Zoologica Scripta

Molecular phylogeny of Geoplaninae (Platyhelminthes) challenges current classification: proposal of taxonomic actions FERNANDO CARBAYO,MARTA ALVAREZ-PRESAS,CLAUDIA T. OLIVARES,FERNANDO P. L. MARQUES, EUDOXIA M. FROEHLICH &MARTA RIUTORT

Submitted: 8 December 2012 Carbayo, F., Alvarez-Presas, M., Olivares, C.T., Marques, F.P.L., Froehlich, E.M. & Accepted: 17 April 2013 Riutort, M. (2013). Molecular phylogeny of Geoplaninae (Platyhelminthes) challenges cur- doi:10.1111/zsc.12019 rent classification: proposal of taxonomic actions. —Zoologica Scripta, 42, 508–528. Despite likely being the most diverse group within the Tricladida, the systematics of land pla- narians (Geoplanidae) has received minor attention. The most species-rich ingroup, the sub- family Geoplaninae, is restricted to the Neotropics. The systematics of Geoplaninae remains uncertain. Unique features supporting the genera are scanty; moreover, parts of the known species have been poorly described, making comparative studies difficult. Likewise the evolu- tionary relationships among land planarians remain insufficiently understood. In the present study, a phylogenetic hypothesis for selected taxa of Geoplaninae based on the molecular data is presented and discussed in the light of morphological features. Our phylogenetic inference is based on the fragments of three nuclear regions (18S, 28S rDNA and EF-1a) and a mito- chondrial marker (cytochrome oxidase I) for which we considered three optimality criteria (parsimony, maximum likelihood and Bayesian inference). Although our data provide little support for most basal nodes, our phylogenetic trees show a number of well-supported clades, unveiling morphologically homogeneous groups. According to these results, we propose to separate Geoplana into Barreirana (formerly considered a subgenus), Cratera gen. n., Imbira gen. n., Matuxia gen. n., Obama gen. n. and Paraba gen. n., emend the diagnoses of Barreirana, Geoplana, Notogynaphallia, Pasipha and Xerapoa and review the classification of the species within these genera. For Geoplana goetschi sensu Marcus, (1951), a new name is proposed. *Corresponding author: Fernando Carbayo, Laboratorio de Ecologia e Evolucß~ao, Escola de Artes, Ci^encias e Humanidades (EACH), Av. Arlindo Bettio, 1000, S~ao Paulo, SP 03828-000, Brazil. E-mail: [email protected] Fernando Carbayo, Laboratorio de Ecologia e Evolucß~ao, Escola de Artes, Ci^encias e Humanidades (EACH), Universidade de S~ao Paulo (USP), Av. Arlindo Bettio, 1000, S~ao Paulo, SP, 03828- 000, Brazil. E-mail: [email protected] Marta Alvarez-Presas, Departament de Genetica, Facultat de Biologia and Institut de Recerca de la Biodiversitat (IRBio), Universitat de Barcelona, Avinguda Diagonal, Barcelona, 643 E-08028, Spain. E-mail: [email protected] Claudia T. Olivares, Fernando P. L. Marques, and Eudoxia M. Froehlich, Departamento de Zoologia, Instituto de Bioci^encias, Universidade de S~ao Paulo (USP), Rua do Mat~ao, Travessa 14 Cidade Universitaria, S~ao Paulo, SP, 05508-900, Brazil. E-mail: [email protected], [email protected], [email protected] Marta Riutort, Departament de Genetica, Facultat de Biologia and Institut de Recerca de la Biodiv- ersitat (IRBio), Universitat de Barcelona, Avinguda Diagonal, Barcelona, 643 E-08028, Spain. E-mail: [email protected]

Introduction throughout the world, especially in tropical regions. These There are over 800 species of land planarians (Geoplani- often colourful invertebrates range mostly from a few dae) predominantly inhabiting moist terrestrial habitats millimetres to over 20 cm in length and prey on soil

508 ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 F. Carbayo et al.  Systematics of Geoplaninae invertebrates, including other land planarians (Winsor et al. 1998). The diversity of these tricladid flatworms is cur- rently organized into four subfamilies, Geoplaninae Stimp- son (1857), Bipaliinae Graff (1896), Microplaninae Pantin (1953) and Rhynchodeminae Graff (1896) (Sluys et al. 2009; see Riutort et al. 2012 for a revision). While subfami- lies Microplaninae, Rhynchodeminae and Bipaliinae are distributed in both hemispheres, the original distribution of Geoplaninae is confined within the limits of Neotropical region. Land planarians probably comprise the most specious taxon within tricladid flatworms. However, the group Fig. 1 Scheme of the phylogenetic relationships of the main remains poorly known despite its long taxonomic history in groups of land planarians after Alvarez-Presas et al. (2008) using which renowned scientists such as Charles Darwin, Fritz Sluys et al. (2009) nomenclature. Muller€ and Libbie H. Hyman, among others, have contrib- uted to its description, circumscription of taxonomic units and earlier notions of interrelationships among taxa (Muller€ (1953) and Froehlich (1967), who postulated that members 1774; Darwin 1844; Hyman 1951). As with many other of Microplaninae were the first to diverge based on the groups of invertebrates, progress in understanding this ele- morphology of the copulatory organs. None of these ment of our biodiversity has been undermined by the hypotheses were generated by any rigorous objective ana- restricted number of systematists interested in the group lytical protocol, and since then, no phylogeny of land pla- (Carbayo & Froehlich 2008), the unavailability of type narians based on the morphological data has been material for reference and the lack of adequate morpho- proposed. logical features to delimit species (Ogren & Sluys 1998; Although some studies used morphological characters to Winsor 2006) leading to poor descriptions and lack of a infer sister-group relationships among major lineages of phylogenetic framework upon which to base the classifica- Tricladida (e.g. Ball 1977, 1981; Sopott-Ehlers 1985; Sluys tion (Carbayo & Leal-Zanchet 2003). Nonetheless, land 1989), those proved to be insufficient to provide fully planarians have recently become of interest for various resolved phylogenetic hypotheses for this group. Our pres- reasons. On the one hand, some tropical species have ent knowledge on the phylogenetic relationships within become invasive, even considered pests, in Great Britain this group therefore has profited from the incorporation of and the United States (Cannon et al. 1999; Ducey et al. molecular data into the systematic study of planarians 1999; Iwai et al. 2010). On the other hand, they have been (Riutort et al. 2012). According to Sluys et al. (2009), shown to be good models for low-scale phylogeographical molecular data have provided radical shifts in our views of studies (Sunnucks et al. 2006; Alvarez-Presas et al. 2011). the phylogenetic relationships between the major lineages The evolutionary relationships among land planarians of triclads. A major finding was that land planarians were remain virtually unstudied. Early hypotheses of sister-group not sister of freshwater and maricolan triclads but they relationships among major lineages of land planarians have shared a common ancestor with only some members of pa- relied on biogeographical narratives involving breakage of ludicolan planarians, that is, Dugesiidae (Carranza et al. continents and dispersal events or a priori assumptions of 1998a,b; Sluys et al. 2009). However, the number of phylo- morphological character evolution. von Graff (1899) postu- genetic molecular studies for major tricladid lineages lated that land planarians originated in the lost continent remains scarce and with low taxonomic representation, and of Gondwana and, as a consequence of the geological phylogenetic hypothesis for geoplaninid land planarians breakage of the continent, they split into two groups. based on the molecular data has never been published. According to him, a lineage diversified in Australia and Geoplaninae is comprised of land planarians that posses a New Zealand (members of Caenoplaninae, currently Cae- broad ciliated creeping sole covering most of the ventral noplanini), and the other colonized South America (i.e. surface; dorsal testes; subepithelial or cutaneous longitudi- Geoplaninae) (Froehlich 1967). More recently, Winsor nal musculature well developed, arranged in bundles; and et al. (1998) proposed that rhynchodemids (at that time longitudinal parenchymal muscle absent or not well devel- Rhynchodeminae + Microplaninae, and currently split into oped, not forming a ring zone (Ogren & Kawakatsu 1990). two not sister groups, Microplaninae and Rhynchodemini) However, as new taxonomic studies come to light, these are the earliest divergent land planarians based on their characters are considered less robust because they have worldwide distribution. This view contradicts Marcus been revealed to be non-exclusive. For instance, species of

ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 509 Systematics of Geoplaninae  F. Carbayo et al. the geoplaninid taxon Anzoplanini Winsor 2006; possesses Here, we attempt to provide phylogenetic refinement for dorsal and ventral testes, and some geoplaninids have well- the Geoplaninae, based on the molecular data and using rig- developed parenchymal muscle fibres. In the only molecu- orous phylogenetic inference methods, which we consider lar phylogenetic study in which Geoplaninae have been desirable to reach a meaningful (i.e. phylogenetic) classifica- represented, the subfamily was classified as the sister group tion for these groups and to understand their evolution. of a clade comprised of members of Rhynchodeminae (cur- rently Rhynchodemini) and Caenoplaninae (currently Cae- Material and methods noplanini) (Alvarez-Presas et al. 2008; Fig. 1). In that Specimen acquisition, preparation and identification study, Geoplaninae was only represented by three species We collected land planarians from June 1998 to July 2010 of Geoplana and one species of Notogynaphallia, although it in Brazil and Chile (Fig. 2) during the day (under rocks or currently comprises 260 species within 18 recognized gen- rotting logs) or during the night (in open places, such as era (Sluys et al. 2009; Carbayo 2010; Grau et al. 2012). trails). Following, we photographed them and took notes Hence, the monophyly of these genera has never been on their external morphology, including colour pattern. tested despite the expectation that some of them constitute Next, we killed the specimens in boiling water and, before non-monophyletic assemblages. This assumption relies fixing them in 10% formalin solution for histological stud- over genera that seem to be poorly circumscribed by a ies, cut off a small piece of the posterior end of the worm combination of features also found in other genera of the and put these fragments in 92–100% ethanol for the subfamily [e.g. Amaga Ogren & Kawakatsu, 1990; Geoplana molecular study. If the copulatory organs were located at Stimpson, 1857; Gigantea Ogren & Kawakatsu, 1990; Noto- the very rear end of the body, we sampled the middle gynaphallia Ogren & Kawakatsu, 1990; and Pasipha Ogren region. We also sectioned 71 fixed specimens for the iden- & Kawakatsu 1990; see Leal-Zanchet & Froehlich (2006); tification purposes or to acquire internal morphological Carbayo (2006, 2008, 2010); Grau et al. (2012)]. It is also data for this work. To achieve that, we cut them into a var- true that some genera are diagnosed by exclusive, putative iable number of pieces containing the anterior region, the synapomorphic characters (e.g. Cephaloflexa Carbayo & prepharyngeal region, the pharynx and the copulatory Leal-Zanchet, 2003, Xerapoa Froehlich, 1955, among apparatus, to individualize regions of taxonomic relevance. others). Given the present state of the art in systematics of We dehydrated these fragments in a graded ethanol ® Geoplaninae, it is obvious that any attempt to test the series, cleared in xylene, embedded in Histosec embedding monophyly of these taxa by rigorous phylogenetic infer- agent for histology (Merck, Darmstadt, Germany), sec- ence would be appreciated for the systematics of the tioned at 7-lm intervals using a Microm HM315R retract- group. ing rotary microtome, affixed with albumin–glycerol (1:1)

Fig. 2 Sampling sites of the specimens studied.

510 ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 F. Carbayo et al.  Systematics of Geoplaninae on glass slides placed on a slide warmer, stained them with Molecular data acquisition Mallory/Cason trichrome (Romeis 1989), dehydrated in a We performed genomic DNA extractions using the graded ethanol series, cleared in xylene and mounted in Wizard Genomic DNA Purification kit (Promega, Entellan mounting medium (Merck, Darmstadt, Ger- Madison, WI, USA) following Alvarez-Presas et al. (2011). many). The slides were observed with an optical micro- We selected one mitochondrial (a cytochrome oxidase I scope. We made drawings of the copulatory apparatuses gene fragment, hereafter referred to as COI) and four with a camera lucida attached to the microscope. Specimen nuclear genes (18S rDNA type II and 28S rDNA, a partial identification was based on the cross-references between coding region of the elongation factor 1-alpha, hereafter the specimens we collected for this study and the primary referred to as EF-1a and the gene encoding the ATPase- literature, type material, and, in some cases, specimens used alpha). We provide information on primers used here in in the original description but not designated as types Table 2. The COI and ribosomal genes have been shown (Table S1). The material was deposited in the Museu de to be phylogenetic informative for tricladid flatworms in Zoologia da Universidade de S~ao Paulo (MZUSP). previous studies (Alvarez-Presas et al. 2008, 2011, 2012; Lazaro et al. 2009), and the other two nuclear genes were Taxonomic representation tested for the first time. Mitochondrial and ribosomal We selected 124 specimens for this study, representing a genes were sequenced mostly in the Universidade of S~ao total of 68 potentially distinct species, including 14 genera Paulo (USP), while the nuclear genes were sequenced in assigned to Geoplaninae and five to Rhynchodeminae the Universitat de Barcelona (UB). We performed (Table 1 and Table S1). Whenever it was possible, in most PCRs (25 lL) on a Techne TC-5000TM (Bibby Scientific cases, we included at least two representatives of a given Ltd, Staffordshire, UK) and on an Eppendorf Mastercy- nominal species. We assigned the undescribed species to a cler (Eppendorf, Hamburg, Germany) personal thermocy- genus based on the possession of morphological diagnostic clers using initial denaturation step of 5 min at 94–95 °C, characters. followed by 35 cycles of 30- to 50-s denaturation at 94 °C, 30-s annealing at 46–58 °C and 30-s – 1.5-min extension Table 1 Current number of Geoplaninae species, by genus and at 72 °C, with a final extension step of 3–10 min at 72 °C. number of species studied. is a group for Pseudogeoplana species in- We purified amplification products with a vacuum manifold querendae and nomina dubia. Geoplaninae 1 was not included. For (Multiscreen HTS Vacuum Manifold; Millipore Corpora- the complete list of species analysed, see Table S1 tion, Billerica, MA, USA) or Agencourt AMPure XP fi Current known Known + PCR Puri cation kit (Beckman Coulter Inc., Beberly, MA, Genus species undescribed species studied USA), following the instructions of the manufacturer. Each l + sequence reaction contained a total volume of 10 L Geoplana Stimpson, 1857 115 18 9 l l l Pseudogeoplana 55 1 + 0 including 1.5 L PCR product, 1 M PCR primer, 0.25 L Ogren & Kawakatsu, 1990 ABI BigDye 5 sequencing buffer and 0.5 lL ABI BIGDYE Pasipha Ogren & 22 6 + 2 TERMINATOR ver. 3.0 (Applied Biosystems, Foster City, CA, Kawakatsu, 1990 USA) in S~ao Paulo, and 20 lL including 0.5–2 lL PCR Notogynaphallia Ogren & 14 5 + 0 product, 5 lM PCR primer, 3 lL BIGDYE TERMINATOR Kawakatsu, 1990 9 l Gigantea Ogren & Kawakatsu, 1990 13 0 + 0 v1.1/3.1 sequencing buffer 5 and 1 L ABI BIGDYE TERMI- Amaga Ogren & Kawakatsu, 1990 10 0 + 0 NATOR v3.1 (Applied Biosystems) in Barcelona. Next, we Choeradoplana Graff, 1896 9 4 + 1 cleaned the BigDye-labelled PCR products using SEPHA- Luteostriata Carbayo, 2010 7 5 + 4 DEX beads (Sigma-Aldrich) or ethanol precipitation, and Issoca Froehlich, 1955 5 2 + 1 the sequencing reaction products were analysed using an Gusana E. M. Froehlich, 1978 3 0 + 1 Cephaloflexa Carbayo & 22+ 1 ABI Prism 3730 Genetic Analyzer (Applied Biosystems) at Leal-Zanchet, 2003 the Unitat de Genomica dels Serveis Cientıfico-Tecnics de Xerapoa Froehlich, 1955 2 1 + 0 la Universitat de Barcelona, Spain, or ABI Prism 3100 at Geobia Diesing, 1861 1 1 + 0 the Centro de Sequenciamento do Instituto de Quımica da Enterosyringa Ogren & 11+ 0 Universidade de S~ao Paulo, Brazil. Kawakatsu, 1990 Liana E. M. Froehlich, 1978 1 0 + 0 Polycladus Blanchard, 1845 1 0 + 1 Phylogenetic inference Supramontana Carbayo & 11+ 0 Alignment. We assembled sequencer reads using the Leal-Zanchet, 2003 package Consed/Phred/Phrap (Ewing & Green 1998; Bogga Grau & Sluys, 2012 1 0 + 0 Ewing et al. 1998; Gordon et al. 1998, 2001). Before sub- Total 263 47 + 19 mitting the data to phylogenetic analysis, we aligned the

ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 511 Systematics of Geoplaninae  F. Carbayo et al.

