An Investigation of the Effect of Chitosan-Based Materials on Skin Wound Healing

AN INVESTIGATION OF THE EFFECT OF CHITOSAN-BASED MATERIALS ON SKIN WOUND HEALING

Yaolei Mi

A thesis presented in fulfilment of the requirements for the degree of Master by Research

Graduate School of Biomedical Engineering

Sydney, Australia

July 2017 PLEASE TYPE THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet

Surname or Family name: Mi

First name: Yaolei Other name/s:

Abbreviation for degree as given in the University calendar: ME

School: Graduate school of Biomedical Engineering Faculty: Engineering

Title: An investigation of the effect of chitosan-based materials on skin wound healing

Abstract 350 words maximum: (PLEASE TYPE)

Chronic wounds fail to undergo an orderly and timely reparative process. Currently, there are no effective treatments for chronic wounds. The heparan sulphate (HS) proteoglycan (HSPG), perlecan, plays an important role in healing chronic wounds through binding and signalling of growth factors. Biomimetic materials that mimic naturally occurring HS may find application in the delivery of growth factors for skin wound healing. Chitosan is a polysaccharide with a similar structure to HS, with the exception of sulphate modifications. This thesis explored the effect of chitosan-arginine (CH-Arg), a water soluble form of chitosan, modified with different levels of sulphate substitution on skin wound healing. Specifically, this thesis investigated the effect of sulphated CH-Arg on the expression of extracellular matrix (ECM) components including perlecan produced by human keratinocytes dermal fibroblasts in 20 and 30 skin models. Perlecan produced by both skin cell types was full-length perlecan decorated with HS and chondroitin sulphate (CS) chains. In addition, smaller fragments of perlecan were present in the fibroblast samples. Exposure to highly sulphated CH-Arg (HS-CH-Arg) increased the perlecan expression in both skin cell types. CH-Arg-based materials did not alter the proliferation of either skin cell type, while sulphated CH-Arg significantly (p <0.05) enhanced keratinocyte migration, demonstrating that the sulphated CH-Arg materials promoted keratinocyte migration. An in vitro skin model was established with similar expression in basement membrane components, proteoglycans and glycosaminoglycans to human adult skin, as well as a well-developed mimicked epidermis. CH-Arg-based materials significantly (p <0.05) enhanced the epidermal thickness, indicating their role in epidermal formation. In addition, sulphated CH-Arg enhanced the expression of perlecan, laminin, collagen type IV, syndecans-1 and -4 and HS with the exception of serglycin. Thus, CH-Arg-based materials have the potential to mimic HS and promote skin wound healing with respect to enhancing re-epithelialisation and the formation of ECM molecules.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or partof this thesis or dissertation.

I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).

R ...... qvv...... 2-110�-1...... , ..... Witness Date . Signature The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

FOR OFFICE USE ONLY Date of completion of requirements for Award:

THIS SHEET IS TO BE GLUED TO THE INSIDE FRONT COVER OF THE THESIS

‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'

Signed ……………………………………………......

Date ……………………………………………......

AUTHENTICITY STATEMENT

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ……………………………………………......

Date ……………………………………………......

ABSTRACT

(CH-Arg), a water soluble form of chitosan, modified with different levels of sulphate substitution on skin wound healing. Specifically, this thesis investigated the effect of sulphated CH-Arg on the expression of extracellular matrix (ECM) components including perlecan produced by human keratinocytes dermal fibroblasts in 2D and 3D skin models.

Perlecan produced by both skin cell types was full-length perlecan decorated with HS and chondroitin sulphate (CS) chains. In addition, smaller fragments of perlecan were present in the fibroblast samples. Exposure to highly sulphated CH-Arg (HS-CH-Arg) increased the perlecan expression in both skin cell types. CH-Arg-based materials did not alter the proliferation of either skin cell type, while sulphated CH-Arg significantly

(p <0.05) enhanced keratinocyte migration, demonstrating that the sulphated CH-Arg materials promoted keratinocyte migration.

An in vitro skin model was established with similar expression in basement membrane components, proteoglycans and glycosaminoglycans to human adult skin, as well as a well-developed mimicked epidermis. CH-Arg-based materials significantly (p <0.05) enhanced the epidermal thickness, indicating their role in epidermal formation. In ii

addition, sulphated CH-Arg enhanced the expression of perlecan, laminin β1, collagen type IV, syndecans-1 and -4 and HS with the exception of serglycin. Thus, CH-Arg- based materials have the potential to mimic HS and promote skin wound healing with respect to enhancing re-epithelialisation and the formation of ECM molecules.

iii

Acknowledgements

First and foremost, I would like to express my most sincere gratitude to my supervisor,

Assoc. Prof. Megan Lord, and my co-supervisor, Dr. Brooke Farrugia. Thank you for your guidance, patience and constant support throughout the duration of my Master by

Research studies. Thank you for persevering with me and continuing to believe in my ability.

I would also like to thank Prof. John Whitelock, Dr. Jelena Rnjak-Kovacina and Dr.

Fengying Tang. Thank you for your valuable suggestions during the group meetings and sharing your fantastic research experiences with me. These experiences led me a further step to being a real researcher.

I would like to thank Prof. Robert O’Grady for your patient review and detailed comments for my thesis drafts to lead to the thesis with less-grammatical errors and more scientific discussion. Thank you for your humour and wisdom which inspired me all the time.

My thanks also go to all the other team members including James Vassie, Xiaoting Lin,

Chun-yi Ng, Keerthana Chandrasekar, Joel Yong, Kumar Sutradhar, HaNa Kim and

Ophelia Huang. Thank you for your emotional support and help during this project.

Thank you also for your company in/out of the lab, leading to me enjoying myself during the whole research journey. Thanks to all the GSBME staff for their full supporting for the project processing, and thanks to Kajal Chaudhry, Liyuan Wang, Jane

Li, Tianruo Guo, and all my friends in GSBME for their assistance and the spare time we spent together.

I would like to thank all my friends from regardless of being from China, Australia and other countries. Thanks for looking after me and company all the time. iv

Most importantly, acknowledgements go to my parents and family for your constant love and care through and beyond this journey. Nothing I have achieved could have been possible without their full love and support.

Table of contents

ABSTRACT ...... i Acknowledgements ...... iii Table of contents ...... v List of Figures ...... viii List of Tables ...... xiii Abbreviations ...... xiv Chapter 1 : Introduction and Literature Review ...... 1 1.1 Introduction ...... 1 1.2 Skin Wound Healing ...... 2 1.2.1 Haemostasis ...... 3 1.2.2 Inflammation ...... 4 1.2.3 Proliferation ...... 5 1.2.4 Wound Contraction and Remodelling ...... 6 1.2.5 The Role of Keratinocytes and Fibroblasts in Skin Wound Healing ...... 7 1.3 ECM Molecules ...... 8 1.3.1 The BM ...... 10 1.3.2 ECM HSPGs ...... 18 1.3.3 GAGs ...... 19 1.4 Syndecans ...... 22 1.5 Serglycin ...... 23 1.6 Growth Factors Involved in Skin Wound Healing ...... 23 1.7 Chitosan ...... 26 1.7.1 The role of chitosan in skin wound healing ...... 26 1.7.2 Derivatives of Chitosan for wound healing ...... 28 1.8 Summary ...... 31 Chapter 2 : Materials and Methods ...... 33 2.1 Materials ...... 33 2.1.1 Antibodies and enzymes ...... 34 2.2 Methods ...... 36 2.2.1 Isolation of Fibroblasts and keratinocytes from human skin ...... 36 2.2.2 Cell Culture ...... 37 2.2.3 Chromatography ...... 38 vi

2.2.4 Bradford Protein Assay ...... 39 2.2.5 Mass Spectrometry ...... 39 2.2.6 Enzyme Linked Immunosorbent Assay (ELISA) ...... 40 2.2.7 Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis (SDS-PAGE) ...... 41 2.2.8 Western Blotting (WB) ...... 42 2.2.9 Immunocytochemistry (ICC) ...... 43 2.2.10 Gene expression of perlecan from cell lines ...... 44 2.2.11 Surface Plasmon Resonance ...... 47 2.2.12 Cell Proliferation Assay (MTS assay) ...... 48 2.2.13 Migration assay ...... 48 2.2.14 3D Skin Model ...... 49 2.2.15 Immunohistochemistry ...... 50 2.2.16 Statistical Analyses ...... 51 Chapter 3 : Characterisation of perlecan produced by keratinocytes and fibroblasts ..... 52 3.1 Expression of HSPGs produced by keratinocyte and fibroblast cells ...... 52 3.2 The structure of perlecan produced by HaCaT cells and human primary dermal fibroblast cells ...... 61 3.2.1 The structure of perlecan produced by HaCaT cells ...... 61 3.2.2 The structure of perlecan produced by human primary dermal fibroblast cells ...... 65 3.3 Binding activities between growth factors and perlecan derived from different cellular origins ...... 69 3.4 The effect of chitosan-based materials on the expression of perlecan produced by HaCaT and human primary dermal fibroblast cells ...... 74 Chapter 4 : The effect of chitosan-based materials on 2D and 3D skin models ...... 82 4.1 The effect of the chitosan-based materials on cell proliferation and migration .... 82 4.2 A comparison of expression of proteoglycans, basement membrane components and GAGs in human adult skin compared to an in vitro skin model ...... 88 4.2.1 The general structure of human adult skin and in vitro skin model ...... 89 4.2.2 A comparison of the expression of BM components between human adult skin and the in vitro skin model ...... 92 4.2.3 A comparison of the expression of cell surface PGs between human adult skin and the in vitro skin model ...... 98 4.2.4 A comparison of the expression of serglycin between human adult skin and the in vitro skin model ...... 101 vii

4.2.5 A comparison of the expression of HS between human adult skin and in vitro skin model ...... 102 4.2.6 The isotype and secondary antibody controls for both human adult skin and the in vitro skin model ...... 106 4.3 A comparison of the expression of PGs, BM components and GAGs in the in vitro skin model following exposure to chitosan-based materials ...... 110 4.3.1 The overall structure of the in vitro skin model following exposure to chitosan-based materials ...... 110 4.3.2 The expression of BM components in the in vitro skin model following exposure to chitosan-based materials ...... 115 4.3.3 The expression of cell surface PGs in the in vitro skin model following exposure to chitosan-based materials ...... 122 4.3.4 The expression of serglycin in the in vitro skin model following exposure to chitosan-based materials ...... 127 4.3.5 The expression of HS in the in vitro skin model following exposure to chitosan-based materials ...... 129 4.3.6 The isotype and secondary antibody controls in the in vitro skin model following exposure to chitosan-based materials ...... 133 Chapter 5 : Discussion ...... 136 5.1 Expression, localisation and structure of HSPG, perlecan, secreted by human keratinocytes and human dermal primary fibroblasts ...... 136 5.2 The effect of chitosan-based materials on the expression and localisation of perlecan secreted by keratinocytes and human dermal primary fibroblasts ...... 140 5.3 The effect of chitosan-based materials on the proliferation and migration of human keratinocytes and human dermal primary fibroblasts ...... 145 5.4 A comparison of the expression of PGs, BM components and GAGs between human adult skin and an in vitro skin model ...... 149 5.5 A comparison of the expression of proteoglycans, BM components and GAGs in the in vitro skin model following exposure to chitosan-based materials ...... 154 Chapter 6 : Conclusions and recommendations for future work ...... 159 6.1 Recommendations for future work ...... 160 Reference ...... 161

viii

List of Figures

Figure 1.1: Phases of wound healing...... 3

Figure 1.2: Skin anatomy...... 8

Figure 1.3 Cellular microenvironment showing main and specific components of ECM..

...... 9

Figure 1.4: The schemes of proteoglycans which are present in ECM...... 10

Figure 1.5: The four major components of BM...... 11

Figure 1.6: A schematic diagram of perlecan...... 17

Figure 1.7: A schematic diagram of glycosaminoglycans...... 22

Figure 1.8: Synthesis of sulphated chitosan...... 29

Figure 1.9: Schematic of sulphation of arginine chitosan...... 30

Figure 3.1: Anion exchange chromatography for the enrichment of PGs in (A) HaCaT and (B) human primary dermal fibroblast conditioned media...... 54

Figure 3.2:WB analysis for the presence of HSPGs in both PG enriched samples derived from HaCaT (A) and fibroblast cell (B) conditioned media...... 57

Figure 3.3: ELISA performed on both HaCaT-derived and fibroblast-derived PGs...... 58

Figure 3.4: ELISA performed on both HaCaT-derived and fibroblast-derived PGs...... 59

Figure 3.5:WB analysis for the presence of perlecan in both PG enriched samples derived from HaCaT (A) and fibroblast cell (B) conditioned media...... 60

Figure 3.6: ELISA analysis of HaCaT-derived PG enriched fraction for the presence of perlecan domains...... 62

Figure 3.7: WB analysis for the presence of perlecan in PG enriched HaCaT conditioned medium...... 63

Figure 3.8: Analysis of HSPG2 mRNA expressed by HaCaT cells...... 64 ix

Figure 3.9: ELISA performed on DEAE enriched human primary dermal fibroblast conditioned medium...... 65

Figure 3.10: WB analysis for the presence of perlecan in dermal fibroblast-derived PGs.

...... 67

Figure 3.11: Analysis of HSPG2 mRNA expression by dermal fibroblast cells ...... 68

Figure 3.12: HaCaT-derived PG enriched fraction for perlecan by IAC (5D7-2E4- conjugated column)...... 70

Figure 3.13: Growth factor binding analyses of endothelial perlecan by linking the perlecan to a BIAcore gold chip...... 72

Figure 3.14: Growth factor binding analyses of endothelial perlecan by linking the perlecan to a BIAcore gold chip...... 73

Figure 3.15: Immunolocalisation of perlecan in HaCaT cells exposed to cell culture medium alone or supplemented with CH-Arg, LS-CH-Arg, HS-CH-Arg or heparin for 4 and 24 hours...... 76

Figure 3.16: Immunolocalisation of perlecan in human primary dermal fibroblast cells exposed to medium alone or supplemented with CH-Arg, LS-CH-Arg, HS-CH-Arg or heparin for 4 and 24 hours...... 78

Figure 3.17: Quantitative PCR analysis of HSPG2 gene expression in HaCaT(A) and human primary dermal fibroblast (B) cells...... 80

Figure 4.1: The proliferation of keratinocytes (A) and dermal fibroblast cells (B) ...... 83

Figure 4.2: Representative images of the migration of keratinocytes...... 86

Figure 4.4: Representative images of H&E staining of both human adult skin (A) and the in vitro skin model (B)...... 91

Figure 4.5: Immunohistochemical analyses of perlecan in adult human skin (A) and in vitro skin model (B)...... 93

Figure 4.6: Immunohistochemical analyses of laminin β1 in adult human skin (A) and in vitro skin model (B)...... 95

Figure 4.7: Immunohistochemical analyses of laminin 5 in adult human skin (A) and the in vitro skin model (B)...... 96

Figure 4.8: Immunohistochemical analyses of collagen type IV in adult human skin (A) and the in vitro skin model (B)...... 97

Figure 4.9: Immunohistochemical analyses of syndecan-1 in adult human skin (A) and the in vitro skin model (B)...... 99

Figure 4.10: Immunohistochemical analyses of syndecan-4 in adult human skin (A) and the in vitro skin model (B)...... 100

Figure 4.11: Immunohistochemical analyses of serglycin in adult human skin (A) and the in vitro skin model (B)...... 102

Figure 4.12: Immunohistochemical analyses of HS chains (clone 10E4) in adult human skin (A) and the in vitro skin model (B)...... 104

Figure 4.13: Immunohistochemical analyses of HS stubs (clone 3G10) in adult human skin and in vitro skin model...... 105

Figure 4.14: The controls included probing with mouse IgG (i), mouse IgM (ii) and rabbit IgG (iii) isotype antibodies...... 107

Figure 4.15: The controls were carried out with sections probed without primary antibodies with biotinylated mouse IgG (i), mouse IgM (ii) and rabbit (iii) secondary antibodies ...... 108 xi

Figure 4.16: H&E staining for the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and HS-CH-Arg for 3 weeks...... 113

Figure 4.17: Analyses of the thickness of the mimicked epidermis and the FSB in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg,

LS-CH-Arg, and HS-CH-Arg for 3 weeks...... 114

Figure 4.18: Immunohistochemical analyses of perlecan in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks...... 116

Figure 4.19: Immunohistochemical analyses of laminin in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks...... 118

Figure 4.20: Immunohistochemical analyses of collagen IV in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks...... 120

Figure 4.21: Immunohistochemical analyses of syndecan-1 in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks...... 123

Figure 4.22: Immunohistochemical analyses of syndecan-4 in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks...... 125

Figure 4.23: Immunohistochemical analyses of serglycin in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks...... 128 xii

Figure 4.24: Immunohistochemical analyses of HS chains in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks...... 130

Figure 4.25: Immunohistochemical analyses of HS stubs in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks...... 132

Figure 4.26: The controls were conducted by using mouse IgG (i) and rabbit IgG (ii) isotype antibodies, and (iii) without primary antibodies ...... 134

xiii

List of Tables

Table 1.1: Nomenclature for laminin isoforms which are present in the BM of stratified epithelia...... 14

Table 1.2: Growth factors involved in wound healing...... 25

Table 2.1: The degree of sulphation of CH-Arg from the calculation of X-ray photoelectron spectroscopy data ...... 34

Table 2.2: A list of primary antibodies used in this project and their details...... 35

Table 2.3: Primers for PCR used in this project...... 46

Table 3.1: Concentration, mass and yield of PG enriched samples from HaCaT and human primary dermal fibroblast conditioned medium...... 55

Table 3.2: HSPGs and laminin present in PG enriched samples and immunopurified

HaCaT-derived perlecan detected by peptide LC-MS2 from an in-solution tryptic digestion...... 56

Table 3.3: HSPGs and laminins present in immunopurified HaCaT-derived perlecan detected by peptide LC-MS/MS from an in-solution tryptic digestion...... 71

xiv

Abbreviations

CH-Arg Arginine functionalised chitosan

HS-CH-Arg Arginine functionalised chitosan with high degree sulphation

LS-CH-Arg Arginine functionalised chitosan with low degree sulphation

BM Basement membrane

BSA Bovine serum albumin

S-CH Chitosan modified with sulphate groups

CS Chondroitin sulphate

C’ase ABC Chondroitinase ABC

DEAE Diethylaminoethyl Anion-Exchange

DMF Dimethyl Formamide

DMEM Dulbecco’s modified Eagle’s medium

DS Dermatan sulphate

ECM Extracellular matrix

EGF Epidermal Growth Factor

ELISA Enzyme linked immunosorbent assay

FBS Fetal Bovine serum

FGF Fibroblast Growth Factor

FGFR Fibroblast Growth Factor receptor xv

GAG Glycosaminoglycan

HA Hyaluronan

H’ase III Heparinase III

H&E Hematoxylin & Eosin

HS Heparan sulphate

HSPG Heparan sulphate proteoglycan

IAC Immunoaffinity chromatography

ICC Immunocytochemistry

IHC Immunohistochemistry

IGF-1 Insulin-like growth factor-1

KGF Keratinocyte growth factor

KS Keratin sulphate

LDL Low density lipoprotein

MS Mass spectrometry

PG Proteoglycan

PDGF Platelet Derived Growth Factor

PBS Phosphate-buffered saline

PCR Polymerase Chain Reaction

PF4 Platelet factor 4 xvi

RT Room temperature

SMC Smooth Muscle Cell

SA-HRP Streptavidin-horse radish peroxidase

SPR Surface plasmon resonance

TGF-β Transforming Growth Factor- β

VEGF Vascular endothelial growth factor

WB Western Blotting

Chapter 1 : Introduction and Literature Review

1.1 Introduction

Non-healing wounds have an increasing impact for both the patient and the society [1].

A delay in wound healing may be due to obesity, and chronic diseases, such as diabetes, cardiovascular disorders, autoimmune diseases or age and dramatically increase the risk of developing chronic wounds [2, 3]. In fact, the morbidity and cost of chronic wounds are considerable. Chronic wounds affected 6.5 million people and generated an annual cost of approximate $20 billion dollars in the United Stated of America in 2009 [1, 2].

The world demand for wound management products is projected to increase 5.3% annually to $39.3 billion in 2016 [4, 5]. The total cost of chronic wounds in Australia was approximately $2.85 billion annually [6].

There has been an increase in the number of wound dressings, biopharmaceutical formulations, and skin substitutes available in the market over the last decades. There are, however, no effective clinical treatments for chronic wounds currently [7, 8].

Growth factors, as pivotal signalling molecules regulating tissue repair and regeneration, have drawn particular attention [9, 10]. Although the effect of a number of growth factors on skin wound healing has been identified, their applications to the clinic have been very limited, largely due to the issues of cost-effectiveness and safety. The lack of appropriate delivery systems, leading to growth factors being used at supra physiological level, might be the main reason for these problems [11-13]. Though the levels of growth factors, such as platelet-derived growth factor (PDGF) and PDGF receptor, have been shown to be low in diabetic and aged mice, excessive use of PDGF may give rise to increased risk of cancer [14]. Therefore, the design of controlled release of growth factors to the physiological level is an ongoing challenge. 2

The use of biomimetic materials, as growth factor delivery vehicles, is hypothesised to play a key role in regenerating injured tissue. Chitosan, which is a deacetylated derivative of chitin, is one such biomimetic material that has been numerously studied for chemical modifications and biomedical applications [15, 16]. Although previous studies on the use of chitosan derivatives for wound healing, including either arginine or/and sulphated functional groups, have been reported, little has been reported on the combined effects of the two [17-21].

This literature review focuses on the process of skin wound healing, by identifying key components such as basement membrane (BM), extracellular matrix (ECM) molecules and growth factors involved. The effects of Chitosan derivatives on wound healing have also been explored.

1.2 Skin Wound Healing

Skin is the largest organ of the human body as the outermost and vital protective barrier against the environment [22]. A wound is a disruption to the epithelial integrity of the skin and may result from a precise break of the tissue by an incision to widespread damage of tissue. A wound is accompanied by disruption of the normal anatomical structure and function. Skin wound healing is a dynamic and interactive biological process. Two basic responses may occur following an injury regardless of how the injury has been sustained: being spontaneous regeneration of epidermal and dermal tissue, and connective tissue repair [23]. The regeneration occurs when the organism is capable of replacing the damaged tissue with what was there before the injury [24]. The mode of repair is primarily determined by the depth of the tissue involved. In minor wounds involving the epidermis, the tissue is regenerated via the process of reepithelialisation [23], whereas in injuries involving the loss of dermal tissue, the 3

wound deficit is complemented with the formation of connective tissue. Connective tissue repair occurs in normal repair, excessive healing, and deficient healing. When excessive connective tissue matrix is deposited, it will result in the alteration of structure and the loss of function, such as fibrosis. During deficient healing, the connective tissue matrix deposited may be insufficient and therefore, the tissue becomes weakened and easily falls apart, such as chronic non-healing ulcers [24]. A normal healing cascade (Figure1.1) is the typical response that most humans experience following injury [24]. It is classically divided into four overlapping phases— haemostasis, inflammation, proliferation, and remodelling [23, 25-27].

Figure 1.1: Phases of wound healing. Adopted from: Clark RA. In: Goldsmith LA, ed.

Physiology, biochemistry, and molecular biology of the skin, 2nd edn, vol. 1. New York:

Oxford University press, 1991.p577 [25].

1.2.1 Haemostasis

Tissue injury leads to the disruption of blood vessels and extravasation of blood into the wound. Platelets play a crucial role in this phase, not only by aggregating in the clot to 4

limit further blood loss, but also by releasing growth factors, cytokines, chemokines, and hormones to further mediate the healing cascade. The growth factors include PDGF, insulin-like growth factor-1(IGF-1), epidermal growth factor (EGF), transforming growth factor-β (TGF-β), and platelet factor 4 (PF4). They attract and activate fibroblasts, endothelial cells and macrophages as well as mast cells to contribute to the subsequent wound healing cascade [25, 26].

1.2.2 Inflammation

The inflammatory phase controls bleeding and clears bacteria and debris from the wound, in order to prevent infection. This phase can be divided into early and late phases, based on the time and duration of the response and the types of inflammatory cells involved [25]. One characteristic of inflammation is the creation of oedema, where fluid leaks into the wound bed and the surrounding tissue. Vasoactive cytokines released by mast cells attract inflammatory leukocytes to the wound bed with associated vasodilation and increased capillary permeability. Neutrophils infiltrate into the wound, which is regulated through numerous chemical signalling mechanisms. Infiltrating neutrophils phagocytose microorganisms and other foreign particles in the wounded area, destroy bacteria and dead host tissue, and kill bacteria in the extracellular space by producing proteases [26]. Monocytes also migrate into the injury site and are activated to become macrophages to continue the wound cleansing process after disappearance of the neutrophils [28].

Macrophages play a pivotal role in the transition between inflammation and proliferation. They reach a peak concentration in a wound at 2-3 days after injury [26].

They are the primary producers of growth factors, such as PDGF, TGF-β, EGF, and basic fibroblast growth factor (FGF-2) [24, 25]. These growth factors are responsible 5

for stimulating angiogenesis, promoting the formation of granulation tissue as well as mediating the inflammatory response. They also produce proteolytic enzymes that are capable of degrading the extracellular matrix (ECM) to cleanse the wound [28].

Additionally, nitric oxide, which has an antimicrobial effect, is produced by macrophages due to the hypoxic wound environment [26]. Currently, the role of macrophages in the transition from inflammation to proliferation through the release of soluble messengers has drawn much interest.

1.2.3 Proliferation

There is not a defined line between the inflammatory phase and the proliferative phase.

Proliferation begins when haemostasis has been attained and the inflammatory response is controlled. This complex process embodies several steps including epithelialisation, the formation of granulation tissue, and neovascularisation [28].

In the process of epithelialisation, epithelial cells perform lateral movement towards the wound site to resurface the wound defect. The basement membrane (BM) and dermal cells follow with the epithelial cells [23, 28]. The migrating epidermal cells interact with numerous ECM molecules, such as fibronectin and vitronectin, through their integrin receptors. The ECM interacts with collagen type I at the edge of the wound site and interweave with fibrin clots in the wound space. Epithelial cells produce collagenase and plasminogen activator to degrade the ECM. At the wound margin, epithelial cells migrate over, where a variety of growth factors are involved including

EGF, TGF- α, and keratinocyte growth factor (KGF). Epithelial cells restore their morphology once tightly re-adhered to the reestablished and ordered BM [23, 28].

Granulation tissue begins to establish in the wound space approximately 3-5 days after injury. Numerous newly formed capillaries lead to its reddish appearance [25]. 6

Macrophages and fibroblasts migrate as well as blood vessels move into the wound site at the same time [28]. The macrophages cleanse the wound and supply growth factors necessary to stimulate fibroplasia and angiogenesis. The fibroblasts produce the new

ECM necessary to maintain cell ingrowth. The blood vessels provide the oxygen and nutrients necessary for cell metabolism. The newly formed ECM molecules, such as fibrin, fibronectin, and hyaluronic acid, provide a scaffold or path to allow cell migration, and further facilitate the formation of granulation tissue [26, 28].

Angiogenesis depends on not only the ECM in the wound site, but also mitosis and migration of endothelial cells [28]. Numerous molecules (e.g. FGF-1, FGF-2, vascular endothelial growth factor (VEGF), TGF-β, and angiogenin) are involved in this complex process [29]. In addition to these factors, endothelial receptors for the provisional matrix, and the expression and activity of proteases are necessary for angiogenesis. The BM at the wound site is digested into fragments which further facilitate endothelial cell migration and new blood vessel migration [28].

1.2.4 Wound Contraction and Remodelling

Wound contraction only occurs in open wounds, with a complex and orchestrated incorporation of ECM, cytokines and cells. Although there are several debated theories about how contraction occurs, all indicate that fibroblasts play a crucial role in this stage

[23]. One of these competing theories assumes that fibroblasts can be modified to a myofibroblast phenotype which tugs the wound edges together through the contractile force [28, 30].

The remodelling process follows with the formation of granulation tissue, [25] and may last for months or years [26]. When the collagen and other proteins deposit in the wound, the degradation of ECM through matrix metalloproteinases also occurs. 7

Therefore this process encompasses a balance between synthesis and degradation of wound matrix, which is regulated by fibroblasts [23-26, 28]. A continued synthesis and degradation of collagen may lead to a transition from the granulation tissue to an avascular scar. The appearance of a scar changes with the level of vascularity with time and the intermolecular cross-links increase in collagen remodelling. Eventually, they will regain a similar structure to unwounded tissue. However, wounds may never achieve the same strength as the unwounded tissue [24].

In summary, the normal healing cascade involves complex interactions of ECM molecules, soluble mediators, and various cell types, such as inflammatory cells, dermal and epithelial cells which together restore the damaged tissue [24, 27, 31].

1.2.5 The Role of Keratinocytes and Fibroblasts in Skin Wound Healing

Skin consists of three layers: the epidermis, dermis and hypodermis (Figure 1.2 A). The epidermis is further divided into four layers: the stratum basale, the stratum spinosum, the stratum granulosum, and the stratum corneum (Figure 1.2 B), where four cell types reside: keratinocytes, melanocytes, Langerhans, and Merkel cells. Some basal cells can generate suprabasal cells that further generate keratinocytes [32]. Keratinocytes are the principal cells of the epidermis, which dominate the phase of reepithelialisation. During the process of keratinisation they migrate up from the BM towards the stratum corneum.

They migrate on the upper layer of newly forming granulation tissue to contact the cells from the other side of the wound, which is regulated by their proliferation to the wound margin. Human skin keratinocytes induce the expression of cytokeratin as well as the matrix metalloproteinases through the interaction with collagen matrix [25, 32].

Figure 1.2: Skin anatomy. Skin (A) consists of epidermis, dermis and hypodermis. The epidermis (B) is divided into stratum basale, the stratum spinosum, the stratum granulosum, and the stratum corneum. Adapted from [32, 33].

The main components of the dermal matrix consist of collagen fibers, elastic fibers and extra-fibrillary matrix [25]. Fibroblasts are crucial in the synthesis, deposition, and remodelling of the ECM. They are stimulated to proliferate by growth factors released from macrophages. Once migrating into wounds, they start to synthesise ECM, which is necessary to support cell ingrowth. Collagen, which is the most abundant component in the ECM, provides strength to tissues. Myofibroblasts derived from the phenotypic modification of fibroblasts are responsible for the wound contraction [26].

1.3 ECM Molecules

ECM molecules, which consist of numerous acellular components, support the integrity of tissues and organs in aspects of structure and function [34]. They are assembled from components synthesised and deposited extracellularly, and interact tightly with growth factors, cytokines, as well as mechanical signals regulated through cell surface receptors

[35]. The ECM is not only tissue-specific, but also is heterogeneous [36]. The ECM is the largest component in normal skin and the synthesis of ECM is a key feature of 9

wound healing, especially when a significant loss of tissue has occurred. The ECM is composed of a variety of polysaccharides, water and collagen proteins which support the substantial elasticity and compressibility of skin. The ECM is comprised of the BM and the interstitial matrix. The interstitial matrix is present in the intercellular spaces

[36-38], while the BM is found basolaterally to cell monolayers (epithelium, mesothelium and endothelium) in the body. The ECM has two main macromolecules which are glycoproteins (including proteoglycans, (PGs)) and fibrous proteins, which are secreted by fibroblasts and epidermal cells. The main fibrous proteins include structural proteins such as the collagens and elastin, and adhesive glycoproteins such as

ﬁbronectin, vitronectin, and laminin. PGs (Figure1.4) are composed of a protein core post-translationally modified with one or more covalently linked glycosaminoglycan

(GAG) chains PGs found in ECM including perlecan, versican, decorin, biglycan, agrin, collagen type XVIII and aggrecan [36, 39, 40]. There are 4 families GAGs including chondroitin/ dermatan sulfate (CS/DS), heparan (HS)/ heparin, keratan sulfate (KS) and hyaluronan (HA) [41].

Figure 1.3: Cellular microenvironment showing main and specific components of ECM.

Adapted from [42]. 10

Figure 1.4: The schemes of proteoglycans which are present in ECM. Protein core

(brown), GAG side chains: HS (blue); CS/DS (yellow). Adapted from [40].

1.3.1 The BM

BM, which separates epithelial and endothelial monolayers from the underlying connective tissue, is a 50-to-100 nm layer with a highly specialised ECM [43]. It provides structural and signalling support to cells and acts as a diffusion barrier to maintain the integrity of tissue [43]. The BMs from different sources are unique in biological functions due to the heterogeneous molecular composition and biochemical complexity [44].

The skin BM physically separates the epidermis and dermis, supplying a dynamically stabilising interface and a mechanical barrier [45, 46] and containing unique structures that sustain the attachment of the epidermis [47]. The components of the attachment complex supply links to basal keratinocytes and to the ECM of the papillary dermis.

