Due-B, a New Human Dna Replication Protein, Is The

DUEB, A NEW HUMAN DNA REPLICATION PROTEIN,

IS THE FUNCTIONAL HOMOLOG OF S. CEREVISIAE SLD3

A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science

Jianhong Yao

B.S., Anhui College of Education

2009 Wright State University

JIANHONG YAO

2009

WRIGHT STATE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

March 25, 2009

I HEREBY RECOMMEND THAT THE thesis PREPARED UNDER MY SUPERVISION BY Jianhong Yao ENTITLED DUEB, a New Human DNA Replication Protein, is the Functional Homolog of S.cerevisiae Sld3 BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science

______Michael Leffak, Ph.D. Thesis Director

______Steven Berberich, Ph.D. Department Interim Chair

Committee on Final Examination

______Michael Leffak, Ph.D.

______Steven Berberich, Ph.D.

______John V. Paietta, Ph.D.

______Joseph F. Thomas, Ph.D. Dean, School of Graduate Studies

ABSTRACT

Yao, Jianhong M.S., Department of Biochemistry and Molecular Biology, Wright State University, 2009. DUEB, a New Human DNA Replication Protein, is the Functional Homolog of S. cerevisiae Sld3 1

1DNA unwinding elements (DUEs) are commonly found at DNA replication origins. The DUE binding protein (DUEB) is crucial for the initiation of DNA replication in eukaryotes. The unique 59 amino acid Cterminal part of DUEB shares nearly 50% similarity with yeast the Cterminus of Sld3. DUEB plays a key role in eukaryotic DNA replication because it is required for the loading of Cdc45, the MCM helicase activator, on chromatin. Here we show that DUEB, just like yeast Sld3, binds to

Cdc45 and TopBP1 through its Cterminus in Sf9 cells and in vitro . We also show that

DUEB, Cdc45 and TopBP1 form a heterotrimeric complex in vitro . The mass spectrometric data show that dominant negative Sf9 DUEB is not phosphorylated but functional HeLa DUEB is phosphorylated. All these data suggest that human DUEB is a functional homolog of yeast Sld3.

TABLE OF CONTENTS

INTRODUCTION ...... 1 Eukaryotic DNA replication ...... 1 The formation of prereplication complex (preRC) ...... 2 The formation of preinitiation complex (preIC) ...... 6 Initiation of DNA replication...... 7 The initiation proteins TopBP1, Sld3 and Cdc45...... 9 DUEB (DNA unwinding element binding protein)...... 16 MATERIALS AND METHODS...... 22 Cell culture...... 22 Generation of recombinent Cdc45 and TopBP1 baculoviruses by BactoBac baculovirus expression system...... 22 Western blot analysis...... 27 Coimmunoprecipitation...... 27 Recombinant Cdc45, TopBP1 and DUEB protein purification ...... 28 Coomassie staining ...... 29 Silver staining ...... 29 The binding assay of TopBP1, Cdc45 and DUEB trimeric complex formation...... 30 Mass spectrometry analysis sample preparation...... 32 RESULTS ...... 33 Generation of recombinant Cdc45 and TopBP1 bacmid and baculoviruses ...... 33 Optimization of the expression of recombinant Cdc45 and TopBP1 proteins in High Five insect cells...... 34 Fulllength DUEB interacts with Cdc45 and TopBP1 in High Five insect cell...... 37 DUEB interacts with Cdc45 and TopBP1 through its cterminal region in High Five insect cells...... 41 Purification of High Five insect cells expressing DUEB, Cdc45 and TopBP1 proteins... 43 DUEB directly interacts with Cdc45 and TopBP1 in vitro ...... 45 DUEB, Cdc45 and TopBP1 form one trimeric complex in vitro...... 45 Mass spectrometry to identify the covalent modification sites of Sf9 DUEB and HeLa DUEB ...... 48 DISCUSSION...... 51 REFERENCES ...... 55

LIST OF FIGURES

Figure 1. Branched pathway model of preinitiation complex assembly in yeast...... 3 Figure 2. Alignment of amino acid sequences of Cterminus of S. cerevisiae Sld3 and human Cterminus of DUEB...... 18 Figure 3. Conserved sequence motifs in the DUEB Cterminus region...... 19 Figure 4. Branched pathway model of preinitiation complex assembly in mammalian cell...... 21 Figure 5. Flow chart for assay of trimeric complex formation...... 31 Figure 6. Generation of recombinant baculovirus and gene expression with the Bacto Bac® Expression System...... 35 Figure 7. Generation of Cdc45 and TopBP1 recombinant bacmid...... 36 Figure 8. Optimization of the expression of recombinant Cdc45 and TopBP1 proteins in High Five insect cells...... 38 Figure 9. DUEB interacts with Cdc45 and TopBP1 in High Five insect cells...... 40 Figure 10. DUEB interacts with Cdc45 and TopBP1 through its Cterminal region in High Five insect cells...... 42 Figure 11. Purification of High Five insect cells expressed DUEB, Cdc45 and TopBP1 proteins...... 44 Figure 12. DUEB directly interacts with Cdc45 and TopBP1 in vitro...... 46 Figure 13. DUEB, Cdc45 and TopBP1 form one complex in vitro...... 47 Figure 14. Mass spectrometry analysis of Sf9 DUEB...... 50