Table 2 Primers used in this study

Genomic region Primer name Sequence Source

EF-1a EFplatF GATTGCYCCWGGYCATCG Present study EFplatR GCRATWGAYTCGTGRTGC Present study EFplatR2 CYTTVACTGARACGTTYTTRAC Present study ATPase A ATPplanF CGGATACCTCAGAAAATC Present study ATPplanR GCCGATCTGCACTTGGC Present study 18S rDNA type II 18SA AACCTGGTTGATCCTGCCAGT Medlin et al. (1988) 18SB TGATCCTTCCGCAGGTTCACCT Medlin et al. (1988) 18SC CGGTAATTCCAGCTCCAATAG Medlin et al. (1988) 18SY CAGACAAATCGCTCCACCAAC Medlin et al. (1988) 18SL CCAACTACGAGCTTTTTAACTG Medlin et al. (1988) 18SO AAGGGCACCACCAGGAGTGGAG Medlin et al. (1988) 28S rDNA 28SC1 ACCCGCTGAATTTAAGCAT Hassouna et al. (1984) 28SD2 TGGTCCGTGTTTCAAGAC Hassouna et al. (1984) 28S2F CTGAGTCCGATAGCAAACAAG Alvarez-Presas et al. (2008) 28S1500R* GCTATCCTGAGGGAAACTTCG Tkach et al. (1999) 28S6R GGAACCCCTTCTCCACTTCAGT Alvarez-Presas et al. (2008) COI FlatwormCOIF GCAGTTTTTGGTTTTTTGGACATCC Sunnucks et al. (2006) FlatwormCOIR GAGCAACAACATAATAAGTATCATG Sunnucks et al. (2006) BarS GTTATGCCTGTAATGATTG Alvarez-Presas et al. (2011) COIR CCWGTYARMCCHCCWAYAGTAAA Lazaro et al. (2009)

*Only used in sequencing. sequences using MAFFT (Katoh et al. 2002) using the (Wheeler 1996, 2001a,b; Phillips et al. 2000). Within this G-INS-i iterative refinement method with 1000 cycles and framework, we performed phylogenetic analyses of the visualized and edited in BioEdit (Hall 1999). After align- data, each partition (i.e. genomic region) in separate and ment, we checked the sequences of EF-1a and COI for concatenated, using a two-step procedure. First, we col- stop codons using the DNA-to-protein-translation online lected candidate topologies using optimization alignment resource by Bikandi et al. (2004) and trimmed all sequences for an array of nine parameter sets that considered a range so that the first base corresponded to the first codon posi- of gap extension costs from 1 to 8 and a range of transfor- tion. The software DAMBE (Xia & Xie 2001) was used to mation costs from 1 to 4, 4 and affine gap costs twice the perform saturation tests for each gene by plotting observed cost of gap extension. The resulting cost ratios for opening transitions and transversions vs. gene divergences under the gaps/extension gaps/transversions/transitions in these nine ML-composite TN93 model. We constructed a concate- parameter sets were as follows: 2:1:1:1, 2:1:1:2, 2:1:2:1, nated data matrix by merging the individual alignments 2:2:1:1, 2:2:1:2, 2:2:2:1, 2:4:1:1, 2:4:1:2 and 2:4:2:1. For including only those species for which we were able to each parameter set, we run nine iterations each of which obtain sequences of at least three of the four genes studied we searched for optimal solutions by constructing 80 Wag- for one or more individuals (Table S1). In a few cases, the ner trees [POY command ‘build (80)’] and refining them by sequences of two individuals (coming from the same popu- a round of SPR followed by TBR (POY command ‘swap()’), lation) were merged to provide sequences from enough after which best and unique trees were selected for each genes for their species. Finally, we created 10 and 7 parti- iteration. We also preformed an extra search using three tions for 18S and 28S rDNA sequences, respectively, based sequential searches of eight hours each [POY command on the putative homologous regions within each gene to ‘search (max_time:0:8:0)’], after which best and unique increase computational efficiency during dynamic homo- trees were selected. These search iterations rendered 10 logy analyses (Giribet 2001). sets of candidate trees that were used in the next step of our analyses. Our second step comprised the rediagnose of Dynamic homology under parsimony (MP). We performed those 10 sets of candidate trees collected under optimiza- tree searches by direct optimization (DO) (Wheeler 1996) tion alignment by filtering unique topologies and rediag- of nucleotide sequences as implemented in POY (ver. nosing them using iterative pass (IP) optimization 4.1.2.1, Varon et al. 2010). The epistemological justification (Wheeler 2003a). This step was applied to the simultaneous for dynamic homology relies on the inter-relationships analyses of all fragments and to each non-coding region between topologies, alignments and parameter sets (i.e. 18S and 28S). Iterative pass optimization is a

512 ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 F. Carbayo et al.  Systematics of Geoplaninae three-dimensional application of DO known to reduce criterion. Nodal support was inferred by bootstrap propor- alignment lengths and hence tree lengths (Wheeler 2003a). tions after 1000 bootstrap replicates with one independent The intense computational demand of this algorithm makes search replicate each (bootstrap reps = 100 and search it unfeasible to use during the tree search procedure exe- reps = 1 in 10 CPUs). Bootstrap results were compiled cuted in the first step. However, IP was practical to employ using SUMTREES (ver. 3.1.0; Sukumaran & Holder 2010). using the subset of trees resulting from the first step. All tree searches for ML were performed on a 10- Finally, for each parameter set, the program reported the 30 9 2.53GHz E5540 Intel Xeon (Intel Corp., USA) implied alignment(s) (sensu Wheeler 2003b), tree(s) topol- CPU cluster at the Biotechnology Center Unit, University ogy(ies) and tree score(s). of Connecticut. Upon completion of search and refinement, we com- puted the incongruence length difference (ILD) following Bayesian inference (BI). Analyses were performed with the Wheeler & Hayashi (1998). Accordingly, we selected as program MR. BAYES v. 3.1.2 (Ronquist & Huelsenbeck our working hypothesis the results obtained from the 2003). Here, we used an alternative analytical strategy by parameter set that yielded the lowest ILD value. Sensitivity setting the GTR model for all data sets partitions using the analysis for most clades on this topology was conducted alignment obtained with MAFFT, both in the analyses of using CLADESCAN (ver. 1.0, Sanders 2010). All tree searches the individual genes and the concatenated data set, leaving under DO and IP rediagnoses were performed on a the inference program to estimate the best values for all 40 9 2.83GHz Q9550 Intel CoreTM2 Quad CPU clus- parameters and hence the model of evolution. For the con- ter at Department Zoology – IB, University of S~ao Paulo. catenated data set, we established a single partition scheme, by gene and by positions within the coding genes (COI Static homology under maximum likelihood (ML). We also and EF), separating the two-first codon positions from the performed phylogenetic analyses using ML as the optimal- third ones (equivalent to model 11 in Table S2). Gamma ity criterion within the context of static homology. To do distribution was estimated for the ribosomal genes, and in this, we used the implied alignment generated by the the protein-coding genes, the partition by positions was selected parameter set based on the ILD value of the previ- considered enough to account for positional variations of ous analysis. With this alignment, we defined 11 different rates, and hence, the gamma function was not imple- partition sets for COI, EF-1a, 18S and 28S under the mented. All parameters were unlinked. Bayesian analyses expectation of incorporating heterogeneity in evolutionary were made for 5 million generations, sampling every 1000 rates among sites (Table S2). Model-based methods of trees, using two independent runs with four chains each phylogenetic inference require the choice of substitution and the default priors implemented in the program [Rev- models, which could be selected in a statistically rigorous mat = dirichlet (1.00, 1.00, 1.00, 1.00, 1.00, 1.00); statef- manner (Ripplinger & Sullivan 2008). Thus, for each indi- req = dirichlet (1.00, 1.00, 1.00, 1.00); shape = uniform vidual partition (Table S2), we selected the best-fitting (0.00, 200.00); pinvar = uniform (0.00, 1.00); topology = all model based on the corrected Akaike information criterion topologies equally probable a priori (uniform); (AICc) selection criteria (Posada & Buckley 2004) using Brlens = unconstrained: exponential (10.0)]. To check that Gmodeltest.pl (PERL script that calculates AICc based on both runs have converged, the congruence of the topolo- the GARLI ver. 2.0 (Zwickl 2006) runs available upon gies and model parameters of both runs were surveyed by request). Model selection considered 11 substitution checking that the standard deviation of the split frequencies schemes, equal and unequal base frequencies, proportions reached a value below 0.01 (default burnin = 25%). To of invariable sites and four categories of variable rates, avoid using the parameters and trees analysed before reach- resulting in the evaluation of a total of 88 substitution ing convergence, 30% of the saved trees were discarded as models. We performed tree searches under each partition burn-in. model/substitution model combination using the parallel implementation of GARLI (ver. 2.0; Zwickl 2006–2011). For Results each partition model and selected substitution model, we Individual gene performance conducted a total of 100 independent search replicates Our molecular data comprised 688 base pairs (bp) for COI, (search reps = 10 in 10 CPUs), using different subset rates 614 bp for EF-1a, 1312 bp for 28S and 1379 bp for 18S. (link models = 0 and subset specific rates = 1), and remain- The ATPase-alpha gene was ruled out as it presented many ing default parameters of the GARLI configuration file. Fol- amplification problems, although the primers used were lowing each run, we compiled the AICc for each partition designed specifically for land planarians, and the few model/substitution model and used the best AICc value to sequences obtained were found to be relatively conserved. select our working hypothesis based on the ML optimality The independent phylogenetic analyses of the four genes

ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 513 Systematics of Geoplaninae  F. Carbayo et al.

Table 3 Tree length and incongruence length difference (ILD) the 3d codon positions, notably for the COI gene, the esti- values for nine alignment parameter sets considered throughout mations were clearly anomalous. The difficulty of the the analyses methods to approach the correct parameter values for this partition could be a consequence of 3d codon positions Parameter set Total COI EF LSU SSU ILD being extremely saturated for this data set as shown in the 2:1:1:1 11 678 3440 1775 3747 1998 0.061483131 saturation analyses (Fig. S1), which could also explain the 2:1:1:2 17 770 4424 2848 6257 3215 0.05773776 inability of this gene to recover most clades (Table S3). 2:1:2:1 18 202 5749 2387 5666 3135 0.069497857 The trees resulting from our three phylogenetic analyses 2:4:1:1 13 035 3420 1778 4569 2411 0.065746068 2:2:1:2 20 473 4457 2853 7807 4014 0.065549748 on the concatenated data set, MP, ML and BI are shown 2:2:2:1 20 954 5804 2393 7276 3941 0.073494321 in Fig. 3 (ML including the sensitivity plot under different 2:2:1:1 15 604 3428 1784 6064 3170 0.074211741 parameter values and support under different method- 2:4:1:2 25 441 4503 2869 10 579 5411 0.081718486 ologies) and Fig. S2 (MP, BI). In general, tree topologies 2:4:1:2 26 119 5886 2404 10 153 5386 0.087675638 are quite similar. Most of the clades that were stable throughout the parameter space of the parsimony analysis were also recovered by the ML and BI analyses. The estimated by BI gave similar tree topologies (not shown). disagreement among sister-group relationships suggested Table S3 shows whether each gene was able to recover the by distinct optimality criteria resides mainly in the nodes monophyletic groups that were consistently inferred that were either found only in the tree selected by the ILD throughout all the analyses of the concatenated data set. value (i.e. parameter set 2:1:1:2) in the parsimony analyses The posterior probability values (PPV) for the mono- or enjoyed low bootstrap or PPV in the ML and BI analy- phyletic groups are also shown on Table S3. The level of ses. Most of these nodes were earlier splits in the phylog- resolution displayed by the four genes is very different, eny. Thus, in essence, analytical procedures agree that our with 28S being the gene that recovers more supported data provide low support for those deeper nodes. nodes, while COI is unable to recover most of the clades. The taxonomic representation of our analysis allowed us to test the monophyly of seven of the 15 genera included, Analyses with concatenated genes as they were represented by at least two nominal species After phylogenetic analysis under dynamic homology (i.e. (e.g. Cephaloflexa [3 spp.], Choeradoplana [5 spp], Geoplana POY) using parsimony as optimality criterion, character con- [26 spp.], Issoca [3 spp.], Luteostriata [9 spp.], Notogynaphallia gruence as inferred by ILD values suggested that the [5 spp.] and Pasipha [8 spp.]). Among these, only members parameter set in which we applied relative costs of 2:1:1:2 of Cephaloflexa nested in a single clade regardless of align- for opening gaps, extension gaps, transversions and transi- ment parameters and/or optimality criteria. This genus, tions, respectively, minimized homoplasy among data sets along with genus Choeradoplana, forms a clade to which we (Table 3). The implied alignment generated by IP algo- will refer to as CEC, only recovered in ML and BI analy- rithm rendered 4143 aligned positions from concatenated ses. The remaining genera resulted in either paraphyletic partitions (1-682 for COI, 683-1294 for EF-1a, 1295-2702 or polyphyletic assemblages. The position of Notogynaphal- for 28S and 2703-4143 for 18S). The results of model/par- lia albonigra within Notogynaphallia is undermined, because tition selection with GARLI analyses on this alignment this species belongs to the monophyletic Choeradoplana. suggested partition model 7 (i.e. [COI 1st+2nd+3rd][(EF- This clade was recovered by ML and BI analyses and eight 1a 1st+2nd)(EF-1a 3rd)][18S][28S]) should be selected of nine alignment parameters of MP analysis. In addition, based on the AICc criterion (Table S2). On the other the position of N. albonigra also resulted in the polyphyly hand, the parameters for the evolutionary models estimated of Notogynaphallia. All other members of Notogynaphallia in the BI analysis under the GTR model and for each par- (i.e. N. sextriata, N. plumbea and N. parca, clade NOT) tition were heterogeneous among gene partitions as nested in a clade, which was recovered by ML, BI and MP, expected (in Table S4 substitution rates are shown). For including all alignment parameter sets. Issoca and Luteostri-

Fig. 3 Phylogenetic tree inferred from the concatenated data set by maximum likelihood (ML). Squares at nodes indicate the presence and/ or level of support of the node under the different parameter schemes as sketched in the legend; black indicates maximum support. Symbols over the nodes denote  95% bootstrap support obtained in the ML (bluish triangles) and maximum posterior probability values (1) in Bayesian inference analyses (orangish circles). Numbers following species names refer to the accession numbers of the specimens deposited in the section Platyhelminthes of the MZUSP (MZUSP PL). The notation p indicates the species pictured on the right side (pictures not to scale). Scale bar is given in number of substitutions per site.

514 ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 F. Carbayo et al.  Systematics of Geoplaninae

ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 515 Systematics of Geoplaninae  F. Carbayo et al. ata also resulted as non-monophyletic genera throughout to try to avoid homoplasy in genetic data reducing the sys- the analyses. However, members of these two genera seem tematic error (Nylander et al. 2004; Brandley et al. 2009), to be phylogenetically related among themselves with the there are still nodes lacking statistical support, mainly in inclusion of Supramontana irritata (clade LIS). Except by the internal branches linking the major supported clades. the phylogenetic position of Pasipha trina, which resulted Thus, the genes selected for this study seem not to be ade- in clade PEX [(Pasipha trina + Enterosyringa pseudorhynch- quate markers for revealing ancient relationships within odemus) Xerapoa hystrix] – recovered by ML, BI and seven this group. Nonetheless, they revealed a good number of of the nine alignment parameter sets used in MP analyses, well-supported clades and the polyphyly of diverse genera the remaining species of Pasipha formed a stable clade that can be sustained with morphological data. (clade PAS). Finally, the phylogenetic position of members of Geoplana, as expected, rendered the genus polyphyletic. Morphological congruence with molecular results I: Nonetheless, we recovered consistent clades among its polyphyly of Geoplana, Notogynaphallia and Pasipha members. The clade comprised by G. ladislavii, G. ladislavii Despite clade instability of some internal nodes in our sensu Froehlich, 1959 (morphology- and molecular-based results (Fig. 3 and Fig. S2), many clades were prevalent preliminary results do not support conspecificity with throughout the parameter space and insensitive to optimal- G. ladislavii von Graff, 1899), G. josefi, G. carinata, G. bur- ity criteria. Of the clades that were recovered throughout meisteri and Geoplana sp. 6, hereafter referred to as clade the analyses, many are comprised of lineages that share BUR, was recovered throughout the analyses. Other spe- morphological attributes and form morphologically cohesive cies of Geoplana (i.e. G. hina, G. crioula, G. tamoia, G. pseu- clades that we will discuss. On the other hand, some genera, dovaginuloides and some undescribed species – Geoplana sp. Geoplana, Notogynaphallia and Pasipha, are polyphyletic in 1, 2, 4, 5 and Geoplaninae 1) nested as a clade (clade PSE) the trees. Their members are located in less inclusive, but in the BI and ML analyses and five of the nine alignment mostly morphologically congruent clades. Most species of parameter sets used in MP analyses – sister to clade BUR. Geoplana are distributed across six morphologically congru- In addition, all members of clades BUR and PSE resulted ent clades, that is, clades GEO, BUR, PSE, TUX, MUL in a monophyletic group throughout the analyses. Other and GOE, the latter also including a species of Notogyna- clades involving species of Geoplana, associated or not with phallia. In clade GEO, there are three species, G. chita, terminals attributed to different genera, were consistently Pseudogeoplana pulchella and two individuals of G. vaginulo- recovered. That includes clade TUX (G. matuta and ides, the type species of the genus. These two individuals are G. tuxaua), clade GOE (G. goetschi sensu Marcus (1951) similar in dorsal colour patterns to specimens studied by and Notogynaphallia guaiana), clade GEO (G. vaginuloides, Marcus (1951), but they differ slightly from each other by G. chita and Pseudogeoplana pulchella) and finally clade MUL the width and colour of the dorsal longitudinal stripes. The (G. rubidolineata and G. multicolor), which resulted as sister specimen MZUSP PL 1009 shows a median ochre orang- of G. franciscana in the ML analyses. ish–coloured stripe and the lateral black stripes with con- spicuous clear spots, whereas the specimen MZUSP PL 666 Discussion presents a narrower, reddish median stripe, and the clear Phylogenetic informativeness of the genes studied spots on the lateral stripes are less conspicuous. The two The phylogenetic information content of the four genes is specimens did not nest in the same clade in the molecular very heterogeneous (Table S3) as shown by the fact that trees, consequently undermining the reciprocal monophyly some genes recover less monophyletic groups, although of the species. Riester (1938), Marcus (1951, 1952) and those recovered are mostly congruent. The 28S ribosomal Froehlich (1956a, 1958) reported up to eight different dor- gene is the one that retrieved the maximum number of sal colour patterns for G. vaginuloides. The conspecificity of monophyletic clades recovered through the analyses of the specimens under G. vaginuloides with Darwin’s species will concatenated data set, while the mitochondrial COI gene is remain an open question until worms with the same dorsal unable to recover most of them. Also 3rd codon position colour pattern, and preferably from the type locality, near saturation could be responsible for the lower resolution to Rio de Janeiro, are examined. obtained with COI (Fig. S1). The concatenated data set Both G. vaginuloides and G. chita are very similar in gen- shows, as expected, a more resolved phylogeny because the eral morphology. The two species also possess a muscular molecular markers used provide information that may be tube around the intestine, although it was explicitly absent affecting different levels of the tree (either basal nodes or in the diagnosis of the Geoplaninae. The tube is composed less inclusive clades) (Huelsenbeck et al. 1996; Soltis et al. of parenchymatic longitudinal single fibres, interwoven with 1999; Baldauf et al. 2000). Despite all the efforts invested muscle fibres of the supra and subintestinal parenchymatic in the analyses, including the use of partitions as a strategy muscular layers, a characteristic previously reported for

516 ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 F. Carbayo et al.  Systematics of Geoplaninae

