98 AN1 10 0 500 -400 99 BA1 81.7 2.54 61.1995104 38.8004896 100 BR4 40 1.99 125 -25 101 AN3 40 2.9 125 -25

Table (2): similarity matrix.

FQ3 FQ2 FQ1 TF1 TF2 TF3 TF4 TF5 RA1 RA2 RA3 RA4 RA5 RA6 RA7 RA8 HE11 HE10 HE9 HE8 HE1 HE12 HE7 HE6 HE2 HE4 HE5 HE3 WD2 BD1 WA1 BD2 WA6 WA5 BD6 WA4 WA2 BD4 WA3 BD3 BD5 KQ6 KQ5 KQ4 KQ3 KQ2 KQ1 YA6 YA5 YA4 YA3 YA2 YA1 BL6 BL5 BL4 BL3 BL2 BL1 BR1 BR2 TU6 TU2 BR3 TU4 BR6 TU3 TU5 AS6 BR5 SA3 AN5 AN2 AS4 AS5 SA4 BA3 BA2 SA6 JE2 JE4 JE1 JE5 JE6 AS2 BA5 BA4 AS1 SA1 TU1 AN4 AS3 SA2 BA6 FQ3 0.000 FQ2 0.000 0.000 FQ1 0.000 0.000 0.000 TF1 0.000 0.000 0.000 0.000 TF2 0.200 0.200 0.200 0.200 0.000 TF3 0.300 0.300 0.300 0.300 0.125 0.000 TF4 0.000 0.000 0.000 0.000 0.200 0.300 0.000 TF5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 RA1 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 RA2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 RA3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 RA4 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 RA5 0.571 0.571 0.571 0.571 0.615 0.692 0.571 0.571 0.571 0.571 0.571 0.571 0.000 RA6 0.538 0.538 0.538 0.538 0.583 0.667 0.538 0.538 0.538 0.538 0.538 0.538 0.100 0.000 RA7 0.538 0.538 0.538 0.538 0.583 0.667 0.538 0.538 0.538 0.538 0.538 0.538 0.100 0.000 0.000 RA8 0.824 0.824 0.824 0.824 0.800 0.867 0.824 0.824 0.824 0.824 0.824 0.824 0.571 0.538 0.538 0.000 HE11 0.250 0.250 0.250 0.250 0.417 0.500 0.250 0.250 0.250 0.250 0.250 0.250 0.500 0.571 0.571 0.765 0.000 HE10 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 HE9 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 HE8 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 HE1 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 HE12 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 HE7 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 HE6 0.333 0.333 0.333 0.333 0.200 0.300 0.333 0.333 0.333 0.333 0.333 0.333 0.571 0.643 0.643 0.750 0.385 0.333 0.333 0.333 0.333 0.333 0.333 0.000 HE2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 HE4 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.000 HE5 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.000 0.000 HE3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 WD2 0.462 0.462 0.462 0.462 0.500 0.583 0.462 0.462 0.462 0.462 0.462 0.462 0.333 0.417 0.417 0.667 0.500 0.462 0.462 0.462 0.462 0.462 0.462 0.462 0.462 0.538 0.538 0.462 0.000 BD1 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.000 WA1 0.500 0.500 0.500 0.500 0.545 0.636 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.714 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.500 0.200 0.455 0.000 BD2 0.300 0.300 0.300 0.300 0.500 0.600 0.300 0.300 0.300 0.300 0.300 0.300 0.786 0.769 0.769 0.938 0.500 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.300 0.222 0.222 0.300 0.692 0.222 0.636 0.000 WA6 0.667 0.667 0.667 0.667 0.727 0.818 0.667 0.667 0.667 0.667 0.667 0.667 0.667 0.750 0.750 0.857 0.692 0.667 0.667 0.667 0.667 0.667 0.667 0.667 0.667 0.636 0.636 0.667 0.400 0.636 0.250 0.556 0.000 WA5 0.500 0.500 0.500 0.500 0.545 0.636 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.714 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.500 0.200 0.455 0.000 0.636 0.250 0.000 BD6 0.455 0.455 0.455 0.455 0.636 0.600 0.455 0.455 0.455 0.455 0.455 0.455 0.455 0.545 0.545 0.867 0.364 0.455 0.455 0.455 0.455 0.455 0.455 0.583 0.455 0.545 0.545 0.455 0.455 0.545 0.500 0.727 0.700 0.500 0.000 WA4 0.583 0.583 0.583 0.583 0.636 0.727 0.583 0.583 0.583 0.583 0.583 0.583 0.583 0.667 0.667 0.786 0.615 0.583 0.583 0.583 0.583 0.583 0.583 0.583 0.583 0.545 0.545 0.583 0.300 0.545 0.125 0.600 0.143 0.125 0.600 0.000 WA2 0.500 0.500 0.500 0.500 0.667 0.750 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.800 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.615 0.500 0.455 0.455 0.500 0.364 0.455 0.222 0.500 0.250 0.222 0.500 0.125 0.000 BD4 0.364 0.364 