The skin BM consists of four main components: laminin, collagen type IV, nidogen and perlecan (Figure 1.5). 11

Figure 1.5: The four major components of BM. The four major components of BM include type IV collagen, laminin, nidogen and perlecan. As it is depicted, a type IV collagen protomer is composed of three α-chains; laminin heterotrimer consists of the α-β-γ- chain. Nidogen and perlecan schematic representation and respective domains are depicted. Adapted from [43].

Type IV collagen and laminin self-assemble and form distinct structures, whose noncovalent interconnection plays a crucial role in stabilising BM. Nidogen mainly functions as a molecular adaptor or catalyst, and perlecan bridges the laminin and type

IV collagen networks and enhances the stability and structural integrity of the BM.

Additionally, perlecan contains GAG chains which are involved in many interactions, including those with growth factors, ECM molecules and neuromusculular junction 12

proteins [48]. Furthermore, the perlecan core protein has been found to be associated with binding with growth factors and ECM matrix [49] , such as perlecan domain V cell adhesion site, α2β1 [50].

1.3.1.1 Collagen type IV

Type IV Collagen (Figure 1.5) is a non-fibrillar collagen that is the most abundant in the

BM. There are six genetically distinct isoforms of type IV collagen, known as α-chains

(α1-α6), which are all highly expressed in vertebrates. Each α-chain consists of an N- terminal 7S domain, a tripe helical collagenous domain with Gly-X-Y repeats, and C- terminal noncollagenous globular domain. The α1-, α3-, α5-chains are primarily found in the epithelial BM, whereas the α2- chain is predominantly present in skeletal and cardiac muscle BM, and the α4-chain is found in the vascular BM. A fundamental unit of type IV collagen is composed of three α-chains, which assemble to form type IV collagen network. The multiple fundamental units interact with each other to form a unique scaffold to further help the formation of the BM [43]. This collagen IV scaffold is essential for BM stability but unnecessary for initiation of its assembly during early development, whereas laminin is essential for the initial development of a BM in vivo

[51].

1.3.1.2 Laminin

Laminin is the second most abundant protein in the BM. Laminin isoforms are heterotrimeric proteins which consist of α-, β- and γ- chains. Five different α chains (α1

– α5), three different β-chains (β1- β3), and three different γ-chains (γ1- γ3), have been identified. The G domain, containing five LG domains, located at the C-termini of the

α-chain, is responsible for linking the ECM matrix to the cytoskeleton by binding to α- dystroglycan [52]. Studies have shown that laminin is deposited by keratinocytes onto 13

culture substratum. Exogenously Engelbreth-Holm-Swarm-derived laminin facilitated the attachment of human keratinocytes but remarkably inhibited the migration of cultured keratinocytes [53]. Laminin has been also shown to affect the proliferation and differentiation of many types of cells. It has been reported that several types of cells including keratinocytes and dermal fibroblasts were found to synthesise laminin [53,

54].

The expression of laminin isoforms performs a tissue-specific behaviour. Fifteen trimeric combinations of laminin, termed laminin 1 to laminin 15 [53-63], have been identified in BMs, some of which are found to be present in the BM of stratified epithelia, including laminin 1, 5, 6 and 10 (Table 1.1). Laminin 1 is the most abundant subtype of laminin present in the BM [54]. Laminin 1 was found to be present early during epithelial morphogenesis in most epithelial tissues, and continued to be present as a major epithelial laminin in some adult tissues including skin epithelial tissue [64].

The major role of laminin-1 in vivo is to affect epithelial cells, and that of laminin-1 in vitro is able to promote survival of a large variety of cultured cells, but the mechanism at the molecular level is still not clear [64]. Laminin-5, which is the main form of laminins in the skin and bladder, occurs in the BM of stratified epithelium. It has been reported that laminin-5 is able to accelerate keratinocyte migration and is essential to epidermal attachment. The basal keratinocytes in healthy skin are tightly connected via their hemidesmosomes, which are formed only in the presence of laminin-5 [65].

Laminin-5 has low affinity for nidogen, fibulin-1 and fubulin-2. Laminin-5 itself does not adhere to collagen IV, but is integrated into the BM by binding nidogen to the unique γ2 chain [65, 66]. Laminin-5 also is able to adhere to other glycoproteins such as syndecans and heparan sulphate proteoglycans (HSPGs). Since the laminin-5 deficiency results in impaired epidermal regeneration, wound healing can be accelerated by 14

providing briefly exogenous laminin-5 as scaffold for cell migration. For example, laminin-5, as well as other supportive factors, is released to the wound site by transplanting artificial skin equivalents [65]. Laminin-6, which is predominately synthesised by human keratinocytes, is restricted to in the BM of the dermal-epidermal junction in skin, but in non-epithelial BMs [53]. Laminin-6 may have a high affinity for nidogen due to sharing the same γ1-chain as laminin-1. Laminin-5 may bridge epidermal basal cells to the BM by α3β1 and α6β4 integrins and a laminin-5/6 complex

[66]. Laminin-5/6 complex likely plays an important role in epidermal-dermal adhesion by strongly binding affinity to the non-collagenous domain of type VII collagen [66].

Laminin Chain composition Reference laminin 1 α1β1γ1 [54] laminin 5 α3β3γ2 [58] laminin 6 α3β1γ1 [53] laminin 10 α5β1γ1 [60] Table 1.1: Nomenclature for laminin isoforms which are present in the BM of stratified epithelia.

It is considered that cells in many tissues may interact with more than a single laminin subtype [67]. Laminin α1, α3 and α5-chains are likely found in BMs to support the epithelial structures, while laminin α2 and α4 chains are more likely present from endothelial or mesenchymal origin [52]. The α5-chain, which also occurs at non- epithelial BM as well as α1-chain, appears to be the major α-chain in epithelial tissues,

The α3-chain occurs in laminin-5, -6, and -7, present in certain epithelial tissues such as skin, bladder, lung and oesophagus. The β1-chain is the most widespread among the β- chains, while the β2-chain occurs at the neuromuscular junction, glomerular mesangium, the alveolar BM and the BM surrounding Schwann cells. The β3-chain and

γ2-chains always combine together to form the laminin-5 subtype, which has been 15

reviewed above. The γ1-chain is the most common laminin chain, occurring in all BMs

[52, 65].

Laminin-5 and laminins with α5-chains dominate the laminin network in the epidermal

BM. The two networks, however, are physically connected by aggregated perlecan [45,

46, 68].

1.3.1.3 Perlecan

Perlecan, which is a multi-domain HSPG, is virtually present in all the BMs. The human perlecan protein core is approximately 467kDa and, together with four GAG attachment sites, the molecular weight can reach over 800 kDa [44, 50]. Overall, perlecan is able to interact with BM components and cell adhesion molecules [69, 70]. The human HSPG2 gene encompasses 97 exons, which generate the core protein of perlecan with five distinct domains (Figure 1.6) based on the sequence homology to other known proteins

[48, 71, 72].

The N-terminal domain I of perlecan has a unique protein sequence which is encoded by

5 distinct exons. It comprises three closely-spaced Ser-Gly-Asp sequences through which three GAGs chains are linked to the protein core [73]. The domain I of perlecan provides the structural support for HS chains which are responsible for the binding to

FGF1, 2, 7, 9, 10, and 18, as well as VEGF and PDGF [74-77]. Domain II of perlecan, which is encoded by 6 exons, is homologous to the class A low density lipoprotein

(LDL) receptor [48]. Domain II is considered as the binding site of LDL [78]. Domain

III of perlecan, which is encoded by 28 exons, has similarity to part of laminin α-chains, including three laminin domain IV-like modules and eight laminin EGF-like repeats.

Domain III interacts with endothelial cells through β 1 and β 3 integrins, indicating that domain III contains cognate integrin receptors [79]. In addition to this, domain III 16

contributes to binding ECM. The largest domain of perlecan, domain IV, which is encoded by 40 exons, comprises multiple Ig-like repeats. It has been reported that domain IV is also associated with binding to ECM components, such as laminin- nidogen complex, fibronectin and heparin [49, 78]. The C-terminal domain V of perlecan, which is encoded by 17 separate exons, has homology to the globular domain of laminin α-chain and agrin [50]. Domain V contains four EGF-like repeats and three laminin G domain-like modules where one potential GAG chain is located (Figure 1.6).

It should be noted that most research to date has focused on the role of domain V of perlecan. Domain V plays an important role in cell adhesion and matrix binding. Some studies indicate domain V may play a role in brain stroke as well as inhibition of tumors

[80]. Jung et al. [50] demonstrated that the fragmented perelcan including the domain V had the ability to regulate angiogenesis and matrix turnover, both major factors in wound healing. Much of our understanding of the biological activity of perlecan domain

V is derived from studies using a recombinantly expressed protein containing most of the perlecan domain V sequence that has been named endorepellin [81]. Domains III and V of perlecan also are responsible for binding to some growth factors. For example, domain III is capable of binding to FGF7, FGF18 and PDGF, while domain V can bind to progranulin and hedgehog, FGF 7 and PDGF [49].

Figure 1.6: A schematic diagram of perlecan. Perlecan consists of five domains decorated with GAG chains attachments on domain I [74, 80].

Perlecan functions in various aspects of developmental and biological processes, such as angiogenesis, chondrogenesis, endochondral ossification, establishment of cartilage and the regulation of the wound healing process [49]. Perlecan was found to be expressed in human and other mammalian skin [82, 83], suggesting that perlecan might play a role in skin biology. Perlecan binds and signals the activity of numerous growth factors, including FGF7 and colony stimulating factor 2, which are involved in human skin formation [69]. Perlecan may function as a backup of soluble factors to control the survival and differentiation of keratinocytes [69]. The disruption of perlecan expression either in the epidermis or the dermis was studied, revealing the important role of perlecan in regulating human epidermal morphogenesis [69]. These findings were also demonstrated by utilising the in vitro engineered human skin [69]. Perlecan deficiency, however, did not remarkably alter the deposition of major BM components, since a continuous linear expression of laminin and collagen IV was found [69, 84, 85]. These studies suggested a strong correlation between the presence of perlecan in the BM zone and epidermal formation. In order to understand the in vivo function of HS chains of 18

perlecan, the perlecan gene HSPG2 was mutated in mouse by gene targeting to remove the HS attachments sites at the N- terminus of perlecan while retaining the ability to express the intact core protein [86]. The study showed that the wound healing, as well as FGF-2-induced tumor growth and defective angiogenesis, was significantly delayed in mutant mice, indicating that HS carried by perlecan upregulated the angiogenesis in vivo[86].

1.3.2 ECM HSPGs

HSPGs, as the name implies, are glycoproteins first identified by one or more HS chains. According to their functions and locations, HSPGs can be divided into three groups: ECM, cell surface, and intracellular [87, 88]. The major HSPGs in the ECM are perlecan, which has been introduced above, collagen type XVIII and agrin.

HSPGs bind to ligands (cytokines, enzymes and their inhibitors, growth factors and

ECM proteins) usually through HS chains, while the protein core of HSPGs can also bind ligands. Drosophoila glypican ortholog binds with bone morphogenetic factor 4

[89]; the protein core of perlecan binds to some growth factors and ECM components

[90]. HSPGs help ligands form and mediate the ligand receptor complex as co-receptors

[91], and regulate the migration and adhesion of cells as endocytic receptors [92].

In wound healing, HSPGs mechanically function in absorbing water and preventing tissue compression [34, 93]. HSPGs may also directly influence inflammation, cell attachment and migration, and growth factor binding [94]. Furthermore, HSPGs may regulate BM permeability, epidermal proliferation, and dermal fibrosis to monitor the long-term quality of wound healing in skin [34]. Andriessen et al. [95] have assessed the roles of HSPGs in skin wound healing in human skin, particularly the correlation between the dynamics of the BM regeneration and HSPG expression. They have also 19

conducted qualitative changes in the re-expression of HSPGs at the BM zone during 2 weeks after dermal wounding and found a decrease in the presence of HS other than the expression of laminin and collagen [96]. These findings indicated a key role of HSPGs, in particular the pendant HS, in skin wound healing.

1.3.2.1 Collagen type XVIII

Collagen type XVIII is a hybrid proteoglycan which possesses the features of non- fibrillar collagens and proteoglycans. Collagen type XVIII is a homotrimer consisting of three identical α1 chains and it encompasses three binding sites for the attachment of

HS chains [44]. The expression of collagen type XVIII can be observed throughout the epithelial and vascular BM of human and mouse tissues, with a similar overall distribution to that of perlecan [97]. It was reported that collagen XVIII was able to compensate for the lack of perlecan in certain tissues, such as liver and kidney [69].

Collagen type XVIII may not be necessary for viability or fertility but is required for eye development as determined through the analysis of collagen type XVIII gene knockout in mice. BM thickening in a sub-line of Col18a1-/- mice indicated a role for collagen XVIII in the maintenance of the BM [98]. The lack of collagen XVIII enhanced angiogenesis during wound healing, but did not enhance tumour growth [44].

1.3.3 GAGs

As mentioned above, there are four families of GAGs: CS/DS, HS/heparin, KS, and

HA. GAGs are linear polysaccharides, whose disaccharide units consist of hexasamine and a uronic acid or galactose [40] (Figure 1.7). GAGs comprise only 0.1-0.3% of the total skin weight [99]. CS/DS and HS/heparin are O-linked to serine residues in the core protein. GAGs are cell-type specific, therefore a variety of compositions of GAGs can be decorated to even the same core protein. For example, perlecan expressed by 20

endothelial cells is almost exclusively decorated with HS chains, while perlecan has been reported to tri-decorate with HS/CS/KS in human embryonic kidney epithelial cells and human fetal chondrocytes [50, 77, 85, 100]. In contrast, perlecan expressed by human mast cells was decorated exclusively with CS [50]. Aggrecan is exclusively decorated with CS/DS chains [101]. KS consists of a sulphated poly-N- acetyllactosamine chain, divided into two types: KS I and KS II. PGs decorated with KS

I, such as lumican and keratocan, are primarily described in cornea, while PGs with KS

II, such as aggrecan, are mainly located in the skeleton [40]. Perlecan derived from epithelial cells and human foetal chondrocytes, was also reported to be substituted with

KS [77, 100].

HA is the only non-sulphated GAG not covalently linked to a protein core. HA is the major GAG in the epidermis [102] to support the proliferation of basal keratinocytes.

HA, also predominant in dermis, is mainly produced by fibroblasts. The activity of fibroblast can be in turn modulated by HA, mostly after HA binding to the HA receptor

CD44 [102]. The HA with high molecular weight maintains cell migration and proliferation, and cytokine production in human dermal fibroblasts [103-107]. Overall,

HA plays an important role in individual phases of wound healing and in regulating

ECM organisation and metabolism. HA-based biomaterials and inhibitors of HA-CD44 signalling pathways have produced promising results in the in vitro and the in vivo models of both wound healing and fibrosis [108].

HS and heparin are assembled from the same monosaccharide building units and consist of the same repeating disaccharide subunits through either α or β linkage to the alternating uronic/iduronic acid and glucosamine [109]. The primary structure of HS, however, differs significantly from that of heparin which has different proportions of disaccharide subunits and a higher SO4 content [110]. Heparin is exclusively 21

synthesised by mast cells and decorates the protein of serglycin [111, 112]. Heparin has been widely used in the clinic as a natural anticoagulant [87, 110], and has also been studied in other biological activities such as inhibition of angiogenesis and tumour growth.

HS is produced by most cells in the body [113]. The primary structure of HS is tissue- and cell type- specific [114]. The diversity of HS structures results in a variety of biological activities and functions, including cell adhesion, cell proliferation and growth, and cell surface binding of proteins. HS chains have a high affinity to numerous growth factors including FGF and EGF. HS chains may allow cells to regulate their responses to different growth factors. HS interacts with growth factors and their receptors to form complex heterotrimers to regulate the subsequent activities [115].

Rapraeger et al. [116]demonstrated that highly sulphated regions of heparin were notably more active than low sulphated regions of HS in FGF binding and mitogenesis.

A certain sulphated pattern is required for respective activities of HS, such as 6-O sulphation [117] for mitogenic activity, 2-O sulphation for FGF signalling pathways

[118]. HS oligosaccharides have been used to explore the structures of HS that bind to growth factors [115, 117]. These studies indicate that different growth factors may recognise the respective unique structure of heparin/HS. The first reported crystal structure of complexes of growth factor- heparin identified that the tetrasaccharide

∆UA(2S)-GlcNS(6S)-IdoA(2S)-GlcNS(6S) and hexasaccharide ∆UA(2S)-GlcNS(6S)-

IdoA(2S)-GlcNS(6S)-IdoA(2S)-GlcNS(6S) bound to FGF-2 [119]. It was also reported that the affinity of HS for FGFs was determined by the number and the position of specific sulphate groups [110, 120]. FGF2 required 2-O-sulphated but not 6-O- sulphated octasaccharides for binding, while both 2-O-sulphate and 6-O-sulphate in octasaccharides were necessary for FGF-7 binding activities [115]. Heparin/HS 22

enhances the affinity and half-life of FGF/FGFR complexes, which indicates that heparin/HS, or mimetics thereof, might be used to deliver FGFs as a therapeutic method

[115].

Figure 1.7: A schematic diagram of glycosaminoglycans. Glycosaminoglycans are composed of repeating disaccharide units via either α or β linkage to an N-acetylated or

N-sulphated hexosamine and either a uronic acid or galactose. [40]

1.4 Syndecans

The syndecans are a family of four transmembrane HSPGs that play a role in growth factor and ECM molecule binding as well as transmitting signals from the ECM to the intracellular cytoskeleton. Syndecan-1 and syndecan-3 are decorated with both HS and

CS, whereas, syndecan-2 and syndecan-4 are exclusively decorated with HS [40]. The expression of syndecan-1, syndecan-2 and syndecan-3 is present in a tissue-specific manner, while syndecan-4 is expressed in a variety of cells with a wide distribution. 23

Syndecan -1 is commonly found in skin epithelium, as well as other epithelial cells and cancer cells in adults [94, 121]. Syndecan-2 is abundant in mesenchymal tissues, liver and neuronal cells. Syndecan-3 is largely expressed in the neural system and some musculoskeletal tissue [41, 121, 122]. Wounds induced an increasing expression of syndecan-1 and syndecan-4 [123], which further stimulated keratinocyte [124] and endothelial cell migration and angiogenesis in mice [125].

1.5 Serglycin

Serglycin is an intracellular PG and is mainly found in hematopoietic and endothelial cells [126]. Serglycin is comprised of a protein core and the attached CS, HS and/ or heparin chains [127]. Serglycin is the most abundant PG produced by mast cells as well as other cells involved in inflammation, such as macrophages [127]. Serglycin produced by a sub-set of mast cells is the only source of heparin [113, 128]. Mast cells are widely distributed in the connective tissue at sites with a direct exposure to the environment such as skin. Serglycin was observed to be primarily within fibrous capsules in response to the implantation of chitosan, suggesting serglycin is able to be utilised to indicate where inflammatory cells have been activated in the tissue [127]. Serglycin plays an important role in granule formation and storage of chemokines, cytokines and proteases, which are crucial in the inflammatory phase of wound healing. After release from the cells, serglycin can be integrated into the ECM to regulate its activities or associate with surface of target cells [126].

1.6 Growth Factors Involved in Skin Wound Healing

It is acknowledged that a variety of growth factors exert significant effects during tissue regeneration; a number of them have also been reported to accelerate and improve the normal healing process. The sources and functions of major growth factors are 24

displayed in Table 1.2. Four growth factor families including the EGF, FGF, PDGF, and TGF-β families are released at the wound site and presumed to be a necessary part of the normal wound healing process [129]. In addition, VEGF and insulin growth factor (IGF) play important roles in wound healing [130]. EGF which was reported as a potent mitogen and maturation factor for epidermal cells, induces epithelial regeneration, increases collagen deposition and enhances granulation tissue formation.

The wound stimulates the expression of PDGF which is mitogenic for smooth muscle, endothelial and fibroblast cells [26, 129]. TGF-β is able to enhance granulation tissue formation and increase tensile strength of healing wounds [131, 132].

At least 22 distinct FGFs have been identified in vertebrates so far [133]. FGFs have a high affinity for HS which is required to regulate their cellular responses by activating and binding to growth factor receptors [76, 134]. FGFs can act as potent angiogenic factors for endothelial cells and are released at the wound site to speed up the epithelial repair. They also enhance vascularisation and reepithelialisation. FGF-2 induces the growth of keratinocytes, fibroblasts and endothelial cells in wound healing, and is the key component to bind with HS [91, 129, 135]. It also can accelerate granulation-tissue formation, increase fibroblast proliferation and collagen deposition [129, 136]. FGF-7 performs a different function from the other FGFs since it is mitogenic only for epithelial cells, but not for fibroblasts or endothelial cells. FGF7 mitogenic activity was reconstituted by exogenous perlecan in perlecan-deficient cells [137]. FGF-7 can accelerate keratinocyte migration in skin wound healing, signalling exclusively to cells through FGF receptor 2, and binding to HS and collagen [29, 138-141]. Beclapermin

(recombinant human PDGF) has been licensed for use in diabetic foot ulcers, applied in diabetic patients with non-infected foot ulcers up to 5 cm2 [11, 142]. FGF-2 has been 25

reported to have biological effects in chronic pressure ulcers [143], but no effect on diabetic foot ulcers.

As mentioned above, the major role of HS in the ECM is binding and signalling growth factors. For example, perlecan binds FGF-1, FGF2 and VEGF through HS [73]. It was reported that HS was essential for the formation of the FGF-FGFR complex, which was key in activating the FGF signalling process and extending the signal’s lifetime [144].

VEGF is secreted into the wound site by activated epidermal cells and macrophages during skin wound healing, and then binds to HSPGs to regulate neovascularisation during granulation tissue formation [144]. Furthermore, the protein core of perlecan also plays a role in growth factor binding activities, such as FGF-7, PDGF and FGF-18.

Specifically, FGF-7 binds to the N-terminal half of domain III of perlecan [137].

Growth factors Major source Function related to wound healing VEGF Platelets, neutrophils ▪ Stimulates angiogenesis in granulation tissue ▪ Stimulates formation of collateral blood vessel in peripheral vascular disease

FGFs Fibroblasts, endothelial cells, ▪ Proliferation of fibroblasts and epithelial cells; matrix deposition; wound smooth muscle cells, contraction; angiogenesis macrophages; also brain, pituitary ▪ Accelerates formation of granulation tissue KGFs Fibroblasts ▪ Proliferation and migration of keratinocytes EGF Platelets, macrophages, ▪ Differentiation, proliferation, migration and adhesion of keratinocytes keratinocytes; also saliva, urine, ▪ Formation of granulation tissue milk, plasma PDGF Platelets, fibroblasts, ▪ Mitogenic for smooth muscle cells, endothelial cells and fibroblasts macrophages, endothelial cells ▪ Chemoattractant for neutrophils and fibroblasts ▪ Fibroblasts proliferation and collagen metabolism TGF-β Platelets, macrophages, ▪ Mitogenic for fibroblasts and smooth muscle cells fibroblasts, neutrophils, ▪ Chemotactic for macrophages keratinocytes ▪ Stimulates angiogenesis (indirect) and collagen metabolism TNF Macrophages, mast cells, T- ▪ Fibroblasts proliferation lymphocytes IGF-1 Fibroblasts, plasma, liver ▪ Fibroblast proliferation ▪ Stimulates synthesis of sulphated proteoglycans and collagen HGF Fibroblasts, keratinocytes, ▪ Re-epithelialization endothelial cells, tumour cells ▪ Neovascularization ▪ Formation of granulation tissue Table 1.2: Growth factors involved in wound healing. Adapted from [25]. 26

1.7 Chitosan

Chitin is abundant in nature, such as crustaceans, insect and fungi. Chitosan is a deacetylated derivative of chitin, and can be modified with different degrees of deacetylation by chemical synthesis. Chitosan, which is a linear polysaccharide, consists of D-glucosamine either acetylated or deacetylated, via β-(1-4)-linkage. It is non-toxic, biodegradable and biocompatible [145]. Therefore it has been applied in various fields, such as cosmetics, food additives, agriculture, water purification, drug delivery systems and regeneration of tissues. Additionally, Yang et al. [146, 147] reported that chitosan efficiently facilitated salivary gland morphogenetic branching by mediating BM components and receptors to stimulate downstream signalling. The role of chitosan in skin wound healing has been drawing more researchers’ attention.

1.7.1 The role of chitosan in skin wound healing

The beneficial effect of chitosan on skin wound healing has been reported by using in vitro, animal, and clinical studies. Azuma, Izumi [16] summarised the in vitro studies of chitosan for wound healing from the aspects of proliferation, migration and production of different types of cells. Human keratinocyte cell line (HaCaT) viability and proliferation differed among chitosan with different molecular weights [148]. The proliferation of fibroblasts was strongly stimulated by chitosan with high degrees of deacetylation [149]. Chitosan and its oligomer inhibited the migration of a mouse fibroblast cell line (3T6), while they enhanced the migration of human vascular endothelial cells [150]. Chitosan varied the inflammatory response of mast cells to material implants, as well as other inflammatory cells such as macrophages [127].

Chitosan did not activate the human polymorphonuclear neutrophil cells [151] which 27

play an important role in regulating wound healing with chitosan treatment at the early phase of healing [152].

Chitosan exhibited an increasing granulation in open wounds on dogs during the early phase of skin wound healing [153] and significantly promoted skin regeneration [154].

Chitosan accelerated the healing of open skin wounds in rats by increasing the epithelialisation rate and organised deposition of collagen [155]. A rat model also was used to study the effect of chitosan on the early healing of burns [156]. This study showed that chitosan significantly prevented the extension of burns at the early phase.

The effect of chitosan dressings on blood loss, survival, and fluid use after severe liver injuries in swine was studied [157]. This study reported that a chitosan dressing decreased haemorrhage and enhanced survival after severe hepatic injury in swine.

Burkatovskaya et al. reported that a chitosan acetate bandage accelerated the healing of the excisional wounds in mice and exhibited an antimicrobial effect during the early wound period [158].

The soft pads of freeze-dried N-carboxybutyl chitosan were used to treat the donor sites of patients experiencing plastic surgery[159]. The results showed that a better-organised cutaneous tissue was formed and abnormal healing was reduced by chitosan treatment compared to the control donor sites without chitosan treatment. The effect of skin graft donor sites dressed with chitosan was evaluated by a comparison with a conventional dressing for 20 patients [160]. Chitosan was easy to apply and maintain and was painless when removed. Furthermore, for chitosan groups, both PGs and capillaries were formed in a looser connective tissue stroma in the papillary dermis. Additionally, chitosan led to a faster return of wound skin colour to normal skin colour. 28

1.7.2 Derivatives of Chitosan for wound healing

Chitosan is capable of being modified with multiple functional groups [161]. For instance, carboxymethyl chitosan [162], sugar-bound chitosan [163], thiolated chitosan

[164] and sulphated chitosan [20, 165] have been reported in the regeneration of tissues. Chitosan also can covalently bind with copper to form a nanocomposite to accelerate the wound healing process [166, 167]. Chitosan can be formed into nanofibers or nanoparticles [168], films, hydrogel, membrane, scaffold, ointment [169], solution and blending powder. The nanofibers have drawn more interest because of their outstanding performance including high surface-to-volume ratio, high mechanical strength, and unique optical properties [16]. Other formulations based on chitosan have also shown a beneficial effect for wound healing. In addition to these, there are numerous studies to combine other materials with chitosan to enhance its activities such as alginate/chitosan [170, 171] , heparin/chitosan [172, 173], gelatin/chitosan [174], collagen/chitosan [175] and growth factor/chitosan [176]. A water-soluble chitosan hydrogel was found to be more efficient than chitosan powder in skin repair because the chitosan-hydrogel resulted in skin with a higher tensile strength and better-arranged collagen fibers which were similar to normal skin [177]. Chitosan films containing minocycline hydeochloride exhibited a beneficial effect on rats with severe burn wounds during the early stage [178]. Chitosan/HA with high transparency showed a more effective acceleration of wound healing and reduced the reoccurrence of wounds after removing the dressing [179]. Chitosan/alginate was more stable to pH changes and could be effective in preventing bacterial infections on wounds with high exudation

[180]. A hybrid of chitosan and collagen improved cell migration in vitro, enhanced reepithelialisation and vascularisation, and increased the secretion of collagen IV as well as other cytokines [175]. 29

1.7.2.1 Sulphated Chitosan

Sulphated chitosan has been used as an anticogulant material, based on its similar structure to heparin [19, 20]. The activities of biomimetic HS in skin wound healing are increasingly investigated. Many methods used to synthesise sulphated chitosan have been shown in Figure 1.8 [21].

Figure 1.8: Synthesis of sulphated chitosan [21].

1.7.2.2 Arginine Functionalised Chitosan (CH-Arg)

CH-Arg has been studied in the aspects of anticoagulation, drug delivery, and gene delivery [181-186]. The amino acid arginine enhanced the production of nitric oxide to further positively influence the wound healing process in an in vitro wound model [17,

18]. In reference of this, arginine functionalised chitosan may be beneficial in the 30

wound healing process. CH-Arg leads to chitosan being water-soluble at physiological pH by providing an overall positive charge, and may also promote cell surface binding activities[187].

1.7.2.3 Arginine Functionalised Chitosan modified with sulphation (S-CH-Arg)

To date, little has been reported about the effect of S-CH-Arg on skin wound healing.

S-CH-Arg was successfully sulphated with a degree of sulphur substitution up to 9% and the method is shown in Figure 1.9[187]. S-CH-Arg was found to bind and signal

FGF-2, suggesting that S-CH-Arg with 9% of sulphation was able to replicate the naturally occurring FGF binding GAGs. This indicated that S-CH-Arg may have a potential application in skin wound healing.

Figure 1.9: Schematic of sulphation of arginine chitosan [187]. 31

1.8 Summary

Skin wound healing is a complex process that is divided into four overlapping phases.

Chronic wounds fail to heal in an orderly and timely manner. Many factors can delay or impair healing, such as infection, diabetes, reduction in tissue growth factors, as well as an imbalance between proteolytic enzymes and their inhibitors. PGs, in particular

HSPGs, play a crucial role in maintaining the structural and functional integrity of skin.

Growth factors are involved in the whole skin wound healing process, among which

FGF2 and FGF7 are the most relevant growth factors to skin wound healing. The main component to bind and signal growth factors in the ECM is HS. Therefore, chitosan- based materials which have a very similar structure with HS were considered as a promising growth factor delivery system to mimic the naturally occurring HS in vivo.

The hypothesis of this project is that arginine functionalised sulphated chitosan (S-CH-

Arg) could accelerate the process of skin wound healing by stimulating the production of HSPGs and regulating the binding activities of FGFs. Therefore, the specific aims of this project are:

 To characterise HSPGs produced by keratinocytes and fibroblasts either with or

without chitosan-based materials.

 To investigate the effect of chitosan treatments on 2 and 3-dimensional skin

wound models when compared to adult skin.

In working towards these aims, the research will involve the biochemical analysis of the structure of HSPGs, including perlecan, produced by skin cells and how the production is affected by the treatment of chitosan-based materials. Additionally, a comparison of expression of PGs and GAGs between human adult skin and an in vitro skin model will 32

be conducted. Finally, a comparison of the expression of PGs and GAGs in the in vitro skin model following exposure to chitosan-based materials will be investigated. 33

Chapter 2 : Materials and Methods

2.1 Materials

Chitosan-arginine (CH-Arg) (the polymer backbone containing 85% deacetylation with

24% arginine functionalised group; 57 kDa, purity > 99%) was provided by Synedgen,

Inc (Claremont, CA, USA). CH-Arg was modified with different degrees of sulphation as described previously (Table 2.1) [187]. Briefly, 30 mL of the Dimethyl Formamide

(DMF) was cooled to 0-4 °C on ice before the DMF was placed at room temperature

(RT). 5 mL of HClSO3 was added dropwise while stirring with a magnetic stirrer and the resultant DMF.SO3 was achieved. 1 g of CH-Arg was dissolved in 20 mL of formic acid within 3 hours at RT. 156 mL of the DMF was added, and the mixture was stirred for 2 hours. DMF.SO3 was added dropwise into the solution within 30 min and the mixture was kept at 55 °C for 1-3 hours. The solution was cooled to RT and poured into

600 mL of the saturated alkaline ethanolic solution of anhydrous sodium acetate. The precipitate was washed with a mixture (ethanol: deionised water, 4:1, v/v) and then dissolved in water. The pH of the solution was adjusted to 7.5. The solution was dialysed against deionized water for 48 hours using a 10 kDa dialysis cut-off membrane and lyophilised. A concentration of 10 µg/mL of CH-Arg was used in all experiments unless stated otherwise. Heparin (H3393, porcine intestinal mucosa) and all other chemicals were purchased from Sigma Aldrich unless stated otherwise.

Degree of sulphation (%) CH-Arg 0 LS-CH-Arg 3 HS-CH-Arg 58 Table 2.1: The degree of sulphation of CH-Arg from the calculation of X-ray photoelectron spectroscopy data[187]. LS-CH-Arg, CH-Arg modified with low degree of sulphate groups; HS-CH-Arg, CH-Arg modified with high degree of sulphate groups.