G. vaginuloides (Grau 2010). Pseudogeoplana pulchella,upto pers. obs.). Regarding the two genus assemblage of clade the present only known through its external aspect, shares GOE, Geoplana and Notogynaphallia, it should be noted that with G. vaginuloides and G. chita all features cited above for the generic diagnosis differs in only one feature, which is the clade (F. Carbayo, pers. obs.; see also the section Taxo- the presence of a penis papilla in Geoplana, and its absence nomic Actions). in Notogynaphallia. Although in some specimens of G. goet- The species in clade BUR (G. ladislavii, G. josefi, G. bur- schi, the penis papilla is a large and conspicuous organ, it is meisteri, G. carinata, G. ladislavii sensu Froehlich 1959 and not a permanent structure. The non-permanent nature of Geoplana sp. 6) share a similar morphology (see the section the penis papilla has lead authors to remove this species Taxonomic Actions) with those in clade PSE (G. tamoia, from Geoplana (diagnostically, species with penis papilla) G. pseudovaginuloides, G. crioula, G. hina, the undescribed into Notogynaphallia (Ogren & Kawakatsu 1990) (diagnosti- Geoplana sp. 1, 2, 4 and 5 and the unknown Geoplaninae cally, species without penis papilla) and back to Geoplana 1), its sister clade. The main differences between members (Leal-Zanchet & Carbayo 2001). of these clades reside in that species in BUR possess a The remaining species of Notogynaphallia studied herein number of trilobulated eyes in addition to the one-cup are distributed into two groups, clade NOT (N. plumbea, eyes, whereas in members of PSE, the eyes are only of N. parca, N. sexstriata), which includes the type species of one-cup type. In addition, the sensory pits of members of the genus N. plumbea and clade CEC (N. albonigra). The BUR are arranged in several rows on each side of the body species within NOT are very similar to each other; the (F. Carbayo, pers. obs.), whereas in members of PSE, the most distinctive feature of the clade is an intrabulbar, pros- pits are arranged in a single row. Differing from BUR spe- tatic vesicle broadly communicates with the male atrium; cies, most of those within PSE have smaller body size, and and the course of the ovovitelline ducts (ascending lateral the terminal portion of the ejaculatory duct in some species to posterior region of the female atrium and joined with opens to a distal cavity of the penis papilla. Unfortunately, each other behind it; see also the section Taxonomic very little can be said about the specimen Geoplaninae 1 Actions). Notogynaphallia albonigra possesses all diagnostic since it is immature; thus, the identification or description features of Choeradoplana (F. Carbayo, pers. obs.). Species of the species is pending on the study of additional, mature of Pasipha are distributed into two clades, PAS and PEX. conspecifics. Clade PAS (Pasipha pasipha, P. chimbeva, P. tapetilla, P. ro- The species within clade TUX (G. tuxaua and G. matuta) sea, P. pinima, Pasipha sp. 1 and sp. 2) includes the type have a distinct intrabulbar prostatic vesicle broadly commu- species, P. pasipha. In addition to sharing external and nicates with an ejaculatory cavity inside an apparent penis internal morphological structures, a distinctive feature pres- papilla. Although the species within clade MUL (G. multi- ent in most species within the clade is an extrabulbar pros- color, G. rubidolineata) also constitute a morphologically tatic vesicle, differentiated by means of the secretions it homogeneous group (see the section Taxonomic Actions), receives (frequently also by means of its shape, divided into the clade can be only diagnosed by a combination of non- an anterior, dilated portion and a narrow, posterior por- exclusive features. A comparative examination of the ultra- tion). Pasipha trina nested into another clade (PEX), which structure of the epithelium with multilayered aspect lining is heterogeneous in generic composition (Pasipha trina, the female atrium might reveal that this type of epithelium Enterosyringa pseudorhynchodemus and Xerapoa hystrix). How- takes various forms among geoplaninids (Carbayo & Leal- ever, species within this clade share many morphological Zanchet 2003; Grau & Carbayo 2011). Geoplana franciscana similarities, among them, it is worth highlighting a very resulted as the sister group of clade MUL only in the ML small body size, the thin creeping sole and rear position of tree, and it also has the morphological characteristics of the the ovaries along the body. specimens in this clade. The only two species that constitute clade GOE belong to different genera (Geoplana goetschi Morphological congruence with molecular results II: new sensu Marcus (1951) and Notogynaphallia guaiana). Contrary clades to most geoplaninid species, these two species have addi- Clade CEC includes species of Choeradoplana, Cephaloflexa tional parenchymatic muscle layers comprised of longitudi- and N. albonigra. The classification of Notogynaphallia alboni- nal bundles of muscle fibres, dorsally as well as ventrally to gra has been already discussed above. This clade also the intestine (F. Carbayo, pers. obs.). This feature clearly includes the type species of the two genera, that is, Ch. iher- distinguishes specimens of G. goetschi sensu Marcus (1951) ingi and Ce. bergi. Each genus is well diagnosed by puta- from the sympatric specimens of G. goetschi sensu Riester tively derived features (see Carbayo & Leal-Zanchet 2003; (1938) that we have sampled in the type locality for this Carbayo & Froehlich 2012), and some of the features are study. Moreover, Riester’s-type material does not possess also shared by members of Choeradoplana and Cephaloflexa, these features, whereas Marcus’ specimens do (F. Carbayo, providing support to clade CEC. These morphological

ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 517 Systematics of Geoplaninae  F. Carbayo et al. attributes include cephalic end curved backwards, lack of Species of unclear phylogenetic relationships eyes and sensory pits at the apex, cephalic retractor muscle Five species (Geoplana quagga + G. goetschi; Geoplana sp. 3; fibres running along sagittal planes and subneural paren- G. phocaica; and Geobia subterranea) are dispersed across the chymal muscle layer only present in the cephalic region. phylogenetic trees, either isolated or constituting a The latter feature is also present in the Colombian geop- two-species clade. Among these species, only laninid Gigantea maupoi Carbayo 2008. It is likely a conver- G. quagga + G. goetschi always constitute a clade, but they gent character because the species is morphologically are notably different from each other both in their external highly divergent from those of clade CEC. In any case, we and internal features, and Geoplana phocaica matches the fea- cannot corroborate this as we have no sequences of this tures of species of clade MUL. The remaining two species species. Choeradoplana iheringi, here represented by speci- do not show morphological homogeneity with any of their mens MZUSP PL 533 and MZUSP PL 540, resulted para- sister groups. These five species show diverse sister-group phyletic. The former specimen has a similar copulatory relationships depending on the parameters and methods apparatus to Ch. iheringi, whereas the copulatory apparatus used in the inferences and are placed in relatively deep of the specimen MZUSP PL 540 is similar to ‘EMF 648’, nodes, which unfortunately could not be resolved with the a specimen studied and identified by Leal-Zanchet & Souza genes used here. (2003) as conspecific with Ch. iheringi. These differences in Concluding remarks over 50 years ago, a number of the morphology of the copulatory apparatuses have been species of Geoplana sensu Froehlich (1955a) were tenta- related to populational variation (Leal-Zanchet & Souza tively gathered into ‘probably natural groups’ (Froehlich 2003), but after our results, we would consider them as 1955a). An initial grouping, based on the external and specific diagnostic features, that is, they likely are not con- internal characters, was firstly proposed for the majority specific. The study of further specimens from different of the well-described Brazilian species (Froehlich 1955a). areas may disentangle this taxonomic problem. Later on, more species were proposed and included into All species in clade LIS (species of Luteostriata, Issoca the groups (Froehlich 1956a), and finally, species from and Supramontana) share a set of morphological features. across the Neotropics were also considered (Froehlich That includes the fibres of the cephalic retractor muscle 1967) (Table S5). The groups they proposed match, in (derived from the longitudinal cutaneous ventral muscula- part, some clades of our results (i.e. GEO, BUR, TUX, ture) anteriorly dissipate by detaching its muscle fibres in NOT, PAS, LIS). Froehlich and E. M. Froehlich a fan-like fashion; and a subneural parenchymal transverse avoided proposing formal taxa because ‘most groups pass muscle layer throughout the entire body. Each genus is gradually to others or show only minor differences also well delimited by details of the cephalic shape and between them’ (Froehlich 1967). Our results have inde- the organization muscle fibres in the head [see Table 3 pendently revealed a number of phylogenetically informa- in Carbayo (2010)]. Strikingly, our results indicate that tive morphological characters that provide good support Issoca is polyphyletic, whereas Luteostriata is paraphyletic, for a systematic review of the species of Geoplaninae even though the species analysed present all diagnostic provided here. features of the respective genus. Luteostriata graffi also The molecular approach has also been suitable for evalu- resulted as a paraphyletic taxon. A thorough taxonomic ating specific diagnostic features, which otherwise would revision of the species for these three genera would be simply have been interpreted as intraspecific variation. necessary. Thus, the inclusion of molecular data is a highly valuable The sister-group relationship between clade CHL tool for unveiling cryptic species of land flatworms. (Gusana sp. 1 + Polycladus sp. 1), from Chile, and the There is still much work to be done to better understand remaining species of Geoplaninae clearly indicates that the evolution of the geoplaninid planarians. The genes there was an early split between this clade and the species COI, 18S and 28S rDNA, and EF-1a revealed phylo- that diversified in Brazil. The species of clade CHL are genetic patterns congruent with morphologically homoge- morphologically rather different from each other in exter- neous groups, but failed to identify ancient nodes. Future nal and internal features. This morphological heterogeneity studies will need to scrutinize the type material, and taxon should not be interpreted as an artefact in our analysis, but and gene sampling across land planarian lineages in the rather a consequence of the poor species representation of Neotropics. That is especially true for genera such as Chilean fauna in our trees. Indeed, the only 26 species of Amaga, Gigantea, Liana for which very little is known and Geoplaninae known from Chile belong to seven genera, from still undiscovered species. By doing so, it is hoped with three of them endemic. Furthermore, scattered sam- that we will be able to disentangle most basal nodes of the plings suggest the existence of a high diversity of unknown phylogeny and discover the diversification processes under- species (Grau & Carbayo 2010). gone by these vagile worms.

518 ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 F. Carbayo et al.  Systematics of Geoplaninae

Taxonomic actions Geoplana pulchella Schultze & Muller,€ 1857 According to the molecular phylogeny and current classifi- cation of Geoplaninae, here, we (i) divide Geoplana into six Species not of Geoplana. genera – Barreirana (currently a subgenus within Geoplana); Geoplana apeva Froehlich, 1959 Cratera gen. n., clade PSE; Imbira gen. n., clade GOE; see under Obama Matuxia gen. n., clade TUX; Obama gen. n., clade BUR; Geoplana argus von Graff, 1899 Paraba gen. n., most of species within clade MUL – (ii) see under Obama emend the diagnoses of five taxa namely Barreirana, Geo- Geoplana arpi Schirch, 1929 plana, Notogynaphallia, Pasipha and Xerapoa and (iii) review see under Pseudogeoplana the classification of the species placed in these genera by Geoplana assu Froehlich, 1959 means of morphological observations (see Discussion) and see under Obama data available in the literature. We considered incertae sedis Geoplana baptistae Leal-Zanchet & Oliveira, 2012 those species morphologically poorly known or those that see under Obama possess a combination of features incongruent with the Geoplana barreirana Riester, 1938 characters listed in the diagnoses of their genera. Nominal see under Barreirana species included as terminals in the present study are Geoplana blaseri Schirch, 1929 marked with *. see under Pseudogeoplana Geoplana braunsi von Graff, 1899 Order Tricladida Lang, 1884 see under Obama Suborder Continenticola Carranza, Littlewood, Clough, Geoplana bresslaui Schirch, 1929 Ruiz-Trillo, Bagun~a & Riutort, 1998 see under Pseudogeoplana Family Geoplanidae Stimpson, 1857 Geoplana burmeisteri Schultze & Muller,€ 1857* Subfamily Geoplaninae Stimpson, 1857 see under Obama Genus Geoplana Stimpson, 1857 Geoplana cafusa Froehlich, 1956 see under Pasipha Geoplana carbayoi Oliveira & Leal-Zanchet, 2012 Emended diagnosis. Geoplaninae with medium-sized see under Obama body, 30–100 mm in length; body slender, with nearly Geoplana carinata Riester, 1938* parallel margins; dorsum strongly convex; eyes monolobu- see under Obama lated, cone shaped in the anterior region of the body; Geoplana carrierei von Graff, 1897 muscle tube around the intestine composed of parenchy- see under Obama matic longitudinal muscle fibres; pharynx cylindrical; pros- Geoplana cassula Froehlich, 1955 tatic vesicle intrabulbar, narrow; thick well-delimited male see under Paraba genital muscle coat and; penis papilla protrusible, cylindri- Geoplana catharina Hyman, 1957 cal, very long, extending even along the entire female see under Obama genital atrium; muscle fibres of penis papilla and ejacula- Geoplana crioula E. M. Froehlich, 1955* tory duct densely packed in a thick layer; male atrium not see under Cratera folded; ascending portion of the ovovitelline ducts lateral Geoplana dictyotona Riester, 1938 to female atrium, joining each other above it; genital see under Obama canal dorso-anteriorly flexed, arising from the posterior Geoplana divae Marcus, 1951 region of the female atrium; female atrium long, not see under Obama folded. Geoplana elegans (Darwin, 1844) see under Pseudogeoplana Distribution. States of Rio de Janeiro, S~ao Paulo, Pa- Geoplana eudoxiae Ogren & Kawakatsu 1990 rana and Santa Catarina, in Brazil. see under Obama Geoplana eudoximariae Ogren & Kawakatsu, 1990 Type species. Planaria vaginuloides Darwin, 1844, desig- see under Obama nated by Froehlich (1955b). Geoplana evelinae Marcus, 1951 see under Obama Species of Geoplana. Geoplana ferussaci von Graff, 1897 Geoplana vaginuloides (Darwin, 1844) see under Obama Geoplana chita Froehlich, 1956b

ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 519 Systematics of Geoplaninae  F. Carbayo et al.

Geoplana ficki Amaral & Leal-Zanchet, 2012 (in Geoplana rufiventris Schultze & Muller,€ 1857 Amaral et al., 2012) see under Obama see under Obama Geoplana ruiva E. M. Froehlich, 1972 Geoplana franciscana Leal-Zanchet & Carbayo, 2001* see under Obama see under Paraba Geoplana schubarti Froehlich, 1958 Geoplana fryi von Graff, 1899 see under Obama see under Obama Geoplana sp. 1* Geoplana gaucha Froehlich, 1959 see under Cratera see under Paraba Geoplana sp. 2* Geoplana glieschi Froehlich, 1959 see under Cratera see under Obama Geoplana sp. 4* Geoplana goetschi sensu Marcus, 1951* see under Cratera see under Imbira Geoplana sp. 5* Geoplana goettei Schirch, 1929 see under Cratera see under Paraba Geoplana sp. 6* Geoplana incognita Riester, 1938 see under Obama see under Paraba Geoplana suva Froehlich, 1959 Geoplana itatiayana Schirch, 1929 see under Paraba see under Obama Geoplana tamoia E. M. Froehlich, 1955b Geoplana joia Froehlich, 1956b see under Cratera see under Cratera Geoplana tapira Froehlich, 1958 Geoplana josefi Carbayo & Leal-Zanchet, 2000* see under Paraba see under Obama Geoplana tingauna Kishimoto & Carbayo, 2012 Geoplana ladislavii von Graff, 1899* (in Almeida et al., 2012) see under Obama see under Paraba Geoplana ladislavii sensu Froehlich, 1959* Geoplana trigueira E. M. Froehlich, 1955b see under Obama see under Obama Geoplana livia E. M. Froehlich, 1955b Geoplana yara E. M. Froehlich, 1955b see under Obama see under Cratera Geoplana marmorata Schultze & Muller,€ 1857 Geoplana zebroides Riester, 1938 see under Obama see under Barreirana Geoplana metzi von Graff, 1899 see under Obama Species of Geoplana incertae sedis. Geoplana multicolor von Graff, 1899* Geoplana alterfusca Hyman, 1962 see under Paraba Geoplana aymara du Bois-Reymond Marcus, 1951 Geoplana phocaica Marcus, 1951* Geoplana beckeri Froehlich, 1959 see under Paraba Geoplana bimbergi Fuhrmann, 1914 Geoplana piriana Almeida & Carbayo, 2012 Geoplana caleta E. M. Froehlich 1978 (in Almeida et al., 2012) Geoplana caucaensis Fuhrmann, 1914 see under Paraba Geoplana caya du Bois-Reymond Marcus, 1951 Geoplana poca Froehlich, 1958 Geoplana chalona du Bois-Reymond Marcus, 1951 see under Obama Geoplana chanca E. M. Froehlich, 1978 Geoplana polyophthalma von Graff, 1899 Geoplana chilihua du Bois-Reymond Marcus, 1951 see under Obama Geoplana chiuna E. M. Froehlich, 1955b Geoplana preta Riester, 1938 Geoplana chulpa du Bois-Reymond Marcus, 1951 see under Paraba Geoplana crawfordi de Beauchamp, 1939 Geoplana pseudovaginuloides Riester, 1938 Geoplana excellentissima Negrete, Brusa & Damborenea, see under Cratera 2012 Geoplana riesteri Froehlich, 1955c Geoplana fragai Froehlich, 1955b see under Obama Geoplana fuhrmanni Hyman, 1962 Geoplana rubidolineata Baptista & Leal-Zanchet, 2005* Geoplana gabriellae du Bois-Reymond Marcus, 1951 see under Paraba Geoplana goetschi Riester, 1938

520 ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 F. Carbayo et al.  Systematics of Geoplaninae