0.364 0.364 0.400 0.333 0.364 0.364 0.364 0.364 0.364 0.364 0.615 0.692 0.692 0.875 0.273 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.455 0.455 0.364 0.500 0.455 0.545 0.636 0.727 0.545 0.333 0.636 0.667 0.000 WA3 0.500 0.500 0.500 0.500 0.545 0.636 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.714 0.538 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.583 0.583 0.500 0.200 0.455 0.000 0.636 0.250 0.000 0.500 0.125 0.222 0.545 0.000 BD3 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.538 0.500 0.500 0.813 0.182 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.200 0.583 0.400 0.750 0.583 0.400 0.667 0.583 0.300 0.583 0.000 BD5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 KQ6 0.300 0.300 0.300 0.300 0.500 0.600 0.300 0.300 0.300 0.300 0.300 0.300 0.692 0.667 0.667 0.938 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.300 0.222 0.222 0.300 0.692 0.400 0.750 0.250 0.700 0.750 0.600 0.727 0.636 0.500 0.750 0.222 0.300 0.000 KQ5 0.700 0.700 0.700 0.700 0.625 0.750 0.700 0.700 0.700 0.700 0.700 0.700 0.700 0.667 0.667 0.700 0.727 0.700 0.700 0.700 0.700 0.700 0.700 0.700 0.700 0.800 0.800 0.700 0.700 0.667 0.625 0.889 0.875 0.625 0.750 0.750 0.778 0.778 0.625 0.667 0.700 0.889 0.000 KQ4 0.400 0.400 0.400 0.400 0.600 0.700 0.400 0.400 0.400 0.400 0.400 0.400 0.545 0.500 0.500 0.857 0.455 0.400 0.400 0.400 0.400 0.400 0.400 0.667 0.400 0.500 0.500 0.400 0.545 0.500 0.600 0.556 0.667 0.600 0.375 0.700 0.600 0.600 0.600 0.333 0.400 0.375 0.714 0.000 KQ3 0.636 0.636 0.636 0.636 0.818 0.909 0.636 0.636 0.636 0.636 0.636 0.636 0.636 0.600 0.600 0.846 0.667 0.636 0.636 0.636 0.636 0.636 0.636 0.846 0.636 0.600 0.600 0.636 0.636 0.600 0.556 0.500 0.429 0.556 0.667 0.500 0.375 0.818 0.556 0.600 0.636 0.500 0.857 0.429 0.000 KQ2 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.875 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.333 0.727 0.667 0.500 0.636 0.545 0.400 0.667 0.111 0.200 0.125 0.778 0.444 0.556 0.000 KQ1 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.538 0.500 0.500 0.813 0.182 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.200 0.583 0.400 0.750 0.583 0.400 0.667 0.583 0.300 0.583 0.000 0.100 0.222 0.667 0.333 0.600 0.111 0.000 YA6 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 YA5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 YA4 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 YA3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 YA2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 YA1 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.000 0.000 0.100 0.538 0.200 0.583 0.222 0.636 0.583 0.545 0.545 0.455 0.455 0.583 0.200 0.100 0.222 0.800 0.500 0.600 0.111 0.200 0.100 0.100 0.100 0.100 0.100 0.000 BL6 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 BL5 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 BL4 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.714 0.692 0.692 0.941 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.125 0.600 0.667 0.636 0.636 0.545 0.545 0.667 0.300 0.200 0.125 0.900 0.444 0.556 0.222 0.300 0.200 0.200 0.200 0.200 0.200 0.111 0.200 0.200 0.000 BL3 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.714 0.692 0.692 0.941 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.125 0.600 0.667 0.636 0.636 0.545 0.545 0.667 0.300 0.200 0.125 0.900 0.444 0.556 0.222 0.300 0.200 0.200 0.200 0.200 0.200 0.111 0.200 0.200 0.000 0.000 BL2 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.714 0.692 0.692 0.941 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.111 0.111 0.200 0.615 0.300 0.667 0.125 0.600 0.667 0.636 0.636 0.545 0.545 0.667 0.300 0.200 0.125 0.900 0.444 0.556 0.222 0.300 0.200 0.200 0.200 0.200 0.200 0.111 0.200 0.200 0.000 0.000 0.000 BL1 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.875 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.300 0.300 0.200 0.615 0.300 0.667 