2.1.1 Antibodies and enzymes

The details of the primary antibodies were shown below (Table 2.2). Biotinylated antibodies against mouse and rabbit IgG, Biotinylated antibodies against mouse IgM,

Horseradish peroxidase (HRP) and Fluorescein Isothiocyanate (FITC) conjugated streptacidin (SA) were purchased from GE Healthcare, Little Chalfont

Buckinghamshire, U.K. Biotinylated antibody against rat IgG was purchased from

Dako, Glostrup, Denmark. Alexa Fluor ®488 goat anti-mouse (IgG and /or IgM), and

Alexa Fluor ®488 goat anti-rabbit were purchased from Life Technologies. The heparinase III (H’ase III) and chondroitinase ABC (C’ase ABC) were purchased from

Seikagaku Corp. (Tokyo, Japan).

35 34

Antigen Species Isotype Clone/Catalogue No. Supplier ELISA WB ICC IHC Raised in house[188, Perlecan Rabbit P CCN-1 1:1000 1:7000 1:1000 1:1000 189] Perlecan Mouse M, IgG 5D7-2E4 Raised in house 2 µg/mL 2 µg/mL 2 µg/mL 5 µg/mL Perlecan DIV Rat M, IgG A7L6 Abcam 2 µg/mL / / / Perlecan DI Mouse M, IgG A76 Raised in house 2 µg/mL / 2 µg/mL / Perlecan DIII Mouse M, IgG 7B5 Invitrogen. 2 µg/mL / / / Perlecan DV Mouse M, IgG A74 Raised in house 2 µg/mL 2 µg/mL / / Perlecan DV Mouse M, IgG E6 Santa Cruz Biotech. 2 µg/mL 2 µg/mL / / Agrin Mouse M, IgG AGR131 Abcam 2 µg/mL / / / Collagen XVIII Mouse M, IgG 1837.46 SC-32720 Santa Cruz Biotech. 2 µg/mL / / / Laminin β-1 Rabbit P, IgG 600-401-116-0.5 Rockland / / / 1:100 Laminin 332 Mouse M, IgG P3H9 DSHB / / / 25 µg/mL Collagen IV Rabbit P, IgG ab6585 Abcam / / 1:500 1:500 Syndecan 1 Mouse M, IgG B-A38 Abcam 2 µg/mL / / 2.5 µg/mL Syndecan 4 Rabbit P, IgG ab24511 Abcam 2 µg/mL / / 1:500 HS-chains Mouse M, IgM 10E4 Seikegaku Corp 2 µg/mL / / 5 µg/mL HS-stubs Mouse M, IgG 3G10 * Seikegaku Corp 2 µg/mL 0.2 µg/mL / 5 µg/mL Serglycin Rabbit P ** Greece / / / 1:500 Mouse IgG Isotype / Invitrogen. / / 2 µg/mL 5 µg/mL Mouse IgM Isotype / Invitrogen. / / 2 µg/mL 5 µg/mL Rabbit IgG Isotype / Invitrogen. / / 2 µg/mL 2 µg/mL Table 2.2: A list of primary antibodies used in this project and their details. DI, DII, DIII, DIV and DV stands for domain I, II, III, IV and

V, respectively; M stands for monoclonal; P denotes polyclonal; WB stands for Western blotting; ICC is immunocytochemistry; IHC denotes immunohistochemistry. * Digestion with Heparinise III, 0.1 U/mL. ** A gift from Dr. Achilleas Theocharis, University of Patras,

Greece. 36

2.2 Methods

2.2.1 Isolation of Fibroblasts and keratinocytes from human skin

Skin samples were collected under human ethics HREC/14/CRGH/173 from Concord

Hospital. However, no details of the donors were provided to the researchers. Samples were placed in sterile phosphate-buffered saline (PBS) containing antibiotic/antifungal solution for 3-4 hours at 4 °C. Samples were cut into 1-2 cm2 in a petri dish in a cell culture hood and were placed into 0.125% trypsin solution to incubate at 4°C to separate the epidermis from the dermis. Following trypsin digestion, Dulbecco’s modified

Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS) was added to inactivate trypsin. Samples were placed in separate petri dishes with 1-2 mL medium, with epidermis facing up and the epidermis was carefully removed from the dermis using forceps. The keratinocytes were collected into a falcon tube using the edge of a scalpel blade to carefully scrape the top of the dermis and the dermis side of the epidermis. The collected keratinocytes were centrifuged (5804, Eppendorf NSW, Australia) at 1,000 rpm for 3 minutes, re-suspended in keratinocyte growth medium-2 (KGM-2) and seeded into a culture flask (Greiner Bio-One NSW, Australia) coated with coating matrix protein (InvitrogenTM life Technology VIC, Australia). Keratinocytes were incubated at

37 °C with 5% CO2 in a CO2 incubator (Sanyo, Model: MCO-20AIC) and fed with fresh medium every 3-4 days. The dermis was placed into a petri dish containing 1 mL collagenase solution to isolate the fibroblasts. The dermis was minced into small pieces

(~1mm2) using a scalpel blade, and then transferred into a new petri dish with 10 mL collagenase solution to incubate overnight at 37 °C. After that, the solution was collected into a falcon tube and centrifuged at 2,000 rpm for 10 minutes. The supernatant was removed and 10 mL of DMEM with 10% FBS was added to re-suspend 37

the cell pellet into a cell culture flask. The cells were refed 24 hours later and then every

3-4 days.

2.2.2 Cell Culture

The HaCaT cell line and human primary dermal fibroblasts were cultured using the same procedure. All the reagents were prepared and warmed to 37 ºC in a water bath.

The cell growth medium was DMEM with 10% FBS and 1% Penicillin-

Streptomycin. A cryovial of cells was thawed in a 37 ºC water bath for 1-2 minutes, followed by adding 10 mL DMEM and centrifuging (1000 rpm, 3 minutes). After removing the supernatant, the cell pellet was re-suspended in 10 mL DMEM and was transferred into a T-75 flask. After 3-4 days, the supernatant was removed and replaced with 10 mL fresh medium to incubate for another 3-4 days until the desired cell confluency was achieved. Subsequently, the supernatant was removed and the cells were washed with sterile Dulbecco’s Phosphate-Buffered Saline (DPBS) twice. 3 mL of the trypsin was added into the flask and the flask was incubated for 3-5 min . The flask was gently tapped to ensure that the cells were detached from the wall of the flask. 7 mL of the medium was added to neutralise the trypsin. The cell suspension was then collected into a 15 mL tube and centrifuged at 1000 rpm for 3 minutes. After removing the supernatant, the cell pellet was suspended in 10 mL medium. After the cell counting, the cells (1x106/ T-75 flask) were seeded into the T-75 flask, fed every 3-4 days, and passaged once a week. The conditioned medium was collected and stored at -20 ºC until required. HaCaT cells between passage 49 and 65 were used, while fibroblasts between passage 3 and 9 were used for this project. 38

2.2.3 Chromatography

2.2.3.1 Diethylaminoethyl Anion-Exchange (DEAE) Chromatography

Conditioned medium was filtered through filter paper after adding 0.02% (w/v) sodium azide. The whole chromatography system (Bio-Rad VIC, Australia) was washed by

20% ethanol, water and DEAE running buffer (250 mM NaCl, 20 mM Tris, 10 mM

EDTA pH 7.5) before connecting the column to the equipment. 1 L of conditioned medium was loaded into a 50 mL DEAE sepharose column overnight at 1 mL/min at

4ºC. The column was equilibrated with 3 column volumes of DEAE running buffer to remove unbound proteins. Proteins bound to the DEAE column were eluted with eluting buffer (1 M NaCl, 20 mM Tris, 10 mM EDTA pH 7.5). The bound proteins were collected in tubes on ice as the UV absorbance began to increase. The column was regenerated with DEAE regenerating buffer (2 M NaCl, 20 mM Tris, 10 mM EDTA pH

7.5) and stored at 4 ºC. Part of the collection was dialysed against DPBS 5 times using

50 mL centrifugal filter (10 kDa cut-off Amicon Ultra centrifugal filter units, Merck

Millipore VIC, Australia). The concentration of the dialysed collection was confirmed by Bradford Protein Assay and stored at -20 ºC for further use. The other part of the collection would undergo the immunoaffinity chromatography to obtain immune- purified perlecan.

2.2.3.2 Immunoaffinity Chromatography (IAC)

The IAC column (4.5 mL) contained covalently immobilised perlecan antibody (clone

5D7-2E4). The column was equilibrated with approximately 20 mL IAC running buffer

(1 M NaCl, 20 mM Tris, 10 mM EDTA pH 7.5). The fraction collected from the DEAE column was recirculated over the IAC column at 1 mL/min at 4ºC overnight. The column was equilibrated with IAC running buffer to remove unbound proteins until 39

reaching a stable absorbance baseline. Perlecan was then eluted with IAC eluting buffer

(6 M Urea, pH 7.5) and collected the fraction when the UV absorbance began to increase. The collection was dialysed against DPBS 5 times by 50 mL centrifugal filter

(10 kDa). After confirming the concentration of the dialysed collection by the Bradford

Protein Assay, the proteins were aliquoted, labelled and stored at -20 ºC for further use.

2.2.4 Bradford Protein Assay

The Bradford protein Assay was performed using the Coomassie plus Reagent (Thermo

Scientific NSW, Australia) to determine the concentration of proteins in each sample.

Two sets of protein standards were prepared from bovine serum albumin (BSA) with concentration ranges from 0-25 µg/mL and from 0-1 mg/mL, respectively. 300 µL of

Coomassie plus reagent was added in a 96-well plate. Either 10 µL of each of the standards from 0-1 mg/mL and samples or 20 µL of each of the standards from 0-25

µg/mL and samples were added in triplicate. The plate was then evenly mixed and incubated at room temperature for 5 minutes. The absorbance was then measured at the wave-length of 595 nm using Infinite F200 plate reader (Tecan, VIC, Australia). A linear standard curve was performed from the absorbance readings for protein standards and the concentrations of the samples were determined depending on the curve.

2.2.5 Mass Spectrometry

Samples obtained from 2.2.2 were reduced (10 mM dithiothreitol for 10 minutes at 95

°C), alkylated (25 mM iodoacetamide for 20 minutes at 25 °C), and digested with trypsin (sequencing grade; Promega, Sydney, Australia) in 50 mM NH4HCO3 at 30°C for 16 h. Samples were prepared at a final concentration of 500 µg/mL and at a final volume of 20 µL. Samples were analysed by liquid chromatography coupled to tandem mass spectrometry (LC-MS2) using an LTQ mass spectrometer (Thermo Fisher 40

Scientific). The results were analysed with XcaliburTM software (Bioworks version 3.1,

Thermo Fisher Scientific) and the Mascot database (Matrix Science, London, UK; version 2.5.1) with a National Centre for Biotechnology Information (NCBI) protein

(Homo sapiens) database. The protein score in the result reported from an MS2 search is derived from the ions scores. For a search that contains a small number of queries, the protein score is the sum of the highest ions score for each distinct sequence.

2.2.6 Enzyme Linked Immunosorbent Assay (ELISA)

ELISA was used to determine the presence of proteins and GAGs by either the direct or sandwich ELISA methods as described below.

2.2.6.1 Direct ELISA

Each well of an ELISA high binding plate (Greiner Bio-One NSW, Australia) was coated with 50 µL of the antigens (10 µg/mL) for 16 hours at 4°C. PBS was also coated onto the plate for background. Selected antigens were digested with H’ase III (0.1

U/mL) for 16 hours at 37ºC. Each well was blocked with blocking solution (0.1% casein in PBS) at RT for 2 hours to block the non-specific binding sites. 50 µL of the primary antibodies was then added and was incubated at RT for 2 hours. After that, 50 µL of the biotinylated secondary antibodies (1:1000 diluted in blocking solution) was added to each well and was incubated at RT for 1 hour. 50 µL of the horseradish peroxidase

(HRP)–conjugated streptavidin (SA) (SA-HRP, 1:500 diluted in blocking sollution) was added and incubated for 30 minutes in the dark was followed. 100 µL of the colour substrate ABTS [2, 2’-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid)] reagent was added, and the absorbance at 405 nm was measured using the plate reader until appropriate development had occurred. Washes between every step were performed 41

with 200 µL of PBST (containing 0.05% tween-20 in PBS). The concentration of primary antibodies used in this project was shown above (Table 2.2).

2.2.6.2 Sandwich ELISA

50 µL of the capture primary antibody (2 µg/mL diluted in PBS) was coated on an

ELISA high binding plate for 16 hours at 4 °C. The control groups were coated with

PBS only. Each well was blocked with blocking solution (0.1% casein in PBS) at RT for 2 hours to block the non-specific binding sites. 50 µL of the antigens (10 µg/mL, diluted in PBS) was added and incubated at RT for 2 hours. 50 µL of the detected antibodies (2 µg/mL diluted in blocking solution) was then added and incubated at RT for 2 hours, followed by incubating 50 µL of the HRP conjugated secondary antibodies

(1:500 diluted in blocking solution) at RT for 2 hours. Between every step the plate was washed twice with 200 µL of PBST. After two extra washes, 100 µL of the ABTS reagent was added, and the absorbance at 405 nm was measured using the plate reader until appropriate development had occurred.

2.2.7 Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis (SDS-PAGE)

Samples (3 µg protein per well) were digested with endoglycosidases prior to electrophoresis with H’ase III (0.1 U/mL) in PBS or C’ase ABC (0.05 U/mL) in Tris buffer pH 8.0 overnight at 37 °C , if required. Lithium dodecyl sulphate (LDS) loading buffer was added to the samples in dilution of 1:4, and the final volume was made up to15 µL with PBS. The samples were then boiled for 10 min at 95 °C.

Standards (Himark, InvitrogenTM life Technology VIC, Australia) with molecular weights 31-460 kDa and samples were run on 3 – 8% Tris-Acetate NuPAGE® SDS-

PAGE gels (InvitrogenTM life Technology VIC, Australia) in Tris-tricine buffer (50 mM

Tricine, 50 mM Tris-base, 0.1% w/v SDS in deionised water) for 1 hour at 160 V using 42

Xcell surelock TM mini-cell electrophoresis system (InvitrogenTM life Technology VIC,

Australia).

2.2.8 Western Blotting (WB)

Following the SDS-PAGE, proteins from the gel were transferred onto a 0.45 µm polyvinylidene fluoride (PVDF) membrane (Merck Millipore VIC, Australia) using the

NOVEX® semi-dry blotter system (InvitrogenTM life Technology VIC, Australia), as described previously [189]. The gel was soaked in the NuPAGE transfer buffer (50 mM

Bicine, 50 mM Bis-Tris, 0.1 mM EDTA, 0.05% w/v SDS and 1% (v/v) Methanol at pH

8.3) for 10 minutes on an orbital shaker (Stuart Equipment NSW, Australia). The 75 mm × 80 mm PVDF membrane was wet with methanol for 30 seconds and equilibrated in the transfer buffer. Four pieces of blotting filter paper (BioRad, Cat No. 170-3960) were soaked in the transfer buffer as well for several minutes. Two pieces of blotting paper were placed on the anode plate, followed by the PVDF membrane then the SDS-

PAGE gel, and another two layers of blotting paper. Bubbles between each layer were rolled out with a roller, then the cathode plate was place on top of the stack and tightened with screws and the transfer was performed at 300 mA 25V for 1 hour.

After the transfer, the membrane was washed with Tris-buffered saline (TBS, 20mM

Tris base and 136 mM NaCl, pH 7.6) twice for 5 min each, and then blocked with blocking buffer [1% (w/v) BSA/TBST (containing 0.1% Tween-20 in TBS)] for 2 hours at RT on a rocker. The membrane was incubated with primary antibodies (Table 2.2) overnight at 4°C on an orbital shaker. The membrane was rinsed twice with TBST for

15 min each, then incubated with HRP-conjugated secondary antibodies (1:50000 diluted in blocking buffer) for 1 hour at RT followed by two 15 min washes with TBST.

The membrane was then washed twice with TBS for 15 min each. The membrane was 43

placed in the chemiluminescence reagent (Thermo Fisher Scientific, Cat No. 34095) for

5 min. The membrane was then placed between two transparencies and developed onto x-ray film in the dark to visualise the immune complexes.

2.2.9 Immunocytochemistry (ICC)

Immunocytochemistry was performed as described previously [189]. Briefly, 200 μL of the HaCaT and human primary dermal fibroblast cells at 2 x104 cells/ mL were seeded onto each well of microscope chamber slides (Thermo Fisher Scientific, Cat No.

155409) and then incubated until cells were attached onto the slide surface. The medium was removed and re-cultured in cell medium, CH-Arg, LS-CH-Arg, HS-CH-Arg and heparin for 4 and 24 hours. Then cells were fixed with 4% paraformaldehyde (PFA) containing 1% sucrose for 15 min at 37 °C, and washed twice with DPBS. Cells were permeabilised with permeabilising solution (300 mM sucrose, 50mM NaCl, 3 Mm

MgCl2, 2 mM HEPES and 0.5% Triton X-100 in deionised water) on ice for 5 minutes, followed by washing with PBST twice. Slides were blocked with blocking solution [1%

(w/v) BSA/PBST] for 1 hour at RT, and then incubated with the primary antibodies

(Table 2.2) for 16 hours at 4°C, followed by washing twice with PBST. Slides were then incubated with the secondary antibodies conjugated Alexa-fluor ®488 (1:500 diluted in the blocking solution) for 1 hour at RT in the dark followed by washing with

PBST twice. If staining for F-actin, cells were incubated with Rhodamine-phalloidin

(1:500 diluted in the blocking solution) for 1 hour at 37 °C in the dark, followed by washing with PBST four times. If staining for the nuclei, cells were incubated with TR-

PRO®-3-Iodide (1:1000 diluted in PBS, Thermo Fisher Scientific, Australia (642/661)) for 30 minutes at RT in the dark. The slides were added with the mounting medium

(Thermo Fisher Scientific, Cat No.S36964) and covered with coverslips (Thermo Fisher

Scientific, Cat No. C24779), followed by applying the nail-polish to the fix coverslips. 44

The cells were visualised with confocal microscope (Leica Microsystems NSW,

Australia) at 40 x oil immersion objective.

2.2.10 Gene expression of perlecan from cell lines

2.2.10.1 RNA Extraction

Total RNA extraction was performed as preciously described [189]. Briefly, HaCaT and human primary dermal fibroblast cells were seeded on 6-well cell culture plates until confluent, and subsequently treated with CH-Arg, LS-CH-Arg, HS-CH-Arg and heparin for 4 hours and 24 hours. Cells were harvested and pelleted by centrifugation at 1,000 rpm for 5 min and supernatant was removed, followed by two sterile DPBS washes followed by resuspension in DPBS. The supernatant was removed and the cells were lysed with Tri Reagent® (1 mL of Tri regent per 106 – 107 cells) by gentle pipetting.

Samples were incubated for 5 min at RT to ensure complete dissociation of nucleoprotein complexes. Chloroform (0.2 mL/ per mL of Tri Reagent) was added to the cells, and subsequently mixed vigorously for 15 s. After that, samples were incubated for 3 min at RT and were centrifuged at 12,000 rpm for 15 min at 4°C. This separated samples into three phases from lower to upper layer: a red organic phase

(containing protein), an interphase (containing DNA), and an aqueous phase (containing

RNA).

The upper phase was transferred into a new Eppendorf tube and the 2-propanol (0.5 mL/ per mL of Tri Reagent) was added and mixed by inversion, followed by incubation at

RT for 10 min. The mixture was centrifuged at 12,000 rpm for 15 min at 4°C using the centrifuge (Allegra X-30, Bechman Coulter USA). After the supernatant was removed carefully, the RNA pellet was washed with 75% ethanol (1 mL ethanol /per mL of Tri

Reagent), and centrifuged at 7,500 rpm for 5 min at 4°C. The supernatant was removed 45

and the RNA pellet was air dried for 1 h on ice. Finally, the pellet was dissolved in 50

µL 0.1% (v/v) diethylpyrocarbonate (DEPC) water. The mixture was cleaned up with

RQ1 RNase-free Dnase (Promega, Cat No.M6101) according to the manufacturer’s protocol. The quantity and purity of RNA were determined with NanoVueTM (GE

HealthCare U.K.) and the RNA was then stored at below -20°C for further use.

2.2.10.2 Complementary DNA (cDNA) Synthesis

ProtoScript® First Strand cDNA Synthesis Kit (BioLabs, New England, Cat No.

E6300) was used to synthesise cDNA from the extracted RNA according to the manufacturer’s protocol. Samples and all kit components were thawed and put on ice.

500 ng of RNA and 2 µL of the oligo-dT primers were mixed and the total volume was made up to 8 µL with nuclease-free water. The mixture was incubated for 5 min at 70

ºC to denature the RNA. Subsequently, 10 µL of M-MuLV reaction Mix and 2 µL of

M-MuLV enzyme Mix were added to the mixture. The reaction was started with an incubation step at 42 °C for 1 hour, followed by an enzyme inactivation step at 80 °C for 5 min. The quality and quantity of the cDNA products were determined before being stored at below -20°C until further use.

2.2.10.3 Polymerase Chain Reaction (PCR)

100 ng of the cDNA template was mixed with 12.5 µL of PCR master Mix (Promega,

Cat NO.M75010) and 1 µL of forward primer and reverse primer (at a final concentration of 4 µM), followed by adding RNAase free-water to make up to 25µL per sample. The samples were mixed evenly before performing a PCR reaction using the

PCR thermocycler (C1000 TM, Bio-Rad VIC, Australia). The PCR reaction program was set as follows: 94ºC for 5 min; 94ºC for 30 sec, annealing temperature for 45s and

72ºC for 2 min for 35 cycles; 72ºC for 7 mins. Agarose gel electrophoresis was 46

performed to visualise the PCR products to ensure the correct size of the PCR products that had been amplified. The details of primers were shown in Table 2.3 [72, 187, 189].

PCR Exons Tm Gene Primer sequences(5’-3’) product size /position (°C) (bp) HSPG2 F: CCATGGGCTGAGGGCATACG (Perlecan 2-7 R: 63 510 DI) GGCACTGTGCCCAGGCGTCGGAACT HSPG2 F:GGTGCCAGAGCGGGTG (Perlecan 79-83 60 397 DV) R:GCCCTGGAACTTGCCCTG F:AGAAGGCTGGGGCTCATTTG GAPDH 369-626 67.5 258 R:AGGGGCCATCCACAGTCTTC Table 2.3: Primers for PCR used in this project[72, 187, 189]. (Accession number for perlecan: NM_005529). DI, domain I; DV, domain V.

2.2.10.4 Agarose Gel Electrophoresis

The products of PCR were visualised on a 1.5% (w/v) agarose gel. The agarose powder

(Promega, Cat No.V3121) was completely dissolved in Tris/Borate/EDTA (TBE) buffer

(89 mM Tris base, 89 mM Boric Acid and 2 mM EDTA, pH 8.3). The gel solution was cooled down to ~60°C before 0.01% (v/v) of nucleic acid stain GelRed (Jomar

Diagnostic, Cat No. 41003) was added. The gel solution was then poured into a gel tray with a comb inserted. The comb was removed carefully from the gel after the gel had solidified. The gel was submerged completely in the TBE buffer. Pre-stained samples and markers were then loaded into the wells of the gel. Electrophoresis was run at 60 V for 1 hour. The gel was visualised with gel doc imager (GelDoc TM EZ Imager system,

BioRad VIC, Australia). 47

2.2.10.5 Quantitative Real-Time Polymerase Chain Reaction (qPCR)

500 ng of the cDNA products was mixed with 0.2 µL of the forward and reverse primers (200 nM each, see Table 2.3) and 5 µL of the Power SYBR Green PCR Master

Mix (Applied Biosysems by Life Technologies, Cat No 4306736) followed by adding

RNAase-free water to make up to 10 µL per sample. GAPDH was used as an endogenous control and to normalise the results for each of the primer sets. After samples were incubated for 10 min at 95 ºC, samples were subjected to 35 cycles (95 ºC for 15 sec, Tm for 1 min) using the ABI StepOnePlusTM Real-Time PCR system

(Applied Biosysems by Life Technologies). A melting curve step was set as followed:

95 ºC for 15 sec, Tm for 1 min, and 95 ºC for 15 sec. Agarose gel electrophoresis was performed to visualise the PCR products after the qPCR reaction finished to ensure the correct size of the PCR products had been amplified. Experiments were conducted by preparing three replicates in one tube and then distributed into three wells.

2.2.11 Surface Plasmon Resonance

Surface plasmon resonance (SPR) was used to assess the interaction between perlecan and FGFs (FGF-2 and FGF-7) using the BIACore 2000 (GE HealthCare U.K.). The

SPR was performed as previously described [190, 191]. Briefly, PBS (degassed and filtered) at 5 µL/min flowrate was injected onto the BiaCore gold sensor chips until a stable baseline was achieved. 100 µL of BSA or perlecan (diluted in PBS at 10 µg/mL) was immobilised in sequence on a BIAcore gold sensor chip at 5 µL/min flowrate at

RT. The multiple channels of the chip were blocked with 80 µL 1%BSA/PBS at 5

µL/min at the same time. 10 µL of 1M NaCl was performed to remove the proteins that had not been tightly immobilised on the gold sensor chips until the baseline did not alter between before and after adding NaCl. 40 µL of the FGFs (50 nM, 100nM and 200 nM) 48

were then injected at 20 µL/min flowrate at 25ºC until stable baseline. 10µl of 1 M

NaCl, 2 M NaCl, or 100 µg/mL heparin was used to regenerate the gold chips until the baseline was stable. The binding curve was analysed by BIAcore 2000 evaluation software 3.0.2 (GE HealthCare U.K.) to determine the association and dissociation rates. Samples with or without endoglycosidase digestion were analysed. The control group for non-specific FGF binding was conducted with BSA at 1 mg/mL.

2.2.12 Cell Proliferation Assay (MTS assay)

Cell proliferation assay was performed as previously decribed [187]. Briefly, 200 µL of

HaCaT and human primary dermal fibroblast cells were seeded in a 96-well cell culture plate at 2.5x104 cells/ mL. The medium was replaced with 200 µL of fresh media containing 10 μg/ mL of CH-Arg, LS-CH-Arg, HS-CH-Arg, heparin, or cells-derived proteoglycans from 2.2.2.1 after incubating cells for 24 hours. After incubating cells for another 24, 48, and 72 hours, 20 µL of the MTS reagent was added and incubated for 6 hours before measuring the absorbance at the wavelength of 490 nm to assess cell proliferation.

2.2.13 Migration assay

70 µL of HaCaT cells at 4 x 105 cells/ mL was seeded in each well of 2-well silicone insert (ibidi, Cat No. 80206) stuck in a 12-well cell culture plate. The 2-well silicone insert has a defined cell-free gap. After incubating cells for 24 hours, the medium was removed carefully without touching the inserts, followed by two gentle washes with

DPBS. 70 µL of the fresh media with serum free medium was added to starve cells for 4 hours. After the medium then was removed from the inserts, 70 µL of the chitosan- based materials (CH-Arg, LS-CH-Arg and HS-CH-Arg) and heparin as well as serum free medium were added. All the materials were prepared in serum free media. After 49

that, three images of each well (top, middle and bottom) were taken under a phase contrast microscope (4 times objective) at different time points (0, 24, 48, and 72 h).

Finally, Image J was used to analyse the wounded area remaining after cell had migrated to evaluate the cell migration.

2.2.14 3D Skin Model

24 mL of bovine collagen (Devro pty limited, Sydney, Australia) solution (3 mg/mL final concentration), 4 mL of the 10x DMEM and 4 mL of the FBS were added into a 50 mL tube (Eppendorf NSW, Australia). The colour of the solution turned red from straw yellow once 0.6 mL of NaOH was added. The solution was adequately mixed with minimal bubbles formed. The human primary dermal fibroblast cell suspension

(containing 2.4 × 106 cells) was added as well and adequately mixed to ensure that cells were evenly distributed within the collagen solution, followed by adding sterile water to make up the final volume to 40 mL. All solutions, with the exception of the cell suspension, must be stored and prepared on ice to ensure that collagen did not start to gel. 1 mL of the solution was added into each transwell insert placed in the well plate.

Subsequently, the well plate was incubated for 30 minutes in an incubator (37 °C, 5%

CO2) to allow the solution to gel. The medium was then added to the well surrounding the transwell insert to ensure that the gel was immersed and the well palte was returned to the incubator for 24 hours. After the medium was removed from each of the wells, 25

µL of the fibrinogen solution (50 µg/mL concentration) was added to each gel to coat the surface and the well plate was incubated in the incubator for 30 minutes. 1 × 105 human primary keratinocytes were then seeded onto each sample and the well plate was incubated for another 30 minutes. After that, the medium (DMEM: KGM-2, 1:1, with

50 µg/mL ascorbic acid) was added to the well surrounding the transwell insert to ensure the gel was immersed and the well plate was returned to the incubator. After 7 50

days, the gel was taken out from the transwell insert to the 6-well cell culture plate to bring to the air liquid interface for 9 days so that the tissue environment was able to mimic naturally occurring morphologic and biochemical conditions of human skin in vivo. For the establishment of the wounded model, a 2 mm scratch wound was fabricated by punching regions out of the collagen gels. 50 µL of the CH-Arg, LS-CH-

Arg and HS-CH-Arg were added topically to each of the unwounded model. The models were fed every 2-3 days with those chitosan-based materials and cultured for further 3 weeks.

2.2.15 Immunohistochemistry

Immunohistochemistry was performed as previously described [127, 188]. Briefly, adult skin and in vitro skin models were fixed in 4% (v/v) PFA, embedded in paraffin and sectioned (4–5 µm ). Sections were immersed twice for 5 min each with xylene to remove paraffin and then the slides were washed in a series of ethanol solutions for 3 min each [twice in 100% (v/v), once in 95% (v/v), once in 70% (v/v)], followed by several rinses of water. Following rehydration, slides were placed in 200 mL of 0.01 M sodium citrate buffer (pH 6.0) in the decloaking chamber (Biocare Medical) to retrieve antigen epitopes. The antigen epitopes retrieval was carried out through heat-mediated method (120 ºC 4 min, 90 ºC 10 min). After they cooled down, a hydrophobic pen was used to mark the area to be stained on each slide. The sections were digested with H’ase

III (0.1 U/ml) for 3 hours at 37 ºC, if required. 3% (v/v) H2O2 was used to quench endogenous peroxidase for 5 min. Sections were washed with water, followed by 3 times washes with 50 mM Tris-HCl, 0.15 M NaCl, pH 7.6 (TBS) for 5 min each.

Subsequently, they were blocked with blocking buffer 1% (w/v) BSA/TBST (0.05% t-

20 in TBS) for 1h at RT. Following blocking, the slides were incubated with primary antibodies (Table 2.2) diluted in 1% (w/v) BSA/TBST for 16 hour at 4 ºC. Slides were 51

also probed with mouse IgG and IgM whole antibodies, and rabbit IgG as isotype controls, as well as blocking solution in place of primary antibodies. Slides were then washed twice with TBST before incubation with the appropriate biotinylated secondary antibodies (1:500 diluted in blocking solution) for 1 hr at RT. Slides were washed twice with TBST, incubated for 30 min with SA-HRP (1:250 diluted in blocking solution), rinsed four times with TBST, and then processed for colour development with

NovaRED chromogen stain (Cat No. SK 4800, Vector Laboratories, USA). The slides were then counterstained with hematoxylin (Cat No. H-3401, Vector Laboratories,

USA) for 6 sec and rinsed with water. Slides were washed through a series of ethanol

[once in 70% (v/v), once in 95% (v/v), twice in 100% (v/v)], dehydrated through two rinses for 5 min each with xylene and mounted with the mounting solution. After the slides were completely dry, the sections were scanned using Scanscope XT Apero system (Leica Microsystems NSW, Australia) and analysed though ImageScope Viewer software.

2.2.16 Statistical Analyses

A two-way analysis of variance (ANOVA) was performed to compare multiple conditions while a one-way ANOVA was performed to compare the significance between two conditions by using Graph pad prism 6.0 software. A p value less than

0.05 was considered statistically significant. At least triplicates were performed in each experiment and each experiment was repeated at least 3 times as well.

Chapter 3 : Characterisation of perlecan produced by keratinocytes and fibroblasts

The aims of this chapter were to characterise the HSPGs, including perlecan, produced by keratinocyte and fibroblast cells and determine the effect of chitosan-based materials on perlecan expression and production by these cells. The PG enriched samples and immuno-purified perlecan were obtained by anion exchange and immunoaffinity chromatography. The PGs present in the PG enriched samples were identified by mass spectrometry. Enzyme-linked immunosorbent assays (ELISA) and Western blotting

(WB) were used to characterise the structure and GAG composition of HSPGs produced by both cell types. Immunocytochemistry (ICC) and polymerase chain reaction (PCR) were used to analyse the effect of chitosan-based materials on perlecan expression and production.