Geoplana guacensis Fuhrmann, 1914 Barreirana barreirana (Riester, 1938) comb. n. Geoplana hina Marcus, 1951 Barreirana zebroides (Riester, 1938) comb. n. Geoplana irua Fuhrmann, 1914 fl Geoplana jandira Froehlich, 1955c Genus Cephalo exa Carbayo & Leal-Zanchet, 2003 fl Geoplana lama du Bois-Reymond Marcus, 1957 Cephalo exa nataliae (Froehlich, 1959) comb. n. Geoplana lambaya du Bois-Reymond Marcus, 1958 Genus Cratera gen. n Geoplana lareta du Bois-Reymond Marcus, 1958 Etymology. The name Cratera is derived from the Latin Geoplana mayori Fuhrmann, 1914 word crater. It alludes to the cavity in the penis papilla Geoplana mirim E. M. Froehlich, 1972 resembling the depression in the mouth of a volcano. The Geoplana mixopulla Ogren & Kawakatsu, 1990 gender is female. Geoplana multipunctata Fuhrmann, 1914 Geoplana pavani Marcus, 1951 Diagnosis. Geoplaninae with medium-sized body, 30–70 Geoplana pichuna du Bois-Reymond Marcus, 1951 in length; body broad, flattened, slightly leaf-shaped; eyes Geoplana picta Froehlich, 1956a monolobulated; pharynx cylindrical to bell-shaped; prostatic Geoplana placilla E. M. Froehlich, 1978 vesicle extrabulbar; penis papilla protrusible, having distally Geoplana quagga Marcus, 1951 a cavity continued from the ejaculatory duct; male atrium Geoplana quenua du Bois-Reymond Marcus, 1958 not folded, generally not separated from the female one; Geoplana quichua Marcus, 1951 ascending portion of the ovovitelline ducts anterior or lat- Geoplana regia E. M. Froehlich, 1955b eral to the female atrium and joining each other above it; Geoplana saima du Bois-Reymond Marcus, 1951 genital canal dorso-anteriorly flexed, arising from the pos- Geoplana shapra du Bois-Reymond Marcus, 1957 tero-dorsal or posterior region of the female atrium; female * Geoplana sp. 2 atrium funnel-shaped. Geoplana sp. 3* Geoplana takia du Bois-Reymond Marcus, 1951 Distribution. States of Rio de Janeiro, S~ao Paulo, south- Geoplana talpa du Bois-Reymond Marcus, 1951 east Brazil. Geoplana tamboensis Fuhrmann, 1914 Geoplana tirua E. M. Froehlich, 1978 Type species. Geoplana pseudovaginuloides Riester, 1938 Geoplana toriba Froehlich, 1958 Geoplana ubaquensis Fuhrmann, 1914 Species of Cratera. * Geoplana valdiviana Grau & Carbayo, 2010 Cratera crioula (E. M. Froehlich, 1955b) comb. n. Geoplana vicuna du Bois-Reymond Marcus, 1957 Cratera joia (Froehlich, 1956b) comb. n. Cratera pseudovaginuloides (Riester, 1938)* comb. n. * Genus Barreirana Ogren & Kawakatsu, 1990 Cratera sp. 1 * Emended diagnosis. Geoplaninae with small-sized body, Cratera sp. 4 * 8–22 mm in length, body subcylindrical, slender with nearly Cratera sp. 5 * parallel margins; dorsal colour pattern with transverse bands; Cratera tamoia (E. M. Froehlich, 1955b) comb. n. eyes monolobulated, distributed on nearly all dorsum; phar- Cratera yara (E. M. Froehlich, 1955b) comb. n. ynx cylindrical; prostatic vesicle intrabulbar, narrow; penis Genus Choeradoplana Graff, 1896 papilla protrusible, large conical, nearly horizontal; male Choeradoplana albonigra (Riester, 1938)* comb. n. atrium not folded; ascending portion of the ovovitelline ducts lateral to the gonopore canal or to the female atrium, Genus Enterosyringa Ogren & Kawakatsu, 1990 joining each other above female atrium; genital canal dorso- Enterosyringa pseudorhynchodemus (Riester, 1938)* fl anteriorly exed, arising from the postero-dorsal region of See under Xerapoa Froehlich, 1955a the female atrium; female atrium small, funnel-shaped. Genus Imbira, gen. n Distribution. States of Rio de Janeiro, S~ao Paulo, in Etymology. In Tupi (Indigenous Brazilian language), Brazil. Imbira is a strip of bark peeled off from certain trees; it alludes to the body shape of the species of the genus. The Type species. Geoplana barreirana Riester, 1938; desig- gender is female. nated by Ogren & Kawakatsu (1990) Diagnosis. Geoplaninae with large-sized body, 90– Species of Barreirana. 140 mm in length, body slender, flattened, with margins

ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 521 Systematics of Geoplaninae  F. Carbayo et al. parallel; eyes monolobulated, marginally arranged along the Distribution. States of Rio de Janeiro and S~ao Paulo, in body; parenchymatic muscle layers of longitudinal fibres, Brazil. dorsally and ventrally to the intestine, in addition to the three common parenchymatic muscle layers; prostatic vesi- Type species. Geoplana tuxaua E. M. Froehlich, 1955b cle extrabulbar, long-branched; penis papilla eversible; male atrium folded; ascending portion of the ovovitelline ducts Species of Matuxia. lateral to the gonopore canal or to the female atrium and Matuxia tuxaua (E. M. Froehlich, 1955b)* joining each other above female atrium; genital canal Matuxia matuta (E. M. Froehlich, 1955b)* dorso-anteriorly flexed, arising from the postero-dorsal region of the female atrium; female atrium rounded, Genus Notogynaphallia Ogren & Kawakatsu, 1990 clothed with an epithelium with multilayered aspect. Emended diagnosis. Geoplaninae with small-to-medium- sized body, 16–70 mm in length; slender body, margins Distribution. States of Rio de Janeiro, S~ao Paulo, Pa- nearly parallel; dorsum and ventral side slightly convex; rana, Santa Catarina and Rio Grande do Sul, in Brazil. eyes monolobulated, marginally arranged along the body; pharynx cylindrical; prostatic vesicle intrabulbar, dilated, Type species. Notogynaphallia guaiana Leal-Zanchet & broadly communicated with the richly folded male atrium; Carbayo, 2001 penis papilla eversible; ascending portion of ovovitelline ducts lateral to posterior region of the female atrium and Species of Imbira. joining each other behind it; genital canal dorso-anteriorly Imbira guaiana (Leal-Zanchet & Carbayo, 2001)* flexed, arising from the posterior region of the female comb. n. atrium; female atrium irregular and narrow. Imbira marcusi Carbayo et al.*, nom. n. Geoplana goetschi sensu Marcus, 1951 Distribution. States of PB, Rio de Janeiro, S~ao Paulo, not Geoplana goetschi Riester, 1938 Parana, Rio Grande do Sul, in Brazil.

Genus Luteostriata Carbayo, 2010 Type species. Geoplana plumbea Froehlich, 1956, desig- Luteostriata arturi (Lemos & Leal-Zanchet, 2008) nated by Ogren & Kawakatsu, 1990 comb. n. Luteostriata pseudoceciliae (Lemos & Leal-Zanchet, Species of Notogynaphallia. 2008) comb. n. Notogynaphallia biseminalis (Riester, 1938) comb. n. Notogynaphallia froehlichae Ogren & Kawakatsu, 1990 Genus Matuxia gen. n Notogynaphallia modesta (von Graff, 1899) Etymology. Matuxia is a free association of the epithetic Notogynaphallia mourei (Froehlich, 1956b) names matuta and tuxaua and the first name of Dr. Notogynaphallia parca (E. M. Froehlich, 1955b)* Eudoxia Maria Froehlich, who described the two species of Notogynaphallia plumbea (Froehlich, 1959)* the new genus. The gender is female. Notogynaphallia sexstriata (von Graff, 1899)*

Diagnosis. Geoplaninae with medium-sized body, 45– Species not Notogynaphallia. 120 mm in length; body slender, margins nearly parallel, Notogynaphallia albonigra (Riester, 1938)* dorsum and ventral side slightly convex; eyes monolobulat- See under Choeradoplana Graff, 1896 ed, marginally arranged along the body; pharynx cylindri- Notogynaphallia arturi Lemos & Leal-Zanchet, 2008 cal; prostatic vesicle intrabulbar, bifurcated proximally and See under Luteostriata Carbayo, 2010 broadly communicated with an ejaculatory cavity inside Notogynaphallia matuta (E. M. Froehlich, 1955b)* penis papilla; penis papilla apparent, with dorsal insertion See under Matuxia gen. n. posterior to the ventral; male atrium not folded, separate Notogynaphallia nataliae (Froehlich, 1959) from the female by a fold; ascending portion of the ovovi- See under Cephaloflexa Carbayo & Leal-Zanchet, 2003 telline ducts lateral to the gonopore canal or to the female Notogynaphallia pseudoceciliae Lemos & Leal-Zanchet, atrium, joining each other above it; genital canal dorso- 2008 anteriorly flexed, arising from the dorsal region of the See under Luteostriata Carbayo, 2010 female atrium; female atrium rounded, clothed with an Notogynaphallia tuxaua (E. M. Froehlich, 1955b)* epithelium with multilayered aspect. See under Matuxia gen. n.

522 ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 F. Carbayo et al.  Systematics of Geoplaninae

Species of Notogynaphallia incertae sedis. Obama divae (Marcus, 1951) comb. n. Notogynaphallia garua (du Bois-Reymond Marcus, Obama eudoxiae (Ogren & Kawakatsu, 1990) comb. n. 1951) Obama eudoximariae (Ogren & Kawakatsu, 1990) Notogynaphallia quinquestriata (Hyman, 1962) comb. n. Notogynaphallia andina (Hyman, 1962) Obama evelinae (Marcus, 1951) comb. n. Notogynaphallia atra (Schultze & Muller,€ 1857) Obama ferussaci (von Graff, 1897) comb. n. Obama ficki (Amaral & Leal-Zanchet, 2012) comb. n. Genus Obama gen. n (in Amaral et al., 2012) Etymology. The name Obama is a composition of the Obama fryi (von Graff, 1899) comb. n. Tupi (Indigenous Brazilian language) words oba (meaning Obama glieschi (Froehlich, 1959) comb. n. leaf) and ma (animal). It alludes to the characteristically Obama itatiayana (Schirch, 1929) comb. n. flattened, leaf-shaped body of the species of the genus. The Obama josefi (Carbayo & Leal-Zanchet, 2001)* gender is female. Obama ladislavii (von Graff, 1899)* comb. n. Obama ladislavii (sensu Froehlich, 1959)* comb. n. Diagnosis. Geoplaninae with medium-sized to large Obama livia (E. M. Froehlich, 1955) comb. n. body, 30–300 mm in length; body broad, flattened, leaf- Obama marmorata (Schultze & Muller,€ 1857) comb. n. shaped; eyes mono- and trilobulated, dorsal; part of the Obama metzi (von Graff, 1899) comb. n. sensory pits arranged in 2–4 rows on each side of the body; Obama poca (Froehlich, 1958) comb. n. pharynx cylindrical or bell-shaped; prostatic vesicle extra- Obama polyophthalma (von Graff, 1899) comb. n. bulbar, short, curved and anteriorly branched; penis papilla Obama riesteri (Froehlich, 1955) comb. n. protrusible, conical, horizontal, occupying entire male Obama rufiventris (Schultze & Muller,€ 1857) comb. n. atrium, with dorsal insertion posterior to the ventral, some- Obama ruiva (E. M. Froehlich, 1972) comb. n. times laterally displaced; male atrium, not folded, generally Obama schubarti (Froehlich, 1958) comb. n. not separated from the female one; ascending portion of Obama sp. 6* the ovovitelline ducts lateral to the female atrium and join- Obama trigueira (E. M. Froehlich, 1955) comb. n. ing each other above it; genital canal dorso-anteriorly flexed, arising from the postero-dorsal or posterior region Genus Paraba gen. n of the female atrium; female atrium ample, long or funnel- Etymology. In Tupi (Indigenous Brazilian language), shaped. Paraba means multicoloured; it alludes to the multicoloured dorsum of the type species of the genus. The gender is Distribution. States of Amapa, Minas Gerais, Rio de female. Janeiro, S~ao Paulo, Parana, Santa Catarina, Rio Grande do Sul, in Brazil. Diagnosis. Geoplaninae with small-to-medium-sized body, 6–80 mm in length; body slender, with margins nearly Type species. Geoplana fryi von Graff, 1899 parallel; dorsum and ventral side slightly convex; eyes monolobulated; pharynx cylindrical; prostatic vesicle extra- Species of Obama. bulbar, generally horizontal; penis papilla protrusible, Obama apeva (Froehlich, 1959) comb. n. conical; male atrium not folded; ascending portion of Obama applanata (von Graff, 1899) comb. n. ovovitelline ducts lateral to the gonopore canal or to female Obama argus (von Graff, 1899) comb. n. atrium, joining each other above female atrium; genital canal Obama assu (Froehlich, 1959) comb. n. dorso-anteriorly flexed, arising from the postero-dorsal region Obama baptistae (Leal-Zanchet & Oliveira, 2012) of female atrium; female atrium female atrium rounded, comb. n. clothed with an epithelium with multilayered aspect. Obama braunsi (von Graff, 1899) comb. n. Obama burmeisteri (Schultze & Muller,€ 1857)* comb. Distribution. States of Rio de Janeiro, S~ao Paulo, Pa- n. rana, Santa Catarina and Rio Grande do Sul, in Brazil. Obama carbayoi (Oliveira & Leal-Zanchet, 2012) comb. n. Type species. Geoplana multicolor von Graff, 1899 Obama carinata (Riester, 1938)* comb. n. Obama carrierei (von Graff, 1897) comb. n. Species of Paraba. Obama catharina (Hyman, 1957) comb. n. Paraba caapora (Froehlich, 1958) comb. n. Obama dictyotona (Riester, 1938) comb. n. Paraba cassula (E. M. Froehlich, 1955) comb. n.

ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 523 Systematics of Geoplaninae  F. Carbayo et al.

Paraba franciscana (Leal-Zanchet & Carbayo, 2001)* Pasipha tapetilla (Marcus, 1951)* comb. n. Pasipha velutina (Riester, 1938) Paraba gaucha (Froehlich, 1959) comb. n. Paraba goettei (Schirch, 1929) comb. n. Species not of Pasipha. * Paraba incognita (Riester, 1938) comb. n. Pasipha trina (Marcus, 1951) Paraba multicolor (von Graff, 1899)* comb. n. see under Xerapoa Paraba phocaica (Marcus, 1951)* comb. n. Pasipha biseminalis (Riester, 1938) Paraba piriana (Almeida & Carbayo, 2012) comb. n. see under Notogynaphallia (in Almeida et al., 2012) Species of Pasipha incertae sedis. Paraba tingauna (Kishimoto & Carbayo, 2012) comb. Pasipha aphalla (Hyman, 1941) n. (in Almeida et al., 2012) Pasipha ercilla (E. M. Froehlich, 1978) Paraba preta (Riester, 1938) comb. n. Pasipha chilensis (von Graff, 1899) Paraba rubidolineata (Baptista & Leal-Zanchet, 2005)* Pasipha velina (E. M. Froehlich, 1955b) comb. n. Pasipha weyrauchi (du Bois-Reymond Marcus, 1951) Paraba suva (Froehlich, 1959) comb. n. Pasipha diminutiva (Hyman, 1955) Paraba tapira (Froehlich, 1958) comb. n. Genus Pseudogeoplana Ogren & Kawakatsu, 1990 Genus Pasipha Ogren & Kawakatsu, 1990 Pseudogeoplana arpi (Schirch, 1929) comb. n. Emended diagnosis. Geoplaninae with variously sized Pseudogeoplana blaseri (Schirch, 1929) comb. n. fl bodies; body slender, attened, with parallel margins; eyes Pseudogeoplana bresslaui (Schirch, 1929) comb. n. monolobulated; prostatic vesicle extrabulbar, differentiated, Pseudogeoplana elegans (Darwin, 1944) comb. n. by means of the secretions it receives and, frequently also by means of its shape, into an anterior, dilated portion and Genus Xerapoa Froehlich, 1955 a narrow, posterior portion; penis papilla eversible; ejacula- Emended diagnosis. Geoplaninae with small-sized body, tory duct opens directly into a richly folded, long male 15–30 mm in length; thin, subcylindrical body, margins atrium, usually separated from the female one by a dorsal nearly parallel; anterior region raised; sensory pits may open fold; ovovitelline ducts with ascending portion, if any, pos- at the tip of small papillae; eyes monolobulated, marginally terior to the female atrium, joining each other behind it; arranged along the body; creeping sole as wide as one-third genital canal ventrally flexed, arising from the posterior of body width; main nervous system two-chords shaped; region of the female atrium. pharynx cylindrical; ovaries close to the pharynx; ovovitel- line ducts with ascending portion, if any, posterior to female Distribution. States of PB, Minas Gerais, Rio de Janeiro, atrium and joining each other behind female atrium; genital S~ao Paulo, Santa Catarina, Rio Grande do Sul, in Brazil. canal horizontal, arising from the posterior region of female atrium; female atrium small, funnel-shaped. Type species. Geoplana pasipha Marcus, 1951; designated by Ogren & Kawakatsu (1990) Distribution. States of S~ao Paulo, Santa Catarina, in Brazil. Species of Pasipha. Pasipha astreae (Marcus, 1951) Type species. Xerapoa hystrix Froehlich, 1955, designated Pasipha caeruleonigra (Riester, 1938) by Froehlich (1955) Pasipha cafusa (Froehlich, 1956) Pasipha chimbeva (E.M. Froehlich 1955b)* Xerapoa species. Pasipha hauseri (Froehlich 1959) Xerapoa hystrix Froehlich, 1955a* Pasipha oliverioi (Froehlich 1955c) Xerapoa una Froehlich, 1955a Pasipha pasipha (Marcus, 1951)* Xerapoa pseudorhynchodemus (Riester, 1938)* comb. n. Pasipha penhana (Riester, 1938) Xerapoa trina (Marcus, 1951)* comb. n. Pasipha pinima (E.M. Froehlich 1955b)* Pasipha plana (Schirch, 1929) Acknowledgements Pasipha rosea (E.M. Froehlich 1955b)* This research was funded by Fundacion BBVA of Spain Pasipha sp. 1* (BIOCON 06–112), Ministerio de Ciencia e Innovacion of Pasipha sp. 2* Spain CGL2008-00378/BOS and CGL2011-23466, and Pasipha splendida (von Graff, 1899) FAPESP. We are indebted to Julio Pedroni, Debora Red-