0.333 0.727 0.667 0.500 0.750 0.667 0.400 0.667 0.111 0.200 0.125 0.778 0.250 0.556 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.222 0.222 0.222 0.000 BR1 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000 BR2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000 0.000 TU6 0.200 0.200 0.200 0.200 0.400 0.500 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.875 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.500 0.200 0.300 0.300 0.200 0.615 0.300 0.667 0.333 0.727 0.667 0.500 0.750 0.667 0.400 0.667 0.111 0.200 0.125 0.778 0.250 0.556 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.222 0.222 0.222 0.000 0.200 0.200 0.000 TU2 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000 0.000 0.200 0.000 BR3 0.000 0.000 0.000 0.000 0.200 0.300 0.000 0.000 0.000 0.000 0.000 0.000 0.571 0.538 0.538 0.824 0.250 0.000 0.000 0.000 0.000 0.000 0.000 0.333 0.000 0.100 0.100 0.000 0.462 0.100 0.500 0.300 0.667 0.500 0.455 0.583 0.500 0.364 0.500 0.100 0.000 0.300 0.700 0.400 0.636 0.200 0.100 0.000 0.000 0.000 0.000 0.000 0.100 0.000 0.000 0.200 0.200 0.200 0.200 0.000 0.000 0.200 0.000 0.000 TU4 0.100 0.100 0.100 0.100 0.300 0.400 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.882 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.417 0.100 0.200 0.200 0.100 0.538 0.200 0.583 0.222 0.636 0.583 0.545 0.667 0.583 0.455 0.583 0.200 0.100 0.222 0.800 0.333 0.600 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.111 0.111 0.111 0.111 0.100 0.100 0.111 0.100 0.100 0.000 BR6 0.200 0.200 0.200 0.200 0.222 0.333 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.364 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.500 0.636 0.667 0.222 0.545 0.111 0.200 0.333 0.625 0.444 0.700 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.222 0.200 0.200 0.222 0.200 0.200 0.300 0.000 TU3 0.200 0.200 0.200 0.200 0.222 0.333 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.364 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.500 0.636 0.667 0.222 0.545 0.111 0.200 0.333 0.625 0.444 0.700 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.222 0.200 0.200 0.222 0.200 0.200 0.300 0.000 0.000 TU5 0.364 0.364 0.364 0.364 0.222 0.333 0.364 0.364 0.364 0.364 0.364 0.364 0.714 0.692 0.692 0.800 0.417 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.455 0.455 0.364 0.615 0.455 0.667 0.500 0.727 0.667 0.750 0.750 0.769 0.545 0.667 0.455 0.364 0.500 0.778 0.600 0.818 0.545 0.455 0.364 0.364 0.364 0.364 0.364 0.455 0.364 0.364 0.400 0.400 0.400 0.400 0.364 0.364 0.400 0.364 0.364 0.300 0.400 0.400 0.000 AS6 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 BR5 0.300 0.300 0.300 0.300 0.333 0.444 0.300 0.300 0.300 0.300 0.300 0.300 0.786 0.769 0.769 0.786 0.500 0.300 0.300 0.300 0.300 0.300 0.300 0.455 0.300 0.400 0.400 0.300 0.583 0.222 0.500 0.444 0.700 0.500 0.727 0.600 0.636 0.500 0.500 0.400 0.300 0.600 0.571 0.700 0.800 0.500 0.400 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.500 0.300 0.300 0.500 0.300 0.300 0.400 0.333 0.333 0.500 0.222 0.000 SA3 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000 AN5 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000 0.000 AN2 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000 0.000 0.000 AS4 0.300 0.300 0.300 0.300 0.333 0.444 0.300 0.300 0.300 0.300 0.300 0.300 0.692 0.667 0.667 0.867 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.455 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.444 0.700 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.250 0.750 0.375 0.667 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.333 0.333 0.333 0.125 0.300 0.300 0.125 0.300 0.300 0.222 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.000 AS5 0.200 0.200 0.200 0.200 0.222 0.333 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.273 0.200 0.200 0.200 0.200 0.200 0.200 0.364 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.500 