3.1 Expression of HSPGs produced by keratinocyte and fibroblast cells

The human keratinocyte cell line (HaCaT) was used to investigate the PGs produced as a model for primary human keratinocytes due to their limited proliferation and rapid differentiation in culture, thus limiting the amount of conditioned medium that can be collected for analysis. In contrast, primary human fibroblasts can be readily cultured and conditioned medium collected for analysis. PGs expressed by HaCaT cell between passage 49 and 65 and human primary dermal fibroblast cells between passage 4 and 9 were isolated from cell conditioned medium using anion exchange chromatography

(Figure 3.1). The non-bound and loosely bound materials were washed off with the washing buffer containing 250 mM NaCl with a conductivity of 30 mS/cm (not shown in the graph) until a stable base line was obtained. The bound PGs were released from the anion exchange column in the eluting buffer containing 1 M NaCl, with a 53

conductivity of 100 mS/cm. After the fractions collected were concentrated, 500 µg/mL of HaCaT-derived PGs and 306 µg/mL of human primary dermal fibroblast-derived

PGs were obtained. The yields of PGs derived from HaCaT and fibroblasts were 1750

μg and 1224 μg per L of conditioned media, respectively. More details were shown in

Table 3.1.

Figure 3.1: Anion exchange chromatography for the enrichment of PGs in (A) HaCaT and (B) human primary dermal fibroblast conditioned media. Binding of the PGs to the

DEAE column was performed in running buffer containing 250mM NaCl at 1 mL/min at

4ºC. Unbound proteins were washed off with running buffer at 1 mL/min. PG enriched fractions were eluted from the column using eluting buffer containing 1M NaCl. The column was then regenerated with regenerating buffer containing 2 M NaCl. The experiment was conducted three times. 55

Concentration Total Mass Yield /L of conditioned Sample (µg/mL) (µg) medium (μg/L)

HaCaT-derived PG enriched 500 1750 1750 fraction Human primary dermal fibroblast-derived PG enriched 306 1224 1224 fraction Table 3.1: Concentration, mass and yield of PG enriched samples from HaCaT and human primary dermal fibroblast conditioned medium.

The PGs present in both PG enriched cell conditioned media were identified by mass spectrometry. In addition to HSPGs, other molecules including laminins were also present in these samples displayed in Table 3.2.

Table 3.2: HSPGs and laminin present in PG enriched samples and immunopurified

HaCaT-derived perlecan detected by peptide LC-MS2 from an in-solution tryptic digestion.

a Molecular mass search score as determined by Mascot query. This is the value (p) that is a measure of the probability that the match is a random event expressed as -

10log (p). The higher the score, the more confidence that the match is not due to a random event.

b Obtained from Swiss-Prot. -, not detected.

The presence of HS in both PG enriched samples derived from HaCaT and fibroblast cell conditioned media was examined with the anti-HS stub monoclonal antibody (clone

3G10) by WB. Antibody clone 3G10 recognises the HS stub epitope exposed by digestion with bacterial H’ase III. Protein cores containing HS stubs, with a range of molecular weights from 117 - 650 kDa after H’ase III digestion, were detected in PG enriched HaCaT cell conditioned media (Figure 3.2 A), while molecular weights ranging from 55-650 kDa were detected in PG enriched fibroblast cell conditioned media (Figure 3.2 B). These data demonstrated that HSPGs were present in PG enriched HaCaT and fibroblast cell conditioned media.

Figure 3.2:WB analysis for the presence of HSPGs in both PG enriched samples derived from HaCaT (A) and fibroblast cell (B) conditioned media. Samples were treated with H’ase III, and probed with monoclonal anti-HS stub antibody (clone

3G10). Molecular weight standards were electrophoresed on the same gel and were indicated on the left.

In order to further investigate the HSPGs and other PGs present in the PG enriched samples of both cell types, the presence of perlecan, argin, collagen XVIII, syndecan-1

58 and syndecan-4 were examined by ELISA (Figures 3.3) The results demonstrated that perlecan was present in both PG enriched samples, while agrin, collagen XVIII, syndecan-1 or syndecan-4 were not detected in either sample, indicating that the major

HSPG produced by both cell types was perlecan. In addition, HS and CS were present in both samples (Figure 3.4), suggesting that PGs present in both PG enriched samples were decorated with HS and/or CS.

4 m

n 3

t 2

c 1 .5

a b

r 1 .0

o s

b 0 .5 A

0 .0 I n n I 1 4 a ir I - - g n n c V a a le A X r c c e n e e e d d P g n n a y y ll S S o C P r im a r y d e r m a l fib r o b la s t s H a C a T c e lls

Figure 3.3: ELISA performed on both HaCaT-derived and fibroblast-derived PGs. The presence of perlecan, agrin, collagen XVIII, syndecan-1, and syndecan-4 were probed by anti-perlecan polyclonal antibody CCN-1, anti-agrin monoclonal antibody clone

AGR 131, anti-collagen XVIII monoclonal antibody clone SC-32720, anti-syndecan-1 monoclonal antibody clone B-A38, and anti-syndecan-4 polyclonal antibody ab24511, respectively. Data were corrected for background and presented as mean ± standard deviation (n=3).

4 m

n 3

t 2

c 1 .5

a b

r 1 .0

o s

b 0 .5 A

0 .0

n s in i b a a u h h t c c s S S S H H C

P r im a r y d e r m a l fib r o b la s t s H a C a T c e lls

Figure 3.4: ELISA performed on both HaCaT-derived and fibroblast-derived PGs. The presence of HS chains, HS stubs and CS chains were probed by anti-HS chain monoclonal antibody clone 10E4, anti-HS stubs monoclonal antibody clone 3G10, and anti-CS monoclonal antibody clone CS56, respectively. The antigens were digested with

Heparinase III (H’ase III, 0.1U/ml) at 37ºC for 16 h prior to coating to detect the HS stub epitope. Data were corrected for background and presented as mean ± standard deviation (n=3).

In order to further verify the expression of perlecan in both PG enriched cell conditioned media, the presence of perlecan was examined with anti-perlecan polyclonal antibody CCN-1 by WB. Perlecan was detected in HaCaT cell conditioned media after H’ase III digestion with a range of molecular weights from 117 - 600 kDa

(Figure 3.5 A), while molecular weights ranging from 55-600 kDa were detected in fibroblast conditioned media after H’ase III digestion (Figure 3.5 B). These data further demonstrated that perlecan was present in both PG enriched cell conditioned media. In

60 addition, these data were consistent with the molecular weight reactivity of HS presented in Figure 3.2 indicating that perlecan produced by both cell types was decorated with HS chains. Furthermore, the smear over 460 kDa was also detected after

H’ase III digestion indicating that perlecan was decorated with structures in addition to

HS.

Figure 3.5:WB analysis for the presence of perlecan in both PG enriched samples derived from HaCaT (A) and fibroblast cell (B) conditioned media. Samples were treated with H’ase III, and probed with polyclonal anti-perlecan antibody CCN-1.

Molecular weight standards were electrophoresed on the same gel and were indicated on the left.

3.2 The structure of perlecan produced by HaCaT cells and human primary dermal fibroblast cells

In light of the data presented above, the structures of perlecan produced by HaCaT cells and human primary dermal fibroblast cells were investigated in this section.

3.2.1 The structure of perlecan produced by HaCaT cells

Firstly, the structure of perlecan produced by HaCaT cells was examined by ELISA.

The HaCaT-derived PG enriched fraction was probed with monoclonal antibodies against perlecan (clone 5D7-2E4) and against domains I (clone A76), III (clone 7B5),

IV (clone A7L6) and V (clone E6). The results indicated that perlecan domains IV and

V were detected in HaCaT-derived PG enriched fraction, while the epitopes of perlecan domains I and III recognised by these antibodies were below the detection limit (Figure

3.6).

1 .5

t 1 .0

a b

r 0 .5

b A

0 .0 ) ) ) ) 6 5 4 6 6 7 E L B 2 E A 7 - 7 ( ( ( 7 A I ( V I I D D I 5 V D I D D

Figure 3.6: ELISA analysis of HaCaT-derived PG enriched fraction for the presence of perlecan domains I, III, IV and V that were probed by monoclonal antibodies, clones

A76, 7B5, A7L6, and E6, respectively. Antibody clone 5D7-2E4 was also used to detect, however its epitope has not been mapped. Data were corrected for background and presented as mean ± standard deviation (n=3).

The monoclonal antibodies against perlecan (clone 5D7-2E4) and perlecan domain V

(clone E6) were used to further investigate the structure of perlecan produced by HaCaT cells by WB (Figure 3.7). The perlecan produced by HaCaT cells displayed a range of molecular weight reactivity of 460-600 kDa (Figure 3.7A, lane 1). Digestion of the sample with H’ase III reduced the molecular weight reactivity of perlecan to the protein core of ~460 kDa indicating that HaCaT cell-derived perlecan was decorated with ~140 kDa HS, and a smear from 460-550 kDa indicating that some perlecan was decorated with structures other than HS (Figure 3.7A, lane 2). Interestingly, perlecan was not

63 detected in the sample digested only with C’ase ABC, however the reason for this is not known (Figure 3.7 A, lane3). Perlecan was detected as a band at ~460 kDa after digestion with both H’ase III and C’ase ABC indicating that the protein core was detected with HS and CS (Figure 3.7 A, lane4). When the sample was probed for perlecan using the monoclonal antibody, clone E6 whose epitope is located in domain

V, no reactivity was observed for the undigested sample or when the sample was digested with C’ase ABC (Figure 3.7 B, lane 1&3). However, following digestion with either H’ase III alone or H’ase III and C’ase ABC, a band at ~460 kDa was detected, indicating that perlecan was decorated with HS (Figure 3.7 B, lane 2&4).

Figure 3.7: WB analysis for the presence of perlecan in PG enriched HaCaT conditioned medium. Samples were untreated or treated with C’ase ABC, H’ase III, or both, and probed with monoclonal anti-perlecan antibodies, clones 2E4 (A) and E6 (B).

Molecular weight standards were electrophoresed on each gel and were indicated on the left.

In order to confirm that the cells express full-length perlecan, HSPG2 mRNA expression in HaCaT cells was analysed (Figure 3.8). The mRNA derived from HaCaT cells was isolated and used to generate cDNA which was amplified using HSPG2 domains I & V specific primers and electrophoresed on agarose gels. Transcripts generated from HaCaT cell produced bands at the expected size for each of the domain specific primers. This indicated that the transcripts produced by HaCaT cells contained domains I and V. Together these data indicated that perlecan produced by HaCaT cells was full-length perlecan decorated with both HS and CS chains.

Figure 3.8: Analysis of HSPG2 mRNA expressed by HaCaT cells. The mRNA derived from HaCaT cells was isolated and used to generate cDNA, which was amplified using

HSPG2 domains I & V specific primers and electrophoresis on 1.5% (w/v) agarose gels. Products from a GADPH primer set were also electrophoresed on the gel to indicate the same amount of cDNA was loaded. Base pair standards were indicated on the left.

3.2.2 The structure of perlecan produced by human primary dermal fibroblast cells

The structure of perlecan produced by human primary dermal fibroblast cells was investigated by ELISA. PG enriched dermal fibroblast conditioned medium was probed with monoclonal antibodies against perlecan domains I (clone A76), III (clone 7B5), IV

(clone A7L6) and V (clone E6), as well as a perlecan antibody that has not been epitope mapped (clone 5D7-2E4) (Figure 3.9). Perlecan domains IV and V were detected in dermal fibroblast -derived PGs, while perlecan domains I and III epitopes were not detected as the absorbance reading was at backgrounds.

2 .5

n 5

0 2 .0

e 1 .5

n a

b 1 .0

o s

b 0 .5 A

0 .0 ) ) ) 4 ) 6 5 6 6 7 E L B 2 E A 7 - 7 ( ( ( 7 A I ( V I I D D I 5 V D D I D

Figure 3.9: ELISA performed on DEAE enriched human primary dermal fibroblast conditioned medium. The presence of perlecan domains I, III, IV and V were probed by monoclonal antibodies clones A76, 7B5, A7L6, and E6, respectively. Monoclonal

Antibody clone 5D7-2E4 was also used to detect, however its epitope has not been mapped. Data were corrected for background and presented as mean ± standard deviation (n=3).

The monoclonal antibodies against perlecan (clone 5D7-2E4) and perlecan domain V

(clone E6) were used to further investigate the structure of the perlecan produced by fibroblasts by WB (Figure 3.10). The perlecan produced by fibroblasts was detected at the 300 kDa when either undigested or digested with C’ase ABC indicating that this sample may contain fragments of perlecan (Figure 3.10 A, lanes 1&3). The molecular weight reactivity of core protein of 460kDa was detected after H’ase III or both H’ase

III and C’ase ABC digestion indicating that perlecan produced by fibroblasts was decorated with HS. A smear from 460-650kDa was also detected when the sample was digested with H’ase III indicating that perlecan produced by fibroblasts was decorated with structures other than HS (Figure 3.10 A, lane 2). Perlecan was detected at ~460 kDa after digestion with both H’ase III and C’ase ABC indicating that the protein core was decorated with HS and CS (Figure 3.10 A, lane 4). Perlecan was detected with a range of the molecular weight reactivity of 268-460 kDa, centred at ~ 300kDa when probed with the monoclonal antibody clone E6, whose epitope is located in domain V

(Figure 3.10 B, lane 1). A similar reactivity was observed after C’ase ABC digestion

(Figure 3.9 B lane 3). Digestion of the sample with H’ase III altered the size of the smear to 117-650 kDa, indicating that perlecan produced by fibroblasts was decorated with HS (Figure 3.10 B, lane 2). The molecular weight reactivity of perlecan protein core of ~460 kDa was detected after digestion of the sample with H’ase III and C’ase

ABC indicating that fibroblast cell-derived perlecan was full-length perlecan decorated with HS and CS, as well as smaller fragments (Figure 3.10 B, lane 4).

Figure 3.10: WB analysis for the presence of perlecan in dermal fibroblast-derived

PGs. Samples were untreated or treated with C’ase ABC, H’ase III, or both, and probed with monoclonal anti-perlecan antibodies, clones 5D7-2E4 (A) and E6 (B). Molecular weight standards were indicated on the left.

In order to confirm whether full-length perlecan was expressed, HSPG2 mRNA produced by human primary dermal fibroblasts was analysed (Figure 3.11). The mRNA derived from dermal fibroblast cells was isolated and used to generate cDNA which was amplified using HSPG2 domains I & V specific primers and electrophoresed on agarose gels. Transcripts generated from dermal fibroblast cells produced bands at the expected size for each of the domain specific primers. This indicated that the transcripts produced by dermal fibroblast cells contained perlecan domains I and V. Together these data indicated that perlecan produced by human primary dermal fibroblasts was full-length perlecan decorated with both HS and CS chains.

Figure 3.11: Analysis of HSPG2 mRNA expression by dermal fibroblast cells.The mRNA derived from dermal fibroblast cells was isolated and used to generate cDNA, which was amplified using HSPG2 domains I & V specific primers and electrophoresis on 1.5% (w/v) agarose gels. Products from a GADPH primer set were also electrophoresed on the gel to indicate the same amount of cDNA was loaded. Base pair standards were indicated on the left.

In summary, full-length perlecan decorated with HS and CS was present in PG enriched fractions derived from HaCaT cell and human dermal fibroblast cell conditioned medium.

3.3 Binding activities between growth factors and perlecan derived from different cellular origins

Previous studies have shown that the major component of the ECM that binds growth factors is HS [87]. Perlecan derived from endothelial cells was capable of binding various growth factors including FGF2 through HS chains [44, 192-194], while the perlecan protein core also contributed to binding some other growth factors including

FGF7 [137, 195]. Knox et al. [196] also reported that perlecan from different cellular origins differed in FGF2 binding activities. Therefore, growth factor binding to perlecan derived from keratinocytes and fibroblasts was of interest in this thesis. Endothelial perlecan, exclusively decorated with HS chains, was used as a control in these experiments as its growth factor binding has been explored previously [192].

In order to analyse growth factor binding to HaCaT and fibroblast-derived perlecan, immunopurified perlecan was prepared. HaCaT-derived perlecan was obtained from the

HaCaT-derived PG enriched fraction by immunoaffinity chromatography (IAC) (using a column immobilised with anti-perlecan antibody, clone 5D7-2E4) (Figure 3.12). The non-bound and loosely bound materials were washed off with the washing buffer containing 1 M NaCl with a conductivity of 100 mS/cm (not shown in the graph) until a stable base line was obtained. The bound perlecan was released from the immunoaffinity column in the eluting buffer containing 6 M urea, with a conductivity of

15 mS/cm. When the UV absorbance returned to a stable baseline, the column was switched to 1M NaCl until the UV absorbance regained a stable baseline. The immunopurified perlecan was collected from 10 min to 35 min and approximately 1100 µL of concentrated HaCaT-derived perlecan was obtained. The concentration was determined to be 14.6 μg/mL by Bradford protein assay and the yield was 19 μg per L of

70 conditioned medium. Fibroblast-derived perlecan was prepared by using the same method, whereas almost no perlecan was obtained possibly due to the low affinity of fibroblast-derived perlecan with the monoclonal antibody, clone 5D7-2E4, bound to the immunoaffinity column.

1 M NaCl 0 .0 7 1 5 0

6 M Urea C

o )

n .

1 M NaCl d U

. 0 .0 6

c A 1 0 0

(

v e

i c

t n

0 .0 5 y a

( b

r o

5 0 S s

c b 0 .0 4

m A

)

0 .0 3 0 0 2 0 4 0 6 0 T im e [ m in .]

U V [A .U .] C o n d u c tiv ity [m S /c m ]

Figure 3.12: HaCaT-derived PG enriched fraction for perlecan by IAC (5D7-2E4- conjugated column). The eluted fraction from anion exchange chromatography was loaded onto the IAC by recirculation at 1 mL/min at 4ºC overnight and equilibrated with running buffer containing 1M NaCl to wash off the unbound molecules. Perlecan enriched fractions were eluted with 6M urea followed by running buffer containing 1M

NaCl.

The PGs present in immunopurified perlecan were identified by mass spectrometry.

HSPGs and laminins present in samples were shown in Table 3.3. The MOWSE scores obtained for peptides present in the HaCaT-derived perlecan sample suggested that the

71 sample was still a mixture with multiple HSPGs and other proteins after running the

IAC, possibly due to the interaction between perlecan and other ECM molecules.

Protein molecular Accession MOWSE scorea Peptide identified mass (Da) numberb HaCaT-derived perlecan Perlecan 468525 P98160 272 HSPGs Agrin 214706 O00468 457 Col XVIII 153746 P39060 92 Glypican 61611 P35052 139 Cell Surface Syndecan 4 21594 P31431 87 HSPGs Syndecan 1 32473 P18827 77 Laminin α5 399390 O15230 609 Laminin γ1 177492 P11047 533 Laminin β2 195954 P55268 351 Laminin Laminin β1 197937 P07942 303 Laminin γ2 130778 Q13753 - Laminin α4 201756 Q16363 -

Table 3.3: HSPGs and laminins present in immunopurified HaCaT-derived perlecan detected by peptide LC-MS/MS from an in-solution tryptic digestion.

a Molecular mass search score as determined by Mascot query. This is the value (p) that is a measure of the probability that the match is a random event expressed as -

10log (p). The higher the score, the more confidence that the match is not due to a random event.

b Obtained from Swiss-Prot. -, not detected

Due to the limited yield of immunopurified perlecan derived from HaCaT cell conditioned medium, binding assays were unable to be performed with this perlecan preparation.

Thus, growth factor binding to endothelial perlecan was analysed by surface plasmon resonance (SPR). BSA background control (Figure 3.13 curve a) and perlecan (diluted in PBS at 10 µg/mL)(Figure 3.13 curve b) were immobilised on gold sensor chips,

72 respectively, followed the addition of BSA to block the remaining surface. The amount of FGF2 binding to endothelial perlecan was 149.6±7.7 RU, while that of FGF7 binding to the perlecan was 81.9±9.8 RU (Figure 3.14) after subtraction of the amount of binding to BSA. These data indicated that endothelial perlecan supported significantly

(p < 0.05) more FGF2 than FGF7 binding. The perlecan-FGF2 and perlecan-FGF7 interaction was assumed to be 1:1, and kinetic constants were fitted separately to the endothelial perlecan sensorgrams. For FGF2 binding, endothelial perlecan gave a ka ≈

5 -3 2 5 2.4 × 10 , kd ≈ 2.1 × 10 , and Kd ≈ 8.6 nM (χ ≈ 6.4). It gave a ka ≈ 2.0 × 10 , kd ≈ 6.0 ×

-4 2 10 , and Kd ≈ 3.6 nM (χ ≈ 6.4 ) when calculated FGF7 binding. These data suggested that the affinity for FGF7 might be slightly greater than that for FGF2.

Figure 3.13: Growth factor binding analyses of endothelial perlecan by linking the perlecan to a BIAcore gold chip. FGF2 (A) and FGF7 (B) were passed over each chip and the amount of binding was monitored. RU, response unit; curve a, BSA+ FGF; curve b, endothelial perlecan +FGF; curve c, b-a.

Figure 3.14: Growth factor binding analyses of endothelial perlecan by linking the perlecan to a BIAcore gold chip. n = 3. * Indicated significant differences (p <0.05) between the amount of FGF2 and FGF7 binding to endothelial perlecan as determined by a one-way ANOVA.

3.4 The effect of chitosan-based materials on the expression of perlecan produced by HaCaT and human primary dermal fibroblast cells

Chitosan, which has a very similar back bone structure to HS, is considered to be able to mimic naturally occurring HS when modified with sulphate groups [113]. In this section, chitosan-arginine (CH-Arg) based materials were used to investigate the effect of these on perlecan expression and localisation.

ICC was performed to investigate the effect of chitosan-based materials on the expression and localisation of perlecan produced by HaCaT and human primary dermal fibroblast cells. HaCaT cells (Figure 3.15) and dermal fibroblast cells (Figure 3.16) were exposed to cell culture medium alone or supplemented with CH-Arg, CH-Arg modified with low degree of sulphate groups (LS-CH-Arg), CH-Arg modified with high degree of sulphate groups (HS-CH-Arg), and heparin for 4 hours and 24 hours. Perlecan expressed by HaCaT cells exposed to medium only was found to be located intracellularly and distributed evenly (Figure 3.15 A). The substrate immediately adjacent to the cells was fluorescently stained, resembling adhesion contacts. Similarly,

HaCaT cells exposed to cell culture medium supplemented with CH-Arg (Figure

3.15C), expressed perlecan with an intracellular localisation and even distribution. In contrast, the staining pattern of perlecan produced by HaCaT cells exposed to cell culture medium supplemented with heparin (Figure 3.15 B), LS-CH-Arg and HS-CH-

Arg (Figure 3.15 D & E), was intracellular with a punctate pattern. Interestingly, the punctate pattern of perlecan expression increased with increasing degree of sulphation of the materials to which the cells were exposed. The staining of perlecan expressed by

HaCaT cells exposed to all the materials for 24 hours was remarkably enhanced when

75 compared to the staining of perlecan expressed when cells were exposed to all the materials for only 4 hours.

Figure 3.15: Immunolocalisation of perlecan in HaCaT cells exposed to cell culture medium alone or supplemented with CH-Arg, LS-CH-Arg, HS-CH-Arg or heparin for 4 and 24 hours. Perlecan was detected using the polyclonal anti-perlecan antibody CCN-

1 followed by Alexafluor 488 conjugated anti-rabbit antibody (green). Cell nuclei were counterstained with To-PRO-3(blue). The scale bar represents 60µm.

Perlecan expressed by human primary dermal fibroblast cells exposed to medium only was detected as micro-fibrillar structures located both pericellularly and extracellularly

(Figure 3.16 A). Cells exposed to heparin (Figure 3.16 B) and CH-Arg (Figure 3.16 C) showed a similar staining pattern for perlecan expression as for cells exposed to medium only. In comparison to the fibroblast cells exposed to cell culture medium only, CH-Arg and heparin for 4 hours, cells exposed to both LS-CH-Arg (Figure 3.16

D) and HS-CH-Arg (Figure 3.16 E) for 4 hours not only revealed some intracellular staining for perlecan, but also enhanced perlecan expression. Furthermore, perlecan expressed by fibroblasts exposed to all the materials for 24 hours was apparently increased when compared to cells exposed to these materials for 4 hours. In this thesis, the exposure time produced unsaturated images for all samples. All comparable conditions were analysed on one slide to get bias free pictures. Therefore, it was possible to quantify the perlecan expression in sections in this thesis.

Figure 3.16: Immunolocalisation of perlecan in human primary dermal fibroblast cells exposed to medium alone or supplemented with CH-Arg, LS-CH-Arg, HS-CH-Arg or heparin for 4 and 24 hours. Perlecan was detected using polyclonal anti-perlecan antibody CCN-1 followed by Alexafluor 488 conjugated anti-rabbit antibody (green).

Cell nuclei were counterstained with To-PRO-3(blue). The scale bar represents 60µm.

Quantitative PCR was performed with the primer set for domain V of the HSPG2 gene to further investigate the effect of chitosan-based materials on the production of perlecan produced by both cell types (Figure 3.17). HSPG2 gene expression was analysed for both cell types exposed to cell culture medium alone or supplemented with

CH-Arg, LS-CH-Arg, HS-CH-Arg, or heparin for over 24 hours. HaCaT cells (Figure

3.17 A) exposed to cell culture medium supplemented with LS-CH-Arg, HS-CH-Arg, or heparin for 4 hours significantly (p < 0.05) increased the gene expression by 3-5 fold over cells exposed to medium only, while these materials reduced the gene expression after exposure for 24 hours, with the exception of HS-CH-Arg which displayed a 1.5 fold increase in the gene expression. In contrast, dermal fibroblast cells (Figure 3.17 B) exposed to HS-CH-Arg for 4 hours significantly (p < 0.05) increased HSPG2 gene expression by 3 fold, while it did not alter significantly the gene expression after exposure for 24 hours. Cells exposed to cell culture medium supplemented with CH-

Arg reduced significantly (p < 0.05) the gene expression after exposure for 4 hours, while did not alter significantly the gene expression after exposure for 24 hours. LS-

CH-Arg did not alter significantly the gene expression after exposure for 24 hours either. In contrast, cells exposed to heparin for both 4 hours and 24 hours significantly

(p < 0.05) reduced the gene expression.

A . H a C a T c e lls

i s

s 1 0 e

r *

p x

e *

2 *

G P

S *

n * i

0 .1 *

l 0 .0 1 o

F 4 h 2 4 h

B . D e r m a l f ib r o b la s t s

o i

s 1 0

2 *

G P

S 1

n i *

e *

g n

a *

l 0 .1 o

F 4 h 2 4 h

C H -A r g L S -C H -A r g H S -C H -A r g H e p a r in

Figure 3.17: Quantitative PCR analysis of HSPG2 gene expression in HaCaT(A) and human primary dermal fibroblast (B) cells. Both cell types were exposed to cell culture medium supplemented with CH-Arg (black), LS-CH-Arg (light grey), HS-CH-Arg (dark grey) or heparin (white) for up to 24 hours. Data presented a fold change compared to cells exposed to medium only and corrected for GADPH expression for each treatment. n = 3. * Indicated significant differences (p <0.05) between cells exposed to treatments and medium only at the same time point as determined by a one-way ANOVA.

In summary, this chapter has revealed that full-length perlecan was produced by HaCaT cells and human primary dermal fibroblast cells, decorated with both CS and HS chains.

Perlecan expressed by HaCaT cells was located intracellularly with an even distribution.

The substrate immediately adjacent to the cells was fluorescently stained, resembling adhesion contacts. The addition of CH-Arg did not alter the localisation of perlecan expressed by HaCaT cells, while an increasingly punctate pattern occurred in CH-Arg modified with increasing degree of sulphation. Perlecan expressed by human primary dermal fibroblast cells was detected as micro-fibrillar structures, and located both pericellularly and extracellularly. The addition of CH-Arg did not alter the localisation of perlecan expressed by fibroblasts, while perlecan expressed by fibroblasts exhibited some intracellular staining as well as extracellular and pericellular staining in the presence of CH-Arg with sulphate groups. HSPG2 gene expression was significantly increased in the presence of HS-CH-Arg for 4 hours. Together these data indicated that

CH-Arg with sulphate groups played a role in the expression and localisation of perlecan produced by both skin cells.

Chapter 4 : The effect of chitosan-based materials on 2D and 3D skin models

In light of the effect of chitosan-based materials on perlecan expression in cells at the protein and gene levels which was explored in Chapter 3, their effects on cell interactions and matrix formation in the in vitro skin model were investigated in this chapter. An MTS assay was used to evaluate whether the chitosan-based materials were cytocompatible in keratinocytes and dermal fibroblast cells. The proliferation and migration of keratinocytes were also investigated by observing cells exposed to the treatments at different time points. PGs, collagen type IV, laminin, and GAGs produced by human adult skin were compared with an in vitro skin model to determine whether the in vitro skin model was able to mimic human adult skin. Furthermore, the effect of the chitosan-based materials on the in vitro skin model was investigated by determining the expression of PGs, collagen type IV, laminin, and GAGs.

4.1 The effect of the chitosan-based materials on cell proliferation and migration

The proliferation of the human keratinocyte cell line (HaCaT) between passage 50 and

52 and human primary dermal fibroblasts between passage 4 and 6 was investigated by an MTS assay. Both cell types were exposed to cell culture medium supplemented with

CH-Arg, LS-CH-Arg, HS-CH-Arg, or heparin, and compared to cell culture medium only for 24, 48, and 72 hours (Figure 4.1). PG enriched HaCaT and dermal fibroblast conditioned media were also investigated to explore whether the proliferation of each skin cell can be affected by the PGs produced by the other skin cell type, simulating the condition of co-culture.

Figure 4.1: The proliferation of keratinocytes (A) and dermal fibroblast cells (B) exposed to cell culture medium alone or supplemented with CH-Arg, LS-CH-Arg, HS-

CH-Arg, heparin and HaCaT or human dermal fibroblast cell derived PGs over 72 hours measured by MTS. The concentration of materials was 10 μg/mL. Data were presented as % of the number of cells in each treatment as a proportion of the number of cells exposed to medium only at each time point. n = 3. * Indicated significant differences (p <0.05) between cells exposed to treatments and medium only at each time point as determined by a two-way ANOVA.

PGs derived from human primary dermal fibroblasts significantly (p < 0.05) altered the number of HaCaT cells compared to cells exposed to cell culture medium only at the same time points analysed over 72 hours. However, none of the other treatments significantly altered the proliferation of keratinocytes. This phenomenon suggested that the proliferation of keratinocytes may be enhanced by the presence of human dermal fibroblasts. These analyses indicated that the CH-Arg-based materials were cytocompatible to HaCaT cells over 72 hours (Figure 4.1 A).

Similarly, the number of dermal fibroblasts exposed to cell culture medium with each of the additions of CH-Arg-based materials was not significantly altered compared to cells exposed to cell culture medium only after 24 and 48 hours. It was shown that dermal fibroblasts exposed to dermal fibroblast-derived PGs for 72 hours significantly (p <

0.05) increased cell number compared to exposure to cell culture medium only after 72 hours (Figure 4.1B).

A ‘scratch assay’ was performed using HaCaT cells at passage number 50-54 to investigate the effect of CH-Arg based materials on keratinocyte migration. In this experiment, the cell culture medium was serum-free. The representative images shown in Figure 4.2 were taken after HaCaT cells were exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, HS-CH-Arg, or heparin for 0, 24, 48, and 72 hours. The migration of HaCaT cells was analysed by measuring the area that remained devoid of cells when exposed to each condition compared to the area that remained devoid of cells exposed to cell culture medium only at each time point (Figure 4.3). The keratinocytes migrated in each of the conditions and the area devoid of cells reduced with time. The area devoid of cells was approximately 25% of the original area after exposure to cell culture medium supplemented with either LS-CH-Arg or HS-CH-Arg

for 24 hours, while approximately 95%, 80% and 50% of the area was devoid of cells after exposure to cell culture medium supplemented with heparin, medium only or CH-

Arg for 24 hours compared to the initial area, respectively. The gap was completely closed after exposure to cell culture medium supplemented with either LS-CH-Arg or

HS-CH-Arg for 48 hours, while the area devoid of cells was approximately 90%, 50% and 30% after exposure to cell culture medium supplemented with heparin, medium only or CH-Arg for 48 hours compared to the initial gap, respectively. The area that remained devoid of cells was approximately 40%, 20%, 0%, 0%, and 85% of the initial area when cells were exposed to cell culture medium only, or supplemented with CH-

Arg, LS-CH-Arg, HS-CH-Arg, or heparin for 72 hours, respectively. Both LS-CH-Arg and HS-CH-Arg significantly (p < 0.05) promoted keratinocyte migration compared to cell culture medium only after 24, 48 and 72 hours, while heparin significantly (p <

0.05) inhibited keratinocyte migration compared to cell culture medium only after 48 and 72 hours. There was no significant difference in the speed of cell migration between cells exposed to cell culture medium only and supplemented with CH-Arg. In addition, there was no significant difference in the speed of cell migration between cells exposed to cell culture medium supplemented with LS-CH-Arg and HS-CH-Arg. These data indicated that sulphated CH-Arg supported higher levels of cell migration than the cell culture medium only, while heparin did not support cell migration over the 72 hours analysis period.