INTRODUCTION

Complete and accurate DNA replication is a basic and essential process for all living organisms. In eukaryotic cells, the precision of this process depends on conserved mechanisms that restrict DNA replication to once and only once per cell cycle. The DNA replication process includes two steps. The first is called initiation, which recruits the replication machinery or “replisome” to replication origins. The second step is elongation, which subsequently duplicates DNA by action of the replisomes (Bell and Dutta, 2002;

Sclafani and Holzen, 2007). The main sites of regulation of DNA replication are the recruitment and initiation processses. The replisome is loaded or recruited to the origin by the protein complexes that recognize the initiator protein, origin recognition complex

(ORC), bound to origin chromatin. Then DNA helicases, minichromosome maintenance complexes (MCMs), unwind the DNA helix, and polymerases copy the DNA (Kelly,

2000; Nasheuer, 2003; Sclafani and Holzen, 2007).

Eukaryotic DNA replication

The first step in the initiation of DNA synthesis is identifying the sites or origins where DNA replication will begin. In lower organisms, DNA replication origins often share conserved functional elements. The bestcharacterized origins are those in budding yeast which were originally identified as socalled autonomously replicating sequences

(ARS) based on their ability to allow extrachromosomal plasmid replication (Marahrens and Stillman, 1992; Newlon, 1996). Although replication origins are easy to identify in

1 2 unicellular organisms, it is difficult to identify replication elements in metazoan species

(Aladjem and Fanning, 2004; Gilbert, 2004). In metazoan cells, the initiation of DNA replication can occur at multiple sites within initiation zones (DePamphillis, 1999;

Kobayashi et al., 1998; Dierov et al., 2004). The origins of replication direct the formation of many protein complexes leading to the assembly of bidirectional DNA replication forks. These events are started by formation of the prereplication complex

(preRC) at origins from late M to G1 phase when CDK (cyclindependent kinase) activity is low. Once the preRC is formed, this complex is activated by at least two kinases CDK (cyclin dependent kinase) and DDK (Dbf4dependent kinase) and additional replication factors to form the preinitiation complex (preIC). The preIC unwinds DNA and recruits multiple eukayotic DNA polymerases while unwinding DNA to start DNA replication at S phase (Kelly and Brown, 2000; Bell and Dutta, 2002;

Dierov et al., 2004; Sclafani and Holzen, 2007). The best understood initiation of eukaryotic DNA replication is in yeast (figure 1).

The formation of prereplication complex (preRC)

A set of conserved protein factors work to license genomic sites for replication

initiation in all eukaryotes. Importantly, this licensing is finely regulated to ensure the

genome duplicates itself only once during each cell division cycle in normal cells.

For replication to occur, the origin recognition complex (ORC) first recognizes

and binds to origins of replication (Diffley, 2001; Krude et al., 1997; Nasheuer et al.,

2002). ORC is a sixsubunit complex (Orc16) that acts as the primary eukaryotic

replication initiation factor. In budding yeast, ORC binds to the conserved ARS

Figure 1. Branched pathway model of preinitiation complex assembly in yeast. (Upper pathway) ORCdependent preRC assembly and Mcm10 loading. (Lower pathway) PreIC assembly.

4 consensus sequence (ACS), and it works as an AAA+ATPase (Bell and Stillman, 1992).

The best understood activity of ORC is its binding to DNA (Bell et al., 1992; Rao et al.,

1995). The discovery of ORC homologs in higher eukaryotic organisms has confirmed this complex to be a conserved component of the replication initiation machinery

(Carpenter et al., 1996; Saxena et al., 2004; Remus et al., 2005).

The next step is to load the DNA helicase onto the replication origin. This recruitment needs at least two proteins, Cdc6 (cell division cycle 6) and Cdt1 (Cdc6 and

Cdc10 dependent transcript 1) (Sclafani and Holzen, 2007). In late mitosis to early G1 phase, the interaction of ORC and replication origin DNA functions as a platform for other replication proteins to load (Pollok et al., 2003). The first protein that loads on the platform is Cdc6 (Coleman et al., 1996; Neuwald et al., 1999). Cdc6 was first identified in S. cerevisiae as an AAA+ ATPase and has been demonstrated to play a crucial role in the assembly of the preRC at a step after ORC and before Mcm27 proteins (Hartwell,

1973; Bell and Dutta, 2002). The binding of Cdc6 to ORC makes the ORCDNA complex more stable and specific for licensing chromatin for replication (Speck et al.,

2005 and 2007).