524 ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 F. Carbayo et al.  Systematics of Geoplaninae ivo, Marılia Juca, Leonardo Zerbone and Welton Araujo Cannon, R. J. C., Baker, R. H. A., Taylor, M. C. & Moore, J. P. (Brazil), Jose H. Grau and Francisco Javier Cadiz Lorca (1999). A review of the status of the New Zealand flatworm in – (Chile) for sampling help and providing specimens, and the UK. Annals of Applied Biology, 135, 597 614. Carbayo, F. (2006). Redescription of two land planarian species of Italo D’Elia, Ana Cavalcanti, Lıgia Domingos and Ana Notogynaphallia Ogren & Kawakatsu (Platyhelminthes, Tricladi- Cristina Machado Vasconcelos for the histological work. da, Geoplaninae) and confirmation of the heterogeneity of the We are indebted to Ana Vasques, MZUSP, for specimen genus. Revista Brasileira de Zoologia, 23, 746–757. labelling and delivering and to Sabrina Baroni, Laboratorio Carbayo, F. (2008). A new species of land planarian of Gigantea de Sistematica Molecular, Department of Zoology – IB Ogren and Kawakatsu, 1990 (Platyhelminthes, Tricladida, Terri- USP, for providing technical support and wise contribution cola) from Colombia, with taxonomic remarks on the genus. – on troubleshooting the acquisition of molecular data. We Italian Journal of Zoology, 75,85 95. Carbayo, F. (2010). A new genus for seven Brazilian land planarian also thank Dr. Masaharu Kawakatsu for the help with species, split off from Notogynaphallia (Platyhelminthes, Tricladi- interpretation of the ICZN and two anonymous referees da). Belgian Journal of Zoology, 140,91–101. for improving the original manuscript. Jim Hesson of Aca- Carbayo, F. & Froehlich, E. M. (2008). Estado do conhecimento dos demicEnglishSolutions.com revised the English. macroturbelarios (Platyhelminthes) do Brasil. Biota Neotropica, 8, 177–197. References Carbayo, F. & Froehlich, E. M. (2012). Three new Brazilian spe- Almeida, A. L., Kishimoto, R. G. & Carbayo, F. (2012). Two new cies of the land planarian Choeradoplana (Platyhelminthes: Tricla- land planarian species (Platyhelminthes: Tricladida) from the dida: Geoplaninae), and an emendation of the genus. Journal of – Brazilian Atlantic Forest. Zoologia, 29, 430–438. Natural History, 46, 1153 1177. Alvarez-Presas, M., Bagun~a, J. & Riutort, M. (2008). Molecular Carbayo, F. & Leal-Zanchet, A. M. (2001). A new species of ter- phylogeny of land and freshwater planarians (Tricladida, Platy- restrial planarian (Platyhelminthes: Tricladida: Terricola) from – helminthes): from freshwater to land and back. Molecular Phylog- South Brazil. Brazilian Journal of Biology, 61, 1519 6984. enetics and Evolution, 47, 555–568. Carbayo, F. & Leal-Zanchet, A. M. (2003). Two new genera of Alvarez-Presas, M., Carbayo, F., Rozas, J. & Riutort, M. (2011). geoplaninid land planarians (Platyhelminthes: Tricladida: Terri- Land planarians (Platyhelminthes) as a model organism for fine- cola) of Brazil in the light of cephalic specializations. Invertebrate – scale phylogeographic studies: understanding patterns of biodi- Systematics, 17, 449 468. versity in the Brazilian Atlantic Forest hotspot. Journal of Evolu- Carranza, S., Ruiz-Trillo, I., Littlewood, D. T. J., Riutort, M. & ~ tionary Biology, 24, 887–896. Baguna, J. (1998a). A reappraisal of the phylogenetic and taxo- Alvarez-Presas, M., Mateos, E., Vila-Farre, M., Sluys, R. & Riu- nomic position of land planarians (Platyhelminthes, Turbellaria, tort, M. (2012). Evidence for the persistence of the land planar- Tricladida) inferred from 18S rDNA sequences. Pedobiologia, 42, – ian species Microplana terrestris (Muller,€ 1774) (Platyhelminthes, 433 440. Tricladida) in microrefugia during the Last Glacial Maximum in Carranza, S., Littlewood, D. T. J., Clough, K. A., Ruiz-Trillo, I., ~ the northern section of the Iberian Peninsula. Molecular Phyloge- Baguna, J. & Riutort, M. (1998b). A robust molecular phylogeny netics and Evolution, 64, 491–499. of the Tricladida (Platyhelminthes: Seriata) with a discussion on Amaral, S. V., Oliveira, S. M. & Leal-Zanchet, A. M. (2012). morphological synapomorphies. Proceedings of the Royal Society of – Three new species of land flatworms and comments on a com- London. Series B: Biological Sciences, 265, 631 640. plex of species in the genus Geoplana Stimpson (Platyhelminthes: Darwin, D. (1844). Brief descriptions of several terrestrial Planariae, Continenticola). Zootaxa, 3338,1–32. and of some remarkable Marine Species, with an account of their – Baldauf, S. L., Roger, A. J., Wenk-Siefert, I. & Doolittle, W. F. Habits. Annals and Magazine of Natural History, 14, 241 251. (2000). A kingdom-level phylogeny of eukaryotes based on com- Du Bois-Reymond Marcus, E. (1951). On South American geopla- fi ^ bined protein data. Science, 290, 972–977. nids. Boletim da Faculdade de Filoso a, Ciencias e Letras da Univer- ~ – Ball, I. (1977). Turbellaria. In Anonymous (Ed.). La faune terrestre sidade de Sao Paulo, Serie Zoologia, 16, 217 255. ^ de L’Ile de Sainte-Helene Musee Royal de l’Afrique Centrale, Du Bois-Reymond Marcus, E. (1957). On Turbellaria. Anais da ^ – Quatrieme Partie, (pp. 492–511). Tervuren: RMCA. Academia Brasileira de Ciencias, 29, 153 191. Ball, I. R. (1981). The phyletic status of the Paludicola. Hydrobiolo- Du Bois-Reymond Marcus, E. (1958). On South American Turbel- ^ – gia, 84,7–12. laria. Anais da Academia Brasileira de Ciencias, 30, 391 417. Baptista, V.d. A. & Leal-Zanchet, A. M. (2005). A new species of Ducey, P. K., Messere, M., Lapoint, K. & Noce, S. (1999). Lumb- Geoplana Stimpson (Platyhelminthes, Tricladida, Terricola) from ricid prey and potential herpetofaunal predators of the invading fl South Brasil. Revista Brasileira de Zoologia, 22, 875–882. terrestrial atworm Bipalium adventitium (Turbellaria: Tricladida: – Beauchamp, P. d (1939). Rotiferes et Turbellaries. Transactions of Terricola). The American Midland Naturalist Journal, 141, 305 the Linnaean Society London, 1,51–78. 314. Bikandi, J., San Millan, R., Rementeria, A. & Garaizar, J. (2004). Ewing, B. & Green, P. (1998). Base-calling of automated sequen- In silico analysis of complete bacterial genomes: PCR, AFLP- cer traces using Phred II. Error probabilities. Genome Research, – PCR, and endonuclease restriction. Bioinformatics, 20, 798–799. 8, 186 194. Brandley, M. C., Warren, D. L., Leache, A. D. & McGuire, J. A. Ewing, B., Hillier, L., Wendl, M. C. & Green, P. (1998). Base- (2009). Homoplasy and clade support. Systematic Biology, 58, calling of automated sequencer traces using Phred I. Accuracy – 184–198. assessment. Genome Research, 8, 175 185.

ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 525 Systematics of Geoplaninae  F. Carbayo et al.

Froehlich, C. G. (1955a). Sobre a morfologia e taxonomia das Hassouna, N., Michot, N. E. & Bachellerie, J. P. (1984). The com- Geoplanidae. Boletim da Faculdade de Filosofia, Ci^encias e Letras da plete nucleotide sequence of mouse 28S rRNA gene. Implications Universidade de S~ao Paulo, Serie Zoologia, 19, 195–279. for the process of size increase of the large subunit rRNA in Froehlich, E. M. (1955b). Sobre^ especies brasileiras do g^enero Geo- higher eukaryotes. Nucleic Acids Research, 12, 3563–3583. plana. Boletim da Faculdade de Filosofia, Ci^encias e Letras da Univer- Huelsenbeck, J. P., Bull, J. J. & Cunningham, C. W. (1996). Com- sidade de S~ao Paulo, Serie Zoologia, 19, 289–369. bining data in phylogenetic analysis. Trends in Ecology & Evolu- Froehlich, C. G. (1955c). Notas sobre^ geoplanas brasileiras. Papeis tion, 11, 152–158. Avulsos do Departamento de Zoologia, 12, 189–198. Hyman, L. H. (1941). Terrestrial flatworms from the Canal Zone, Froehlich, C. G. (1956a). Tricladida Terricola das regioes~ de Ter- Panama. American Museum Novitates, 1105,1–11. esopolis e Ubatuba. Papeis Avulsos do Departamento de Zoologia, Hyman, L. H. (1951). The Invertebrates. II. Platyhelminthes and 12, 313–344. Rhynchocoela. New York, NY: McGraw-Hill. Froehlich, C. G. (1956b). Planarias Terrestres do Parana. Dusenia, Hyman, L. H. (1955). Miscellaneous marine and terrestrial flat- 7, 173–196. worms from South America. American Museum Novitates, 1742, Froehlich, C. G. (1958). On a collection of Brazilian land planari- 1–33. ans. Boletim da Faculdade de Filosofia, Ci^encias e Letras da Univer- Hyman, L. H. (1957). A few turbellarians from Trinidad and the sidade de S~ao Paulo, Serie Zoologia, 21,93–121. Canal Zone, with corrective remarks. American Museum Novi- Froehlich, C. G. (1959). On Geoplanids from Brazil. Boletim da tates, 1862,1–8. Faculdade de Filosofia, Ci^encias e Letras da Universidade de S~ao Hyman, L. H. (1962). Some land planarians from Caribbean coun- Paulo, Serie Zoologia, 22, 201–242. tries. American Museum Novitates, 2110,1–25. Froehlich, C. G. (1967). A contribution to the zoogeography of Iwai, N., Sugiura, S. & Chiba, S. (2010). Predation impacts of the Neotropical land planarians. Acta Zoologica Lilloana, 23, 153–162. invasive flatworm Platydemus manokwari on eggs and hatchlings Froehlich, E. M. (1978). On a collection of chilean land planarians. of land snails. Journal of Molluscan Studies, 76, 275–278. Boletim de Zoologia, Universidade de S~ao Paulo, 3,7–80. Katoh, K., Misawa, K., Kuma, K. & Miyata, T. (2002). MAFFT: a Froehlich, E. M. & Froehlich, C. G. (1972). Land planarians from novel method for rapid multiple sequence alignment based on the Amazonian Region. Papeis Avulsos do Departamento de Zoolo- fast Fourier transform. Nucleic Acids Research, 33, 511–518. gia, 26,29–45. Lazaro, E. M., Sluys, R., Pala, M., Stocchino, G. A., Bagun~a, J. & Fuhrmann, O. (1914). Planaires terrestres de Colombie. Memoires Riutort, M. (2009). Molecular barcoding and phylogeography of de la Societe des Sciences Naturelles de Neuchatel, 5, 748–792. sexual and asexual freshwater planarians of the genus Dugesia in Giribet, G. (2001). Exploring the behavior of POY, a program for the Western Mediterranean (Platyhelminthes, Tricladida, Du- direct optimization of molecular data. Cladistics, 17,60–70. gesiidae). Molecular Phylogenetics and Evolution, 52, 835–845. Gordon, D., Abajian, C. & Green, P. (1998). Consed: a graphical Leal-Zanchet, A. M. & Carbayo, F. (2001). Two new species of tool for sequence finishing. Genome Research, 8, 195–202. Geoplanidae (Platyhelminthes, Tricladida, Terricola) from Bra- Gordon, D., Desmarais, C. & Green, P. (2001). Automated finish- zil. Journal of Zoology, 253, 433–446. ing with autofinish. Genome Research, 11, 614–625. Leal-Zanchet, A. M. & Froehlich, E. M. (2006). A species complex von Graff, L. (1897). Neue Landplarien (Viaggio del Dott.A.Borel- in the genus Notogynaphallia Ogren and Kawakatsu (Platyhelmin- li nel Chaco Boliviano e nella Republica Argentina. Bollettino dei thes: Tricladida: Terricola) with a taxonomic revision of hom- Musei di Zoologia ed Anatomia Comparata della R. Universitadi onyms of Geoplana marginata Schultze & Muller€ and a Torino, 12,1–3. reinterpretation of Notogynaphallia caissara (Froehlich) anatomy. von Graff, L. (1899). Monographie der Turbellarien II. Tricladida ter- Belgian Journal of Zoology, 136,81–100. ricola (landplanarien). Leipzig: Engelmann. Leal-Zanchet, A. M. & Souza, S. (2003). Redescription of Choera- Grau, J. H. (2010). Relacßoes~ filogeneticas entre os g^eneros de doplana iheringi Graff (Platyhelminthes, Tricladida, Terricola). Geoplaninae (Platyhelminthes, Tricladida) inferidas de caracteres Revista Brasileira de Zoologia, 20, 523–530. morfologicos. Master Project. Universidade de S~ao Paulo, S~ao Lemos, V. S. & Leal-Zanchet, A. M. (2008). Two new species of Paulo, Brazil. Available via http://www.teses.usp.br/teses/disponi- Notogynaphallia Ogren & Kawakatsu (Platyhelminthes: Tricladi- veis/41/41133/tde-12052010-103936/pt-br.php. da: Terricola) from Southern Brazil. Zootaxa, 1907,28–46. Grau, J. H. & Carbayo, F. (2010). Panorama de la diversidad de Marcus, E. (1951). Turbellaria brasileiros (9). Boletim da Faculdade planarias terrestres (Platyhelminthes: Tricladida) de Chile. Bo- de Filosofia, Ci^encias e Letras da Universidade de S~ao Paulo, Serie letın de Biodiversidade de Chile, 2,41–54. Zoologia, 16,1–217. Grau, J. H. & Carbayo, F. (2011). A new land planarian species of Marcus, E. (1952). Turbellaria brasileiros (10). Boletim da Faculdade Geoplana (Platyhelminthes, Tricladida, Geoplanidae) from the de Filosofia, Ci^encias e Letras da Universidade de S~ao Paulo, Serie Valdivian temperate rainforest of southern Chile. Zoosystematics Zoologia, 17,5–187. and Evolution, 87, 327–334. Marcus, E. (1953). Turbellaria Tricladida. Institut des Parcs Nation- Grau, J. H., Sluys, R., Froehlich, E. & Carbayo, F. (2012). aux du Congo Belge, Exploration du Parc National de l ‘Upemba, Reflections on the genus Amaga Ogren and Kawakatsu 1990, and Mission G. F. de Witte, 21, 1–62. description of a new genus of land planarian (Platyhelminthes: Tri- Medlin, L., Elwood, H. J., Stickel, S. & Sogin, M. L. (1988). The cladida: Geoplanidae). Journal of Natural History, 46,1529–1546. characterization of enzymatically amplified eukaryotic 16S-like Hall, T. A. (1999). BioEdit: a user-friendly biological sequence rRNA-coding regions. Gene, 71, 491–499. alignment editor and analysis program for Windows 95/98/NT. Muller,€ O. (1774). Vermium terrestrium et fluviatilium, seu anima- Nucleic Acid Symposium Series, 41,95–98. lium infusoriorum, helminthicorum et testaceorum, non

526 ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 F. Carbayo et al.  Systematics of Geoplaninae

marinorum, succincta historia. Vol. primi pars altera. Havniae et Stimpson, W. (1857). Prodromus descriptionis animalium everte- Lipsiae,4,52–72. bratorum quae in Expeditione ad Oceanum, Pacificum Septentri- Negrete, L., Brusa, F. & Damborenea, C. (2012). A new species of onalem a Republica Federata missa, Johanne Rodgers Duce, Geoplana (Platyhelminthes: Tricladida: Geoplanidae) from the observavit et descripsit. Pars 1. Turbellaria Dendrocoela. Proceed- Western Amazon basin with comments on the land planarian ings of the Academy of Natural Sciences of Philadelphia, 9,19–31. fauna from Peru. Zootaxa, 3358,55–67. Sukumaran, J. & Holder, M. T. (2010). DendroPy: a Python Nylander, J. A. A., Ronquist, F., Huelsenbeck, J. P. & Nieves-Al- library for phylogenetic computing. Bioinformatics, 26, 1569– drey, J. (2004). Bayesian phylogenetic analysis of combined data. 1571. Systematic Biology, 53,47–67. Sunnucks, P., Blacket, M. J., Taylor, J. M., Sands, C. J., Ciavaglia, Ogren, R. & Kawakatsu, M. (1990). Index to the species of the S. A., Garrick, R. C., Tait, N. N., Rowell, D. M. & Pavlova, A. family Geoplanidae (Turbellaria, Tricladida, Terricola). Part I: (2006). A tale of two flatties: different responses of two terres- Geoplaninae. Bulletin of the Fuji Women’s College, 28,79–166. trial flatworms to past environmental climatic fluctuations at Ogren, R. & Sluys, R. (1998). Selected characters of the copulatory Tallaganda in montane southeastern Australia. Molecular Ecology, organs in the land planarian family Bipaliidae and their taxonomic 15, 4513–4531. significance (Tricladida:Terricola). Hydrobiologia, 383,77–82. Tkach, V., Grabda-Kazubska, B., Pawlowski, J. & Swiderski, Z. Phillips, A., Janies, D. & Wheeler, W. C. (2000). Multiple (1999). Molecular and morphological evidence for close phylo- sequence alignment in phylogenetic analysis. Molecular Phyloge- genetic affinities of the genera Macrodera, Leptophallus, Metale- netics and Evolution, 16,17–30. ptophallus and Paralepoderma (Digenea, Plagiorchiata). Acta Posada, D. & Buckley, T. R. (2004). Model selection and model Parasitologica, 44, 170–179. averaging in phylogenetics: advantages of akaike information Varon, A., Vinh, L. S. & Wheeler, W. C. (2010). POY version 4: criterion and bayesian approaches over likelihood ratio tests. Sys- phylogenetic analysis using dynamic homologies. Cladistics, 26, tematic Biology, 53, 793–808. 72–85. Riester, A. (1938). Beitraege zur Geoplaniden-Fauna Brasiliens. Wheeler, W. C. (1996). Optimization Alignment: the end of mul- Abhandlungen der Senckenberg Naturforsch Gesellschaft fur€ Naturf- tiple sequence alignment in phylogenetics? Cladistics, 12,1–9. orschung, 441,1–88. Wheeler, W. C. (2001a). Homology and the optimization of DNA Ripplinger, J. & Sullivan, J. (2008). Does choice in model selection sequence data. Cladistics, 17,3–11. affect maximum likelihood analysis? Systematic Biology, 57,76–85. Wheeler, W. C. (2001b). Homology and DNA sequence data. In Riutort, M., Alvarez-Presas, M., Lazaro, E., Sola, E. & Paps, J. G. P. Wagner (Ed.) The Character Concept in Evolutionary Biology (2012). Evolutionary history of the Tricladida and the Platyhel- (pp. 303–318). New York, NY: Academic Press. minthes: an up-to-date phylogenetic and systematic account. The Wheeler, W. C. (2003a). Iterative pass optimization of sequence International Journal of Developmental Biology, 56,5–17. data. Cladistics, 19, 254–260. Romeis, B. (1989). Mikroskopische Technik.Munchen:€ Urban und Wheeler, W. C. (2003b). Implied alignment: a synapomorphy- Schwarzenberg. based multiple-sequence alignment method and its use in clado- Ronquist, F. & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian gram search. Cladistics, 19, 261–268. phylogenetic inference under mixed models. Bioinformatics, 19, Wheeler, W. C. & Hayashi, C. Y. (1998). The phylogeny of the 1572–1574. extant chelicerate orders. Cladistics, 14, 173–192. Sanders, J. G. (2010). Program note: Cladescan, a program for Winsor, L. (2006). New and revised terrestrial flatworm taxa automated phylogenetic sensitivity analysis. Cladistics, 26, 114– (Platyhelminthes: Tricladida: Terricola) of Australia and the 116. Subantarctic Islands of New Zealand. Tuhinga, 17,81–104. Schirch, P. F. (1929). Sobre as planarias terrestres do Brasil. Bole- Winsor, L., Johns, P. M. & Yeates, G. W. (1998). Introduction, tim do Museu Nacional, 5,27–38. and ecological and systematic background, to the Terricola (Tri- Schultze, M. & Muller,€ F. (1857). Beitr€age zur Kenntnis der Land- cladida). Pedobiologia, 42, 389–404. planarien, nach Mithheilungen des Dr. Fritz Muller€ in Brasilien Xia, X. & Xie, Z. (2001). DAMBE: data analysis in molecular biol- und nach eigenen Untersuchungen von Dr. Max Schultze. Abtei- ogy and evolution. Journal of Heredity, 92, 371–373. lung Naturische Gesellschaft Halle, 4,61–74. Zwickl, D. J. (2006). Genetic algorithm approaches for the phylo- Sluys, R. (1989). Phylogenetic relationships of the triclads (Platy- genetic analysis of large biological sequence datasets under the helminthes, Seriata, Tricladida). Bijdragen tot de Dierkunde, 59, maximum likelihood criterion. Ph.D. dissertation, The Univer- 3–25. sity of Texas at Austin. Available via www.bio.utexas.edu/faculty/ Sluys, R., Kawakatsu, M., Riutort, M. & Bagun~a, J. (2009). A new antisense/garli/Garli.html. higher classification of planarian flatworms (Platyhelminthes, Tricladida). Journal of Natural History, 43, 1763–1777. Soltis, P. S., Soltis, D. E. & Chase, M. W. (1999). Angiosperm Supporting Information phylogeny inferred from multiple genes as a tool for compara- Additional Supporting Information may be found in the tive biology. Nature, 402, 402–404. Sopott-Ehlers, B. (1985). The phylogenetic relationships within online version of this article: the Seriata (Platyhelminthes). In S. C. Morris, J. D. George, R. Fig. S1. Saturation plots for all the genes, the number of Gibson & H. M. Platt (Eds) The Origin and Relationships of Lower transitions (s) and transversions (v) are plotted against the – Invertebrates (pp. 159 167). Oxford: Clarendon Press. ML-composite TN93 distance as calculated with DAMBE.

ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 527 Systematics of Geoplaninae  F. Carbayo et al.

Fig. S2. Phylogenetic trees inferred from the concate- fication base and GenBank accession numbers for all the nated data set: (A) using POY; Squares at nodes indicate the sequences. presence and/or level of support of the node under the dif- Table S2. Data partition schemes tested in the ML analy- ferent parameter schemes and on the ML tree as sketched sis, models applied to each of the partition schemes and in the legend, black and red indicate maximum support. (B) results. by Bayesian inference; Symbols over the nodes denote Table S3. Comparison of monophyletic groups (and their maximum posterior probability; Scale bar is given in num- PP supports) obtained in the individual gene analyses vs. ber of substitutions per site. In both trees numbers follow- the concatenated data set. ing species’ names refer to the accession numbers of the Table S4. Substitution rates estimated by Bayesian infer- specimens deposited in the section Platyhelminthes of the ence for the different partitions when applying the GTR MZUSP (MZUSP PL). model. Table S5. Morphological classifications listed in previous Table S1. Individuals used in the study, Museum code studies. used in the figures and text, collecting locality data, identi-

528 ª 2013 The Norwegian Academy of Science and Letters, 42, 5, September 2013, pp 508–528 Fig. S1. Saturation plots for all the genes, the number of transitions (s) and transversions (v) are plotted against the ML-composite TN93 distance as calculated with DAMBE. Fig. S2A. Phylogenetic trees inferred from the concatenated data set: (A) using poy; Squares at nodes indicate the presence and/or level of support of the node under the different parameter schemes and on the ML tree as sketched in the legend, black and red indicate maximum support. (B) by Bayesian inference; Symbols over the nodes denote maximum posterior probability; Scale bar is given in number of substitutions per site. In both trees numbers following species’ names refer to the accession numbers of the specimens deposited in the section Platyhelminthes of the MZUSP (MZUSP PL).

Endeavouria septemlineata 657, 1184 Dolichoplana striata 1005 outgroup Arthurdendyus triangulatus Artioposthia testacea Australoplana sp.

82 Gusana sp. 1 1088, 1089 clade CHL Polycladus sp. 1 1186 100 Geoplana goetschi 412 Geoplana quagga 594, 1188

Geoplana goetschi sensu Marcus 404, 1190 100 100 clade GOE Geoplaninae Notogynaphallia guaiana 653, 1071

Pasipha tapetilla 732, 938 Pasipha rosea 660 62 Pasipha sp. 2 664 Pasipha sp. 1 1195 clade PAS 94 Pasipha pinima 717, 1011

Pasipha pasipha 1012, 1053

Pasipha chimbeva 476, 403

Geobia subterranea 673, 650

Geoplana franciscana 935, 1069 Geoplana sp. 3 1194

100 Geoplana phocaica 460, 457, 1200

Cephaloflexa bergi 303, 305 100 Cephaloflexa sp. 1 1211/1019 Cephaloflexa Cephaloflexa araucariana 1073, 1076

Geoplana tuxaua 1192, 1058 100 clade TUX Geoplana matuta 1021, 1022

Notogynaphallia sexstriata 680, 656 clade NOT 99 Notogynaphallia plumbea 1060, 1198 Notogynaphallia parca 1196

Choeradoplana bocaina 997, 998, 999

Notogynaphallia albonigra 1083 Choeradoplana gladismariae 1004, 1003 Choeradoplana 99 Choeradoplana banga 1000, 1002 Choeradoplana iheringi sensu Souza & Leal-Zanchet 540 Choeradoplana iheringi 533

100 Geoplana multicolor 1055, 1017 Geoplana rubidolineata 936 Geoplana hina 1008 Geoplana sp. 2 1048 Geoplana crioula 1078, 1079

Geoplana sp. 1 1050, 1052 clade PSE Geoplana tamoia 665, 672 Geoplaninae 1 1193

99 Geoplana pseudovaginuloides 670, 671

Geoplana sp. 4 1014, 1051 Geoplana sp. 5 348/350

Geoplana ladislavii sensu Froehlich 707, 1007, 698 71 Geoplana josefi 1074, 1075

sp.6 1066, 1067 Geoplana clade BUR Geoplana ladislavii 681, no voucher

99 Geoplana carinata 1062, 1064

Geoplana burmeisteri 658, 733

Geoplana chita 1086, 1087 Geoplana vaginuloides 666 100 Pseudogeoplana pulchella 1068 clade GEO Geoplana vaginuloides 1009 Pasipha trina 669, 1191 clade PEX ML 89 Enterosyringa pseudorhynchodemus 1187, 1189 2:1:1:1 2:1:2:1 tree Xerapoa hystrix 1057, 1197 Luteostriata sp. 2 654, 655/1212 Luteostriata ernesti 1070 2:2:1:1 2:2:2:12:2:1:2 Luteostriata muelleri 1199, no voucher Luteostriata sp. 1 659, 663

Luteostriata graffi 652, 1214/1072

Luteostriata sp. 668 2:4:1:1 2:4:2:12:4:1:2 Luteostriata ernesti ? no voucher clade LIS Supramontana irritata 937, 772

97 Luteostriata abundans 646, no voucher, 648

Luteostriata ceciliae 1077 100 Issoca jandaia 1213/1015

Issoca sp. 1 1085, 1020, 1045 100 Issoca rezendei 667, 1010 Fig. S2B. Phylogenetic trees inferred from the concatenated data set: (A) using poy; Squares at nodes indicate the presence and/or level of support of the node under the different parameter schemes and on the ML tree as sketched in the legend, black and red indicate maximum support. (B) by Bayesian inference; Symbols over the nodes denote maximum posterior probability; Scale bar is given in number of substitutions per site. In both trees numbers following species’ names refer to the accession numbers of the specimens deposited in the section Platyhelminthes of the MZUSP (MZUSP PL). Supplementary material

Table S1. Individuals used in the study, Museum code used in the figures and text, collecting locality data, identification base and GenBank accession numbers for all the sequences.

Specimen's Collecting Species Collecting locality Latitude Longitude Identification COI 18S 28S EF-1alpha accession number date

Rhynchodeminae

Arthurdendyus triangulatus (Dendy, DQ66602 AF03304 DQ66595 KC61455 1895) 7 4 3 9 Artioposthia testacea Hutton, 1880 AF17830 DQ66601 DQ66595 KC61456 5 0 2 0 Australoplana sp. DQ66602 AF05043 DQ66595 KC61455 8 4 5 8 Dolichoplana striata Moseley, 1877 MZUSP PL 1005 Igrejinha, RS (Brazil) -29,57200 -50,77800 10/vii/2004 external morphology similar to that described by Corrêa KC60822 KC60845 KC60834 KC61446 (1947) 6 8 1 5 Endeavouria septemlineata (Hyman, MZUSP PL 657 Parque Ecológico do Tietê, São -23,48570 -46,50959 30/iii/2006 external morphology similar to that in original description KC60823 KC60846 KC60834 KC61447 1939) Paulo, SP (Brazil) 3 5 8 1 MZUSP PL 1184 Maquiné, RS (Brazil) -29,67774 -50,20640 10/ii/2004 external morphology similar to that in original description KC608222 KC608454 KC608337 KC61446 1 Geoplaninae

Cephaloflexa araucariana Carbayo & MZUSP PL 1073 Floresta Nacional de São Francisco -29,42736 -50,39838 21/i/2009 external morphology similar to that of sympatric type KC60831 KC60855 KC60843 KC61453 Leal-Zanchet, 2003 de Paula, RS (Brazil) material here analysed 6 0 3 6 MZUSP PL 1076 Floresta Nacional de São Francisco -29,42739 -50,39072 23/i/2009 external morphology similar to that of sympatric type KC60831 KC60855 KC60843 KC61453 de Paula, RS (Brazil) material here analysed 9 3 6 9 Cephaloflexa bergi (Graff, 1899) MZUSP PL 303 São Sebastião, SP (Brazil) -23,75203 -45.631027 07/ix/2006 external morphology similar to that described by Marcus KC60823 KC60847 KC60835 KC61447 (1951) 8 0 3 2 MZUSP PL 305 São Sebastião, SP (Brazil) -23,75203 -45.631027 07/ix/2006 external morphology similar to that described by Marcus KC60824 KC60847 KC60835 KC61447 (1951) 0 2 5 4 Cephaloflexa sp. 1 MZUSP PL 1019 Parque Nacional Serra da Bocaina, SP -23,65388 -45,88910 10/ii/2008 external and internal morphology (from F2103: cephalic KC60827 KC60850 KC60838 KC61450 (Brazil) region, pharynx, and copulatory apparatus; from F2108: 4 6 9 1 pharynx and copulatory apparatus) here analysed MZUSP PL 1211 Parque Nacional Serra da Bocaina, SP -23,65388 -45,88910 10/ii/2008 external and internal morphology (cephalic region, pharynx KC60827 KC60850 KC60838 - (Brazil) and copulatory apparatus) here analysed 2 4 7 Choeradoplana banga Carbayo & E. MZUSP PL 1000 Parque Estadual Serra da Cantareira, -23,42916 -46,63250 30/i/2008 holotype KC60826 KC60849 KC60838 - M. Froehlich, 2012 SP (Brazil) 7 9 2 MZUSP PL 1002 Parque Estadual Serra da Cantareira, -23,42914 -46,63250 14/xii/2008 paratype KC60830 KC60853 KC60841 KC61452 SP (Brazil) 1 4 7 3 Choeradoplana bocaina Carbayo & E. MZUSP PL 998 Parque Nacional Serra da Bocaina, SP -22,75222 -44,62194 07/ix/2008 paratype KC60828 KC60851 KC60839 KC61450 M. Froehlich, 2012 (Brazil) 3 5 8 9 MZUSP PL 999 Parque Nacional Serra da Bocaina, SP -22,75222 -44,62194 10/ii/2008 paratype KC60827 KC60850 KC60838 KC61450 (Brazil) 3 5 8 0 MZUSP PL. 997 Parque Nacional Serra da Bocaina, SP -22,75000 -44,61666 08/ix/2008 holotype KC60828 KC60852 KC60840 - (Brazil) 8 0 3 Choeradoplana gladismariae Carbayo MZUSP PL 1003 Parque Estadual Intervales, SP -24,27638 -48,41556 12/xii/2008 holotype KC60830 KC60854 KC60842 KC61452 & E. M. Froehlich, 2012 (Brazil) 6 0 3 8 MZUSP PL. 1004 Parque Estadual Intervales, SP -24,27638 -48,41556 07/vii/2009 paratype KC60832 KC60856 KC60844 - (Brazil) 6 0 3 Choeradoplana iheringi sensu Souza MZUSP PL 540 Parque Nacional Serra da Bocaina, SP -22,74277 -44,61639 ix/2008 paratype KC60829 KC60852 KC60840 KC61451 & Leal-Zanchet, 2003 (Brazil) 3 5 8 7 Choeradoplana iheringi Graff, 1899 MZUSP PL 533 Floresta Nacional de São Francisco -29,42367 -50,38711 02/iv/2012 external and internal (pharynx and copulatory apparatus) KC60832 KC60855 KC60843 KC61454 de Paula, RS (Brazil) morphology similar to that in original description 0 4 7 0 Enterosyringa pseudorhynchodemus MZUSP PL 1189 Cidade Universitária, USP, São Paulo, -23,56671 -46,73017 17/iii/2006 external morphology similar to that in original description KC60823 KC60846 KC60835 - (Riester, 1938) SP (Brazil) 7 9 2 MZUSP PL 1187 Parque Ecológico do Tietê, São -23,48570 -46,50959 30/iii/2006 external morphology similar to that in original description KC60823 KC60846 KC60835 - Paulo, SP (Brazil) 5 7 0 Geobia subterranea (Schultze & MZUSP PL 650 Colégio Cristo Rei, São Leopoldo, RS -29,78828 -51,15084 30/v/2004 external morphology similar to that in original description KC60822 KC60845 KC60834 KC61446 Müller, 1857) (Brazil) 5 7 0 4 MZUSP PL 673 Parque Nacional da Serra dos Órgãos, -22,49870 -42,99620 18/xii/2007 external morphology similar to that in original description KC60825 KC60848 KC60837 KC61448 RJ (Brazil) 5 7 0 5 Geoplana burmeisteri Schultze & MZUSP PL 658 Parque Ecológico do Tietê, São -23,48570 -46,50959 30/iii/2006 external morphology similar to that in original description KC60823 KC60846 KC60834 - Müller, 1857 Paulo, SP (Brazil) 4 6 9 MZUSP PL 733 Parque Estadual Serra da Cantareira, -23,46047 -46,63672 26/x/2008 external morphology similar to that in original description KC60829 KC60852 KC60841 KC61452 SP (Brazil) 7 9 2 0 Geoplana carinata Riester, 1938 MZUSP PL 1062 Parque Estadual Intervales, SP -24,27638 -48,41556 12/xii/2008 external morphology similar to that in original description KC60830 KC60853 KC60842 KC61452 (Brazil) 4 8 1 7 MZUSP PL 1064 Parque Estadual Intervales, SP -24,27638 -48,41556 12/xii/2008 external morphology similar to that in original description KC60830 KC60854 KC60842 KC61452 (Brazil) 7 1 4 9 Geoplana chita Froehlich, 1956 MZUSP PL 1086 São Sebastião, SP (Brazil) -23,75203 -45.631027 26/ii/2010 external morphology similar to that in original description KC60832 KC60856 KC60844 KC61454 9 3 6 7 MZUSP PL 1087 São Sebastião, SP (Brazil) -23,75203 -45.631027 27/ii/2010 external morphology similar to that in original description KC60833 KC60856 KC60844 KC61454 0 4 7 8 Geoplana crioula E. M. Froehlich, MZUSP PL 1078 Parque Estadual Serra da Cantareira, -23,43084 -46,63413 19/iv/2009 external and internal morphology (pharynx and copulatory KC60832 KC60855 KC60844 KC61454 1955 SP (Brazil) apparatus) similar to that in original description 3 7 0 3 MZUSP PL 1079 Parque Estadual Serra da Cantareira, -23,43084 -46,63413 19/iv/2009 external and internal morphology (pharynx and copulatory KC60832 KC60855 KC60844 KC61454 SP (Brazil) apparatus) similar to that in original description 4 8 1 4 Geoplana franciscana Leal-Zanchet & MZUSP PL 935 Floresta Nacional de São Francisco -29,36666 -50,38333 12/viii/1999 external morphology similar to that of sympatric type KC60833 KC60856 KC60845 KC61455 Carbayo, 2001 de Paula, RS (Brazil) material here analysed 5 9 2 2 MZUSP PL 1069 Floresta Nacional de São Francisco -29,42894 -50,39200 02/xi/2006 external morphology similar to that of sympatric type KC60831 KC60854 KC60842 KC61453 de Paula, RS (Brazil) material here analysed 2 6 9 3 Geoplana goetschi sensu Marcus, MZUSP PL 1190 São Sebastião, SP (Brazil) -23,75203 -45.631027 08/ix/2006 external and internal morphology (pre-pharyngeal region and KC60824 KC60847 KC60835 - 1951 pharynx) similar to that described by Marcus (1951) 1 3 6 MZUSP PL 404 Parque Nacional Serra da Bocaina, SP -22,75222 -44,62194 ix/2008 external and internal morphology (copulatory apparatus) KC60829 KC60852 KC60840 KC61451 (Brazil) similar to that described by Marcus (1951) 1 3 6 6 Geoplana goetschi Riester 1938 MZUSP PL 412 Parque Estadual Serra da Cantareira, -23,46047 -46,63672 26/x/2008 external morphology similar to that in original description KC60829 KC60852 KC60840 - SP (Brazil) 4 6 9 Geoplana hina Marcus, 1951 MZUSP PL 1008 Parque Nacional Saint Hilaire / -25,76437 -48,62266 10/i/2008 external and internal morphology (pharynx and copulatory KC60826 KC60849 KC60837 KC61449 Lange, PR (Brazil) apparatus) similar to that in original description 1 3 6 1 Geoplana josefi Carbayo & Leal- MZUSP PL 1074 Floresta Nacional de São Francisco -29,42736 -50,39838 21/i/2009 external morphology similar to that of sympatric type KC60831 KC60855 KC60843 KC61453 Zanchet, 2001 de Paula, RS (Brazil) material here analysed 7 1 4 7 MZUSP PL 1075 Floresta Nacional de São Francisco -29,42736 -50,39838 21/i/2009 external morphology similar to that of sympatric type KC60831 KC60855 KC60843 KC61453 de Paula, RS (Brazil) material here analysed 8 2 5 8 Geoplana ladislavii Graff, 1899 MZUSP PL 681 Parque Nacional da Serra de Itajaí, -27,04836 -49,09200 05/i/2008 external morphology similar to that in original description KC60825 KC60849 KC60837 KC61448 SC (Brazil) 8 0 3 8 no voucher Floresta Nacional de São Francisco -29,41666 -50,38333 20/vi/1998 external morphology similar to that in original description AF17831 DQ66600 DQ66597 KC61455 de Paula, RS (Brazil) 5 5 5 7