Overall, CH-Arg-based materials were cytocompatible to both keratinocytes and dermal fibroblasts, and CH-Arg modified to incorporate sulphate groups, regardless of degree of functionlisation, were able to accelerate keratinocyte migration compared to CH-Arg without sulphate modification and cell culture medium only.

Figure 4.2: Representative images of the migration of HaCaT cells exposed to cell culture medium supplemented with CH-Arg, LS-CH-Arg, HS-CH-Arg, and Heparin compared to cells exposed to medium only after 0, 24, 48 and 72 hours. The concentration of materials was 10 μg/mL. The scale bar represents 60 μm.

1 5 0 M e d iu m o n ly

) C H -A rg

% L S -C H -A rg

( 1 0 0 * * * * e

r *

* H S -C H -A rg

u s

o H e p a rin

p 5 0 a

G * *

h h h 4 8 2 2 4 7

Figure 4.3: The migration of HaCaT cells exposed to cell culture medium supplemented with CH-Arg, LS-CH-Arg, HS-CH-Arg, and heparin compared to cells exposed to cell culture medium only for 0, 24, 48, 72 hours. Data were presented as gap closure (%) by measuring the area that remained devoid of cells at each time point. The concentration of materials was 10 μg/mL. Data were presented as mean ± standard deviation (n=4).* indicated significant difference (p < 0.05) between cells exposed to treatments and medium only at each time point as determined by a two-way ANOVA.

4.2 A comparison of expression of proteoglycans, basement membrane components and GAGs in human adult skin compared to an in vitro skin model

Human skin consists of the epidermis and dermis, which are separated by a basement membrane (BM). Keratinocytes and dermal fibroblasts represent the two main cell types in the epidermis and dermis, respectively. Due to increasing restrictions in the use and handling of animal skin and cost, in vitro skin models have received more attention for human skin studies. In this thesis, an in vitro skin model was fabricated by culturing human primary keratinocytes on fibroblast populated collagen gels, brought to the air/liquid interface to induce stratification of the keratinocytes to mimic the human adult skin. A comparison of glycoproteins and GAGs expression between human adult skin and the in vitro human skin model was conducted using immunohistochemistry (IHC) in order to demonstrate whether the in vitro skin model was able to represent human adult skin. These markers were divided into three groups including BM components, cell surface and intracellular PGs, and GAGs.

4.2.1 The general structure of human adult skin and in vitro skin model

The different cell types and structures found in human adult skin and the in vitro skin model were identified by Hematoxylin-eosin (H&E) staining (Figure 4.4). H&E staining stains the nuclei to dark blue, and the cytoplasm, collagen and keratin to red/pink. Representative images of H&E staining of both human adult skin (Figure 4.4

A) and the in vitro skin model (Figure 4.4 B) were shown below. The epidermis was primarily divided into the stratum corneum (SC), the stratum spinosum (SP) and the stratum basale (SB) based on the morphology of the keratinocytes (Figure 4.4 A). The

SC, which was an acellular layer, was located at the top of epidermis. The keratinocytes in the SP were irregular in morphology and with visible dark blue nuclei, and the upper keratinocytes in this layer had begun to lose their nuclei. The keratinocytes in the SB rested on the underlying BM with visible dark blue nuclei. The fibroblast populated dermis consisted of papillary dermis and reticular dermis based on the arranged connective tissue. The loose and areolar connective tissue was observed in papillary dermis, while dense and irregular connective tissue was found in reticular dermis

(Figure 4.4 A).

Human primary dermal fibroblast cells populated a collagen type I gel, termed the mimicked dermis, in the in vitro skin model represented the dermis, while human primary keratinocytes were seeded on top of the mimicked dermis, termed the mimicked epidermis, represented the epidermis. After 27 days in culture, the mimicked epidermis had a similar epidermis thickness with the human adult skin. The mimicked epidermis from the bottom to the top was divided into the formed stratum basale (FSB), formed stratum spinosum (FSP), and formed stratum corneum (FSC) dependent on the keratinocyte morphology in different location (Figure 4.4 B). The keratinocytes in the

FSB were round in morphology and arranged tightly with visible nuclei. In contrast, those in the FSP became flatter in morphology and arranged loosely with still visible, but faded, nuclei. There were almost no keratinocytes observed in the FSC. The keratinocytes in FSB were stained faintly by eosin, while the upper keratinocytes showed an intense staining by eosin. Overall, the in vitro skin model formed the mimicked epidermis and dermis which had similar structure with the epidermis and dermis in human adult skin, respectively.

Figure 4.4: Representative images of H&E staining of both human adult skin (A) and the in vitro skin model (B). The scale bars represent 60 μm. The nuclei were stained to dark blue by hematoxylin, and the cytoplasm, collagen and keratin were counterstained to orange/pink by eosin. SC, SP and SB in human adult skin denoted the stratum corneum, stratum spinosum and stratum basale, respectively. K and F&C denoted the keratinocyte layer and fibroblasts populated in collagen gel, respectively. FSC, FSP and FSB in skin model represented the formed stratum corneum, formed stratum spinosum and formed stratum basale, respectively.

4.2.2 A comparison of the expression of BM components between human adult skin and the in vitro skin model

The expression and localisation of BM components including perlecan, laminins, and collagen type IV were explored in human adult skin and in the in vitro skin model to investigate whether the in vitro skin model was able to form a BM similar to human skin.

Perlecan was present in both the epidermis and dermis of human adult skin (Figure 4.5

A (i)). Perlecan was detected with intracellular staining in the epidermis associated with keratinocytes and the intensity of perlecan expressed along the basal cells was higher than that expressed in the upper keratinocytes of the epidermis (Figure 4.5 A (ii)).

Similarly, the expression of perlecan in the in vitro skin model was detected in the dermal-epidermal junction (DEJ) as well as surrounding the fibroblasts in the mimicked dermis (Figure 4.5 B (i)). In contrast, intracellular perlecan was not found in the keratinocytes in the in vitro skin model (Figure 4.5 B (ii)).

Figure 4.5: Immunohistochemical analyses of perlecan in adult human skin (A) and in vitro skin model (B). The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). E and D denoted epidermis and dermis, respectively while K and F&C denoted the keratinocyte layer and fibroblasts embedded in Col I gel, respectively. Perlecan was identified by using a rabbit polyclonal antibody,

CCN-1, followed by anti-rabbit secondary antibody and then stained by NovaRED.

The expression and localisation of laminin β1, the most widespread among the β-chains, and laminin-5, as the main form of laminin present in the human skin, were investigated to represent the overall expression of laminin. The localisation of laminin β1 in human skin was similar to that of perlecan in human skin. It was located in both the epidermis and dermis with an intense intracellular staining associated with keratinocytes and fibroblasts in both skin layers (Figure 4.6 A (i)). The staining of laminin β1 in the epidermis was primarily distributed in the basal cells (Figure 4.6 A (ii)). The expression of laminin β1 in the in vitro skin model was located throughout the mimicked epidermis and the DEJ, as well as the mimicked dermis, particularly associated with fibroblasts with both an intracellular and pericellular pattern (Figure 4.6 B (i) & (ii)).

Figure 4.6: Immunohistochemical analyses of laminin β1 in adult human skin (A) and in vitro skin model (B). The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). E and D denoted epidermis and dermis, respectively while K and F&C denoted the keratinocyte layer and fibroblasts embedded in Col I gel, respectively. Laminin β1 was identified by using a rabbit polyclonal antibody, 600-401-116-0.5, followed by anti-rabbit secondary antibody and then stained by NovaRED.

The expression of laminin 5 was faintly detected in the BM of human adult skin and intracellularly in the lower basal keratinocytes (Figure 4.7 A (i &ii)). Similarly, the faint staining was found in the DEJ of the in vitro skin model (Figure 4.7 B (i &ii)). Laminin

5 was also observed around fibroblasts populated in collagen type I gel of the skin model (Figure 4.7 B (iii)), while it was not observed in the dermis of human adult skin.

Figure 4.7: Immunohistochemical analyses of laminin 5 in adult human skin (A) and the in vitro skin model (B). The boxed region in (i) was enlarged in (ii) and (iii). Scale bars represented 300µm (i) and 60µm (ii & iii). E and D denoted epidermis and dermis, respectively while K and F&C denoted the keratinocyte layer and fibroblasts embedded in Col I gel, respectively. Laminin 5 was identified by using a mouse monoclonal antibody, clone P3H9, followed by anti-mouse secondary antibody and then stained by

NovaRED.

The expression of collagen IV was detected throughout the dermis of human adult skin

(Figure 4.8 A (i)) and the BM (Figure 4.8 A (ii)). A layer with intense collagen type IV staining was present in the DEJ in the in vitro skin model (Figure 4.8 B (i)), separating the mimicked epidermis from the mimicked dermis. Collagen IV was not found in the mimicked epidermis in the in vitro skin model, similar to the absence of collagen IV in the epidermis of human adult skin (Figure 4.8 A &B (ii)).

Figure 4.8: Immunohistochemical analyses of collagen type IV in adult human skin (A) and the in vitro skin model (B). The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). E and D denoted epidermis and dermis, respectively while K and F&C denoted the keratinocyte layer and fibroblasts embedded in Col I gel, respectively. Collagen IV was identified by using a rabbit polyclonal antibody, ab6586, followed by anti-rabbit secondary antibody and then stained by

NovaRED.

Together these data indicated that the BM was formed in the in vitro skin model, containing perlecan, laminin and collagen type IV, with similar localisation to human adult skin. Additionally, perlecan and laminin β1 were found in the epidermis and dermis of both human adult skin and the in vitro skin model, and was shown to be associated with keratinocytes and fibroblasts resident in both layers, respectively.

Laminin 5 was not found in either the epidermis or dermis of either skin or the skin model. Collagen type IV was observed throughout the dermis of both skin and the skin model, but not in the epidermis.

4.2.3 A comparison of the expression of cell surface PGs between human adult skin and the in vitro skin model

The expression and localisation of cell surface PGs, syndecan-1 and syndecan-4, were explored in human adult skin (Figure 4.9 A) and the in vitro skin model (Figure 4.9 B) to investigate whether the in vitro skin model was able to express cell surface PGs similar to human adult skin.

In human adult skin, syndecan-1 (Figure 4.9 A) was primarily found in the epidermis, particularly on the superficial layers of the keratinocytes (Figure 4.9 A (ii)). Fibroblast cells located in the dermis also weakly stained for syndecan-1 (Figure 4.9 A (iii)). In contrast, syndecan-1 in the in vitro skin model (Figure 4.9 B) was predominantly observed in the DEJ associated with basal keratinocytes, while it was not found to be present in the mimicked epidermis and dermis (Figure 4.9 B (ii)).

Figure 4.9: Immunohistochemical analyses of syndecan-1 in adult human skin (A) and the in vitro skin model (B). The boxed region in (i) was enlarged in (ii).The boxed region iii in Aa (i) was enlarged and then inserted at the right top of Aa (i). Scale bars represented 300µm (i) and 60 µm (ii and iii). E and D denoted epidermis and dermis, respectively while K and F&C denoted the keratinocyte layer and fibroblasts embedded in Col I gel, respectively. Syndecan-1 was identified by using a mouse monoclonal antibody, clone B-A38, followed by anti-mouse secondary antibody and then stained by

NovaRED.

Syndecan-4 was observed in both the epidermis and dermis in human adult skin associated with keratinocytes and fibroblasts (Figure 4.10 A (i)). Syndecan-4 was located predominantly on the cell surface of keratinocytes in the epidermis. Some weak staining was also found perinuclearly in fibroblasts within the dermis (Figure 4.10A

100

(ii)). In the in vitro skin model, syndecan-4 was rarely found surrounding fibroblasts in the mimicked dermis (Figure 4.10 B (i)). Syndecan-4 was localised in the DEJ and extracellularly in the epidermis associated with keratinocytes (Figure 4.10 B (ii)).

Figure 4.10: Immunohistochemical analyses of syndecan-4 in adult human skin (A) and the in vitro skin model (B). The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60 µm (ii and iii). E and D denoted epidermis and dermis, respectively while K and F&C denoted the keratinocyte layer and fibroblasts embedded in Col I gel, respectively. Syndecan-4 was identified by using a rabbit polyclonal antibody, ab24511, followed by anti-rabbit secondary antibody and then stained by

NovaRED.

101

4.2.4 A comparison of the expression of serglycin between human adult skin and the in vitro skin model

The expression and localisation of serglycin were explored in human adult skin and the in vitro skin model to investigate whether the skin model was able to express serglycin similar to human adult skin.

Serglycin was observed intracellularly in the keratinocytes in the epidermis in human adult skin (Figure 4.11 A (ii)). In addition, serglycin was also found on the surface of keratinocytes in the epidermis. Similarly, serglycin was found throughout the mimicked epidermis and much stronger intracellular staining was observed in both the mimicked epidermis associated with keratinocytes in the in vitro skin model (Figure 4.11 B (ii)).

In contrast to human adult skin, serglycin was found intracellularly in the mimicked dermis associated with fibroblasts (Figure 4.11 B (i)).

102

Figure 4.11: Immunohistochemical analyses of serglycin in adult human skin (A) and the in vitro skin model (B). The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). E and D denoted epidermis and dermis, respectively while K and F&C denoted the keratinocyte layer and fibroblasts embedded in Col I gel, respectively. Serglycin was identified by using a rabbit polyclonal antibody, gift from Dr.Achilleas Theocharis, followed by anti-rabbit secondary antibody and then stained by NovaRED.

4.2.5 A comparison of the expression of HS between human adult skin and in vitro skin model

The presence of HS was investigated in human skin and the in vitro skin model. HS chains containing both N-acetylated and N-sulphated disaccharide units, were detected

103

using the antibody clone 10E4, while all HS was detected with the antibody clone 3G10 following H’ase III treatment. In human adult skin, HS chains were found on the cell surface of keratinocytes in the epidermis and extracellularly associated with keratinocytes. Some HS chains were found in the dermis associated with fibroblasts

(Figure 4.12 A (ii)). HS chains were present in the DEJ associated with keratinocytes in the in vitro skin model (Figure 4.12 B (ii)), and faint staining was found surrounding fibroblasts in the mimicked dermis (Figure 4.12 B (i)). HS stubs were observed predominantly on the cell surface of keratinocytes in the epidermis and fibroblasts in the dermis in human adult skin (Figure 4.13 A (ii)). Similarly, HS stubs were found in the

DEJ associated with keratinocytes and surrounding fibroblasts in the mimicked dermis in the in vitro skin model (Figure 4.13 B (ii)).

104

Figure 4.12: Immunohistochemical analyses of HS chains (clone 10E4) in adult human skin (A) and the in vitro skin model (B). The boxed region in (i) was enlarged in (ii).

Scale bars represented 300µm (i) and 60µm (ii). E and D denoted epidermis and dermis, respectively while K and F&C denoted the keratinocyte layer and fibroblasts embedded in Col I gel, respectively. HS chains were identified by using a mouse monoclonal antibody, clone 10E4, followed by anti-rabbit secondary antibody and then stained by NovaRED.

105

Figure 4.13: Immunohistochemical analyses of HS stubs (clone 3G10) in adult human skin and in vitro skin model. The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). E and D denoted epidermis and dermis, respectively while K and F&C denoted the keratinocyte layer and fibroblasts embedded in Col I gel, respectively. HS stubs were identified by using a mouse monoclonal antibody, clone 3G10, followed by anti-rabbit secondary antibody and then stained by

NovaRED.

106

4.2.6 The isotype and secondary antibody controls for both human adult skin and the in vitro skin model

Both human adult skin and the in vitro skin model were probed with whole rabbit IgG, and whole mouse IgG and IgM antibodies, as isotype controls, to ensure the specificity of the staining presented in sections 4.2.2-4.2.5 (Figure 4.14). These data demonstrated that non-specific immunoglobulin binding did not occur. No significant staining was observed when probed with the biotinylated anti-rabbit IgG, anti-mouse IgG or IgM secondary antibody followed by NovaRED development (Figure 4.15).

107

Figure 4.14: The controls included probing with mouse IgG (i), mouse IgM (ii) and rabbit IgG (iii) isotype antibodies, followed by the secondary antibodies and then stained by NovaRED development. Scale bars represented 60µm. E and D denoted epidermis and dermis, respectively while K and F&C denoted the keratinocyte layer and fibroblasts embedded in Col I gel, respectively.

108

Figure 4.15: The controls were carried out with sections probed without primary antibodies with biotinylated mouse IgG (i), mouse IgM (ii) and rabbit (iii) secondary antibodies and then stained by NovaRED develpoment. Scale bars represented 60µm. E and D denoted epidermis and dermis, respectively while K and F&C denoted the keratinocyte layer and fibroblasts embedded in Col I gel, respectively.

109

Overall, the in vitro skin model represented the human adult skin. After the skin model was cultured for 27 days, the basal keratinocytes in the mimicked epidermis were round and arranged tightly, and keratinocytes in the upper layer became flatter and arranged loosely, which was similar to human adult skin. A BM underneath the basal keratinocytes was formed in the in vitro skin model. BM components including perlecan, laminin, and collagen type IV were present in the in vitro skin model similar to human adult skin indicating that the BM was formed in the in vitro skin model to be able to represent human adult skin. In addition, syndecan-1 and syndecan-4 were also observed on the cell surface of keratinocytes in the mimicked epidermis which was similar to the epidermis in human adult skin. Furthermore, HS was present in both the mimicked epidermis and dermis in the in vitro skin model similar to human adult skin, indicating that the localisation of HSPGs in the in vitro skin model was similar to their localisation in human adult skin. Serglycin were found in the mimicked epidermis in the in vitro skin model similar to the epidermis in human adult skin, while serglycin was found in the mimicked dermis in the in vitro skin model, but not observed in the dermis in human adult skin. Together with these data, the in vitro skin model was a valid one to represent human adult skin, although the skin model did not completely replicate the human adult skin.

110

4.3 A comparison of the expression of PGs, BM components and GAGs in the in vitro skin model following exposure to chitosan-based materials

In order to investigate the effect of chitosan-based materials on skin ECM production, the in vitro skin model was exposed to cell culture medium alone or supplemented with

CH-Arg, LS-CH-Arg or HS-CH-Arg for 3 weeks. A comparison of the overall structure, as well as the expression of glycoproteins and GAGs among these treatments in the in vitro skin model was conducted using IHC to investigate whether CH-Arg-based materials were able to affect the expression of these molecules involved in wound healing. These markers were divided into four groups including BM components, cell surface PGs, intracellular PGs, and GAGs.

4.3.1 The overall structure of the in vitro skin model following exposure to chitosan-based materials

The overall structure of the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, or HS-CH-Arg for 3 weeks was investigated by H&E staining. Representative images of H&E stained sections of the in vitro skin model are shown in Figure 4.16. The in vitro skin model was divided into three parts: the mimicked epidermis with resident keratinocytes, the BM (dash arrowed in Figure

4.16 A ii) underneath the basal keratinocytes, and the underlying mimicked dermis populated with fibroblasts. The mimicked epidermis was further divided into the FSC without cells, the FSS with the flatter keratinocytes and the FSB with the round keratinocytes. The basal keratinocytes were round in morphology and arranged tightly, while the upper keratinocytes were flatter and arranged loosely (Figure 4.16 A). The in vitro skin model exposed to medium supplemented with chitosan-based materials

111

showed a remarkable difference from the models exposed to cell culture medium only.

The thickness of the mimicked epidermis in the skin model exposed to cell culture medium only or supplemented with CH-Arg (Figure 4.16 B), LS-CH-Arg (Figure 4.16

C) or HS-CH-Arg (Figure 4.16 D) was on average 54.3 ± 17.8, 151.5 ± 62.9, 119.2 ±

33.5 and 135.9 ± 34.1 μm, respectively, by calculating the thickness of 3 replicates of 9 sites per condition. This analysis indicated that the thickness of the mimicked epidermis in the in vitro skin model exposed to medium supplemented with chitosan-based materials was significantly (p < 0.05) thicker than that of the model exposed to cell culture medium only (Figure 4.17 A). Additionally, the addition of LS-CH-Arg reduced the thickness of the mimicked epidermis of the skin model compared to the addition of

CH-Arg. These data indicated that cell culture medium supplemented with the chitosan- based materials significantly enhanced epidermal production compared to the model exposed to cell culture medium only. In contrast, the thickness of the FSB in the skin model (Figure 4.17 B) exposed to cell culture medium alone or supplemented with CH-

Arg, LS-CH-Arg or HS-CH-Arg was on average 26.4 ± 9.2, 36.8 ± 12.7, 26.0 ± 5.1 and

32.8 ± 19.9 μm. The addition of CH-Arg significantly (p < 0.05) increased the thickness of the FSB compared to cell culture medium only, while the addition of either LS-CH-

Arg or HS-CH-Arg did not alter significantly (p < 0.05) the thickness. Similarly, the addition of LS-CH-Arg reduced the thickness of the FSB compared to the additive CH-

Arg. Overall the CH-Arg-based materials significantly (p < 0.05) enhanced the mimicked epidermal thickness, in particular the thickness of the FSS and FSC, indicating that CH-Arg-based materials were beneficial to the formation of the epidermis.

The morphology of basal keratinocytes was slightly different among the CH-Arg-based materials. Generally, the basal keratinocytes in the skin model exposed to cell culture

112

medium alone or supplemented with CH-Arg or HS-CH-Arg were round and arranged regularly, while they were polygonal and arranged irregularly in the skin model exposed to cell culture medium supplemented with LS-CH-Arg.

113

Figure 4.16: H&E staining for the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and HS-CH-Arg for 3 weeks. The nuclei were stained to dark blue by hematoxylin, and the cytoplasm, collagen and keratin were counterstained to orange/pink by eosin. Scale bars represented 300µm (i) and 60µm (ii). ME and MD denoted the mimicked epidermis and dermis, respectively.

FSC, FSS, and FSB denoted the formed stratum corneum, formed stratum spinosum, and formed stratum basale, respectively.

114

Figure 4.17: Analyses of the thickness of the mimicked epidermis and the FSB in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-

CH-Arg, and HS-CH-Arg for 3 weeks.3 replicates for each condition were conducted, 3 sections were chosen for each replicate, and 3 sites (maximum, middle, minimum thickness) were analysed for each section. Therefore, 27 points were used to analyse the thickness of the mimicked epidermis and the FSB in the in vitro skin models. * Indicated significant differences (p <0.05) compared to the skin model exposed to cell culture medium only as determined by a one-way ANOVA. # indicated significant differences

(p <0.05) compared to the skin model exposed to cell culture medium supplemented with CH-Arg by a one-way ANOVA.

115

4.3.2 The expression of BM components in the in vitro skin model following exposure to chitosan-based materials

The presence and localisation of perlecan, laminin β1, and collagen type IV in the in vitro skin model were explored to investigate whether CH-Arg-based materials were able to affect the expression of BM components.

Perlecan was present in both the mimicked epidermis and mimicked dermis in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg,

LS-CH-Arg, or HS-CH-Arg (Figure 4.18 i & ii). In the mimicked epidermis, perlecan was only detected in the FSB (Figure 4.18 A). Perlecan showed a gradient pattern in the

FSB, with the most intense staining in the lower keratinocytes overlying the BM to weaker staining in the upper keratinocytes. Perlecan was observed intracellularly in the keratinocytes, and was localised around the nuclei. In addition, perlecan was also found on the cell surface of the keratinocytes with a high intensity. Perlecan was found on the top of the stratum corneum in the skin model exposed to cell culture medium supplemented with CH-Arg (Figure 4.18 B), LS-CH-Arg (Figure 4.18 C) or HS-CH-

Arg (Figure 4.18 D), rather than cell culture medium only. Beyond that, the additives of chitosan-based materials did not alter remarkably the staining pattern of perlecan compared to no additives.

116

Figure 4.18: Immunohistochemical analyses of perlecan in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

CCN-1, followed by anti-rabbit secondary antibody and then developed by NovaRED.

117

The localisation of laminin β1 in both the mimicked epidermis and dermis was found with an intense intracellular staining, particularly around the nuclei of keratinocytes and fibroblasts regardless of the skin model exposed to cell culture medium only (Figure

4.19 A) or supplemented with CH-Arg (Figure 4.19 B), LS-CH-Arg (Figure 4.19 C), or

HS-CH-Arg (Figure 4.19 D). Laminin β1 in the mimicked epidermis showed a gradient staining pattern, with a higher intensity of staining in the basal keratinocytes and a lower intensity of staining in the upper keratinocytes, as well as the FSC (Figure 4.19

A). A similar staining pattern of laminin β1 was shown after exposure to cell culture medium supplemented with chitosan-based materials (Figure 4.20 B-D) compared to models exposed to cell culture medium only

118

Figure 4.19: Immunohistochemical analyses of laminin in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks. The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). ME and MD denoted the mimicked epidermis and dermis, respectively. Laminin β1 was identified by using a rabbit polyclonal antibody,

600-401-116-0.5, followed by anti-rabbit secondary antibody and then developed by

NovaRED.

119

The expression of collagen IV was primarily detected throughout the mimicked dermis of the skin model exposed to cell culture medium only (Figure 4.20 A) or supplemented with CH-Arg (Figure 4.20 B), LS-CH-Arg (Figure 4.20 C), or HS-CH-Arg (Figure 4.20

D). The keratinocytes attached to the BM showed a relatively higher collagen IV staining compared to the other keratinocytes which were not linked to the BM. In the skin model exposed to cell culture medium supplemented with CH-Arg-based materials

(Figure 4.20 B-D), collagen IV was also observed on the top of these models with a higher intensity, while it was not found in the skin models exposed to cell culture medium only.

120

Figure 4.20: Immunohistochemical analyses of collagen IV in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks. The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). ME and MD denoted the mimicked epidermis and dermis, respectively. Collagen IV was identified by using a rabbit polyclonal antibody, ab6586, followed by anti-rabbit secondary antibody and then developed by NovaRED.

121

Overall, perlecan, laminin, and collagen type IV were present in both the mimicked epidermis and dermis in the skin model regardless of the condition of exposure. The

BM components were found on the top of the mimicked epidermis in the skin model exposed to cell culture medium supplemented with CH-Arg materials rather than the skin model exposed to cell culture medium only. However, the staining pattern of the

BM components did not show any difference among these additives. Together these analyses indicated that the CH-Arg-based materials may enhance the expression of the

BM components in the in vitro skin model.

122

4.3.3 The expression of cell surface PGs in the in vitro skin model following exposure to chitosan-based materials

The expression and localisation of cell surface PGs, syndecan-1 and syndecan-4 were investigated in the in vitro skin model following exposure to cell culture medium only or supplemented with chitosan-based materials for 3 weeks to explore whether CH-Arg- based materials were able to alter the expression of cell surface PGs.

Syndecan-1 was predominantly observed on the superficial layer of the basal keratinocytes and cell membrane associated in the in vitro skin model regardless of the different conditions of exposure (Figure 4.21 A-D). Syndecan-1 was primarily found on the lower keratinocytes close to the BM in the in vitro skin model exposed to cell culture medium (Figure 4.21 A) or supplemented with CH-Arg (Figure 4.21 B). In contrast, the staining of syndecan-1 showed a gradient pattern in the FSB in the skin model exposed to cell culture medium supplemented with LS-CH-Arg (Figure 4.21 C) with a decrease in syndecan-1 expression away the BM. Syndecan-1 was found on the cell surface of the middle basal keratinocytes relatively stronger than that found on the cell surface of the basal keratinocytes close to the FSS and attached to the BM in the skin model exposed to cell culture medium supplemented with HS-CH-Arg (Figure 4.21

D).

123

Figure 4.21: Immunohistochemical analyses of syndecan-1 in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks.The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). ME and MD denoted the mimicked epidermis and dermis, respectively. Syndecan-1 was identified by using a mouse monoclonal antibody clone B-A38, followed by anti-mouse secondary antibody and then developed by

NovaRED.

124

Syndecan-4 was observed in both the mimicked epidermis associated with keratinocytes and dermis associated with fibroblasts in the skin model exposed to cell culture medium only or supplemented with chitosan-based materials (Figure 4.22 A-D). Syndecan-4 was found intracellularly, as well as on the surface of the basal keratinocytes in the mimicked epidermis in the model exposed to cell culture medium without (Figure 4.22

A) or with additives (Figure 4.22 B-D). Some staining was also found in the FSP associated with keratinocytes and the FSC in the skin model exposed to cell culture medium supplemented with CH-Arg-based materials arrowed in Figure 4.22 B-D.

125

Figure 4.22: Immunohistochemical analyses of syndecan-4 in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks. The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). ME and MD denoted the mimicked epidermis and dermis, respectively.Syndecan-4 was identified by using a rabbit polyclonal antibody, ab24511, followed by anti-rabbit secondary antibody and then developed by NovaRED.

126

Overall, cell surface PGs including syndecan-1 and syndecan-4 were present in the mimicked epidermis associated with keratinocytes in the in vitro skin model exposed to cell culture medium without or with additives. Syndecan-1 was found with a gradient pattern in the FSB in the skin model exposed to cell culture medium supplemented with

LS-CH-Arg with an increase in syndecan-1 expression towards the BM. Syndecan-1 was found to be stronger on the cell surface of the middle basal keratinocytes than the basal keratinocytes close to the FSS or attached to the BM in the skin model exposed to cell culture medium supplemented with HS-CH-Arg. Syndecan-4 was found in the FSP associated with keratinocytes and the FSC in the skin model exposed to cell culture medium supplemented with CH-Arg-based materials compared to the skin model exposed to cell culture medium only. Together these analyses indicated that CH-Arg- based materials, in particular CH-Arg with sulphate groups may play a role in enhancing the expression of cell surface PGs.

127

4.3.4 The expression of serglycin in the in vitro skin model following exposure to chitosan-based materials

The expression and localisation of serglycin were investigated in the in vitro skin model following exposure to cell culture medium only or supplemented with CH-Arg, LS-CH-

Arg or HS-CH-Arg in order to explore the effect of CH-Arg-based materials on the expression of serglycin in the skin model (Figure 4.23).

In the skin model exposed to cell culture medium only (Figure 4.23 A), serglycin was observed throughout the basal keratinocytes with intracellular staining, particularly around the nuclei. In addition to the intracellular staining in basal keratinocytes, serglycin was also found in the FSP associated with the upper keratinocytes in the skin model exposed to cell culture medium supplemented with CH-Arg-based materials

(Figure 4.23 B-D). The staining pattern in the mimicked dermis was similar between the exposure to cell culture medium supplemented with CH-Arg-based materials and cell culture medium only with intracellular staining in fibroblasts. These analyses indicated that CH-Arg-based materials may play a role in the expression of serglycin in the skin model.

128

Figure 4.23: Immunohistochemical analyses of serglycin in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks. The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). ME and MD denoted the mimicked epidermis and dermis, respectively. Serglycin was identified by using a rabbit polyclonal antibody, gift from Dr.Achilleas Theocharis, followed by anti-rabbit secondary antibody and then developed by NovaRED.

129

4.3.5 The expression of HS in the in vitro skin model following exposure to chitosan-based materials

The presence and localisation of HS were investigated in the in vitro skin model following exposure to cell culture medium only or supplemented with CH-Arg-based materials for 3 weeks to explore the effect of CH-Arg-based materials on the expression of HS in the in vitro skin model. HS chains containing both N-acetylated and N- sulphated disaccharide units, were detected using the antibody clone 10E4, while all HS was detected with the antibody clone 3G10 following H’ase III treatment.

HS chains were primarily found on the surface of the basal keratinocytes with a gradient staining pattern, with the most intense staining in the lower keratinocytes overlying the

BM to weaker staining in the upper keratinocytes, until the staining was not observed in the keratinocytes in the FSP in the skin model exposed to cell culture without (Figure

4.24 A) or with the additions of CH-Arg-based materials (Figure 4.24 B-D). Some intracellular staining was also found in the basal keratinocytes in the mimicked epidermis in the skin model exposed to all conditions. HS chains were found throughout the FSB in the model exposed to cell culture medium supplemented with HS-CH-Arg

(Figure 4.24 D), rather than only 1-2 layers of basal keratinocytes in the FSB in the model exposed to cell culture medium (Figure 4.24 A) or supplemented with other CH-

Arg-based materials (Figure 4.24 B&C). The staining of HS chains was similar between the exposure to cell culture medium supplemented with CH-Arg-based materials and cell culture medium only in the mimicked dermis associated with fibroblasts.

130

Figure 4.24: Immunohistochemical analyses of HS chains in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks. The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). ME and MD denoted the mimicked epidermis and dermis, respectively. HS chains were identified by using a mouse monoclonal antibody, clone 10E4, followed by anti-rabbit secondary antibody and then developed by

NovaRED.