Cdt1 cooperates with Cdc6 to load the DNA helicase, Mcm27 (mini chromosome maintenance) complex, during G1 phase of the cell cycle. The Heilin group recently reported that human Cdt1 binds to Cdc7 and recruits Cdc45 to chromatin at S phase (Ballabeni et al., 2008). Cdt1 was initially identified in fission yeast as a cellcycle regulated gene (Hofmann et al., 1994), and is essential for both nuclear localization and loading of MCM on chromatin (Maiorano et al., 2000; Tanaka et al., 2000; Hofmann et al., 2002). Overexpression of Cdt1 leads to ectopic preRC formation and rereplication

5 of DNA (Ricke et al., 2004). The level of Cdt1 activity is controlled by binding of geminin to form an inactive complex (Lutzman et al., 2006) and degradated by proteosome in a replication dependent manner (Arias and Walter, 2006; 2007; Aparicio, et al., 2006). It is well demonstrated that regulation of the activity of Cdt1 is important for maintaining genomic integrity (Arias and Walter, 2006; 2007).

It is believed that the MCM complex is recruited to the DNA replication origin by

ORC after Cdc6 and Cdt1 bind to the ORCDNA structure, and functions as a DNA helicase. MCMs are composed of six subunits (Mcm27), which are conserved in eukaryotes (Forsburg, 2004; Lei 2005). Lutzmann et al. reported that Mcm9, a new member of Mcm27 family, binds to Cdt1 and is also required for the recruitment of the

Mcm27 helicase onto chromatin (Lutzman et al., 2008). All six members are AAA+

ATPases with similarity to prokaryotic DNA helicases. All are required for initiation and elongation during DNA replication. MCMs helicases unwind the DNA double strands during the chromosomal replication and move with the replication fork. (Sclafani and

Holzen, 2007; Blow et al., 2008). After the MCMs loading on the replication origin, the prereplication complex is formed in G1 phase, and the replication origin is licensed and waits for additional signal for origin firing.

Once the preRC forms, rereplication is prevented until the next G1 phase. Cells

limit replication initiation to once per cell cycle by several pathways. One example is the

CDKmediated prevention of rereplication. The increase of CDK activity in the G1/S

transition phase inactivates the loading of the preRC components, Cdc6, MCM and Orc2,

to prevent reinitiation (Nguyen et al., 2001). Cdc6 is phosphorylated and /or exported

from the nucleus during S phase to prevent reinitiation at replication origins

(Alexandrow et al., 2004). MCMs are released from chromatin after phosphorylation

(Ishimi et al., 2001), and phosphorylated Orc2 is inactivated in fission yeast (Vas et al.,

2001). The second pathway involves the regulation by geminin, the inhibitor of Cdt1.

Because constitutive expression of Cdt1 results in rereplication (Yanow et al., 2001;

Arias et al., 2006), the regulation of Cdt1 by geminin inhibits the Cdt1mediated loading of MCMs and thus prevents DNA rereplication. The PCNAdependent and Cul

Ddb1 Cdt2 dependent Cdt1 proteolysis destroy the Cdt1 and prevent rereplication in

interphase (Arias and Walter, 2006; 2007). Another mechanism to prevent rereplication

involves chromatin conformation. It has been suggested that the conformation of local

chromatin has an effect on both the activity and timing of origins (Bell and Dutta, 2002).

The formation of preinitiation complex (preIC)

The assembly of the preRC in late mitosis and early G1 phases is not sufficient for DNA synthesis. The preRC requires to be rearranged during S phase by recruiting at least two protein kinases, the cyclindependent kinase (CDK) and the Dbf4 or Drf1 dependent Cdc7 kinase (DDK) (Saxena and Dutta, 2004), and other additional replication proteins, MCM10, Cdc45, TopBP1, Sld2, Sld3 and GINS, to form the preinitiation complex (preIC) (Bell and Dutta, 2002;). The preIC forms only after the activation by

CDK and DDK at the G1/S transition (Nougarede et al., 2000; Walter, 2000).