Geoplana ladislavii sensu Froehlich, MZUSP PL 698 Parque Nacional da Serra de Itajaí, -27,04836 -49,09200 06/i/2008 external and internal morphology (copulatory apparatus) KC60825 KC60849 KC60837 KC61448 1959 SC (Brazil) similar to that described by Froehlich (1959) 9 1 4 9 MZUSP PL 707 Parque Nacional da Serra de Itajaí, -26,96065 -49,06756 07/i/2008 external morphology similar to that described by Froehlich KC60826 KC60849 KC60837 KC61449 SC (Brazil) (1959) 0 2 5 0 MZUSP PL 1007 Parque Nacional da Serra de Itajaí, -27,04836 -49,09200 04/i/2008 external morphology similar to that described by Froehlich KC60825 KC60848 KC60837 KC61448 SC (Brazil) (1959) 6 8 1 6

Geoplana matuta E. M. Froehlich, MZUSP PL 1021 Parque Estadual do Desengano, RJ -27,95989 -48,75761 17/iii/2008 external and internal morphology (cephalic region, pharynx KC60827 KC60850 KC60839 KC61450 1955 (Brazil) and copulatory apparatus) similar to that in original 6 8 1 3 description MZUSP PL 1022 Parque Estadual do Desengano, RJ -21,87138 -41,91472 17/iii/2008 external morphology similar to that in original description KC60827 KC60850 KC60839 KC61450 (Brazil) 7 9 2 4 Geoplana multicolor Graff, 1899 MZUSP PL 1017 Parque Nacional Serra da Bocaina, SP -22,72583 -44,62611 10/ii/2008 external and internal morphology (cephalic region, pharynx KC60827 KC60850 KC60838 KC61449 (Brazil) and copulatory apparatus) similar to that in original 1 3 6 9 description MZUSP PL 1055 Parque Estadual Serra da Cantareira, -23,42914 -46,63250 14/xii/2008 external morphology similar to that described by Marcus KC60829 KC60853 KC60841 KC61452 SP (Brazil) (1951) 9 2 5 1 Geoplana phocaica Marcus, 1951 MZUSP PL 1200 Parque Estadual Serra da Cantareira, -23,43084 -46,63413 20/iv/2009 external and internal morphology (cephalic region, ovarian KC60832 KC60855 KC60844 - SP (Brazil) region, pre-pharyngeal region, pharynx and copulatory 5 9 2 apparatus) similar to that of sympatric material in original description MZUSP PL 457 Parque Nacional Serra da Bocaina, SP -22,73389 -44,61639 ix/2008 internal morphology (pharynx and copulatory apparatus) KC60828 KC60852 KC60840 KC61451 (Brazil) similar to that of sympatric material in original description 9 1 4 4 MZUSP PL 460 Parque Nacional Serra da Bocaina, SP -22,73389 -44,61639 ix/2008 internal morphology (pharynx and copulatory apparatus) KC60829 KC60852 KC60840 KC61451 (Brazil) similar to that of sympatric material in original description 0 2 5 5 Geoplana pseudovaginuloides Riester, MZUSP PL 670 Parque Nacional da Serra dos Órgãos, -22,45528 -42,99750 16/xii/2007 external morphology similar to that of sympatric material in KC60825 KC60848 KC60836 KC61448 1938 RJ (Brazil) original description 1 3 6 2 MZUSP PL 671 Parque Nacional da Serra dos Órgãos, -22,45528 -42,99750 16/xii/2007 external morphology similar to that of sympatric material in KC60825 KC60848 KC60836 KC61448 RJ (Brazil) original description 2 4 7 3 Geoplana quagga Marcus, 1951 MZUSP PL 1188 Parque Ecológico do Tietê, São -23,48570 -46,50959 30/iii/2006 external morphology similar to that in original description KC60823 KC60846 KC60835 - Paulo, SP (Brazil) 6 8 1 MZUSP PL 594 Parque Nacional Saint Hilaire / -25,46972 -48,81222 14/i/2008 external and internal morphology (pharynx and copulatory KC60826 KC60849 KC60838 KC61449 Lange, PR (Brazil) apparatus) similar to that in original description 5 7 0 5 Geoplana rubidolineata Baptista & MZUSP PL 936 Floresta Nacional de São Francisco -29,36666 -50,38333 26/viii/1999 external morphology similar to that of sympatric material in KC60833 KC60856 KC60845 KC61455 Leal-Zanchet, 2005 de Paula, RS (Brazil) original description 3 7 0 0 Geoplana sp. 1 MZUSP PL 1050 Parque Nacional Serra da Bocaina, SP -22,75222 -44,62194 07/ix/2008 external and internal morphology (cephalic region, pharynx KC60828 KC60851 KC60839 KC61451 (Brazil) and copulatory apparatus) here analysed 4 6 9 0 MZUSP PL 1052 Parque Nacional Serra da Bocaina, SP -22,75000 -44,61666 08/ix/2008 external and internal morphology (ovarian region, pharynx KC60828 KC60851 KC60840 KC61451 (Brazil) and copulatory apparatus) here analysed 7 9 2 3 Geoplana sp. 2 MZUSP PL 1048 Parque Estadual Intervales, SP -24,27333 -48,41694 29/vii/2008 external and internal morphology here analysed KC60828 KC60851 KC60839 KC61450 (Brazil) 1 3 6 8 Geoplana sp. 3 MZUSP PL 1194 Parque Nacional Serra da Bocaina, SP -22,73389 -44,61639 07/ix/2008 external and internal morphology here analysed KC60828 KC60851 KC60839 - (Brazil) 2 4 7 Geoplana sp. 4 MZUSP PL 1014 Parque Nacional Serra da Bocaina, SP -22,73333 -44,60000 07/ii/2008 external and internal morphology here analysed KC60826 KC60850 KC60838 KC61449 (Brazil) 8 0 3 7 MZUSP PL 1051 Parque Nacional Serra da Bocaina, SP -22,73389 -44,61639 08/ix/2008 external and internal morphology here analysed KC60828 KC60851 KC60840 KC61451 (Brazil) 5 7 0 1 Geoplana sp. 5 MZUSP PL 348 Parque Estadual do Desengano, RJ -21,87667 -41,91972 18/iii/2008 external and internal morphology (cephalic region, ovarian KC60827 KC60851 KC60839 KC61450 (Brazil) region, pre-pharyngeal region, pharynx and copulatory 8 0 3 5 apparatus) here analysed MZUSP PL 350 Parque Estadual do Desengano, RJ -21,87667 -41,91972 18/iii/2008 external and internal morphology (cephalic region, pre- - - - - (Brazil) pharyngeal region, pharynx and copulatory apparatus) here analysed Geoplana sp. 6 MZUSP PL 1066 Parque Estadual da Serra do -27,95989 -48,75761 09/i/2009 external morphology similar to that in original description; KC60830 KC60854 KC60842 KC61453 Tabuleiro, SC (Brazil) internal morphology similar to that of material studied by 8 2 5 0 Froehlich (1959) MZUSP PL 1067 Parque Estadual da Serra do -27,98139 -48,74806 13/i/2009 external morphology similar to that in original description; KC60830 KC60854 KC60842 KC61453 Tabuleiro, SC (Brazil) internal morphology similar to that of material studied by 9 3 6 1 Froehlich (1959) Geoplana tamoia E. M. Froehlich, MZUSP PL 665 Parque Nacional da Serra dos Órgãos, -22,45528 -42,99750 15/i/2007 external morphology similar to that of sympatric material in KC60824 KC60847 KC60836 KC61447 1955 RJ (Brazil) original description 6 8 1 8 MZUSP PL 672 Parque Nacional da Serra dos Órgãos, -22,49870 -42,99620 18/xii/2007 external morphology similar to that of sympatric material in KC60825 KC60848 KC60836 KC61448 RJ (Brazil) original description 4 6 9 4 Geoplana tuxaua E. M. Froehlich, MZUSP PL 1192 Parque Nacional da Serra dos Órgãos, -22,45528 -42,99750 16/xii/2007 external and internal morphology similar to that in original KC60825 KC60848 KC60836 - 1955 RJ (Brazil) description 3 5 8 MZUSP PL 1058 Parque Estadual Serra da Cantareira, -23,42914 -46,63250 14/xii/2008 external morphology similar to that of sympatric material in KC60830 KC60853 KC60841 KC61452 SP (Brazil) original description 2 6 9 5 Geoplana vaginuloides MZUSP PL 666 Parque da Previdência, São Paulo, SP -25,76437 -48,62266 17/vi/2007 external morphology similar to that described by Riester KC60824 KC60847 KC60836 KC61447 (Brazil) (1938) 7 9 2 9 MZUSP PL 1009 Parque Nacional Saint Hilaire / -25,76437 -48,62266 10/i/2008 external morphology similar to that described by Riester KC60826 KC60849 KC60837 KC61449 Lange, PR (Brazil) (1938) 2 4 7 2 Geoplaninae 1 MZUSP PL 1193 Parque Nacional Serra da Bocaina, SP -22,75000 -44,61666 07/ii/2008 external and internal morphology here analysed KC60826 KC60850 KC60838 - (Brazil) 9 1 4 Gusana sp. 1 MZUSP PL 1088 Parque Hualpén (Chile) -36,79611 -73,15244 07/vii/2010 external and internal morphology here analysed KC60833 KC60856 KC60844 KC61454 1 5 8 9 MZUSP PL 1089 Parque Hualpén (Chile) -36,79611 -73,15244 07/vii/2010 external and internal morphology here analysed KC60833 KC60856 KC60844 - 2 6 9 Issoca jandaia Froehlich, 1955 MZUSP PL 1015 Parque Nacional Serra da Bocaina, SP -22,78222 -44,60583 09/ii/2007 external and internal morphology similar to that in original KC60827 KC60850 KC60838 KC61449 (Brazil) description 0 2 5 8 MZUSP PL 1213 Parque Nacional Serra da Bocaina, SP -22,78222 -44,60583 09/ii/2007 external and internal (pharynx) morphology similar to that in - - - - (Brazil) original description Issoca rezendei (Schirch, 1929) MZUSP PL 667 Parque da Previdência, São Paulo, SP -23,58080 -46,72709 09/viii/2007 external morphology similar to that in original description KC60824 KC60848 KC60836 KC61448 (Brazil) 8 0 3 0 MZUSP PL 1010 Parque Nacional Saint Hilaire / -25,46972 -48,81222 13/i/2008 external morphology similar to that in original description KC60826 KC60849 KC60837 KC61449 Lange, PR (Brazil) 3 5 8 3 Issoca sp. 1 MZUSP PL 1020 Parque Estadual do Desengano, RJ -21,87694 -41,92583 16/iii/2008 external and internal morphology here analysed KC60827 KC60850 KC60839 KC61450 (Brazil) 5 7 0 2 MZUSP PL 1045 Reserva Biológica Augusto Ruschi, -19,88740 -40,54319 24/v/2008 external and internal morphology here analysed KC60827 KC60851 KC60839 KC61450 ES (Brazil) 9 1 4 6 MZUSP PL 1085 Parque Estadual do Desengano, RJ -21,87555 -41,91361 13/viii/2009 external and internal morphology here analysed KC60832 KC60856 KC60844 KC61454 (Brazil) 8 2 5 6 Luteostriata abundans (Graff, 1899) MZUSP PL 646 Parobé, RS (Brazil) -29,62940 -50,83110 27iii/2004 external morphology similar to that described by Leal- KC60822 KC60845 KC60833 KC61446 Zanchet & E. M. Froehlich (2006) 3 5 8 2 MZUSP PL 648 Parobé, RS (Brazil) -29,62940 -50,83110 27/iii/2004 external morphology similar to that described by Leal- KC60822 KC60845 KC60833 KC61446 Zanchet & E. M. Froehlich (2006) 4 6 9 3 no voucher São Leopoldo, RS (Brazil) -29,78828 -51,15084 1998 external morphology similar to that described by Leal- KC63162 KC63162 KC63162 KC61455 Zanchet & E. M. Froehlich (2006) 1 2 5 6 Luteostriata ceciliae (Froehlich & MZUSP PL 1077 Floresta Nacional de São Francisco -29,42367 -50,38711 25/i/2009 external and internal morphology similar to that of sympatric KC60832 KC60855 KC60843 KC61454 Leal-Zanchet, 2003) de Paula, RS (Brazil) material in original description 1 5 8 1 Luteostriata ernesti ? no voucher São Paulo, SP (Brazil) -23,49080 -46,52090 2005 external and internal morphology here analysed - KC63162 KC63162 KC61455 3 6 5 Luteostriata ernesti (Leal-Zanchet & MZUSP PL 1070 Floresta Nacional de São Francisco -29,42367 -50,38711 25/i/2009 external and internal morphology similar to that of sympatric KC60831 KC60854 KC60843 KC61453 Froehlich, 2006) de Paula, RS (Brazil) material in original description 3 7 0 4 Luteostriata graffi (Leal-Zanchet & MZUSP PL 652 Taquara, RS (Brazil) -29,64900 -50,79500 24/vii/2004 external morphology similar to that of sympatric material in KC60822 KC60845 KC60834 KC61446 Froehlich, 2006) original description 7 9 2 6 MZUSP PL 1214 Floresta Nacional de São Francisco -29,42963 -50,39780 21/i/2009 external morphology similar to that of sympatric material in - - - - de Paula, RS (Brazil) original description MZUSP PL 1072 Floresta Nacional de São Francisco -29,42963 -50,39780 21/i/2009 external and internal morphology similar to that of sympatric KC60831 KC60854 KC60843 KC61453 de Paula, RS (Brazil) material in original description 5 9 2 5 Luteostriata muelleri (Diesing, 1861) MZUSP PL 1199 Parque Estadual da Serra do -27,84278 -48,92583 15/i/2009 external morphology similar to that described by Carbayo KC60831 KC60854 KC60842 - Tabuleiro, SC (Brazil) (2010) 1 5 8 no voucher - KC63162 KC63162 KC61455 4 7 4 Luteostriata sp. MZUSP PL 668 Parque da Previdência, São Paulo, SP -23,58080 -46,72709 09/viii/2007 external and internal morphology here analysed KC60824 KC60848 KC60836 KC61448 (Brazil) 9 1 4 1 Luteostriata sp. 1 MZUSP PL 659 São Sebastião, SP (Brazil) -23,75203 -45.631027 07/ix/2006 external and internal morphology here analysed KC60823 KC60847 KC60835 KC61447 9 1 4 3 MZUSP PL 663 Estação Biológica de Boraceia, -23,65388 -45,88910 02/ii/2006 external and internal morphology here analysed KC60824 KC60847 KC60835 KC61447 Salesópolis, SP, Brazil 3 5 8 6 Luteostriata sp. 2 MZUSP PL 654 Santinhos, Florianópolis, SC (Brazil) -27,46370 -48,38100 09/ix/2004 external and internal morphology here analysed KC60823 KC60846 KC60834 KC61446 0 2 5 8 MZUSP PL 655 Santinhos, Florianópolis, SC (Brazil) -27,46370 -48,38100 09/ix/2004 external and internal morphology here analysed KC60823 KC60846 KC60834 KC61446 1 3 6 9 MZUSP PL 1212 Santinhos, Florianópolis, SC (Brazil) -27,46370 -48,38100 09/ix/2004 external morphology here analysed - - - -