131

HS stubs were observed predominantly on the cell surface of basal keratinocytes in the mimicked epidermis and interpenetrated into the collagen I gel in the mimicked dermis.

The staining in the basal keratinocytes of the models exposed to cell media only (Figure

4.25 A) showed a gradient pattern with the keratinocytes closer to the BM more intensely stained than the keratinocytes further away from the BM. This phenomenon also occurred in the models exposed to chitosan-based materials (Figure 4.25 B-D). HS stubs were found throughout the FSB in the model exposed to cell culture medium supplemented with HS-CH-Arg (Figure 4.25 D), rather than only several layers of basal keratinocytes close to the BM in the FSB in the model exposed to cell culture medium

(Figure 4.25 A) or supplemented with other CH-Arg-based materials (Figure 4.25

B&C).

Overall, HS was present in both the mimicked epidermis and dermis in the in vitro skin model exposed to cell culture medium without or with the additives of CH-Arg-based materials associated with basal keratinocytes and fibroblasts, respectively. HS was found on the surface of the basal keratinocyte with a gradient pattern, with a decrease in the expression of HS further away from the BM. HS was found throughout the FSB in the skin model exposed to cell culture medium supplemented with HS-CH-Arg compared to several layers of basal keratinocytes in the skin model exposed to other conditions. This phenomenon indicated that HS-CH-Arg may be able to enhance the expression of HS in the in vitro skin model. Together these analyses indicated that CH-

Arg-based materials, in particular with sulphate groups may play a role in enhancing the expression of HS in the in vitro skin model.

132

Figure 4.25: Immunohistochemical analyses of HS stubs in the in vitro skin model exposed to cell culture medium only or supplemented with CH-Arg, LS-CH-Arg, and

HS-CH-Arg for 3 weeks. The boxed region in (i) was enlarged in (ii). Scale bars represented 300µm (i) and 60µm (ii). ME and MD denoted the mimicked epidermis and dermis, respectively. HS stubs were identified by using a mouse monoclonal antibody, clone 3G10, followed by anti-rabbit secondary antibody and then developed by

NovaRED.

133

4.3.6 The isotype and secondary antibody controls in the in vitro skin model following exposure to chitosan-based materials

The in vitro skin model following exposure to cell culture medium only or supplemented with CH-Arg-based materials was probed with whole rabbit IgG, and whole mouse IgG antibodies, as isotype controls, to determine the specificity of staining presented in sections 4.3.2-4.3.5 (Figure 4.26). These data demonstrated that non- specific immunoglobulin binding did not occur as no significant staining was detected.

134

Figure 4.26: The controls were conducted by using mouse IgG (i) and rabbit IgG (ii) isotype antibodies, and (iii) without primary antibodies, followed by secondary antibodies and then developed by NovaRED. Scale bars represented 60µm. ME and MD denoted the mimicked epidermis and dermis, respectively.

135

In summary, this chapter has revealed the effect of CH-Arg-based materials on the proliferation and migration of skin cells, as well as matrix formation in the in vitro skin model. CH-Arg-based materials at 10 μg/ml were cytocompatible to human keratinocytes and dermal fibroblasts, and CH-Arg-based materials, in particular with sulphate groups, supported the migration of keratinocytes. A BM underlying the mimicked epidermis was formed in the in vitro skin model containing the major BM components including perlecan, laminin, and collagen type IV. In addition, syndecan-1, syndecan-4, and serglycin as well as the HS were found in the in vitro skin model similar to their localisation in human adult skin. Together these analyses indicated that the in vitro skin model was a valid model to represent the human adult skin. The additives of CH-Arg-based materials significantly enhanced the thickness of the epidermis in the in vitro skin model compared to the model exposed to cell culture medium only, indicating that CH-Arg-based materials were able to support the epidermal formation. Additionally, CH-Arg-based materials altered the expression and localisation of perlecan, laminin, collagen IV, syndecan-1, and syndecan-4, as well as serglycin compared to the skin model exposed to cell culture medium only, indicating that CH-Arg-based materials in particular with sulphate groups may play a role in enhancing the expression the matrix molecules in the skin model. Together with the role of HS-CH-Arg in enhancing the expression of HS, CH-Arg-based materials may play an important role in healing skin wounds.

136

Chapter 5 : Discussion

Chronic wounds are those that have failed to undergo an orderly and timely reparative process to generate anatomic and functional integrity of the wounded site [197]. The incidence of chronic wounds has rapidly increased due to the rising prevalence of some chronic diseases. There are, however, no effective treatments in the long-term care for patients with chronic wounds.

The HSPG, perlecan, is present in all BMs and promotes cell attachment and migration associated with wound healing [88, 95, 194, 198]. The major role of HS is the binding and signalling of growth factors and the sulphated regions in HS bind to growth factors/growth factor receptors [199]. Biomaterials that mimic naturally occurring HS are hypothesised to play a key role in skin wound healing through the delivery of growth factors. Chitosan is a polyglucosamine material composed of repeating β-

(1→4)-linked N-acetyl-D-glucosamine and D-glucosamine units [15], with a similar structure to HS, with the exception of sulphate modifications. Thus, this thesis explored the structure and expression of perlecan produced by HaCaT keratinocytes and human primary dermal fibroblasts either without or with the presence of sulphate modified versions of chitosan in the 2D and 3D skin model, as well as the possibility of sulphated chitosan-based materials to mimic HS in skin wound healing.

5.1 Expression, localisation and structure of HSPG, perlecan, secreted by human keratinocytes and human dermal primary fibroblasts

Perlecan has been found to be expressed in human and other mammalian skins [67, 82,

83]. The epidermal keratinocytes and dermal fibroblasts are the principle source of perlecan in the skin BM [200, 201]. In this thesis, anion exchange chromatography was

137

used to isolate PGs from the conditioned media of both HaCaT cells and human dermal fibroblasts. The negatively charged PGs were bound to the DEAE Sepharose column, and then were eluted at 1M NaCl [202]. In addition to perlecan, HSPGs including collagen type XVIII and agrin, and cell surface PGs, glypican and syndecans, as well as

BM components, laminins were also found to be present in PGs enriched HaCaT keratinocyte and human primary dermal fibroblast conditioned media identified by LC-

MS2. Different type of syndecans and laminins were shown to differ in the PG enriched

HaCaT and fibroblast cell conditioned media, consistent with the previous literature [40,

52, 94, 121, 124, 125, 203, 204]. These literature reported that different laminin chains and syndecans were able to be produced by human epidermal keratinocytes [204] and dermal fibroblasts [203]. For example, laminin chains α5 and γ2 were found in BMs associated with epithelial cells, while laminin chain α4 was more likely present in connective tissue [52]; syndecan-1 was commonly found in skin epithelium associated with keratinocytes in adults [94, 121, 124], while syndecan-4 was expressed in a variety of cells with a wide distribution [40, 125].

ELISA analyses performed in this thesis, however, did not exhibit any detectable level of collagen type XVIII, agrin, or syndecans in both PG enriched HaCaT and human dermal fibroblast cell conditioned media, suggesting these molecules may be present in low abundance. In contrast, perlecan and GAGs including HS and CS were detected in both the PG enriched cell conditioned media, indicating that human keratinocytes and dermal fibroblasts were able to produce perlecan under standard culture conditions.

Alitalo et al. [204] and Heremans et al. [203] reported that human epidermal keratinocytes and dermal fibroblasts were able to produce perlecan decorated with HS.

Yamane et al. [205] reported that rat epidermal and dermal cells can also produce

HSPGs including perlecan. They also observed that CSPGs were present in the rat skin

138

BM. Neither rat cultured keratinocytes nor fibroblasts, however, synthesised CSPGs in vitro, while epidermal cells produced CSPGs in vivo [205]. In light of the distinct distribution of CSPGs in skin development [206], they deduced that the synthesis of

CSPGs in the skin BM may be associated with a differentiation state of cells [205]. CS was found to be produced by human dermal fibroblasts and human epidermal keratinocytes in this thesis. This inconsistency may also result from the different species and different antibodies identifying different CSPG epitopes compared to the literature.

The structure of perlecan, as well as its expression pattern, differs considerably among cell types, thereby altering the role it plays in biological functions, such as angiogenesis, chondrogenesis, establishment of cartilage, and the regulation of the wound healing process [70, 85, 207]. Hence, the structure of perlecan derived from human keratinocytes and fibroblasts was investigated. In this thesis, the expected product size was obtained by RT-PCR using specific primer sets from domains I and V of the

HSPG2 gene, indicating that domains I and V of perlecan were expressed by human keratinocytes and dermal fibroblasts similar to perlecan endogenously produced by other cells such as human coronary smooth muscle cells (SMCs) and endothelial cells

[72, 187, 189]. These data also demonstrated perlecan produced by human keratinocytes and dermal fibroblasts contained at least domains I and V. These data support previous work by Sher et al. [69] that confirmed perlecan mRNA expression in human primary and HaCaT keratinocytes, and human primary dermal fibroblasts, in both monolayer cultures and skin equivalents by RT-PCR using a specific primer set from domain I of the human perlecan cDNA [69].

The structure of perlecan derived from HaCaT and human primary dermal fibroblast cell conditioned media was further explored in this thesis. The perlecan produced by

139

HaCaT cells was a PG with a protein core of ~460 kDa decorated with ~140 kDa HS and ~ 80 kDa CS. The perlecan, however, produced by human dermal fibroblasts was a

PG with a protein core of ~ 460 kDa decorated with HS and CS, as well as smaller fragments. Fibroblast-derived perlecan either untreated or treated with H’ase III identified by using polyclonal antibody against perlecan, CCN-1, exhibited several smaller bands ranging from 55 -300 kDa. These perlecan fragments may be due to proteolytic degradation and/or alternative splicing as previously reported by Jung et al.

[50] and Lord et al. [72]. Heremans et al. [203] reported that endogenous perlecan derived from both human epidermal keratinocytes and human dermal fibroblasts was an

HSPG with a protein core of ~400 kDa. They also demonstrated that perlecan with smaller core proteins ranging from 80 -350 kD occurred in both keratinocyte and fibroblast concentrated culture media after heparitinase digestion. Additionally, smaller size HSPGs with core proteins ranging from 21 to 350 kDa have been also reported to be present in other BMs. For example, perlecan present in rat liver BM contained smaller core proteins ranging from 150-300 kDa [208]; human and bovine glomerular

BM contained a ~200 kDa smaller perlecan core protein [209]. The large HSPG core protein was calculated at 467 kDa by constructing a cDNA clone library [210, 211].

The structure of perlecans derived from HaCaT keratinocytes and human dermal fibroblasts, however, were different, which can be demonstrated from their distinct reactivity with different monoclonal antibodies. This phenomenon may be due to the different composition and spatial structure of HS/CS. It has been shown that perlecan derived from different cells can differ in structure and function [192, 193, 212], most commonly due to cell-type specific GAG decoration. Perlecan endogenously secreted by endothelial cells was exclusively decorated with HS chains [189]; perlecan endogenously expressed by human embryonic kidney cells and human fetal

140

chondrocytes was substituted with HS/CS/KS [50, 77, 85, 100]; endogenous perlecan produced by human mast cells was decorated with CS and HS [50]. For example, perlecan secreted by skin fibroblasts from the mutant mice (Hspg2 Δ3/Δ3, lacking the

GAG attachment sites in domain I of perlecan) were substituted both CS and HS chains

[213], while perlecan expressed by skin fibroblasts from the wild-type mice were substituted with HS chains, but not with CS chains [213, 214]. However, this was partial in agreement with reports by Shu et al. [215] that perlecan expressed by the liver tissue in wild-type mice was decorated with HS chains, but not with CS chains, while no HS or CS substitution was found in the perlecan in the Hspg2 Δ3/Δ3 mice.

5.2 The effect of chitosan-based materials on the expression and localisation of perlecan secreted by keratinocytes and human dermal primary fibroblasts

Although chitosan has been used in various forms including fibres, powder, granules, sponges, and composites in most studies, water soluble forms of chitosan are desirable to enhance the interaction between the wound sites and the healing agents [177].

Arginine functionalisation was able to make chitosan water soluble under physiological conditions (CH-Arg) [187]. Therefore, this thesis investigated the effect of CH-Arg with different level of sulphate substitution on human skin-derived perlecan expression and localisation for the first time.

Immunocytochemical analyses demonstrated that perlecan was intracellularly located and evenly distributed in HaCaT cells exposed to cell culture medium. This phenomenon was in agreement with reports by Dos Santos et al. [200] that perlecan in cultured keratinocytes was regularly distributed intracellularly. They also revealed that perlecan was co-localised with the ends of actin cables and β1-intergin subunits,

141

suggesting that an integrin containing a β1 subunit might be involved in keratinocyte adhesion to perlecan [200]. The perlecan expressed by human primary dermal fibroblasts was localised at the extracellular and pericellular spaces as micro-fibrillar structures. The perlecan secreted by human lung fibroblasts had a similar localisation with dermal fibroblast-derived perlecan detected in ECM as fibrillar structures [203,

216]. In addition to this, perlecan has also been observed to be localised differently based on different cell types, thereby contributing to different functions. For instance, perlecan was detected intracellularly in mast cells [127], while perlecan was secreted into the extracellular or pericellular space of SMCs [189] and human fetal chondroblast cells with micro-fibrillar structures [187]. Both keratinocytes and fibroblasts exposed to cell culture medium supplemented with CH-Arg, LS-CH-Arg, HS-CH-Arg and heparin for 4 hours displayed the similar perlecan expression pattern with cells exposed to cell culture medium only. Heparin, with a greater degree of sulphate groups than HS [217], was used as a higher sulphate control in this thesis. Presented data indicated that CH-

Arg regardless of the level of sulphation may induce, at least not inhibit, the expression of perlecan in the both cell types. Both cell types exposed to the materials for 24 hours increased perlecan expression compared to 4 hours exposure, indicating that perlecan expression was increased with time. Additionally, the punctate expression pattern for perlecan in HaCaT cells was increased with increasing degree of sulphate modification of CH-Arg, indicating that CH-Arg that more closely mimicked HS through sulphate modification increased perlecan expression in human keratinocytes. The intracellular expression of perlecan occurred in human dermal fibroblasts exposed to cell culture medium supplemented with either LS-CH-Arg or HS-CH-Arg, but not in cells exposed to cell culture medium only or supplemented with CH-Arg or heparin. This

142

phenomenon also indicated that sulphated CH-Arg that closely resembled HS may play a role in enhancing perlecan expression.

HaCaT cells exposed to cell culture medium supplemented with LS-CH-Arg and HS-

CH-Arg increased HSPG2 gene expression compared to cells exposed to cell culture medium only. In contrast to their effect on keratinocytes, HS-CH-Arg rather than LS-

CH-Arg increased HSPG2 gene expression in human dermal fibroblasts, while heparin down regulated its expression. These findings indicated that sulphated CH-Arg may play a role in regulating HSPG2 gene expression in skin cells. Despite of no literature reporting the effect of chitosan-based materials on perlecan expression in human skin cells, their effects on HSPG2 gene expression in other cell types have been explored.

For instance, chitosan enhanced perlecan expression at both the protein and gene levels in embryonic murine submandibular glands [146]. S-CH-Arg increased HSPG2 gene expression in human fetal chondroblasts, while CH-Arg and heparin reduced its expression after exposure for 7 days [187].

The mechanism of how LS/HS-CH-Arg affected perlecan expression is still unclear in this study. CH-Arg (57 kDa, DD 85%, arginine functionalisation 24%) with a sulphate content of 6% enhanced perlecan expression in human fetal chondroblasts compared to

CH-Arg without sulphate groups [187]. Heparin with a higher level of FGF2 binding activity than S-CH-Arg, however, reduced perlecan expression in human fetal chondroblasts compared to cells exposed to S-CH-Arg [187]. This phenomenon indicated the level of sulphate modification of CH-Arg was important for regulating perlecan expression.

Growth factors including FGF, TGFβ and VEGF play a key role in wound healing via the promotion of both angiogenesis and reepithelialisation [28]. Due to the short half-

143

life of growth factors in vitro, an appropriate growth factor delivery system has been a target issue [218]. It has been reported that HS chains decorating perlecan act as a growth factor reservoir [189, 219]. Previous studies have demonstrated that HS is exclusively responsible for FGF2 binding [212], while both HS and the protein core of perlecan bind to FGF 7 [137]. Perlecan derived from different cellular origins, however, revealed distinct FGF2 binding activity, and the bioactivity of HS substituting perlecan was dependent on the cellular origin [192]. Therefore, in order to investigate the growth factor binding activity of perlecan derived from human keratinocyte cells and dermal fibroblasts, perlecan was isolated from HaCaT and human dermal fibroblast cell conditioned media. In this thesis, HaCaT-derived perlecan was immunopurified, however, the yield was too low for further analysis. Perlecan has previously been immunopurified from many other human cell lines including endothelial cells [191,

212], colon carcinoma cells [191, 193], articular chondrocytes [190], human embryonic kidney epithelial cells [100] and human fetal lung fibroblasts [220]. It was reported that the average perlecan yields were ~ 300 μg / L human umbilical artery endothelial cell

(HUAEC) conditioned medium [212], while the average perlecan yields were 19 μg / L

HaCaT cell conditioned medium in this thesis. This difference suggested that the ability of cells to produce perlecan differed with cellular origin. The purified HaCaT-derived perlecan explored in this thesis may still contain collagen XVIII, agrin, syndecans and laminins in addition to perlecan identified by LC-MS2, indicating that an interaction between perlecan and these molecules may occur. This finding supported the notion that laminin, collagen IV and perlecan, as well as other ECM components such as fibrillin formed distinct and irregular polymers in BMs to contribute to their general architecture

[46]. In spite of several attempts, however, human dermal fibroblast-derived perlecan was not obtained. This phenomenon was possibly due to the low affinity between

144

human dermal fibroblast-derived perlecan and the monoclonal antibody, clone 5D7-

2E4, bound to the immunoaffinity column. Due to the limited yield of immunopurified

HaCaT-derived perlecan, growth factor binding assays were unable to be performed with this perlecan preparation. However, the affinity of HUAEC perlecan for FGF2 and

FGF7 was investigated, in this thesis, with Kd values of ~ 8.6 nM and ~3.6 nM, respectively. This was similar to the kinetics reported for FGF2 binding to HUAEC perlecan with Kd values of ~ 2 nM [192]. The literature also reported that perlecan isolated from an endothelial cell line (C11 STH) bound to FGF2 with Kd values of ~ 1 nM. It has also been reported that endothelial perlecan with different sources had a

125 similar affinity for human I- FGF2, with Kd values of 60-80 nM [212], while the

125 perlecan protein core had an affinity for I- FGF7 with Kd values of ~60 nM [137].

Additionally, it has been reported that heparin/HS enhanced the affinity and half-life of

FGF/FGFR complexes, indicating that heparin/HS, or mimetics thereof, might be used to deliver FGFs as a therapeutic method [115]. S-CH has been reported as a drug delivery vehicle [221] to be used in the early stage of wound healing in diabetic mice. In addition, CH-Arg, has been studied for its DNA or siRNA delivery [181-183]. Mizuno et al. [222] studied hydroxypropyl chitosan (deacetylation degree, DD 60%) scaffolds loaded with FGF-2 in diabetic mice for wound healing. Those authors demonstrated that these scaffolds had a significant effect on wound healing in comparison to the scaffolds alone. Recently, FGF2 encapsulated gelatin micro-particles loaded into chitosan scaffolds have been utilised in aged mice to treat pressure ulcers [223]. The FGF2- loaded chitosan scaffolds exhibited improved angiogenesis and accelerated the healing of pressure ulcers. These studies demonstrated that the presence of amino, hydroxyl functional groups, and other additional functional groups, as well as the positive charge in chitosan play a significant role in regulating growth factor release from these

145

matrices [218]. Rapraeger et al. [116] demonstrated that highly sulphated regions of heparin were more active than low sulphated regions of HS in FGF binding and mitogenesis. They also reported that the affinity of HS for FGFs was determined by the number and the position of specific sulphate groups. Together these literature indicate the importance of sulphated regions of HS in binding FGF2. It has been reported that

2 chitosan interacted with FGF2 with a low affinity (Kd ~6.12×10 nM) and enhanced its bioavailability [224]. Therefore, CH-Arg with different levels of sulphation may bind

FGFs as previously reported by Lord et al. [187] that S-CH-Arg was able to bind and potentiate the signalling of FGF2, but CH-Arg not.

5.3 The effect of chitosan-based materials on the proliferation and migration of human keratinocytes and human dermal primary fibroblasts

The proliferation of keratinocytes plays a key role in re-epithelialisation [225]. During the formation of granulation tissue in a dermal wound, fibroblasts are stimulated to migrate into the wound site and proliferate in order to reconstitute the various connective tissue components [226]. Thus, the study of keratinocyte and fibroblast cell proliferation is important for accelerating skin wound healing. In addition to CH-Arg- based materials and heparin, PG enriched HaCaT and human dermal fibroblast cell conditioned media were also investigated in this study, to explore whether the proliferation of each skin cell can be affected by the PGs produced by the other skin cell type.

The presented results demonstrated that CH-Arg-based materials were cytocompatible to both keratinocytes and fibroblasts after exposure for over 72 hours, but did not enhance their proliferation. These data supported some studies demonstrating that the

146

chitosan-based materials were cytocompatible to human or mouse skin cells. For example, chitosan (210 kD, DD 80%) conjugated with laminin was reported to be cytocompatible and was used to deliver keratinocytes to wounded skin [227-229].

Additionally, CH-Arg with 17 % arginine content [230] and chitosan (DD 95%)- agarose hydrogel [171, 231] did not affect human dermal fibroblast cell viability after exposure for 72 hours. In contrast, it has also been reported that chitosan-based materials enhanced human or rat skin cell proliferation. For example, carboxymethyl chitosan sulphate (DD 92%) with a sulphate content of 26 % enhanced the proliferation of rat skin fibroblasts [232]. Chitosan chloride (13 kD, DD 89%) had a stimulatory effect on human dermal fibroblast proliferation, whereas this mitogenic property was not universal for all human dermal fibroblast cultures tested [149]. This enhancement of proliferation was dependent on the presence of serum, indicating that chitosan chloride may interact with serum components such as growth factors [233] to act as a stimulatory factor [149, 234]. In addition to this, chitosan with low DD (< 25 %) was shown to induce human keratinocyte proliferation [235]. Some reports, however, demonstrated that chitosan-based materials inhibited human keratinocyte proliferation.

Chitosan with high DD (89%) inhibited proliferation of human primary and HaCaT keratinocytes [235]. Chitosans of 5 & 120 kDa exhibited a molecular-weight-dependent negative effect on HaCaT cell viability and proliferation [236]. These contradictions may be due to the chitosan-based materials with different DD, molecular weights and functionalised groups compared to the literature.

The mechanism of how CH-Arg incorporated with different sulphate groups affects the proliferation of human keratinocytes and dermal fibroblasts is still not clear in this thesis. Human primary keratinocytes failed to bind directly to chitosan (210 kD, DD

80%) [228], indicating that chitosan affected keratinocyte proliferation via an indirect

147

stimulation. Chitosan (40 kDa) with a sulphate content of 73% inhibited breast cancer cell proliferation, induced their apoptosis and blocked the binding of FGF 2 to HS, but chitosan without sulphate groups did not inhibit these activities [237]. In addition to this, some naturally sulphated polysaccharides, such as pentosane polysulphate [238], inhibited breast cancer cell proliferation via binding FGF2 and then blocking the binding of FGF2 to HS [239]. Furthermore, fibroblast proliferation was increased in the presence of highly sulphated celluloses without any additional growth factors, and the activity of FGF2 was also enhanced by cellulose with many sulphate groups [240].

Together these studies indicated the importance of sulphate groups in binding growth factors and the role of CH-Arg incorporated with sulphate groups that play in skin cell proliferation may differ based on different cells.

Additionally, the presented results showed that PGs derived from human dermal fibroblasts enhanced the proliferation of human keratinocytes and dermal fibroblasts.

This phenomenon indicated that human skin cell proliferation was enhanced by components produced by human dermal fibroblasts but not HaCaT cells. It was consistent with the notion that the keratinocyte proliferation was enhanced when co- cultured with fibroblasts [31, 241, 242]. Wang et al. [241] reported that contact with fibroblasts stimulated the proliferation of keratinocyte during wound healing, and that

HB-EGF played a central role in this process and could be enhanced by IL-1α and TGF-

β1.

However, the MTS assay does not directly measure cell number, but is routinely used in this way for biomaterials research. The assay measures the cellular metabolic activity due to NAD (P) H flux which can be altered with different treatments. The CH-Arg preparations used in this thesis have previously been shown not to interfere with the

148

assay [187]. In the future, these results may be confirmed by using qualitative microscopy observations or a DNA-binding dye assay such as CyQuant.

Keratinocyte migration is a crucial step in re-epithelialisation during skin wound healing [225]. In this thesis, keratinocyte migration was explored by measuring the area that remained devoid of cells. LS/HS-CH-Arg supported a significantly (p <0.05) higher level of keratinocyte migration than cell culture medium only (serum free) or supplemented with CH-Arg, while heparin did not support cell migration over the 72 hours analysis period. Although there was a trend towards improved cell migration in the case of cells treated with cell culture medium supplemented with CH-Arg in comparison to cells exposed to cell culture medium only, the statistical significance level of p < 0.05 was not achieved. Although very few studies reported the effect of chitosan on keratinocyte migration, they showed a consistent notion that chitosan without any functionalisation did not promote keratinocyte migration. Recently,

Blazevic et al. [243] investigated the effect of chitosans with different molecular weights (50-150 kD & 150-400 kD) and DD (75-90% & >90%) on HaCaT cell migration in a scratch assay. Those authors found that chitosans regardless of molecular weight or DD did not alter or even inhibited keratinocyte migration [243]. In contrast, chitosan loaded with melatonin enhanced the keratinocyte migration. These indicated that the CH-Arg materials that more closely mimic HS, through enhancing the incorporation of sulphate groups, may play a role in keratinocyte migration.

However, keratinocyte migration is a sophisticated cooperation between growth factors, cytokines, cell-matrix interactions, and cell-to-cell communications [244]. Keratinocyte migration has been reported to be enhanced in direct contact with fibroblasts [31, 241], possibly due to their production of HB-EGF, IL-1α and TGF-β1. Additionally,

149

mesenchymal stem cell-conditioned medium, which contained TGF-β1, IL-6, IL-8, collagen type I, fibronectin, and IGF binding protein-7, also accelerated HaCaT migration but not proliferation [31]. Keratinocyte migration is also stimulated by growth factors including EGF, IGF, and FGFs 2 and 7 [245, 246]. Therefore, LS/HS-

CH-Arg may stimulate keratinocyte migration through a direct or indirect effect on these growth factors and cytokines. In addition to the great potential of chitosan-based materials for delivering growth factors and other biomolecules in tissue regeneration described above, chitosan-based materials can directly stimulate cytokine or growth factor production. It has been reported that chitosans (DD 37% & 80%) stimulated the production of IL-8 by rat primary cultured dermal fibroblasts [234], while IL-1α and IL-

6 were not stimulated by mouse primary cultured dermal fibroblasts. 2-N and 6-O- sulphated chitosan (DD >90%) with sulphate content of 13-15% directly enhanced the bioactivity of BMP-2 in vitro and in vivo [247].

Migration assay used in this thesis in principle is 2D migration assay, while almost all cells move in 3D in physiological circumstances. Although current migration research is performed mainly using 2D wound healing assay, the movement of keratinocytes in 3D should be studied to link the cellular and molecular interactions in the physiological microenvironment [248].

5.4 A comparison of the expression of PGs, BM components and GAGs between human adult skin and an in vitro skin model

Animal models have been employed to represent human skin to investigate skin wound healing. Nevertheless, rodent skin remarkably differed from human skin with respect to a thinner epidermis and dermis, and looser skin attachment, as well as the skin healing mechanism by contraction rather than re-epithelialisaiton [32, 249-251]. Porcine skin

150

has also been used in skin wound healing, as a substitute for human skin analyses due to its similarity in gross, microscopic and ultrastructural features to human skin [250, 252,

253]. An immunohistochemical comparison of bama minipig and human skin showed that they have the same antigenic determinants of human laminin, fibronectin, collagens

I, III and IV, and keratin [254]. However, due to legal and ethical demands, as well as the cost, animal models have been limited and in vitro engineering of human skin has been a target issue [255].

Keratinocytes and fibroblasts are the predominant cells that reside in the human epidermis and dermis, respectively. Based on different demands, there are two general types of in vitro skin models: epidermis only containing human keratinocytes, and epidermis and dermis full thickness model containing both keratinocytes and fibroblasts

[255]. In this thesis, a full thickness skin model was established by populating human primary dermal fibroblasts in collagen type I gels, then seeding human primary epidermal keratinocytes on the top of collagen type I gels and growing for 7 days, and subsequently being exposed to the air-liquid interface for 20 days leading to the formation of a fully differentiated epidermis. The first model of the in vitro skin model was developed by Bell et al. [256] by populating rat dermal fibroblasts in a collagen lattice and seeding rat primary keratinocytes on the top of collagen lattice. Subsequent in vitro skin models have been developed based on their investigations [257-259]. The model has been enhanced through various components, including hair follicle [260], blood capillary [261], and other cell types resident in human skin including melanocytes

[262, 263]. In addition to this, the in vitro models of diseased or damaged human skin could also be established to investigate the mechanism of the skin diseases or the effect of treatment [255].

151

In this thesis, it was shown that the mimicked epidermis in the in vitro skin model had a similar thickness as the epidermis in human adult skin. In addition, the mimicked epidermis exhibited all epidermal layers present in human adult skin, with cell differentiation of this epithelium as assessed by H&E staining. These analyses indicated that the in vitro skin model represented human skin. This result is in agreement with a study by el-Ghalbzouri et al. [264] that reported a well-developed epidermis using a similar method to fabricate an in vitro skin model. However, the 3D skin model used in this thesis could be improved by constructing with a more wide variety of cell types including melanocytes and Langerhans cells as well as hair follicle cells derived from stem cells [260].

The in vitro skin model used in this thesis was examined for the expression of PGs and

BM components, as well as GAGs and compared to human adult skin. The skin BM components, laminin, collagen type IV, and perlecan were observed in the BM of human skin and the DEJ of the skin model, indicating that the BM was formed in the in vitro skin model to separate the mimicked epidermis from the underlying mimicked dermis. Perlecan is crucial for keratinocyte survival and epidermis formation by regulating the activity of perlecan-binding factors associated with epidermal morphogenesis [69, 201]. It has been reported that perlecan was present in the skin BM

[265], with a decreased expression in aging skin [200]. Perlecan was also present in the

DEJ in an in vitro skin model established by co-culturing human dermal fibroblasts and human primary keratinocytes in a collagen type I and CS matrix [266]. In addition, perlecan was found to be present in both the epidermis and dermis in both human skin and the in vitro skin model in this thesis, as also reported by Sher et al. [69]. Laminin

β1, with a widespread distribution in most human tissues [52], and laminin 5, mainly present in the skin mediating adhesion of basal keratinocytes [47, 65] were analysed to

152

represent laminin expression. Collagen IV is an essential glycoprotein in the skin BM to maintain its structural integrity [68]. It has been reported that collagen IV and VII, and laminin V which were produced by fibroblasts contributed to the skin BM formation

[267]. Collagen IV and laminin were found to be present in the DEJ in an in vitro skin model [266, 268]. Interestingly, collagen IV was not observed in either the epidermis or mimicked epidermis, indicating that the collagen IV present in the BM was of dermal fibroblast origin. Hill et al. [269] also reported that collagen IV was present only in DEJ and the mimicked dermis.

Syndecans-1 and -4 play a role in transmitting signals from the ECM to the intracellular cytoskeleton and bind numerous growth factors, in particular through their HS chains

[121]. In this thesis, syndecan-1 was found on the surface of the lower keratinocytes in human skin, while it was observed in the DEJ associated with the basal keratinocytes in the in vitro skin model. Syndecan-4 was observed on the cell surface associated with keratinocytes in the epidermis and fibroblasts in the dermis in human adult skin, while it was present in the DEJ associated with basal keratinocytes and also found weakly in the mimicked dermis in the in vitro skin model. These findings were in agreement with reports that syndecans-1 and 4 showed strong epidermal expression associated with keratinocyte cell membranes and were also expressed by fibroblasts in human skin [265,

270, 271]. It has been demonstrated that mice lacking syndecan-4 displayed delayed wound repair and impaired angiogenesis [17] which demonstrated that this proteoglycan was essential for skin repair. The expression of syndecan-1 and -4 in chronic ulcers differed in their staining in normal skin [127], reflecting their potential roles during inflammation and cell proliferation.

153

Serglycin is involved in the storage of chemokines, cytokines and proteases, which are crucial in the inflammatory phase of wound healing [126]. In this thesis, serglycin was only observed intracellularly in the epidermis associated with keratinocytes in human adult skin. However, serglycin was found throughout the mimicked epidermis in the in vitro skin, in particular intracellularly associated with keratinocytes. In addition, serglycin was also found in the mimicked dermis associated with fibroblasts. Serglycin is mainly found in hematopoietic and endothelial cells [126]. Connective tissue mast cells reside skin and produce serglycin decorated with GAGs including heparin, HS and

CS [271]. Little is known about the expression of serglycin in fibroblasts and keratinocytes, only Wegrowski et al. [272] reported the mRNA expression of serglycin in human keratinocytes.