MCM10 is characterized as a factor required for efficient initiation of DNA replication (Merchant et al., 1997). The Mcm10 protein associates with the preRC complex through Mcm27 before Cdc45 recruitment and replication origin unwinding

(Kawasaki et al., 2000; Ricke and Bielinsky, 2004). Mcm10 is also required for

7 continued replication fork progression at times when ORC and Cdc6 are dispensable from replication complex (Piatti et al., 1996; Kawasaki et al., 2000). The MCMs helicases are inactive until Cdc45 protein binds to the origin. Cdc45 is a crucial factor for the initiation of DNA replication (Aparicio.et al., 1999; Tercero et al., 2000). The binding of TopBP1 to the preRC is required for the recruitment of Cdc45 onto chromatin

(Hashimoto et al., 2003). Two other proteins in yeast, Sld2 and Sld3, are also required for loading Cdc45. The putative Sld2 homolog, RECQL4, has been identified in metazoans, but so far, no Sld3 homolog has been found in higher eukaryotes (Matsuno et al., 2006;

Sangrithi et al., 2005). All three proteins, Cdc45, TopBP1 and Sld3 will be introduced later, since they are highly related to my thesis. The large multiprotein complex that is formed at this step is the preIC (Zou et al., 1998). The preIC does not exist for very long, and replication begins as soon as the preIC is formed (Bell and Dutta, 2002).

Initiation of DNA replication

The CDK and DDK dependent recruitment of Cdc45 and GINS to the replication origin coincides with the conversion of the preRC to a preIC. Upon preIC formation, the activated MCMs helicases unwind the DNA at the replication origin

(Walter and Newport, 2002; Pacek and Walter, 2004; Dutta et al., 2008). The eukaryotic singlestranded binding protein, RPA, coats the unwound DNA and stabilizes the single strand as a template for DNA synthesis. Although the exact order of binding of RPA,

GINS, PCNA and polymerases is unclear, data from yeast and Xenopus egg extracts suggest that RPA is required for loading of DNA polymerases (Zou et al., 2000; Mimura et al., 2000; Walter et al., 2000).

The GINS complex is composed of Sld5, Psf1, Pls2 and Psf3 proteins, and is required for DNA replication by stimulating the processivity of DNA polymerase epsilon

(Kubota et al., 2003; Seki et al., 2006; Sclafani and Holzen, 2007). The stable binding of

Cdc45 and MCMs also requires the GINS complex during S phase (Labib et al., 2007).

The large complex consisting of Cdc45, Mcm27 and GINS activates the DNA helicase activity of MCM proteins, which triggers the unwinding of DNA at replication origins.

The subsequent recruitment of DNA polymerase alpha allows synthesis of a short RNA primer and initiation of DNA synthesis. The loading of PCNA (proliferating cell nuclear antigen) requires DNA polymerase alpha (Mimura et al., 2000). PCNA functions as a processivity factor for DNA polymerases delta and epsilon for DNA elongation.

Although the comprehensive model of the initiation of DNA replication is well established, additional factors have still been identified recently. Noc3 and Yph1 in yeast

(Zhang et al., 2002; Miklereit et al., 2001; Du et al., 2002), Mcm9 in higher eukaryotes

(Lutzmann et al., 2005; 2008); Mcm8 in human cells (Gozuacik et al., 2003; Johnson et al., 2003; Volkeing et al., 2005) and ABAP1 in plants (Masuda et al., 2008) are novel factors that have been proved to affect the initiation of DNA replication. The primary components required for the initiation of DNA replication are largely conserved throughout eukaryotic organisms. However, the existence of metazoanspecific replication factors, such as Mcm8 and geminin, may be required for maintaining the large genomes in higher eukaryotes.

The initiation proteins TopBP1, Sld3 and Cdc45

TopBP1 (topoisomerase IIβ binding protein 1)

Human TopBP1 was initially identified as a protein interacting with DNA

topoisomerase IIβ (Yamane et al., 1997). TopBP1 possesses eight BRCA1 carboxyl

terminal (BRCT) domains that are structurally and functionally conserved throughout

eukaryotic organisms and are commonly found in proteins involved in DNA repair or cell

cycle checkpoints (Callebaut and Mornon, 1997). The BRCT domain is a phospho protein binding domain involved in cell cycle control (Yu et al., 2003; Manke et al.,

2003). The homologues of TopBP1 are known as Dbp11 in Saccharomyces cerevisiae ,

Rad4/Cut5 in Schizosaccharomyces pombe , Mus101 in Drosophila melanogaster and

Xmus101/Cut5 in Xenopus laevis (Schmidt et al., 2007). Human TopBP1 plays a key role in various aspects of DNA metabolism, such as cell survival, DNA replication, resistance to DNA damage and checkpoint control, chromatin remodeling and transcriptional regulation (Valerie et al., 2005; Garcia et al., 2005; Uta et al., 2007).