Notogynaphallia albonigra (Riester, MZUSP PL 1083 Parque Estadual do Desengano, RJ -21,87555 -41,91361 13/viii/2009 external and internal morphology similar to that of type KC60832 KC60856 KC60844 KC61454 1938) (Brazil) material here analysed 7 1 4 5 Notogynaphallia guaiana Leal- MZUSP PL 653 Floresta Nacional de São Francisco -29,41666 -50,38333 01/viii/2004 external and internal morphology similar to that of sympatric KC60822 KC60846 KC60834 KC61446 Zanchet & Carbayo, 2001 de Paula, RS (Brazil) type material here analysed 9 1 4 7 MZUSP PL 1071 Floresta Nacional de São Francisco -29,42367 -50,38711 20/i/2009 external and internal morphology similar to that of sympatric KC60831 KC60854 KC60843 - de Paula, RS (Brazil) type material here analysed 4 8 1 Notogynaphallia parca (E. M. MZUSP PL 1196 Parque Estadual Serra da Cantareira, -23,42914 -46,63250 26/x/2008 external and internal morphology similar to that of sympatric KC60829 KC60853 KC60841 - Froehlich, 1955) SP (Brazil) material in original description 8 0 3 Notogynaphallia plumbea (Froehlich, MZUSP PL 1198 Parque Estadual Intervales, SP -24,27638 -48,41556 12/xii/2008 external and internal morphology similar to that in original KC60830 KC60853 KC60842 - 1956) (Brazil) description 5 9 2 MZUSP PL 1060 Parque Estadual Serra da Cantareira, -23,42914 -46,63250 14/xii/2008 external and internal morphology similar to that of sympatric KC60830 KC60853 KC60842 KC61452 SP (Brazil) material in original description 3 7 0 6 Notogynaphallia sexstriata (Graff, MZUSP PL 656 Cidade Universitária, USP, São Paulo, -23,56671 -46,73017 19/xii/2005 external and internal morphology similar to that described by KC60823 KC60846 KC60834 KC61447 1899) SP (Brazil) du-Bois Reymond Marcus (1951) 2 4 7 0 MZUSP PL 680 Parque Nacional da Serra de Itajaí, -27,04836 -49,09200 04/i/2008 external and internal morphology similar to that described by KC60825 KC60848 KC60837 KC61448 SC (Brazil) du-Bois Reymond Marcus (1951) 7 9 2 7 Pasipha chimbeva (E. M. Froehlich, MZUSP PL 403 Parque Nacional Serra da Bocaina, SP -22,73389 -44,61639 08/ix/2008 external and internal morphology similar to that in original KC60828 KC60851 KC60840 KC61451 1955) (Brazil) description 6 8 1 2 MZUSP PL 476 Parque Estadual Serra da Cantareira, -23,42914 -46,63250 14/xii/2008 external and internal morphology similar to that of sympatric KC60830 KC60853 KC60841 KC61452 SP (Brazil) material in original description 0 3 6 2 Pasipha pasipha (Marcus, 1951) MZUSP PL 1012 Parque Estadual Alberto Löfgren, São -23,45925 -46,63730 26/i/2008 external and internal morphology similar to that of sympatric KC60826 KC60849 KC60838 KC61449 Paulo, SP (Brazil) material in original description 6 8 1 6 MZUSP PL 1053 Parque Estadual Serra da Cantareira, -23,46047 -46,63672 26/x/2008 external and internal morphology similar to that of sympatric KC60829 KC60852 KC60841 KC61451 SP (Brazil) material in original description 5 7 0 8 Pasipha pinima (E. M. Froehlich, MZUSP PL 717 Parque Nacional da Serra dos Órgãos, -22,45528 -42,99750 10/vii/2008 external morphology similar to that in original description KC60828 KC60851 KC60839 KC61450 1955) RJ (Brazil) 0 2 5 7 MZUSP PL 1011 Parque Nacional Saint Hilaire / -25,46972 -48,81222 13/i/2008 external and internal morphology similar to that in original KC60826 KC60849 KC60837 KC61449 Lange, PR (Brazil) description 4 6 9 4 Pasipha rosea (E. M. Froehlich, 1955) MZUSP PL 660 Parque Estoril, São Bernardo do -23,77368 -46,51469 22/x/2006 external and internal morphology similar to that of sympatric KC60824 KC60847 KC60835 KC61447 Campo, SP (Brazil) material in original description 2 4 7 5 Pasipha sp. 1 MZUSP PL 1195 Parque Nacional Serra da Bocaina, SP -22,72972 -44.63805 ix/2008 external and internal morphology here analysed KC60829 KC60852 KC60840 - (Brazil) 2 4 7 Pasipha sp. 2 MZUSP PL 664 Parque Nacional da Serra dos Órgãos, -22,38455 -42,97681 14/i/2007 external and internal morphology here analysed KC60824 KC60847 KC60836 KC61447 RJ (Brazil) 5 7 0 7 Pasipha tapetilla (Marcus, 1951) MZUSP PL 732 Parque Estadual Serra da Cantareira, -23,46047 -46,63672 26/x/2008 external morphology similar to that in original description KC60829 KC60852 KC60841 KC61451 SP (Brazil) 6 8 1 9 MZUSP PL 938 São Paulo, SP (Brazil) -29,36666 -50,38333 v/2007 external morphology similar to that in original description KC60833 KC60857 KC60845 KC61455 6 0 3 3 Pasipha trina (Marcus, 1951) MZUSP PL 1191 Cascata Imbuí, Teresópolis, RJ -22,38455 -42,97681 14/i/2007 external and internal morphology similar to that in original KC60824 KC60847 KC60835 - (Brazil) description 4 6 9 MZUSP PL 669 Parque Nacional da Serra dos Órgãos, -22,45528 -42,99750 15/xii/2007 external morphology similar to that in original description KC60825 KC60848 KC60836 - RJ (Brazil) 0 2 5 Polycladus sp. 1 MZUSP PL 1186 Valdívia (Chile) -39,81000 -73,23000 2004 external and internal morphology here analysed KC60822 KC60846 KC60834 - 8 0 3 Pseudogeoplana pulchella (Schultze & MZUSP PL 1068 Parque Estadual da Serra do -27,84278 -48,92583 14/i/2009 external morphology similar to that in original description; KC60831 KC60854 KC60842 KC61453 Müller, 1857) Tabuleiro, SC (Brazil) internal morphology analysed 0 4 7 2 Supramontana irritata Carbayo & MZUSP PL 772 Floresta Nacional de São Francisco -29,42064 -50,39394 25/i/2009 external and internal morphology similar to that of sympatric KC60832 KC60855 KC60843 KC61454 Leal-Zanchet, 2003 de Paula, RS (Brazil) type material here analysed 2 6 9 2 MZUSP PL 937 Floresta Nacional de São Francisco -29,36666 -50,38333 09/ii/2006 external and internal morphology similar to that of sympatric KC60833 KC60856 KC60845 KC61455 de Paula, RS (Brazil) type material here analysed 4 8 1 1 Xerapoa hystrix Froehlich, 1955 MZUSP PL 1197 Parque Estadual Serra da Cantareira, -23,42914 -46,63250 14/xii/2008 external and internal morphology similar to that of sympatric - KC60853 KC60841 - SP (Brazil) material in original description 1 4 MZUSP PL 1057 Parque Estadual Serra da Cantareira, -24,27638 -48,41556 12/xii/2008 external and internal morphology similar to that of sympatric - KC60853 KC60841 KC61452 SP (Brazil) material in original description 5 8 4 Table S2. Data partition schemes tested in the ML analysis, models applied to each of the partition schemes and results

Free Sequence Substitution Models Applied K lnL AICc parameters Length [TPM1+I+G] 4 248 4143 -55375,18953 111278,09555 [JC+G][TVM+I+G] 10 254 4143 -55189,97694 110921,27179 [TIM3+I+G][K80+G][TPM1uf+I+G][GTR+I+G] 27 271 4143 -52522,86062 105625,80546 [(GTR+G)(TIM1+I+G)(TIM1+I+G)][K80+G][TPM1uf+I+G][GTR+I+G] 44 288 4143 -52522,88147 105664,95546 [(HKY+I+G)(TIM1+I+G)][K80+G][TPM1uf+I+G][GTR+I+G] 33 277 4143 -52560,74249 105715,33284 [TIM3+I+G][(TrN+G)(TVMef+I+G)(HKY+I+G)][TPM1uf+I+G][GTR+I+G] 43 287 4143 -52295,00684 105206,89617 [TIM3+I+G][(GTR+I+G)(HKY+I+G)][TPM1uf+I+G][GTR+I+G] 41 285 4143 -52256,78288 105125,83178 [(GTR+G)(TIM1+I+G)(TIM1+I+G)][(TrN+G)(TVMef+I+G)(HKY+I+G)] [TPM1uf+I+G][GTR+I+G] 60 304 4143 -52295,34452 105247,00586 [(HKY+I+G)(TIM1+I+G)][(TrN+G)(TVMef+I+G)(HKY+I+G)][TPM1uf+I+G] [GTR+I+G] 49 293 4143 -52336,67713 105304,11497 [(GTR+G)(TIM1+I+G)(TIM1+I+G)][(GTR+I+G)(HKY+I+G)][TPM1uf+I+G] [GTR+I+G] 58 302 4143 -52257,40260 105166,46457 [(HKY+I+G)(TIM1+I+G)][(GTR+I+G)(HKY+I+G)][TPM1uf+I+G][GTR+I+G] 47 291 4143 -52295,11177 105216,35338 Table S3. PP values supporting the monophyly of the clades recovered in the analyses of the concatenated dataset, for each.

Dataset Clade 18S 28S EF COI Concatenated

GEO clade (Geoplana vaginuloides, G. pulchella, G. chita) 1 1 1 0.96 1 BUR clade (Geoplana burmeisteri, G. ladislavii, G. josefi, G. sp. 6, G. carinata, G. - 1 1 - 1 ladislavii sensu Froehlich, 1959)

PSE clade (G. tamoia, G. hina, G. crioula, G. pseudovaginuloides, G. sp. 1, 2, 4, 5) 0.98 0.99 ↓ - 1 GOE clade (Notogynaphallia guaiana, G. goetschi sensu Marcus, 1951) - 1 1 - 1 TUX clade (Geoplana matuta, G. tuxaua) 1 1 1 - 1 (Geoplana phocaica, Geoplana sp. 3) - ↓ ? - 1 (Geoplana quagga, Geoplana goetschi) - 1 ? - 1 (Geoplana rubidolineata, G. multicolor) 1 1 - - 1 MUL clade (Geoplana rubidolineata, G. multicolor, G. franciscana) - 0.95 - - 0.97 CHL clade (Gusana, Polycladus) - 0.93 ? - 1 NOT clade (Notogynaphallia sextriata, N. plumbea, N. parca) - 1 1 0.91 1 PAS clade (Pasipha, except P. trina) 1 1 - - 1 Choeradoplana spp. - 1 - - 1 CEC clade (Choeradoplana, Cephaloflexa) ↓ - ↓ - 0.94 Luteostriata - - - - ↓ Issoca – I. rezendei monophyletic - - 0.97 - ↓ Supramontana 1 1 0.96 - 1 LIS clade (Luteostriata, Issoca, Supramontana) 1 1 1 ↓ 1 PEX clade (Pasipha trina, Enterosyringa, Xerapoa) - 1 ? ? 1 - the clade does not exist; ↓ the clade has very low support; ? missing one or more components of the clade Table S4. Substitution rates estimated by Bayesian Inference for the different partitions when applying the GTR model. The parameter values obtained with MrBayes software have been made proportional to r(G<->T).

Method Parameter Gene EF-1alpha (1st & 18S 28S COI (1st & 2nd) COI (3rd) EF-1alpha (3rd) 2nd) Bayesian Inference r(A<->C) 0,97361 1,05497 1,03494 18,57709 1,76839 2,23486 r(A<->G) 2,74218 5,16432 2,19039 24,48363 2,39131 16,33055 r(A<->T) 1,83459 1,62193 0,75989 0,92608 2,20911 2,80082 r(C<->G) 0,69447 0,92022 1,11448 6,95459 3,70788 1,88079 r(C<->T) 3,88368 5,75784 6,57423 212,04989 5,77989 8,45840 r(G<->T) 1 1 1 1 1 1 Table S5. Morphological classifications listed in previous studies. Species in bold are studied in this paper.

Publication Group Species in the group E.M. Froehlich A G. pasipha, G. penhana, G. pinima, G. plana, G. pulchella, G. rosea, G. velutina, G. astraea, G. (1955a) chimbeva B G. argus, G. braunsi, G. carinata, G. divae, G. duca, G. itatiayana, G. ladislavii, G. notocelis, G, arpi, G. blaseri, G. fryi C G. pseudovaginuloides, G. metzi, G. evelinae, G. yara, G. taxiarcha, G. ferussaci, G. nigrofusca, G. dictyonota, G. tamoia, G. regia, G. pavani, G. trigueira, G. livia, G. splendida, G. crioula D G. vaginuloides, G. leucophyna, G. hina E G. barreirana, G. cassula, G. zebroides F G. modesta, G. parca, G. albonigra, G. sexstriata, G. trina Natural group 1 G. matuta, G. tuxaua Natural group 2 G. multicolor, G. phocaica, G. preta, G. incognita, G. quagga No classification G. caissara, G. marginata, G. tapetilla, G. pseudorhynchodemus, G. bergi Froehlich (1956a) C Group C in E.M. Froehlich (1955) + G. joia, G. polyophthalma D Group D in E.M. Froehlich (1955) + G. chita F Group F in E.M. Froehlich (1955) + G. mourei, G. plumbea Froehlich (1967) G. applanata-group G. apeva, G. applanata, G. argus, G. assu, G. aymara, G. bimbergi, G. braunsi, G. bresslaui, G. burmeisteri, G. carinata, G. carrierei, G. catharina, G. chulpa, G. dictyonota, G. fryi, G. divae, G. glieschi, G. itatiayana, G. ladislavii, G. lareta, G. marmorata, G. mayori, G. rufiventris, G. tamboensis G. taxiarcha-group 1 G. alterfusca, G. beckeri, G. caucauensis, G. evelinae, G. ferussaci, G. fuhrmanni, G. fusca, G. hina, G. joia, G. livia, G. multipunctata, G. pavani, G. poca, G. polyophthalma, G. pseudovaginuloides, G. pulla, G. regia, G. riesteri, G. schubarti, G. shapra, G. tamoia, G. taxiarcha, G. toriba, G. trigueira, G. vicuna, G. yara G. taxiarcha-group 2 G. caapora, G. chiuna, G. crawfordi, G. crioula, G. fragai, G. gaucha, G. goettei, G. incognita, G. multicolor, G. phocaica, G. preta, G. saima, G. suva, G. vaginuloides G. barreirana-group G. barreirana, G. zebroides, G. elegans G. pasipha-group G. astraea, G. caeruleonigra, G. cafusa, G. chimbeva, G. hauseri, G. oliveroi, G. pasipha, G. penhana, G. pinima, G. plana, G. rosea, G. splendida, G. velutina, G. chilensis, G. aphalla G. abundans-group G. abundans, G. albonigra, G. fita, G. marginata, G. muelleri G. gigantea-group G. gigantea, G. chiriquii, G. idaia, G. montana, G. picadoi, G. sandersoni, G. vongunteni, G. cameliae

G. amagensis-group G. amagensis, G. becki, G. bogotensis, G. buergeri, G. bussoni, G. contamanensis, G. ortizi No classification G. goetschi Ogren & Genus Geoplana; G. alterfusca, G. apeva, G. applanata, G. argus, G. arpi, G. assu, G. aymara, G. beckeri, G. bimbergi, Kawakatsu (1990) subgenus Geoplana G. blaseri, G. braunsi, G. bresslaui, G. burmeisteri, G. caapora, G. caleta, G. cantuta, G. carinata, G. carrierei, G. catharina, G. caucauensis, G. caya, G. chalona, G. chanca, G. chiliua, G. chita, G. chiuna, G. chulpa, G. crawfordi, G. crioula, G. dictyonota, G. divae, G. duca, G. eudoxiae, G. eudoximariae, G. evelinae, G. ferussaci, G. fragai, G. fryi, G. fuhrmanni, G. fusca, G. gabriellae, G. gaucha, G. glieschi, G. goettei, G. guacensis, G. hina, G. incognita, G. irua, G. itatiayana, G. jandira, G. joia, G. ladislavii, G. lama, G. lambaya, G. lareta, G. leucophryna, G. livia, G. marginata, G. marmorata, G. mayori, G. metzi, G. mirim, G. mixopulla, G. multicolor, G. multipunctata, G. nigra, G. notocelis, G. notophtalma, G. pavani, G. phocaica, G. pichuna, G. picta, G. placilla, G. poca, G. polyophthalma, G. preta, G. pseudovaginuloides, G. quagga, G. quenua, G. quichua, G. regia, G. riesteri, G. rufiventris, G. ruiva, G. saima, G. schubarti, G. shapra, G. suva, G. takia, G. talpa, G. tamboensis, G. tamoia, G. tapira, G. taxiarcha, G. tirua, G. toriba, G. trigueira, G. ubaquensis, G. vaginuloides, G. vicuna, G. yara Genus Geoplana; subgenus Barreirana G. (B) barreirana, G. (B) zebroides, G. (B) elegans, G. (B) cafusa, G. (B) cassula Genus Gigantea G. gigantea, G. chiriquii, G. idaia, G. montana, G. picadoi, G. sandersoni, G. vongunteni, G. cameliae, G. bistrata, G. unicolor Genus Pasipha P. astraea, P. biseminalis, P. caeruleonigra, P. chimbeva, P. hauseri, P. oliveroi, P. pasipha, P. penhana, P. pinima, P. plana, P. rosea, P. splendida, P. velutina, P. chilensis, P. aphalla, P. diminutiva, P. ercilla, P. pulchella, P. tapetilla, P. trina, P. velina, P. weyrauchi Genus Notogynaphallia N. abundans, N. albonigra, N. fita, N. marginata, N. muelleri, N. plumbea, N. andina, N. atra, N. bergi, N. caissara, N. froehlichae, N. garua, N. goetschi, N. matuta, N. meixneri, N. modesta, N. mourei, N. nana, N. nataliae, N. octostriata, N. parca, N. quintestriata, N. schultzei, N. sexlineata, N. sexstriata, N. tuxaua Genus Amaga A. amagensis, A. becki, A. bogotensis, A. buergeri, A. bussoni, A. contamanensis, A. libbieae, A. olivacea, A. ortizi, A. righii, A. ruca Genus Choeradoplana C. iheringi, C. catua, C. marthae, C. langi, C. bilix, C. ehrenreichi Genus Geobia G. subterranea Genus Issoca I. rezendei, I. jandaia, I. piranga, I. potyra, I. spatulata Genus Gusana G. cruciata, G. lata, G. platei Genus Liana L. guasa Genus Enterosyringa E. pseudorhynchodemus Genus Xerapoa X. hystrix, X. una Genus Polycladus P. gayi Genus Pseudogeoplana P. albopunctata, P. andicola, P. atropurpurea, P. bilinearis, P. bilineata, O. blanchardi, P. bohlsi, P. bonita, P. brasiliensis, P. brittlebanki, P. burri, P. cardosi, P. collini, P. columbiana, P. distinct, P. doederleini, P. ehlersi, P. elongate, P. eugeniae, P. flava, P. goeldii, P. gollmeri, P. gonzalezi, P. halbani, P. lumbricoides, P. maculate, P. maximiliani, P. meyerhansi, P. nephelis, P. nigrocephala, P. nigrofusca, P. nobilis, P. obscura, P. octolineata, P. oerstedi, P. pallid, P. panamensis, P. pardalina, P. pavonina, P. perspicillata, P. pulla, P. reticulata, P.riedeli, P. rosenbergi, P. rostrata, P. sagittata, P. schirchi, P. semilineata, P. stolli, P. taenioides, P. theresopolitana, P. tricolor, P. tristriata, P. ucayalensis, P. wetzeli E. M. Froehlich & Group 1 N. plumbea, N. sexstriata, N. garua, N. albonigra, N. parca, N. mourei, N. froehlichae Leal-Zanchet (2003) Group 2 N. ceciliae, G. marginata Graff, 1899, G. marginata Marcus, 1951, N. abundans, N. muelleri, N. caissara, N. fita, N. guaiana No classification N. nataliae, N. atra, N. andina, N. modesta, N. quinquestriata, N. goetschi, N. matuta, N. tuxaua Leal-Zanchet & E. Group 2 N. ernesti, N. graffi, N. guaiana, N. muelleri, N. fita, N. caissara, N. ceciliae, N. abundans M. Froehlich (2006) Lemos & Leal- Group 2 N. ernesti, N. graffi, N. guaiana, N. muelleri, N. fita, N. caissara, N. ceciliae, N. abundans, N. arturi, Zanchet (2008) N. pseudoceciliae Carbayo (2010) Genus Luteostriata L. abundans, L. ernesti, L. ceciliae, L. caissara, L. graffi, L. muelleri, L. fita Carbayo, F., Álvarez-Presas, M., Olivares, C.T., Marques, F.P.L., Froehlich, E.M. & Riutort, M. (2013). Molecular phylogeny of Geoplaninae (Platyhelminthes) challenges current classification: proposal of taxonomic actions. —Zoologica Scripta, 00, 000–000.

DOI: 10.1111/zsc.12019

Acknowledgements. We thank Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio), Instituto Estadual do Ambiente do Governo do Rio de Janeiro (INEA), Instituto Florestal do Governo do Estado de São Paulo (IF), Departamento de Águas e Energia Elétrica do Governo do Estado de São Paulo (DAEE), Museu de Zoologia da Universidade de São Paulo (MZUSP), Fundação do Meio Ambiente do Governo Estado de Santa Catarina (FATMA) for sampling licence in Reserva Biológica Augusto Ruschi, Parque Nacional da Serra dos Órgãos, Parque Nacional Serra da Bocaina, Parque Nacional Saint Hilaire/Lange, Parque Nacional da Serra de Itajaí, Floresta Nacional de São Francisco de Paula (ICMBio); Parque Estadual do Desengano (INEA); Parque Estadual Alberto Löfgren, Parque Estadual Serra da Cantareira, Parque Estadual Intervales (IF), Parque Ecológico do Tietê (DAEE), Estação Biológica de Boraceia (MZUSP); Parque Estadual da Serra do Tabuleiro (FATMA).