0.636 0.667 0.222 0.545 0.111 0.200 0.333 0.625 0.444 0.700 0.222 0.111 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.222 0.200 0.200 0.222 0.200 0.200 0.300 0.000 0.000 0.400 0.111 0.333 0.111 0.111 0.111 0.125 0.000 SA4 0.100 0.100 0.100 0.100 0.111 0.222 0.100 0.100 0.100 0.100 0.100 0.100 0.643 0.615 0.615 0.813 0.333 0.100 0.100 0.100 0.100 0.100 0.100 0.273 0.100 0.200 0.200 0.100 0.417 0.200 0.455 0.400 0.636 0.455 0.545 0.545 0.583 0.300 0.455 0.200 0.100 0.400 0.667 0.500 0.727 0.300 0.200 0.100 0.100 0.100 0.100 0.100 0.200 0.100 0.100 0.300 0.300 0.300 0.300 0.100 0.100 0.300 0.100 0.100 0.200 0.111 0.111 0.300 0.000 0.222 0.000 0.000 0.000 0.222 0.111 0.000 BA3 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 BA2 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 SA6 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 JE2 0.400 0.400 0.400 0.400 0.250 0.375 0.400 0.400 0.400 0.400 0.400 0.400 0.667 0.636 0.636 0.769 0.455 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.500 0.500 0.400 0.667 0.333 0.600 0.556 0.800 0.600 0.700 0.700 0.727 0.444 0.600 0.333 0.400 0.556 0.500 0.667 0.778 0.444 0.333 0.400 0.400 0.400 0.400 0.400 0.500 0.400 0.400 0.600 0.600 0.600 0.444 0.400 0.400 0.444 0.400 0.400 0.500 0.250 0.250 0.444 0.333 0.375 0.333 0.333 0.333 0.375 0.250 0.333 0.250 0.250 0.250 0.000 JE4 0.500 0.500 0.500 0.500 0.400 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.615 0.692 0.692 0.714 0.273 0.500 0.500 0.500 0.500 0.500 0.500 0.364 0.500 0.583 0.583 0.500 0.615 0.455 0.545 0.636 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.455 0.500 0.636 0.625 0.727 0.818 0.545 0.455 0.500 0.500 0.500 0.500 0.500 0.583 0.500 0.500 0.667 0.667 0.667 0.545 0.500 0.500 0.545 0.500 0.500 0.583 0.400 0.400 0.400 0.455 0.500 0.455 0.455 0.455 0.500 0.400 0.455 0.400 0.400 0.400 0.250 0.000 JE1 0.400 0.400 0.400 0.400 0.250 0.375 0.400 0.400 0.400 0.400 0.400 0.400 0.769 0.750 0.750 0.933 0.583 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.333 0.333 0.400 0.667 0.500 0.727 0.375 0.667 0.727 0.818 0.700 0.727 0.600 0.727 0.500 0.400 0.375 0.875 0.667 0.778 0.444 0.500 0.400 0.400 0.400 0.400 0.400 0.333 0.400 0.400 0.250 0.250 0.250 0.444 0.400 0.400 0.444 0.400 0.400 0.333 0.444 0.444 0.250 0.333 0.556 0.333 0.333 0.333 0.375 0.444 0.333 0.250 0.250 0.250 0.500 0.600 0.000 JE5 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.846 0.833 0.833 0.929 0.667 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.444 0.700 0.286 0.625 0.700 0.909 0.667 0.700 0.700 0.700 0.600 0.500 0.500 0.857 0.778 0.750 0.556 0.600 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.556 0.500 0.500 0.556 0.500 0.500 0.444 0.556 0.556 0.375 0.444 0.500 0.444 0.444 0.444 0.500 0.556 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.000 JE6 0.364 0.364 0.364 0.364 0.222 0.333 0.364 0.364 0.364 0.364 0.364 0.364 0.615 0.583 0.583 0.714 0.538 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.364 0.455 0.455 0.364 0.615 0.300 0.545 0.500 0.727 0.545 0.750 0.636 0.667 0.545 0.545 0.455 0.364 0.636 0.625 0.727 0.818 0.545 0.455 0.364 0.364 0.364 0.364 0.364 0.455 0.364 0.364 0.545 0.545 0.545 0.545 0.364 0.364 0.545 0.364 0.364 0.455 0.400 0.400 0.400 0.300 0.333 0.300 0.300 0.300 0.500 0.400 0.300 0.222 0.222 0.222 0.250 0.400 0.444 0.375 0.000 AS2 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 BA5 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 BA4 0.300 0.300 0.300 0.300 0.125 0.250 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.545 0.545 0.786 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.600 0.818 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.444 0.571 0.556 0.800 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.333 0.300 0.300 0.333 0.300 0.300 0.400 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.250 0.125 0.222 0.125 0.125 0.125 0.143 0.333 0.375 0.500 