DNA replication Yeast Rad4/Cut5 is known to be required for the initiation of

DNA replication. The Forsburg group showed that loading of preinitiation complex components, such as Cdc45 (XCdc45 indicates Xenopus Cdc45; SCdc45 indicates S. cerevisiae and S. pombe Cdc45, because their sequences are highly conserved.) and RPA, and the DNA polymerases are dependant on Rad4/Cut5 (Dolan et al., 2004). Both

Xenopus Xmus101/Cut5 and Drosophila Mus101 are also shown to have the essential roles in DNA replication (Hashimoto et al., 2003; Van Hatten et al., 2002). Xcut5 is also proved to be required for assembly of preICs and loading of DNA polymerases in

Xenopus egg extracts (Garcia et al., 2005). According to the model established in

Xenopus egg extracts, Xcut5 associates with chromatin in two distinct modes. In mode 1, before XCdc45 loading, Xcut5 binds weakly to the chromatin in a SCDKindependent manner, and is required for XCdc45 binding and conversion of the preRCs to preICs.

This binding is for the initiation of DNA replication. In mode 2, after preICs are formed and DNA replication is initiated, Xcut5 binds the chromatin tightly in a SCDK dependent manner. This binding is required for checkpoint function (Hashimoto et al.,

2003). In mammalian cells, although TopBP1 is mainly studied in the DNA damage response, many groups proved that it also plays a role in the initiation of DNA replication. TopBP1 mRNA and protein levels both increase during S phase, which suggest that TopBP1 is involved in DNA replication (Yamane et al., 2002; Liu et al.,

2004; Jeon et al., 2007). Makiniemi et al. reported that human TopBP1 interacts with polymerase epsilon just like its Xenopus and yeast homologous (Makiniemi et al., 2001).

TopBP1 is also proven to be required for recruitment of Cdc45 to origins of DNA

replication during G1/S transition (Schmidt et al., 2007; Jeon et al., 2007). The

interaction of Dpb11 and CDK phosphorylated Sld2 and Sld3 is the minimal requirement

for CDKdependent activation of DNA replication in budding yeast (Zegerman et al.,

2007; Tanaka et al., 2007). Together, these data suggest that the function of helicase

activation and replisome loading of TopBP1 orthologues in DNA replication is conserved

throughout evolution.

DNA damage detection and checkpoint activation As mentioned before,

TopBP1 is mainly studied in the DNA damage response. Saka et al. first reported that

fission yeast Rad4/Cut5 is required for prevention of mitotic entry in response to DNA

replication blocks (Saka et al., 1993), and the Araki group proved the similar function of

Dbp11 in budding yeast (Araki et al., 1995). After that, a more direct connection was

found between Dbp11 and Cut5 with the respective Rad9/Rad1/Hus1 (9–1–1) complexes,

which recruit Chk1 to stalled replication forks for activation by ATR (Wang et al., 2002;

Furuya et al., 2004). All these evidences demonstrate that TopBP1 is involved in DNA

damage detection and checkpoint activation. In mammalian cells, the level of TopBP1

reduced with siRNA results in a defect in phosphorylation of Chk1 (checkpoint 1) and

other ATR (ATM and Rad3related) substrates (Burrows et al., 2008) and cells exhibited

ultraviolet sensitivity as well as increased cell death by apoptosis (Van Hatten et al.,

2002; Yamane, et al., 2002). Yamane et al. demonstrated that TopBP1 and BRCA1 have

overlapping functions in the G2/M DNA damage checkpoint to activate the Chk1 kinase

(Yamane et al., 2006). The mechanisms that regulate TopBP1 access to ATRATRIP

(ATRinteracting protein) are complex but include posttranslational modifications and

recruitment of TopBP1 independently of ATRATRIP to sites of replication stress or

DNA damage (Delacroix et al., 2007; Lee et al., 2007; Yoo.et al., 2007). Furthermore,

TopBP1 physically interacts with ATR through an ATR activation domain (AAD) and

activates ATR through ATRIP and a PIKK regulatory domain (ATR PRD) (Kumagai et

al., 2006; Mordes et al., 2008).

Transcriptional regulation Several BRCTrepeat containing proteins have been proven to act in transcriptional coactiviation (Shimizu et al., 2001; Saka et al., 1997; Liu

et al., 2003; Yu et al., 2003). The Cterminal BRCT repeating domains of BRCA1 have been proven to be involved in the activation of transcription (Ouchi et al., 1998). Several

groups reported that TopBP1 interacts with transcription factors, such as human papillomavirus (HPV) E2 protein, the E2F1 transcription factor and the POZdomain

factor Miz1 and TopBP1 can function as a transcriptional regulator (Makiniemi et al.,

2001; Boner et al., 2002; Liu et al., 2004; Herold et al., 2002; Garcia et al., 2005).

Cdc45 (cell division cycle 45)

Cdc45 is a critical factor for the initiation and elongation of DNA replication (Zou

et al., 2000; Tercero et al., 2000). It is highly conserved among all eukaryotes and

knockout of this gene causes embryonic death in mice (Yoshida et al., 2001). Cdc45

moves with the replication fork and functions as a helicase cofactor of MCMs (Sclafani et

al., 2007). Cdc45 is required for loading of the replisome, DNA polymerases and RPA

(Aparicio et al., 1999).