HS was found in the BM, on the cell surface and extracellularly associated with keratinocytes in the epidermis, as well as in the dermis in human adult skin, while HS was mainly present in the DJE as well as in the mimicked dermis in the in vitro skin model. In addition, HS was also observed in the dermis of both human skin and the skin model. These findings were in agreement with reports that HS was observed in dermal cells and epidermal keratinocytes, as well as the BM in human skin. HS was shown to be widely distributed in connective tissues, and has roles in all phases of wound healing

[273]. Overall, the in vitro skin model used in this thesis is a valid model to represent human adult skin with respect to its similarity in general skin structure and expression of molecules including BM components, PGs and GAGs to human skin.

154

5.5 A comparison of the expression of proteoglycans, BM components and GAGs in the in vitro skin model following exposure to chitosan- based materials

Chitosan-based materials have been investigated their positive effects on chronic wound healing by using the diabetic rodent models [102, 176, 221, 274-276]. In this study, the effect of CH-Arg-based materials on the in vitro skin model with respect to the expression of PGs, GAGs, and BM components was explored for the first time. The

CH-Arg-based materials did not alter the morphology of basal keratinocytes compared to their morphology in the model exposed to cell culture medium only for 3 weeks.

However, the keratinocytes in the FSS and FSC in the skin model exposed to chitosan- based materials were further from the basal layer than those exposed to cell culture medium only. Human keratinocytes migrate upward from the basal layer to the SS and

SC and terminally differentiate until they die and are sloughed off [277]. These analyses performed in this thesis indicated that keratinocyte migration in the 3D skin model was enhanced by CH-Arg-based materials. These results were in agreement with the 2D scratch assay performed in this thesis.

The thickness of the epidermis is very important with respect to its barrier function and tensile strength [263]. In this thesis, CH-Arg, LS-CH-Arg, and HS-CH-Arg all significantly (p < 0.05) enhanced the thickness of the mimicked epidermis compared to the model exposed to cell culture medium only. There was no significant difference among these three materials with the exception of LS-CH-Arg which reduced the thickness of the epidermis compared to CH-Arg. Similarly, the skin model exposed to cell culture medium supplemented with LS-CH-Arg also reduced the thickness of the

155

basal keratinocyte layer. Together these analyses suggested that CH-Arg-based materials played a role in stimulating epidermal formation.

It is interesting to note that the skin model increased the epidermal thickness in response to CH-Arg treatment. These data might appear contradictory to the in vitro data that indicated that the CH-Arg-based materials did not alter the proliferation of HaCaT and human dermal primary fibroblasts. This difference may be due to the use of primary keratinocytes in the 3D skin model as compared to the HaCaT cell line in the in vitro assays. This difference also may be due to the assays being in different formats with the skin model being in 3D as compared to the 2D in vitro assays.

BM components are crucial in maintaining the structural and functional integrity of skin. In this thesis, the presented results showed that the skin model exposed to cell culture medium supplemented with CH-Arg, LS-CH-Arg and HS-CH-Arg enhanced the expression of perlecan, laminin β1 and collagen IV in the FSC compared to the model exposed to cell culture medium only. It has been reported that epidermal keratinocyte- derived perlecan was essential for human epidermal formation [69]. In addition, Dos

Santos et al. reported a decreased expression of perlecan in skin aging and the epidermal thickness was decreased by seeding aged or perlecan-deficient epidermal keratinocytes over the fibroblast populated collagen I gels, leading to the alteration of the BM in aged skin [200]. This may be due to perlecan controlling the bioavailability of perlecan- binding soluble factors (particularly FGF-7) involved in epidermal morphogenesis [69].

Thus, CH-Arg-based materials may stimulate epidermal formation by showing perlecan expression, and thereby stimulating the bioavailability of FGF-7. Together these analyses indicated that CH-Arg-based materials may play a role in promoting skin epidermal formation, and thereby they could be employed in regenerating the aged skin.

156

It has also been reported that perlecan deficient keratinocytes [69] and aged keratinocytes [200] did not affect the expression of laminin-5 and collagen IV in the

BM. Additionally, another study demonstrated that collagen IV and laminins 5 and 10 were present in the DEJ only in the presence of fibroblasts [278]. Similarly, a BM was formed with similar biochemical composition and ultrastructural appearance to the human skin BM when culturing the fetal bovine keratinocyte with human dermal fibroblast populated collagen I gels, while the BM was not formed in the absence of fibroblasts [279]. This phenomenon demonstrated BM components were of fibroblast origin. Therefore, the CH-Arg may stimulate the formation of the BM, by showing the expression of perlecan produced by keratinocytes, and laminin and collagen IV expressed by human dermal fibroblasts. This could be explained via CH-Arg-based materials stimulating the migration of keratinocytes, and thereby HS expressed by keratinocytes exposed to CH-Arg-based materials was present in the upper layer of the mimicked epidermis.

In this thesis, syndecan-1 was observed on the cell membrane of the keratinocytes with a stronger staining on the keratinocytes in the FSP when the skin model was exposed to cell culture medium supplemented with LS-CH-Arg and HS-CH-Arg. This phenomenon was in agreement with reports that syndecan-1 was expressed in the suprabasal, stratifying epidermal cells, whereas it was expressed at a low level in the basal layer

[126, 127]. It indicated that sulphated CH-Arg rendered the skin model as a good representation of human skin with respect to the expression of syndecan-1in keratinocytes.

The mechanism of how CH-Arg-based materials affect syndecan-1 expression is still not clear. It has been reported that the expression of syndecan-1 was upregulated in all

157

cell layers of the epidermis during wound healing [119]. In addition, syndecan-1 expression was enhanced by UV irradiation for 24 hours [109]. In contrast, syndecan-1 expression was decreased in aged (over 50 years old) keratinocytes [128]. This phenomenon indicated that different mechanisms may be involved in the syndecan-1 expression in different damaged tissues.

Sydecan-4 staining in the FSC was enhanced in the model exposed to cell culture medium supplemented with LS-CH-Arg and HS-CH-Arg. It has been reported that wounds strongly induced sydecan-4 expression in fibroblasts and endothelial cells [13].

It has been reported that UV irradiation induced syndecan-4 expression at protein level, but not in mRNA level, indicating the existence of posttranslational mechanism [265].

The results presented in this thesis showed that CH-Arg based materials did not alter the staining pattern of serglycin in the skin model. The expression of serglycin was enhanced in fibrous capsules by the implantation of chitosan, suggesting that serglycin was able to indicate where inflammatory cells have been activated in the tissue [127].

Since no inflammatory cells were added in the in vitro skin model used in this thesis, thus the results can be expected. Together these analyses indicated the potential role of

CH-Arg-based materials in inflammatory phase of skin wound healing.

In this thesis, HS was present in the BM and on the cell membrane in the mimicked epidermis associated with lower keratinocytes, as well as in the dermis associated with fibroblasts in the skin model exposed to cell culture medium supplemented with CH-

Arg-based materials. The staining pattern in the basal keratinocytes showed a gradient pattern that the keratinocytes closer to the BM produced more HS than the keratinocytes further from BM. This indicated that the ability of producing HS was decreased with keratinocyte differentiation, which was in agreement with reports by Dos Santos et al.

158

[200]. Interestingly, HS expression in keratinocytes in the FSB and FSP moved up further from the BM in the skin model exposed to cell culture medium supplemented with HS-CH-Arg, but not found in the model exposed to other additives. This could be explained via CH-Arg-based materials stimulating the migration of keratinocytes, and thereby HS expressed by keratinocytes exposed to CH-Arg-based materials was present in the upper layer of the mimicked epidermis. This indicated the potential role of the degree of sulphate groups on CH-Arg in aged skin.

Overall, CH-Arg-based materials, in particular LS-CH-Arg and HS-CH-Arg, were shown to enhance the expression of all components analysed, including perlecan, laminin β1, collagen type IV, syndecans-1 and -4, and HS, with the exception of serglycin. Thus, CH-Arg-based materials have the potential to promote skin wound healing, particularly in chronic wounds such as chronic ulcer and burn wounds where there is a total loss of tissue [227].

159

Chapter 6 : Conclusions and recommendations for future work

HSPGs, including perlecan, play a key role in healing chronic wounds by delivering growth factor to the wounded sites, interaction with cells and other ECM molecules.

The results presented in this thesis showed that perlecan produced by both human keratinocytes and human dermal fibroblasts was full-length perlecan decorated with HS and CS chains. Additionally, smaller fragments of perlecan were present in the human dermal fibroblast samples. Exposure to HS-CH-Arg increased the perlecan expression in human keratinocytes and dermal fibroblasts at the mRNA level, and also altered their perlecan expression pattern.

CH-Arg-based materials were shown to be cytocompatible to both keratinocytes and dermal fibroblasts. LS/HS-CH-Arg significantly (p <0.05) enhanced keratinocyte migration compared to cells exposed to cell culture medium only or supplemented with

CH-Arg or heparin. These data demonstrated that the sulphated CH-Arg materials that mimicked HS promoted keratinocyte migration.

A valid in vitro skin model was established to represent human adult skin with respect to the similar expression in BM components, PGs and GAGs to those observed in human adult skin. Additionally, a well-developed mimicked epidermis and the underlying BM were formed in the in vitro skin model. CH-Arg-based materials did not alter the morphology of basal keratinocytes, while they significantly (p <0.05) enhanced the thickness of epidermis compared to the in vitro skin model exposed to cell culture medium, indicating that CH-Arg-based materials were of benefit to the epidermal formation. In addition, CH-Arg-based materials, in particular LS-CH-Arg and HS-CH-

Arg, were shown to enhance the expression of all components analysed, including perlecan, laminin β1, collagen type IV, sydecans-1 and -4 and HS, but not serglycin. In

160

light of these, CH-Arg-based materials have the potential to promote skin wound healing, particularly in chronic wounds such as chronic ulcer and burn wounds where there is a total loss of tissue.

6.1 Recommendations for future work

Further investigation of the structure of HS that decorates perlecan produced by human keratinocytes and human dermal primary fibroblasts would provide further insight into the functional roles of the GAGs chains, particularly HS in growth factor binding activity. Furthermore, perlecan generated from human primary fibroblasts derived from different donors could be analysed to exclude possible differences in structure due to the source. The interaction of CH-Arg-based materials with growth factors, as well as the interaction of perlecan isolated from both keratinocyte and fibroblast cell conditioned media, should be investigated to better understand the underlying potential of CH-Arg with different degree of sulphation to mimic the naturally occurring HS. Previous studies have shown that HS chains substituted to endothelial perlecan can bind to FGF 2 and 7, while the perlecan protein core was involved in the FGF 7 binding. Therefore, a comparison of growth factors binding to endothelial, keratinocyte and fibroblast-derived perlecan could help comprehend the growth factor binding structure and further define the optimal level of sulphation of CH-Arg for growth factor delivery.

161

Reference

1. Frank Werdin, M.T., Hans-Eberhardt Schaller, and and H.-O. Rennekampff, Evidence- based management strategies for treatment of chronic wounds. ePlasty 2009. 9: p. 169-179. 2. Briquez, P.S., J.A. Hubbell, and M.M. Martino, Extracellular Matrix-Inspired Growth Factor Delivery Systems for Skin Wound Healing. Adv Wound Care (New Rochelle), 2015. 4(8): p. 479-489. 3. Gainza, G., et al., Advances in drug delivery systems (DDSs) to release growth factors for wound healing and skin regeneration. Nanomedicine, 2015. 11(6): p. 1551-73. 4. Ashwani Mishra, S.P., Anupam Kumar Pathak Formulation and evaluation of the wound healing chitosan gel of povidone iodine. International journal of Pharmaceutical & Biological Archives 2014. 5(2): p. 81-85. 5. Freedonia. world wound management products: Industry study with forecasts for 2016&2021. 2012. 6. Zheng, N.G.H., Modelling the direct health care costs of chronic wounds in Australia. Wound Pratice & Research: Journal of the Australian Wound Management Association, 2014. 22(1): p. 13. 7. Moura, L.I., et al., Recent advances on the development of wound dressings for diabetic foot ulcer treatment--a review. Acta Biomater, 2013. 9(7): p. 7093-114. 8. Jayakumar, R., et al., Biomaterials based on chitin and chitosan in wound dressing applications. Biotechnol Adv, 2011. 29(3): p. 322-37. 9. Dinh, T., S. Braunagel, and B.I. Rosenblum, Growth factors in wound healing: the present and the future? Clin Podiatr Med Surg, 2015. 32(1): p. 109-19. 10. Bruce A. Mast, G.S.S., interactions of ctokines, growth factors and proteases in acute and chronic wounds. wound repair and regeneration, 1996. 4(4): p. 411-420. 11. Bennett, S.P., et al., Growth factors in the treatment of diabetic foot ulcers. Br J Surg, 2003. 90(2): p. 133-46. 12. PAUL W. FINCH, J.S.R., TORU MiiU, DINA RON, STUART A. AARONSON, Human KGF is FGF-Related with properties of a paracrine effector of epithelial cell growth. Science, 1989. 245: p. 752-755. 13. Lee, K., E.A. Silva, and D.J. Mooney, Growth factor delivery-based tissue engineering: general approaches and a review of recent developments. J R Soc Interface, 2011. 8(55): p. 153-70. 14. Demidova-Rice, T.N., M.R. Hamblin, and I.M. Herman, Acute and Impaired Wound Healing: Pathophysiology and Current Methods for Drug Delivery, Part 2: Role of Growth Factors in Normal and Pathological Wound Healing: Therapeutic Potential and Methods of Delivery. Advances in skin & wound care, 2012. 25(8): p. 349-370. 15. Anitha, A., et al., Chitin and chitosan in selected biomedical applications. Progress in Polymer Science, 2014. 39(9): p. 1644-1667. 16. Azuma, K., et al., Chitin, chitosan, and its derivatives for wound healing: old and new materials. J Funct Biomater, 2015. 6(1): p. 104-42. 17. Debats, I.B., et al., Role of arginine in superficial wound healing in man. Nitric Oxide, 2009. 21(3-4): p. 175-83. 18. Zhang, X.J., D.L. Chinkes, and R.R. Wolfe, The anabolic effect of arginine on proteins in skin wound and muscle is independent of nitric oxide production. Clin Nutr, 2008. 27(4): p. 649-56. 19. Jayakumar, R., et al., Sulfated chitin and chitosan as novel biomaterials. Int J Biol Macromol, 2007. 40(3): p. 175-81.

162

20. Riccardo A.A. Mizzarelli, F.T., Monica E,anuelli, Sulfated N-(carboxymethyl) chitosans: Novel blood anticoagulants elsevier science publishers B.V. Amsterdam, 1984. 126: p. 225-231. 21. ankit jain, a.g., satish shilpi, ashish jain, pooja hurkat, sanjay k.jain a new horizon in modifications of chitosan syntheses and applications. Critical reviews in therapeutic drug carrier system 2013. 30(2): p. 91-181. 22. Raheeqa Razvi, S.s.a.R.S., skin and its ageing. THE NOTTH-EAST VETERINARIAN, 2002. XIV(4): p. 16-18. 23. Beldon, P., Basic science of wound healing. Surgery (Oxford), 2010. 28(9): p. 409-412. 24. Robert F. Diegelmann , a.M.C.E., Wound healing: an overview of acute fibrotic and delayed healing. Frontiers in Bioscience, 2004. 9: p. 283-289. 25. Enoch, S. and D.J. Leaper, Basic science of wound healing. Surgery (Oxford), 2008. 26(2): p. 31-37. 26. Young, A. and C.-E. McNaught, The physiology of wound healing. Surgery (Oxford), 2011. 29(10): p. 475-479. 27. K G Harding, H.L.M., G K Patel, healing chronic wounds. BMJ, 2002. 324: p. 160-163. 28. Adam J. Singer, M.D., and Richard A.F. Clark, M.D., cutaneous wound healing. the New England Journal of Medicine 1999. 341: p. 738-746. 29. Werner, S. and R. Grose, Regulation of wound healing by growth factors and cytokines. Physiological Reviews, 2003. 83(3): p. 835-870. 30. Berry, D.P., et al., Human Wound Contraction: Collagen Organization, Fibroblasts, and Myofibroblasts. Plastic and Reconstructive Surgery, 1998. 102(1): p. 124-131. 31. Walter, M.N., et al., Mesenchymal stem cell-conditioned medium accelerates skin wound healing: an in vitro study of fibroblast and keratinocyte scratch assays. Exp Cell Res, 2010. 316(7): p. 1271-81. 32. Fenner, J. and R.A.F. Clark, Anatomy, Physiology, Histology, and Immunohistochemistry of Human Skin. 2016: p. 1-17. 33. Solanas, G. and S.A. Benitah, Regenerating the skin: a task for the heterogeneous stem cell pool and surrounding niche. Nat Rev Mol Cell Biol, 2013. 14(11): p. 737-748. 34. J.EADY, j.A.M.a.r.A., Heparan sulphate proteoglycan and wound healing in skin journal of pathology 1997. 183: p. 251-252. 35. Schultz, G.S. and A. Wysocki, Interactions between extracellular matrix and growth factors in wound healing. Wound Repair Regen, 2009. 17(2): p. 153-62. 36. Frantz, C., K.M. Stewart, and V.M. Weaver, The extracellular matrix at a glance. Journal of Cell Science, 2010. 123(24): p. 4195-4200. 37. Walter, A.B.H.J.L.R.R., Essential Cell Biology 3rd ed. 2009: Garland Science, Taylor & Francis Group. 38. VINAY KUMAR, A.K.A., NELSON FAUSTO, Robbins and CotranPATHOLOGIC BASIS OF DISEASE. Seventh Edition ed. 2005. 39. Järveläinen, H., et al., Extracellular Matrix Molecules: Potential Targets in Pharmacotherapy. Pharmacological Reviews, 2009. 61(2): p. 198-223. 40. Jeffrey D Esko, K.k., and ULF lindahl, Proteoglycans and Sulfated Glycosaminoglycans essentials of glycobiology 2nd edition ed. C.R. Varki A, Esko JD, et al.,. 2009, NY: Cold Spring

Harbor Laboratory. 41. Schaefer, L. and R.M. Schaefer, Proteoglycans: from structural compounds to signaling molecules. Cell and Tissue Research, 2009. 339(1): p. 237-246. 42. Ou, K.-L. and H. Hosseinkhani, Development of 3D in Vitro Technology for Medical Applications. International Journal of Molecular Sciences, 2014. 15(10): p. 17938.

163

43. VALERIE S. LEBLEU, B.M., AND RAGHU KALLURI, Structure and function of basement membranes. experimental Biology and medicine 2007. 232: p. 1121-1129. 44. Iozzo, R.V., J.J. Zoeller, and A. Nystrom, Basement membrane proteoglycans: modulators Par Excellence of cancer growth and angiogenesis. Mol Cells, 2009. 27(5): p. 503-13. 45. Breitkreutz, D., N. Mirancea, and R. Nischt, Basement membranes in skin: unique matrix structures with diverse functions? Histochemistry and Cell Biology, 2009. 132(1): p. 1-10. 46. Breitkreutz, D., et al., Skin Basement Membrane: The Foundation of Epidermal Integrity-BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan. BioMed Research International, 2013. 2013: p. 16. 47. Toshio Nishiyama, K.K., Satoshi Amano , Akira Takeda , Makoto Tsunenaga , Eijiro Adachi, Robert e. Bergeson, The imporatnce of laminin 5 in the dermal- epidermal basement membrane. Journal of Dermatological Science, 2000. 25(1): p. s51-59. 48. V.iozzo, R., Perlecan: A Gem of a proteoglycan. Matrix Biol, 1994. 14: p. 203-208. 49. Knox, S.M. and J.M. Whitelock, Perlecan: how does one molecule do so many things? Cell Mol Life Sci, 2006. 63(21): p. 2435-45. 50. Jung, M., et al., Mast cells produce novel shorter forms of perlecan that contain functional endorepellin: a role in angiogenesis and wound healing. J Biol Chem, 2013. 288(5): p. 3289-304. 51. Poschl, E., et al., Collagen IV is essential for basement membrane stability but dispensable for initiation of its assembly during early development. Development, 2004. 131(7): p. 1619-28. 52. PATRICK TUNGGAL, N.S., MATS PAULSSON, AND MARK-CHRISTOPH OTT, Laminin: Structure and Genetic Regulation. microscopy research and technique 2000. 51: p. 214-227. 53. Marinkovich, M.P., et al., The dermal-epidermal junction of human skin contains a novel laminin variant. J Cell Biol, 1992. 119(3): p. 695-703. 54. Timpl, R., et al., Laminin--a glycoprotein from basement membranes. Journal of Biological Chemistry, 1979. 254(19): p. 9933-9937. 55. Ehrig, K., et al., Merosin, a tissue-specific basement membrane protein, is a laminin-like protein. Proceedings of the National Academy of Sciences of the United States of America, 1990. 87(9): p. 3264-3268. 56. Hunter, D.D., et al., A laminin-like adhesive protein concentrated in the synaptic cleft of the neuromuscular junction. Nature, 1989. 338(6212): p. 229-34. 57. Sanes, J.R., et al., S-laminin. Cold Spring Harb Symp Quant Biol, 1990. 55: p. 419-30. 58. Rousselle, P., et al., Kalinin: an epithelium-specific basement membrane adhesion molecule that is a component of anchoring filaments. J Cell Biol, 1991. 114(3): p. 567- 76. 59. Champliaud, M.F., et al., Human amnion contains a novel laminin variant, laminin 7, which like laminin 6, covalently associates with laminin 5 to promote stable epithelial- stromal attachment. J Cell Biol, 1996. 132(6): p. 1189-98. 60. Miner, J.H., et al., The laminin alpha chains: expression, developmental transitions, and chromosomal locations of alpha1-5, identification of heterotrimeric laminins 8-11, and cloning of a novel alpha3 isoform. J Cell Biol, 1997. 137(3): p. 685-701. 61. Manuel Koch, P.F.O., Anne Albus, William Jin, Dale D. Hunter, William J. Brunken, Robert E. Burgeson, and Marie-France Champliaud, Characterization and Expression of the Laminin γ3 Chain: A Novel, Non-Basement Membrane–associated, Laminin Chain. The Journal of Cell Biology 1999. 145(3): p. 605-617.

164

62. Richard T. Libby, C.R.L., Grant W. Balkema, William J. Brunken and Dale D. Hunter Disruption of Laminin β2 Chain Production Causes Alterations in Morphology and Function in the CNS. the journal of neuroscience, 1999. 19(21): p. 9399-9411. 63. Libby, R.T., et al., Laminin Expression in Adult and Developing Retinae: Evidence of Two Novel CNS Laminins. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2000. 20(17): p. 6517-6528. 64. Ekblom, P., P. Lonai, and J.F. Talts, Expression and biological role of laminin-1. Matrix Biology, 2003. 22(1): p. 35-47. 65. Schneider, H., C. Muhle, and F. Pacho, Biological function of laminin-5 and pathogenic impact of its deficiency. Eur J Cell Biol, 2007. 86(11-12): p. 701-17. 66. Chan, L.S., et al., Laminin-6 and laminin-5 are recognized by autoantibodies in a subset of cicatricial pemphigoid. J Invest Dermatol, 1997. 108(6): p. 848-53. 67. Breitkreutz, D., et al., Skin basement membrane: the foundation of epidermal integrity- -BM functions and diverse roles of bridging molecules nidogen and perlecan. Biomed Res Int, 2013. 2013: p. 179784. 68. Behrens, D.T., et al., The epidermal basement membrane is a composite of separate laminin- or collagen IV-containing networks connected by aggregated perlecan, but not by nidogens. J Biol Chem, 2012. 287(22): p. 18700-9. 69. Sher, I., et al., Targeting perlecan in human keratinocytes reveals novel roles for perlecan in epidermal formation. J Biol Chem, 2006. 281(8): p. 5178-87. 70. Gubbiotti, M.A., T. Neill, and R.V. Iozzo, A current view of perlecan in physiology and pathology: A mosaic of functions. Matrix Biol, 2016. 71. ISABELLE R. COHEN, S.G., ALAN D. MURDOCH, AND RENATO V. IOZZO, Structural characterization of the complete human perlecan gene and its promoter. Biochemistry 1993. 90: p. 10404-10408. 72. Lord, M.S., et al., Transcriptional complexity of the HSPG2 gene in the human mast cell line, HMC-1. Matrix Biol, 2014. 35: p. 123-31. 73. Renato, V.I., J.Z. Jason, and N. and Alexander, Basement Membrane Proteoglycans: Modulators Par Excellence of Cancer Growth and Angiogenesis. Mol. Cells, 2009. 27(5): p. 503-513. 74. Whitelock, J.M., J. Melrose, and R.V. Iozzo, Diverse Cell Signaling Events Modulated by Perlecan. Biochemistry, 2008. 47(43): p. 11174-11183. 75. Faham, S., R.J. Linhardt, and D.C. Rees, Diversity does make a difference: fibroblast growth factor-heparin interactions. Current Opinion in Structural Biology, 1998. 8(5): p. 578-586. 76. Ornitz, D.M., FGFs,heparan sulfate and FGFRs:complex interactions essential for development. bioessays, 2000. 22: p. 108-112. 77. Chuang, C.Y., et al., Heparan sulfate-dependent signaling of fibroblast growth factor 18 by chondrocyte-derived perlecan. Biochemistry, 2010. 49(26): p. 5524-32. 78. Hopf , M., et al., Recombinant domain IV of perlecan binds to nidogens, laminin– nidogen complex, fibronectin, fibulin-2 and heparin. European Journal of Biochemistry, 1999. 259(3): p. 917-926. 79. Hayashi, K., J.A. Madri, and P.D. Yurchenco, Endothelial cells interact with the core protein of basement membrane perlecan through beta 1 and beta 3 integrins: an adhesion modulated by glycosaminoglycan. The Journal of Cell Biology, 1992. 119(4): p. 945-959. 80. Roberts, J., M. Kahle, and G. Bix, Perlecan and the Blood-Brain Barrier: Beneficial Proteolysis? Frontiers in Pharmacology, 2012. 3(155). 81. Mongiat, M., et al., Endorepellin, a novel inhibitor of angiogenesis derived from the C terminus of perlecan. J Biol Chem, 2003. 278(6): p. 4238-49.

165

82. Murdoch, A.D., et al., Widespread expression of perlecan proteoglycan in basement membranes and extracellular matrices of human tissues as detected by a novel monoclonal antibody against domain III and by in situ hybridization. J Histochem Cytochem, 1994. 42(2): p. 239-49. 83. Yamane, Y., H. Yaoita, and J.R. Couchman, Basement membrane proteoglycans are of epithelial origin in rodent skin. J Invest Dermatol, 1996. 106(3): p. 531-7. 84. Costell, M., et al., Perlecan maintains the integrity of cartilage and some basement membranes. J Cell Biol, 1999. 147(5): p. 1109-22. 85. Arikawa-Hirasawa, E., et al., Perlecan is essential for cartilage and cephalic development. Nat Genet, 1999. 23(3): p. 354-8. 86. Zhongjun Zhou, J.W., Renhai Cao, Hiroyuki Morita, Raija Soininen, Kui Ming Chan, and Y.C. Baohua Liu, and Karl Tryggvason, Impaired angiogenesis delayed wound healing and retarded tumor growth in perlecan heparan sulfate-deficient mice. Cancer research 2004. 64: p. 4699-4702. 87. Jonh M. Whitelock, R.V.l., heparan sulfated: A complex polymer charged with biological activity American chemical society 2005. 105: p. 2745-2764. 88. Sarrazin, S., W.C. Lamanna, and J.D. Esko, Heparan sulfate proteoglycans. Cold Spring Harb Perspect Biol, 2011. 3(7). 89. Kirkpatrick, C.A., et al., The function of a Drosophila glypican does not depend entirely on heparan sulfate modification. Developmental Biology, 2006. 300(2): p. 570-582. 90. Whitelock, J.M., et al., The Degradation of Human Endothelial Cell-derived Perlecan and Release of Bound Basic Fibroblast Growth Factor by Stromelysin, Collagenase, Plasmin, and Heparanases. Journal of Biological Chemistry, 1996. 271(17): p. 10079- 10086. 91. Yayon, A., et al., Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell, 1991. 64(4): p. 841-848. 92. Christianson, H.C. and M. Belting, Heparan sulfate proteoglycan as a cell-surface endocytosis receptor. Matrix Biology, 2014. 35: p. 51-55. 93. Scott, P.G., et al., Chemical characterization and quantification of proteoglycans in human post-burn hypertrophic and mature scars. Clin Sci (Lond), 1996. 90(5): p. 417- 25. 94. Gallo, R., et al., Syndecans-1 and -4 are induced during wound repair of neonatal but not fetal skin. J Invest Dermatol, 1996. 107(5): p. 676-83. 95. Andriessen, M.P., et al., Basal membrane heparan sulphate proteoglycan expression during wound healing in human skin. J Pathol, 1997. 183(3): p. 264-71. 96. Latijnhouwers, M.A., et al., Tenascin expression during wound healing in human skin. J Pathol, 1996. 178(1): p. 30-5. 97. Marneros, A.G. and B.R. Olsen, Physiological role of collagen XVIII and endostatin. Faseb j, 2005. 19(7): p. 716-28. 98. Utriainen, A., et al., Structurally altered basement membranes and hydrocephalus in a type XVIII collagen deficient mouse line. Hum Mol Genet, 2004. 13(18): p. 2089-99. 99. Bernstein, E.F., et al., Chronic sun exposure alters both the content and distribution of dermal glycosaminoglycans. Br J Dermatol, 1996. 135(2): p. 255-62. 100. Knox, S., et al., Perlecan from human epithelial cells is a hybrid heparan/chondroitin/keratan sulfate proteoglycan. FEBS Lett, 2005. 579(22): p. 5019- 23. 101. Lord, M.S. and J.M. Whitelock, Recombinant production of proteoglycans and their bioactive domains. FEBS J, 2013. 280(10): p. 2490-510. 102. Salbach, J., et al., Regenerative potential of glycosaminoglycans for skin and bone. J Mol Med (Berl), 2012. 90(6): p. 625-35.

166

103. Toole, B.P., T.N. Wight, and M.I. Tammi, Hyaluronan-cell interactions in cancer and vascular disease. Journal of Biological Chemistry, 2002. 277(7): p. 4593-4596. 104. Turley, E.A., P.W. Noble, and L.Y. Bourguignon, Signaling properties of hyaluronan receptors. J Biol Chem, 2002. 277(7): p. 4589-92. 105. Balazs, E.A., T.C. Laurent, and R.W. Jeanloz, Nomenclature of hyaluronic acid. Biochemical Journal, 1986. 235(3): p. 903-903. 106. Hascall, V.C., et al., Intracellular hyaluronan: a new frontier for inflammation? Biochimica et Biophysica Acta (BBA) - General Subjects, 2004. 1673(1–2): p. 3-12. 107. J. Necas, L.B., P. Brauner, J. Kolar, Hyaluronic acid (hyaluronan): a review. Veterinarni Medicina 2008. 53(8): p. 397-411. 108. Ghatak, S., et al., Roles of Proteoglycans and Glycosaminoglycans in Wound Healing and Fibrosis. International Journal of Cell Biology, 2015. 2015: p. 20. 109. Casu, B., Chapter 1 - Structure and Active Domains of Heparin A2 - Garg, Hari G, in Chemistry and Biology of Heparin and Heparan Sulfate, R.J. Linhardt and C.A. Hales, Editors. 2005, Elsevier Science: Amsterdam. p. 1-28. 110. Rabenstein, D.L., Heparin and heparan sulfate: structure and function. Natural Product Reports, 2002. 19(3): p. 312-331. 111. Walenga, J.M., W.P. Jeske, and J. Fareed, Chapter 5 - Biochemical and Pharmacologic Rationale for Synthetic Heparin Polysaccharides A2 - Garg, Hari G, in Chemistry and Biology of Heparin and Heparan Sulfate, R.J. Linhardt and C.A. Hales, Editors. 2005, Elsevier Science: Amsterdam. p. 143-177. 112. Mizumoto, S., H. Kitagawa, and K. Sugahara, Chapter 7 - Biosynthesis of Heparin and Heparan Sulfate A2 - Garg, Hari G, in Chemistry and Biology of Heparin and Heparan Sulfate, R.J. Linhardt and C.A. Hales, Editors. 2005, Elsevier Science: Amsterdam. p. 203-243. 113. Farrugia, B.L., et al., Can we produce heparin/heparan sulfate biomimetics using "mother-nature" as the gold standard? Molecules, 2015. 20(3): p. 4254-76. 114. Born, J., et al., N-Acetylated domains in heparan sulfates revealed by a monoclonal antibody against the Escherichia coli K5 capsular polysaccharide. Distribution of the cognate epitope in normal human kidney and transplant kidney with chronic vascular rejection. J Biol Chem, 1996. 271(37): p. 22802-9. 115. Ashikari-Hada, S., et al., Characterization of growth factor-binding structures in heparin/heparan sulfate using an octasaccharide library. J Biol Chem, 2004. 279(13): p. 12346-54. 116. Rapraeger, A.C., In the clutches of proteoglycans: how does heparan sulfate regulate FGF binding? Chemistry & Biology, 1995. 2(10): p. 645-649. 117. Pye, D.A., et al., Heparan Sulfate Oligosaccharides Require 6-O-Sulfation for Promotion of Basic Fibroblast Growth Factor Mitogenic Activity. Journal of Biological Chemistry, 1998. 273(36): p. 22936-22942. 118. Bullock, S.L., et al., Renal agenesis in mice homozygous for a gene trap mutation in the gene encoding heparan sulfate 2-sulfotransferase. Genes & Development, 1998. 12(12): p. 1894-1906. 119. Faham, S., et al., Heparin structure and interactions with basic fibroblast growth factor. Science, 1996. 271(5252): p. 1116-20. 120. Kreuger, J., et al., Sequence analysis of heparan sulfate epitopes with graded affinities for fibroblast growth factors 1 and 2. J Biol Chem, 2001. 276(33): p. 30744-52. 121. Couchman, J.R., Syndecans: proteoglycan regulators of cell-surface microdomains? Nat Rev Mol Cell Biol, 2003. 4(12): p. 926-938. 122. De Luca, M., et al., A Conserved Role for Syndecan Family Members in the Regulation of Whole-Body Energy Metabolism. PLoS ONE, 2010. 5(6): p. e11286.