0.333 0.125 0.125 0.000 AS1 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 SA1 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 TU1 0.300 0.300 0.300 0.300 0.125 0.250 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.545 0.545 0.786 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.600 0.818 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.444 0.571 0.556 0.800 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.333 0.300 0.300 0.333 0.300 0.300 0.400 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.250 0.125 0.222 0.125 0.125 0.125 0.143 0.333 0.375 0.500 0.333 0.125 0.125 0.000 0.125 0.125 0.000 AN4 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000 AS3 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000 0.000 SA2 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000 0.000 0.000 BA6 0.400 0.400 0.400 0.400 0.250 0.375 0.400 0.400 0.400 0.400 0.400 0.400 0.667 0.636 0.636 0.769 0.455 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.400 0.500 0.500 0.400 0.667 0.333 0.600 0.556 0.800 0.600 0.700 0.700 0.727 0.444 0.600 0.333 0.400 0.556 0.500 0.667 0.778 0.444 0.333 0.400 0.400 0.400 0.400 0.400 0.500 0.400 0.400 0.600 0.600 0.600 0.444 0.400 0.400 0.444 0.400 0.400 0.500 0.250 0.250 0.444 0.333 0.375 0.333 0.333 0.333 0.375 0.250 0.333 0.250 0.250 0.250 0.000 0.250 0.500 0.429 0.250 0.250 0.250 0.143 0.250 0.250 0.143 0.250 0.250 0.250 0.000 AN6 0.200 0.200 0.200 0.200 0.000 0.125 0.200 0.200 0.200 0.200 0.200 0.200 0.615 0.583 0.583 0.800 0.417 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.200 0.300 0.300 0.200 0.500 0.300 0.545 0.500 0.727 0.545 0.636 0.636 0.667 0.400 0.545 0.300 0.200 0.500 0.625 0.600 0.818 0.400 0.300 0.200 0.200 0.200 0.200 0.200 0.300 0.200 0.200 0.400 0.400 0.400 0.400 0.200 0.200 0.400 0.200 0.200 0.300 0.222 0.222 0.222 0.111 0.333 0.111 0.111 0.111 0.333 0.222 0.111 0.000 0.000 0.000 0.250 0.400 0.250 0.375 0.222 0.000 0.000 0.125 0.000 0.000 0.125 0.000 0.000 0.000 0.250 JE3 0.545 0.545 0.545 0.545 0.600 0.700 0.545 0.545 0.545 0.545 0.545 0.545 0.857 0.846 0.846 0.857 0.583 0.545 0.545 0.545 0.545 0.545 0.545 0.667 0.545 0.500 0.500 0.545 0.769 0.500 0.727 0.375 0.667 0.727 0.818 0.700 0.727 0.600 0.727 0.500 0.545 0.375 0.875 0.667 0.625 0.444 0.500 0.545 0.545 0.545 0.545 0.545 0.500 0.545 0.545 0.444 0.444 0.444 0.444 0.545 0.545 0.444 0.545 0.545 0.500 0.444 0.444 0.600 0.500 0.556 0.500 0.500 0.500 0.375 0.444 0.500 0.600 0.600 0.600 0.500 0.600 0.500 0.429 0.600 0.600 0.600 0.556 0.600 0.600 0.556 0.600 0.600 0.600 0.500 SA5 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429 AN1 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429 BA1 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429 BR4 0.300 0.300 0.300 0.300 0.125 0.250 0.300 0.300 0.300 0.300 0.300 0.300 0.583 0.545 0.545 0.786 0.364 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.300 0.400 0.400 0.300 0.583 0.400 0.636 0.600 0.818 0.636 0.600 0.727 0.750 0.333 0.636 0.222 0.300 0.444 0.571 0.556 0.800 0.333 0.222 0.300 0.300 0.300 0.300 0.300 0.400 0.300 0.300 0.500 0.500 0.500 0.333 0.300 0.300 0.333 0.300 0.300 0.400 0.125 0.125 0.333 0.222 0.444 0.222 0.222 0.222 0.250 0.125 0.222 0.125 0.125 0.125 0.143 0.333 0.375 0.500 0.333 0.125 0.125 0.000 0.125 0.125 0.000 0.125 0.125 0.125 0.143 AN3 0.500 0.500 0.500 0.500 0.375 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.750 0.727 0.727 0.929 0.545 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.500 0.444 0.444 0.500 0.750 0.600 0.818 0.500 0.778 0.818 0.800 0.800 0.818 0.556 0.818 0.444 0.500 0.286 0.857 0.625 0.750 0.375 0.444 0.500 0.500 0.500 0.500 0.500 0.444 0.500 0.500 0.375 0.375 0.375 0.375 0.500 0.500 0.375 0.500 0.500 0.444 0.375 0.375 0.375 0.444 0.667 0.444 0.444 0.444 0.286 0.375 0.444 0.375 0.375 0.375 0.429 0.556 0.167 0.333 0.556 0.375 0.375 0.286 0.375 0.375 0.286 0.375 0.375 0.375 0.429