Cdc45 was first identified in a screen for coldsensitive cell division cycle (cdc) mutants and when grown at the restrictive temperature cdc451 cells arrest late in G1 with a haploid DNA complement (Moir et al., 1982). Therefore, Cdc45 is required for the early step, the initiation of DNA replication, in DNA synthesis (Hennessy et al., 1991).

Hardy provided strong evidence that Cdc45 plays a role in initiation of DNA replication

(Hardy, 1997). In vitro, depletion of XCdc45 in Xenopus egg extracts inhibited the loading of DNA polymease alpha on chromatin (Mimura et al., 1998). Similarly, mutants of SCdc45 prevented the assembly of DNA polymerases at origins of replication, as reported in S. cerevisiae and human cells (Zou et al., 2000; Aparicio et al., 1999;

Kukimoto et al., 1999). Further studies in yeast and Xenopus showed that Cdc45 is also

required for the elongation step of DNA replication (Hopwood et al., 1996; Minura et al.,

2000; Tercero et al., 2000). Cdc45 origin association corresponds well with the time of

activation of the actual replication machinery, which suggests that Cdc45 may serve as a bridge between origins and the replisome (Aparicio et al., 1999; Masuda et al., 2003;

Pacek et al., 2006). The main function of Cdc45 is to activate MCM complex (Masuda et

al., 2003). In vitro, purified MCMsCdc45GINS complexes from budding yeast and

Drosophila have DNA helicase activity (Pacek et al., 2006; Gambus et al., 2006; Moyer

et al., 2006).

In vitro experiments performed in Xenopus egg extracts show that XCdc45 loads

after the preRC formation and before DNA unwinding and polymerase association

(Minura et al., 2000; Walter et al., 2000). The loading of Cdc45 on the replication origin

may occur in two modes. One is a weak CDKindependent association and another is a

stable CDKdependent association (Aparicio et al., 1997; Aparicio et al; 1999; Kelly and

Brown, 2000). Cdc45 has been found to not only associate with DNA polymerases

(Kukimoto et al., 1999; Spiga et al., 2004), but also interacts with ORC, RPA and the

MCMs (Zou et al., 2000; Kamimura et al., 2001; Uchiyama et al., 2001). The association

of Cdc45 with polymerases and MCM helicases suggests that it is a helicase cofactor and

helps to unwind the DNA template (Bell and Dutta, 2002; Sclafani and Holzen, 2007).

Once assembled at the origin, Cdc45, like MCM proteins, colocalizes with polymerases

at the replication fork (Aparicio et al., 1999; Zou et al., 2000). Cdc45 is synthesized in

late G1 phase, loads and functions in S phase, and is then ubiquitylated by the APC/C Cdh1

E3 ligase and degraded during the next early G1 phase (Pollok et al., 2007). Cdc45 is much less abundant than MCM proteins, which implies that Cdc45 may be a limiting factor for the initiation of DNA replication (Zou et al., 1998; Apricio et al., 1999; Minura et al., 2000; Edwards et al., 2002).

Sld3 (synthetically lethal with Dpb111)

Sld3 encodes a 77 kDa protein and its predicted amino acid sequence has

similarities with those of the budding yeast YOR165w ORF and Psl3 in S. pombe . Sld3,

together with Sld2 and Sld5, was first identified by screening synthetic lethal mutations

with Dpb111 (Araki et al., 1998). Sld3 is required for the initiation of DNA replication,

and Sld3 knockout yeast strains are inviable. Sld3 and Cdc45 binds early in S phase to

early firing origins and late in S phase to late firing origins. (Kamimura et al., 2001;

Nakajima et al., 2002).

Sld3 and Sld2 are essential CDK substrates and their phosphorylation is the

minimal requirement for CDKdependent activation of the initiation of DNA replication

in budding yeast (Masumoto et al; 2002; Tanaka et al., 2007). Sld3 has 12 CDK phosphorylation motifs. Three Ser/Thr sites, T600, T609 and S622, of Sld3 are important

for DNA replication (Zegerman et al., 2007; Tanaka et al., 2007). In budding yeast, phophorylation of Sld3 at T600 and S622 by CDK is crucial for binding to the Cterminal

BRCT3 region of the TopBP1 homolog Dpb11, which is crucial for polymerase loading

in cooperation with the Sld3SCdc45 complex (Araki et al., 1995; Masumoto et al., 2002;

Tanaka et al., 2007; Zegerman et al., 2007). DNA replication can occur in both Sld3 and

Sld2SCDK bypass mutants.