167

123. Elenius, K., et al., Induced expression of syndecan in healing wounds. J Cell Biol, 1991. 114(3): p. 585-95. 124. Stepp, M.A., et al., Defects in keratinocyte activation during wound healing in the syndecan-1-deficient mouse. Journal of Cell Science, 2002. 115(23): p. 4517-4531. 125. Echtermeyer, F., et al., Delayed wound repair and impaired angiogenesis in mice lacking syndecan-4. The Journal of Clinical Investigation, 2001. 107(2): p. R9-R14. 126. Kolset, S.O. and H. Tveit, Serglycin – Structure and biology. Cellular and Molecular Life Sciences, 2008. 65(7): p. 1073-1085. 127. Farrugia, B.L., et al., The localisation of inflammatory cells and expression of associated proteoglycans in response to implanted chitosan. Biomaterials, 2014. 35(5): p. 1462-77. 128. Drzeniek, Z., et al., Proteoglycan synthesis in haematopoietic cells: isolation and characterization of heparan sulphate proteoglycans expressed by the bone-marrow stromal cell line MS-5. Biochemical Journal, 1997. 327(Pt 2): p. 473-480. 129. Paul Martin, J.H.-W.a.J.M., Growth factors and cutaneous wound healing. Progress in Growth Facotr Research, 1992. 4: p. 25-44. 130. Joao De Masi, E.C., et al., The influence of growth factors on skin wound healing in rats. Braz J Otorhinolaryngol, 2016. 131. Mustoe, T., et al., Accelerated healing of incisional wounds in rats induced by transforming growth factor-beta. Science, 1987. 237(4820): p. 1333-1336. 132. Kiritsy, C.P. and S.E. Lynch, Role of Growth Factors in Cutaneous Wound Healing: A Review. Critical Reviews in Oral Biology & Medicine, 1993. 4(5): p. 729-760. 133. Eswarakumar, V.P., I. Lax, and J. Schlessinger, Cellular signaling by fibroblast growth factor receptors. Cytokine & Growth Factor Reviews, 2005. 16(2): p. 139-149. 134. itoh, D.M.O.a.N., Fibroblast growth factors. Genome biology 2001. 2(3): p. 3005.1- 3005.12. 135. Buntrock, P., K.D. Jentzsch, and G. Heder, Stimulation of wound healing, using brain extract with fibroblast growth factor (FGF) activity. Experimental pathology, 1982. 21(1): p. 46-53. 136. Kawai, K., et al., Accelerated wound healing through the incorporation of basic fibroblast growth factor-impregnated gelatin microspheres into artificial dermis using a pressure-induced decubitus ulcer model in genetically diabetic mice. Br J Plast Surg, 2005. 58(8): p. 1115-23. 137. Mongiat, M., et al., The protein core of the proteoglycan perlecan binds specifically to fibroblast growth factor-7. J Biol Chem, 2000. 275(10): p. 7095-100. 138. Carrington, L.M. and M. Boulton, Hepatocyte growth factor and keratinocyte growth factor regulation of epithelial and stromal corneal wound healing. J Cataract Refract Surg, 2005. 31(2): p. 412-23. 139. Koivisto, L., et al., HaCaT keratinocyte migration is dependent on epidermal growth factor receptor signaling and glycogen synthase kinase-3alpha. Exp Cell Res, 2006. 312(15): p. 2791-805. 140. El Agha, E., et al., Role of fibroblast growth factors in organ regeneration and repair. Seminars in Cell & Developmental Biology, 2016. 53: p. 76-84. 141. Peplow, P.V. and M.P. Chatterjee, A review of the influence of growth factors and cytokines in in vitro human keratinocyte migration. Cytokine, 2013. 62(1): p. 1-21. 142. Harding, K.G., H.L. Morris, and G.K. Patel, Science, medicine and the future: healing chronic wounds. Bmj, 2002. 324(7330): p. 160-3. 143. Robson, M.C., et al., The safety and effect of topically applied recombinant basic fibroblast growth factor on the healing of chronic pressure sores. Ann Surg, 1992. 216(4): p. 401-6; discussion 406-8.

168

144. Macri, L., D. Silverstein, and R.A.F. Clark, Growth factor binding to the pericellular matrix and its importance in tissue engineering. Advanced Drug Delivery Reviews, 2007. 59(13): p. 1366-1381. 145. Material Science of Chitin and Chitosan, ed. S.T. Tadashi Uragami. 2006, Japan: Kodansha Ltd. 284. 146. Yang, T.L. and Y.C. Hsiao, Chitosan facilitates structure formation of the salivary gland by regulating the basement membrane components. Biomaterials, 2015. 66: p. 29-40. 147. Hsiao, Y.C. and T.L. Yang, Data supporting chitosan facilitates structure formation of the salivary gland by regulating the basement membrane components. Data Brief, 2015. 4: p. 551-8. 148. Wiegand, C., D. Winter, and U.C. Hipler, Molecular-weight-dependent toxic effects of chitosans on the human keratinocyte cell line HaCaT. Skin Pharmacol Physiol, 2010. 23(3): p. 164-70. 149. Howling, G.I., et al., The effect of chitin and chitosan on the proliferation of human skin fibroblasts and keratinocytes in vitro. Biomaterials, 2001. 22(22): p. 2959-66. 150. Okamoto, Y., et al., Effects of chitin/chitosan and their oligomers/monomers on migrations of fibroblasts and vascular endothelium. Biomaterials, 2002. 23(9): p. 1975- 9. 151. Santos, T.C., et al., In vitro evaluation of the behaviour of human polymorphonuclear neutrophils in direct contact with chitosan-based membranes. J Biotechnol, 2007. 132(2): p. 218-26. 152. Ueno, H., et al., Chitosan accelerates the production of osteopontin from polymorphonuclear leukocytes. Biomaterials, 2001. 22(12): p. 1667-1673. 153. Ueno, H., et al., Accelerating effects of chitosan for healing at early phase of experimental open wound in dogs. Biomaterials, 1999. 20(15): p. 1407-14. 154. Boucard, N., et al., The use of physical hydrogels of chitosan for skin regeneration following third-degree burns. Biomaterials, 2007. 28(24): p. 3478-88. 155. Mi, F.L., et al., Fabrication and characterization of a sponge-like asymmetric chitosan membrane as a wound dressing. Biomaterials, 2001. 22(2): p. 165-73. 156. Jin, Y., et al., Effects of chitosan and heparin on early extension of burns. Burns, 2007. 33(8): p. 1027-31. 157. Pusateri, A.E., et al., Effect of a Chitosan-Based Hemostatic Dressing on Blood Loss and Survival in a Model of Severe Venous Hemorrhage and Hepatic Injury in Swine. Journal of Trauma and Acute Care Surgery, 2003. 54(1): p. 177-182. 158. Burkatovskaya, M., et al., Effect of chitosan acetate bandage on wound healing in infected and noninfected wounds in mice. Wound Repair Regen, 2008. 16(3): p. 425-31. 159. Biagini, G., et al., Wound management with N-carboxybutyl chitosan. Biomaterials, 1991. 12(3): p. 281-6. 160. Stone, C.A., et al., Healing at skin graft donor sites dressed with chitosan. Br J Plast Surg, 2000. 53(7): p. 601-6. 161. Kim, I.-Y., et al., Chitosan and its derivatives for tissue engineering applications. Biotechnology Advances, 2008. 26(1): p. 1-21. 162. Mourya, V.K., N.N. Inamdar, and A. Tiwari, Carboxymethyl chitosan and its applications. Advanced Materials Letters, 2010. 1(1): p. 11-33. 163. Li, X., et al., Biological activity of chitosan–sugar hybrids: specific interaction with lectin. Polymers for Advanced Technologies, 2000. 11(4): p. 176-179. 164. Felice, F., et al., Effect of different chitosan derivatives on in vitro scratch wound assay: a comparative study. Int J Biol Macromol, 2015. 76: p. 236-41. 165. Vikhoreva, G., et al., Preparation and anticoagulant activity of a low-molecular-weight sulfated chitosan. Carbohydrate Polymers, 2005. 62(4): p. 327-332.

169

166. Gopal, A., et al., Chitosan-based copper nanocomposite accelerates healing in excision wound model in rats. Eur J Pharmacol, 2014. 731: p. 8-19. 167. Zhang, X., D. Yang, and J. Nie, Chitosan/polyethylene glycol diacrylate films as potential wound dressing material. Int J Biol Macromol, 2008. 43(5): p. 456-62. 168. Cao, L., et al., Vascularization and bone regeneration in a critical sized defect using 2- N,6-O-sulfated chitosan nanoparticles incorporating BMP-2. Biomaterials, 2014. 35(2): p. 684-98. 169. Archana, D., J. Dutta, and P.K. Dutta, Evaluation of chitosan nano dressing for wound healing: characterization, in vitro and in vivo studies. Int J Biol Macromol, 2013. 57: p. 193-203. 170. Murakami, K., et al., Hydrogel blends of chitin/chitosan, fucoidan and alginate as healing-impaired wound dressings. Biomaterials, 2010. 31(1): p. 83-90. 171. Ribeiro, M.P., et al., Development of a new chitosan hydrogel for wound dressing. Wound Repair Regen, 2009. 17(6): p. 817-24. 172. Kweon, D.-K., S.-B. Song, and Y.-Y. Park, Preparation of water-soluble chitosan/heparin complex and its application as wound healing accelerator. Biomaterials, 2003. 24(9): p. 1595-1601. 173. Fujita, M., et al., Vascularization in vivo caused by the controlled release of fibroblast growth factor-2 from an injectable chitosan/non-anticoagulant heparin hydrogel. Biomaterials, 2004. 25(4): p. 699-706. 174. Deng, C.-M., et al., Biological properties of the chitosan-gelatin sponge wound dressing. Carbohydrate Polymers, 2007. 69(3): p. 583-589. 175. Huang, R., et al., Biomimetic LBL structured nanofibrous matrices assembled by chitosan/collagen for promoting wound healing. Biomaterials, 2015. 53: p. 58-75. 176. Wang, W., et al., Acceleration of diabetic wound healing with chitosan-crosslinked collagen sponge containing recombinant human acidic fibroblast growth factor in healing-impaired STZ diabetic rats. Life Sci, 2008. 82(3-4): p. 190-204. 177. Cho, Y.W., et al., Water-soluble chitin as a wound healing accelerator. Biomaterials, 1999. 20(22): p. 2139-45. 178. Aoyagi, S., H. Onishi, and Y. Machida, Novel chitosan wound dressing loaded with minocycline for the treatment of severe burn wounds. Int J Pharm, 2007. 330(1-2): p. 138-45. 179. Xu, H., et al., Chitosan–hyaluronic acid hybrid film as a novel wound dressing: in vitro and in vivo studies. Polymers for Advanced Technologies, 2007. 18(11): p. 869-875. 180. Dong, Y., et al., A novel CHS/ALG bi-layer composite membrane with sustained antimicrobial efficacy used as wound dressing. Chinese Chemical Letters, 2010. 21(8): p. 1011-1014. 181. Gao, Y., et al., Arginine-chitosan/DNA self-assemble nanoparticles for gene delivery: In vitro characteristics and transfection efficiency. International journal of pharmaceutics, 2008. 359(1): p. 241-246. 182. Lv, H.X., et al., A biomimetic chitosan derivates: preparation, characterization and transdermal enhancement studies of N-arginine chitosan. Molecules, 2011. 16(8): p. 6778-90. 183. Plianwong, S., et al., Chitosan combined with poly-L-arginine as efficient, safe, and serum-insensitive vehicle with RNase protection ability for siRNA delivery. Biomed Res Int, 2013. 2013: p. 574136. 184. Liu, L., et al., The impact of arginine-modified chitosan–DNA nanoparticles on the function of macrophages. Journal of Nanoparticle Research, 2009. 12(5): p. 1637-1644. 185. W.G.LIU, J.R.Z., Z.Q.CAO, F.Y.XU, K.D.YAO, A chitosan-arginine conjugate as a novel anticoagulation biomaterial. Materials in medicine 2004. 15: p. 1199-1203.

170

186. Zhang, X., et al., Preparation of arginine modified PEI-conjugated chitosan copolymer for DNA delivery. Carbohydr Polym, 2015. 122: p. 53-9. 187. Lord, M.S., et al., Synthesis and characterization of water soluble biomimetic chitosans for bone and cartilage tissue regeneration. J. Mater. Chem. B, 2014. 2(38): p. 6517- 6526. 188. Brooke L. Farrugia, J.M.W., Robert O’Grady, Bruce Caterson, and a.M.S. Lord, Mast cells produces a unique chondroitin sulfate epitope. Journal of Histochemistry and Cytochemistry, 2016. 64(2): p. 85-98. 189. Lord, M.S., et al., The role of vascular-derived perlecan in modulating cell adhesion, proliferation and growth factor signaling. Matrix Biol, 2014. 35: p. 112-22. 190. Melrose, J., et al., The structure, location, and function of perlecan, a prominent pericellular proteoglycan of fetal, postnatal, and mature hyaline cartilages. J Biol Chem, 2006. 281(48): p. 36905-14. 191. Knox, S., et al., Not all perlecans are created equal: Interactions with fibroblast growth factor 2 (FGF-2) and FGF receptors. Journal of Biological Chemistry, 2002. 192. Knox, S., et al., Not all perlecans are created equal: interactions with fibroblast growth factor (FGF) 2 and FGF receptors. J Biol Chem, 2002. 277(17): p. 14657-65. 193. Knox, S., J. Melrose, and J. Whitelock, Electrophoretic, biosensor, and bioactivity analyses of perlecans of different cellular origins. PROTEOMICS, 2001. 1(12): p. 1534- 1541. 194. Whitelock, J.M., J. Melrose, and R.V. Iozzo, Diverse cell signaling events modulated by perlecan. Biochemistry, 2008. 47(43): p. 11174-83. 195. Ghiselli, G., I. Eichstetter, and R.V. Iozzo, A role for the perlecan protein core in the activation of the keratinocyte growth factor receptor. Biochemical Journal, 2001. 359(Pt 1): p. 153-163. 196. Sarah Knox, C.M., Sally Stringer, James Melrose and John Whitelock, Not all Perlecans are Created Equal: Interactions with Fibroblast Growth Factor 2 and FGF receptors. Biochemistry and Molecular Biology, 2002. 197. Sen, C.K., et al., Human skin wounds: a major and snowballing threat to public health and the economy. Wound Repair Regen, 2009. 17(6): p. 763-71. 198. Horiguchi, Y., et al., Distribution, ultrastructural localization, and ontogeny of the core protein of a heparan sulfate proteoglycan in human skin and other basement membranes. Journal of Histochemistry & Cytochemistry, 1989. 37(7): p. 961-970. 199. Harmer, N.J., Chapter 14 - Role of Heparan Sulfate in Fibroblast Growth Factor Signaling A2 - Garg, Hari G, in Chemistry and Biology of Heparin and Heparan Sulfate, R.J. Linhardt and C.A. Hales, Editors. 2005, Elsevier Science: Amsterdam. p. 399-434. 200. Dos Santos, M., et al., Perlecan expression influences the keratin 15-positive cell population fate in the epidermis of aging skin. Aging (Albany NY), 2016. 8(4): p. 751-68. 201. Varkey, M., J. Ding, and E.E. Tredget, Superficial dermal fibroblasts enhance basement membrane and epidermal barrier formation in tissue-engineered skin: implications for treatment of skin basement membrane disorders. Tissue Eng Part A, 2014. 20(3-4): p. 540-52. 202. Whitelock, J.M. and R.V. Iozzo, Isolation and purification of proteoglycans, in Methods in Cell Biology. 2002, Academic Press. p. 53-67. 203. Heremans, A., et al., Matrix-associated heparan sulfate proteoglycan: core protein- specific monoclonal antibodies decorate the pericellular matrix of connective tissue cells and the stromal side of basement membranes. J Cell Biol, 1989. 109(6 Pt 1): p. 3199-211. 204. Alitalo, K., et al., Extracellular matrix proteins of human epidermal keratinocytes and feeder 3T3 cells. J Cell Biol, 1982. 94(3): p. 497-505.

171

205. Yamane, Y., H. Yaoita, and J.R. Couchman, Basement Membrane Proteoglycans Are of Epithelial Origin in Rodent Skin. Journal of Investigative Dermatology, 1996. 106(3): p. 531-537. 206. Couchman, J.R., J.L. King, and K.J. McCarthy, Distribution of Two Basement Membrane Proteoglycans Through Hair Follicle Development and the Hair Growth Cycle in the Rat. Journal of Investigative Dermatology, 1990. 94(1): p. 65-70. 207. Breitkreutz, D., N. Mirancea, and R. Nischt, Basement membranes in skin: unique matrix structures with diverse functions? Histochem Cell Biol, 2009. 132(1): p. 1-10. 208. Farquhar, C.J.S.a.M.a.G., Characterization of a novel heparan sulfate proteoglycan found in the extracellular matrix of liver sinusoids and basement membranes. The Journal of Cell Biology, 1991. 113(5): p. 1231-1241. 209. Mohan, P.S. and R.G. Spiro, Characterization of heparan sulfate proteoglycan from calf lens capsule and proteoglycans synthesized by cultured lens epithelial cells. Comparison with other basement membrane proteoglycans. Journal of Biological Chemistry, 1991. 266(13): p. 8567-8575. 210. Tryggvason, P.k.a.K., Human basement membrane heparan sulfate proteoglycan core protein: a 467-kD protein containing multiple domains resembling elements of the low density lipoprotein receptor, laminin, neural cell adhesion molecules, and epidermal growth factor. The Journal of Cell Biology, 1992. 116(2): p. 559-571. 211. Murdoch, A.D., et al., Primary structure of the human heparan sulfate proteoglycan from basement membrane (HSPG2/perlecan). A chimeric molecule with multiple domains homologous to the low density lipoprotein receptor, laminin, neural cell adhesion molecules, and epidermal growth factor. Journal of Biological Chemistry, 1992. 267(12): p. 8544-57. 212. Whitelock, J.M., et al., Human perlecan immunopurified from different endothelial cell sources has different adhesive properties for vascular cells. Matrix Biology, 1999. 18(2): p. 163-178. 213. Morita, H., et al., Heparan Sulfate of Perlecan Is Involved in Glomerular Filtration. Journal of the American Society of Nephrology, 2005. 16(6): p. 1703-1710. 214. Rossi, M., et al., Heparan sulfate chains of perlecan are indispensable in the lens capsule but not in the kidney. Embo j, 2003. 22(2): p. 236-45. 215. Shu, C.C., et al., Ablation of Perlecan Domain 1 Heparan Sulfate Reduces Progressive Cartilage Degradation, Synovitis, and Osteophyte Size in a Preclinical Model of Posttraumatic Osteoarthritis. Arthritis & Rheumatology, 2016. 68(4): p. 868-879. 216. Heremans, A., et al., Heparan sulfate proteoglycan from the extracellular matrix of human lung fibroblasts. Isolation, purification, and core protein characterization. Journal of Biological Chemistry, 1988. 263(10): p. 4731-4739. 217. Olczyk, P., L. Mencner, and K. Komosinska-Vassev, Diverse Roles of Heparan Sulfate and Heparin in Wound Repair. Biomed Res Int, 2015. 2015: p. 549417. 218. Gohil, S.V., et al., 7 - Chitosan-based scaffolds for growth factor delivery A2 - Jennings, J. Amber, in Chitosan Based Biomaterials Volume 2, J.D. Bumgardner, Editor. 2017, Woodhead Publishing. p. 175-207. 219. Kinsella, M.G., et al., Changes in Perlecan Expression During Vascular Injury. Role in the Inhibition of Smooth Muscle Cell Proliferation in the Late Lesion, 2003. 23(4): p. 608- 614. 220. Aviezer, D., et al., Perlecan, basal lamina proteoglycan, promotes basic fibroblast growth factor-receptor binding, mitogenesis, and angiogenesis. Cell, 1994. 79(6): p. 1005-1013. 221. Moura, L.I., et al., Chitosan-based dressings loaded with neurotensin--an efficient strategy to improve early diabetic wound healing. Acta Biomater, 2014. 10(2): p. 843- 57.

172

222. Mizuno, K., et al., Effect of chitosan film containing basic fibroblast growth factor on wound healing in genetically diabetic mice. Journal of Biomedical Materials Research Part A, 2003. 64A(1): p. 177-181. 223. Park, C.J., et al., Accelerated wound closure of pressure ulcers in aged mice by chitosan scaffolds with and without bFGF. Acta Biomaterialia, 2009. 5(6): p. 1926-1936. 224. Masuoka, K., et al., The interaction of chitosan with fibroblast growth factor-2 and its protection from inactivation. Biomaterials, 2005. 26(16): p. 3277-3284. 225. Woodley, D.T., et al., Re-epithelialization. Human keratinocyte locomotion. Dermatol Clin, 1993. 11(4): p. 641-6. 226. Schreier, T., E. Degen, and W. Baschong, Fibroblast migration and proliferation during in vitro wound healing. Research in Experimental Medicine, 1993. 193(1): p. 195-205. 227. Revi, D., et al., Chitosan scaffold co-cultured with keratinocyte and fibroblast heals full thickness skin wounds in rabbit. J Biomed Mater Res A, 2014. 102(9): p. 3273-81. 228. Ikemoto, S., et al., Laminin peptide-conjugated chitosan membrane: Application for keratinocyte delivery in wounded skin. J Biomed Mater Res A, 2006. 79(3): p. 716-22. 229. Patil, S.V. and L.S.Y. Nanduri, Interaction of chitin/chitosan with salivary and other epithelial cells—An overview. International Journal of Biological Macromolecules. 230. Antunes, B.P., et al., Chitosan/arginine–chitosan polymer blends for assembly of nanofibrous membranes for wound regeneration. Carbohydrate Polymers, 2015. 130: p. 104-112. 231. Miguel, S.P., et al., Thermoresponsive chitosan-agarose hydrogel for skin regeneration. Carbohydr Polym, 2014. 111: p. 366-73. 232. Tao, S., et al., Preparation of carboxymethyl chitosan sulfate for improved cell proliferation of skin fibroblasts. International Journal of Biological Macromolecules, 2013. 54: p. 160-165. 233. Inui, H., M. Tsujikubo, and S. Hirano, Low molecular weight chitosan stimulation of mitogenic response to platelet-derived growth factor in vascular smooth muscle cells. Biosci Biotechnol Biochem, 1995. 59(11): p. 2111-4. 234. Mori, T., et al., Effects of chitin and its derivatives on the proliferation and cytokine production of fibroblasts in vitro. Biomaterials, 1997. 18(13): p. 947-51. 235. Gomathysankar, S., A.S. Halim, and N.S. Yaacob, Proliferation of Keratinocytes Induced by Adipose-Derived Stem Cells on a Chitosan Scaffold and Its Role in Wound Healing, a Review. Archives of Plastic Surgery, 2014. 41(5): p. 452-457. 236. Wiegand, C., D. Winter, and U.C. Hipler, Molecular-Weight-Dependent Toxic Effects of Chitosans on the Human Keratinocyte Cell Line HaCaT. Skin Pharmacology and Physiology, 2010. 23(3): p. 164-170. 237. MING JIANG, H.O., PIN RUAN, HAN ZHAO, ZHENJUN PI, SILUO HUANG, PING YI and MICHEL CREPIN, Chitosan derivatives inhibti cell proliferation and induce apoptosiss in breast cancer cells. ANTICANCER RESEARCH, 2011. 31: p. 1321-1328. 238. Zaslau, S., et al., In vitro effects of pentosan polysulfate against malignant breast cells. Am J Surg, 2004. 188(5): p. 589-92. 239. Marshall, J.L., et al., Phase I trial of orally administered pentosan polysulfate in patients with advanced cancer. Clin Cancer Res, 1997. 3(12 Pt 1): p. 2347-54. 240. Peschel, D., et al., Synthesis of novel celluloses derivatives and investigation of their mitogenic activity in the presence and absence of FGF2. Acta Biomaterialia, 2010. 6(6): p. 2116-2125. 241. Wang, Z., et al., Enhanced keratinocyte proliferation and migration in co-culture with fibroblasts. PLoS One, 2012. 7(7): p. e40951. 242. Loo, A.E. and B. Halliwell, Effects of hydrogen peroxide in a keratinocyte-fibroblast co- culture model of wound healing. Biochem Biophys Res Commun, 2012. 423(2): p. 253- 8.

173

243. Blažević, F., et al., Nanoparticle-mediated interplay of chitosan and melatonin for improved wound epithelialisation. Carbohydrate Polymers, 2016. 146: p. 445-454. 244. Kirfel, G. and V. Herzog, Migration of epidermal keratinocytes: mechanisms, regulation, and biological significance. Protoplasma, 2004. 223(2-4): p. 67-78. 245. Tsuboi, R., et al., Stimulation of keratinocyte migration by growth factors. J Dermatol, 1992. 19(11): p. 652-3. 246. Paller, M.A.S.a.A.S., The Roles of Growth Factors in Keratinocyte Migration. advances in wound care 2014. 4(4): p. 213-224. 247. Zhou, H., et al., Enhanced bioactivity of bone morphogenetic protein-2 with low dose of 2-N, 6-O-sulfated chitosan in vitro and in vivo. Biomaterials, 2009. 30(9): p. 1715-24. 248. van Horssen, R. and T.L.M. ten Hagen, Crossing barriers: The new dimension of 2D cell migration assays. Journal of Cellular Physiology, 2011. 226(1): p. 288-290. 249. Mancuso, M., et al., Modulation of basal and squamous cell carcinoma by endogenous estrogen in mouse models of skin cancer. Carcinogenesis, 2009. 30(2): p. 340-7. 250. Summerfield, A., F. Meurens, and M.E. Ricklin, The immunology of the porcine skin and its value as a model for human skin. Molecular Immunology, 2015. 66(1): p. 14-21. 251. Pasparakis, M., I. Haase, and F.O. Nestle, Mechanisms regulating skin immunity and inflammation. Nat Rev Immunol, 2014. 14(5): p. 289-301. 252. Lademann, J., et al., Which Skin Model Is the Most Appropriate for the Investigation of Topically Applied Substances into the Hair Follicles? Skin Pharmacology and Physiology, 2010. 23(1): p. 47-52. 253. Meurens, F., et al., The pig: A model for human infectious diseases. Trends in Microbiology, 2012. 20(1): p. 50-57. 254. Liu, Y., et al., Light Microscopic, Electron Microscopic, and Immunohistochemical Comparison of Bama Minipig (Sus scrofa domestica) and Human Skin. Comparative Medicine, 2010. 60(2): p. 142-148. 255. Mathes, S.H., H. Ruffner, and U. Graf-Hausner, The use of skin models in drug development. Advanced Drug Delivery Reviews, 2014. 69–70: p. 81-102. 256. Bell, E., et al., Living tissue formed in vitro and accepted as skin-equivalent tissue of full thickness. Science, 1981. 211(4486): p. 1052-1054. 257. Marquardt, Y., et al., Characterization of a novel standardized human three- dimensional skin wound healing model using non-sequential fractional ultrapulsed CO2 laser treatments. Lasers Surg Med, 2015. 47(3): p. 257-65. 258. Okugawa, Y. and Y. Hirai, A novel three-dimensional cell culture method to analyze epidermal cell differentiation in vitro. Methods Mol Biol, 2014. 1195: p. 183-90. 259. Chen, Z., et al., A Novel Three-Dimensional Wound Healing Model. Journal of Developmental Biology, 2014. 2(4): p. 198-209. 260. Michel, M., et al., Characterization of a new tissue-engineered human skin equivalent with hair. In Vitro Cellular & Developmental Biology - Animal, 1999. 35(6): p. 318. 261. Bellas, E., et al., In vitro 3D Full-Thickness Skin-Equivalent Tissue Model Using Silk and Collagen Biomaterials. Macromolecular Bioscience, 2012. 12(12): p. 1627-1636. 262. Duval, C., et al., Human Skin Model Containing Melanocytes: Essential Role of Keratinocyte Growth Factor for Constitutive Pigmentation—Functional Response to α- Melanocyte Stimulating Hormone and Forskolin. Tissue Engineering Part C: Methods, 2012. 18(12): p. 947-957. 263. N. Mori, Y.M.a.S.T., Stretchable culture device of skin-equivalent with improved epidermis thickness, in 2016 IEEE 29th International Conference on Micro Electro Mechanical Systems (MEMS). 2016: shanghai. p. 256-262. 264. el-Ghalbzouri, A., et al., Effect of fibroblasts on epidermal regeneration. Br J Dermatol, 2002. 147(2): p. 230-43.

174

265. Jung, J.Y., et al., Acute UV irradiation increases heparan sulfate proteoglycan levels in human skin. J Korean Med Sci, 2012. 27(3): p. 300-6. 266. Varkey, M., J. Ding, and E.E. Tredget, Superficial Dermal Fibroblasts Enhance Basement Membrane and Epidermal Barrier Formation in Tissue-Engineered Skin: Implications for Treatment of Skin Basement Membrane Disorders. Tissue Engineering Part A, 2013. 20(3-4): p. 540-552. 267. Wong, T., J.A. McGrath, and H. Navsaria, The role of fibroblasts in tissue engineering and regeneration. Br J Dermatol, 2007. 156(6): p. 1149-55. 268. El Ghalbzouri, A., et al., Basement Membrane Reconstruction in Human Skin Equivalents Is Regulated by Fibroblasts and/or Exogenously Activated Keratinocytes. Journal of Investigative Dermatology, 2005. 124(1): p. 79-86. 269. Hill, D.S., et al., A Novel Fully Humanized 3D Skin Equivalent to Model Early Melanoma Invasion. Molecular Cancer Therapeutics, 2015. 14(11): p. 2665-2673. 270. Lundqvist, K. and A. Schmidtchen, Immunohistochemical studies on proteoglycan expression in normal skin and chronic ulcers. Br J Dermatol, 2001. 144(2): p. 254-9. 271. Smith, M.M. and J. Melrose, Proteoglycans in Normal and Healing Skin. Adv Wound Care (New Rochelle), 2015. 4(3): p. 152-173. 272. Wegrowski, F.X.M.S.B.Y., Proteoglycans in skin aging in Textbooke of aging skin 2010. 273. Melrose, J., Glycosaminoglycans in Wound Healing Bone and Tissue Regeneration Insights, 2016. 7: p. 29-50. 274. Ding, Z., et al., Immobilization of chitosan onto poly-L-lactic acid film surface by plasma graft polymerization to control the morphology of fibroblast and liver cells. Biomaterials, 2004. 25(6): p. 1059-1067. 275. Sung, J.H., et al., Gel characterisation and in vivo evaluation of minocycline-loaded wound dressing with enhanced wound healing using polyvinyl alcohol and chitosan. Int J Pharm, 2010. 392(1-2): p. 232-40. 276. Yingshan Zhou, et al., Electrospun water-soluble cbcs pva as wound dressing for skin regeneration. Biomacromolecules, 2008. 9: p. 349–354. 277. Turksen, K. and T.C. Troy, Epidermal cell lineage. Biochem Cell Biol, 1998. 76(6): p. 889- 98. 278. El Ghalbzouri, A., et al., Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes. J Invest Dermatol, 2005. 124(1): p. 79-86. 279. Marinkovich, M.P., et al., Cellular origin of the dermal-epidermal basement membrane. Developmental Dynamics, 1993. 197(4): p. 255-267.