Appendix(3):FAMD Format

FQ3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 FQ2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 FQ1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 TF1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 TF2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 TF3 1 1 0 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 TF4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 TF5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 RA1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 RA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 RA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 RA4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 RA5 1 1 0 0 1 1 0 0 1 1 0 0 0 0 1 0 0 0 1 RA6 1 1 0 0 1 1 0 0 0 1 0 0 0 0 1 0 0 0 1 RA7 1 1 0 0 1 1 0 0 0 1 0 0 0 0 1 0 0 0 1 RA8 0 0 0 0 1 1 0 0 0 1 1 0 0 1 1 0 1 0 0 HE11 1 1 0 0 0 0 1 1 1 1 0 0 0 1 0 0 0 1 1 HE10 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 HE9 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 HE8 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 HE1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 HE12 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 HE7 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 HE6 1 1 0 0 0 0 1 1 1 1 0 0 1 0 0 0 0 0 0 HE2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 HE4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 HE5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 HE3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 WD2 1 1 0 0 1 1 0 0 1 1 0 0 1 0 0 0 0 1 0 BD1 1 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 WA1 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0 BD2 1 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 WA6 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0 WA5 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0 BD6 1 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 1 WA4 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0 WA2 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 1 BD4 1 1 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 1 0 WA3 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 1 0 BD3 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1 BD5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 KQ6 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1 KQ5 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 KQ4 1 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1 KQ3 1 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 1 1 KQ2 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1 KQ1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1 YA6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 YA5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 YA4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 YA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 YA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 YA1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 BL6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 BL5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 BL4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 BL3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 BL2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 BL1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1 BR1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 BR2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 TU6 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 1 TU2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 BR3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 TU4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 1 BR6 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0 TU3 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0 TU5 1 1 0 0 0 0 1 1 0 1 0 0 1 1 0 0 0 0 0 AS6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0 BR5 0 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0 SA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0 AN5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0 AN2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0 AS4 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0 AS5 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 1 0 SA4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 1 0 BA3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 BA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 SA6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 JE2 1 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 JE4 1 0 0 0 0 0 1 1 1 1 0 0 0 1 0 0 0 0 0 JE1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 JE5 1 0 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 JE6 1 0 0 0 0 0 1 1 0 1 0 0 1 0 1 0 0 0 0 AS2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 BA5 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 BA4 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 AS1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 SA1 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 TU1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 AN4 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 AS3 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 SA2 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 BA6 1 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 AN6 1 1 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 JE3 1 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1 1 0 SA5 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 AN1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 BA1 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 BR4 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 AN3 1 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0

( Olea europea L

2113

( Olea europea L

29 Microsatellite (SSR)

3 0

6 6 93 044 04

PCA