Sld3 has been shown to bind SCdc45 directly in both budding yeast and fission

yeast (Kamimura et al., 2001; Nakajima et al., 2002). Sld3, together with Dbp11,

MCM10 and GINS, are required for the stable loading of SCdc45 on chromatin at S phase (Mendez and Stillman, 2003). Using a protein crosslinking agent, Kamimura et al. observed that Sld3 and SCdc45 form a complex throughout the cell cycle (Kamimura et

15 al., 2001). A similar result has been demonstrated in fission yeast (Nakajima et al., 2002).

The complex of Sld3 and SCdc45 associates with origins by interaction of Cdc45 and

MCM protein, at least in S phase (Kamimura et al., 2001). Different to GINS that is required for stable association of SCdc45 with origin durings S phase, Sld3 is required for the initial recruitment of SCdc45 and GINS (Kamimura et al., 2001; Kanemaki et al.,

2006). Sld3 also binds to other replication proteins. In budding yeast, Sld3 binds to GINS in a twohybrid assay and it is required for the loading of GINS on origin (Takayama et al., 2003).

Metazoan homologs of Cdc45, Sld2 (RecQL4), and Dpb11 (TopBP1) have already been isolated, but so far no Sld3 homolog has been found, which are shown in the following table. The main reason is that Sld3, even within fungi, is very poorly conserved.

S. pombe Sld3 shares only 14% identity and 24% similarity with S. cerevisiae Sld3. The

Cterminal regions of both proteins share 10% identity and 60% similarity. But Cdc45 is well conserved from yeast to higher eukaryotes and the Nterminal BRCT repeats of

Dpb11 are conserved in its metazoan homolog TopBP1 (Makiniemi et al., 2001;

Yamamoto et al., 2000). All the evidences suggest that Sld3, like other important replication proteins, such as Cdc45 and TopBP1, should have its functional metazoan homolog in DNA replication.

The homology of yeast Cdc45, Dpb11 and Sld2 in metazoan.

Yeast Metazoan Cdc45 Cdc45 Dpb11 TopBP1 Sld2 RecQL4 Sld3 DUEB?

DUEB (DNA unwinding element binding protein)

In higher eukaryotic organism, there is no consensus sequence, like ACS in budding yeast, for ORC binding. A common characteristic of eukaryotic origins of

replication is the presence of an area of helical instability known as the DNA unwinding

element (DUE) (Liu et al., 2003; Natale at al., 1993). To identify proteins that might

regulate the origin of higher eukaryotes, our lab used a yeast onehybrid assay with the

DUE from the c-myc origin as bait. A 23.4 kDa protein was found and named the DNA

unwinding element binding protein (DUEB) (Casper et al., 2005).

Human DUEB has 209 amino acids including an Nterminus head (150 amino

acids) and Cterminus tail (59 amino acids). DUEB was isolated as a homodimer and it

is highly conserved throughout evolution. The crystal structure shows that the Nterminus

of DUEB, similar to its homolog in bacteria, archae and yeast, which do not have the C

terminus ~59 amino acids, has strong homology to tRNA proofreading enzymes

(Soutourina et al., 2000) and actually it was annotated as human histidyltRNA

synthetase (Meng et al., 2002; FerriFioni at al., 2001, 2006; Hussain et al., 2006).

However, no other tRNA editing enzymes have an Mg 2+ ion in the active site (Kemp et al., 2007). The Cterminal part is not visible in the structure and is dynamically disordered (Kemp et al., 2007). Suprisingly, the Cterminus of DUEB shares 3554% similarity to Sld3 proteins in yeast (Fig 2).

In vivo, DUEB localizes to the nucleus and binds to chromatin. Purified DUEB from HeLa cells possesses ATPase activity and this ATPase activity is requires the Thr

81 residue (Kemp et al., 2007). DUEB was proposed to be involved in regulating replication initiation because chromatin immunoprecipitation assay results showed DUE

B to be bound near the c-myc replicator DUE in a cell cycle dependent manner (Casper et al., 2005; Ghosh et al., 2006). DUEB also appeared to be preferentially phosphorylated in cells arrested in early S phase. DUEB can be phosphorylated by Casein kinase (CK2), and DUEB loading on chromatin can be inhibited by p27, the CDK inhibitor, in vitro

(Chowdhury, unpublished data). Immunodepletion of DUEB in Xenopus egg extracts inhibits DNA replication and DNA replication can be restored by adding back recombinant DUEB from HeLa cells (Casper et al., 2005). SiRNA of DUEB delayed entry into S phase and promoted cell death in HeLa cells (Casper et al., 2005). Dominant negative DUEB inhibits DNA replication before RPA loading and after preRC formation in Xenopus egg extracts (Casper et al., 2005). Immunodepleted DUEB in

Xenopus egg extracts eliminated Cdc45 loading and strongly reduced TopBP1 loading on chromatin (Chowdhury, unpublished data). All these results suggested that DUEB plays an essential role in replication initiation.

As mentioned before, the metazoan Sld3 has not been found. Although DUEB sequence has a low percent of homolog to Sld3, this could not exclude the possibility that

DUEB is the functional homolog of Sld3 because Sld3 is poorly conserved in evolution.

Human DUEB shares 4% identity and 14% similarity with S. cerevisiae Sld3. Cterminal of DUEB shares nearly 50% similarity with S. cerevisiae Sld3 (Figure 2). DUEB has a unique 59 amino acid C terminus presented only in vertebrates, which is critical for binding double strand DNA. The Cterminal T154 and S179 of DUEB are homologous to Sld3 essential phosphorylation sites (Fig 3). As we know, DUEB is a member of the

DtyrosyltRNA deacylases from yeast and bacteria (Kemp et al., 2007; FerriFioni et al.,

2001; Lim et al., 2003). It also functions as an ATPase. So DUEB may be a

600 622 >Sld3 A TPAVKKRTVTPNKKAQLQSIIE SPLNFKDDDTHEGRKNTSNITSTPTNKPPENSSKRRV 658 >DUE-B -----GTA TSDPKQLSKLEKQQQR----KEKTRAKGP SESSKERNTPRKE--DRSASSGA 199 . * *:: ::*:. : *:. :* .::*: .** :: :.*:. . 154 179 >Sld3 RRRLFAPEST 668 >DUE-B EGDVSSEREP 209 . : : ...

Figure 2. Alignment of amino acid sequences of Cterminus of S. cerevisiae Sld3 and human Cterminus of DUEB. Identical residues are marked with an asterisk and conservative changes with double or single dots. The homologous phosphorlation sites by CDK are marked with red.

Figure 3. Conserved sequence motifs in the DUEB Cterminus region. Potential phosphorylation sites indicated in bold red.

20 multifunctional esterase (Kemp et al., 2007). DUEB also has many similar functions and characteristies as Sld3. DUEB is a CK2 substrate and can be phosphorylated during the cell cycle. Our working model (Figure 4) proposes that DUEB is required for Cdc45 and TopBP1 loading and DNA replication origin firing (Chowdhury et al., unpublished data; Casper et al., 2005; Ghosh et al., 2006). So the work to be reported below is to test the hypothesis that DUEB can bind Cdc45 and TopBP1 through its Cterminus, in a manner that is homologous to Sld3 binding to Cdc45 and Dpb11 in yeast. (Kamimura et al., 2001; Araki et al., 1995; Tanaka et al., 2007; Zegerman et al., 2007).

Figure 4. Branched pathway model of preinitiation complex assembly in mammalian cell. (Upper pathway) ORCdependent preRC assembly and Mcm10 loading. (Lower pathway) Proposed reactions 16. Rx. 1: TopBP1 binds to Cdc45. Rx. 2: binding of DUEB to TopBP1/Cdc45 to form a ternary complex. Rx. 3: ORC. Cdc7 dependent loose association of the the TopBP1/DUEB/Cdc45 (TDC) complex at early firing origins. Rx. 4: CDK2dependent phosphorylation of DUEB leads to tight binding of DUEB at the origin and transfer of Cdc45 to the preRC, forming the preIC. Rx. 5: Activation of the MCM complex and GINS binding lead to origin unwinding, dissociation of phosphorylated DUEB and TopBP1. Rx. 6: PP2A removes inhibitory phosphates from a soluble factor (DUEB) to allow subsequent Cdc45 loading. Dephosphorylated DUEB binds TopBP1/Cdc45 released from early firing origins/forks for loading at late firing origins.

MATERIALS AND METHODS

Cell culture

The insect Sf9 and High Five cells were obtained from Invitrogen. The Sf9 cells were used for making recombinant baculoviruses and High Five cells used for expression and purification of recombinant Cdc45, TopBP1, DUEB and Cterminal truncated DUE

B proteins. Sf9 cells were maintained in either Grace’s insect medium supplemented with yeastolate, lactalbumin, pluronic acid, and 10% fetal bovine serum or in the serumfree medium Sf900 II SFM (Invitrogen). High Five cells were cultured in Grace’s insect medium supplemented with yeastolate, lactalbumin, pluronic acid, and 10% fetal bovine serum. Both media included the antibiotic gentamicin (10 g/ml), except during transfections. Cells were grown as adherent cultures.

Generation of recombinent Cdc45 and TopBP1 baculoviruses by BactoBac baculovirus expression system

Transformation

The Cdc45 and TopBP1 cDNA were cloned into Baculovirus vector pFastBAC TM .

The pFastBACCdc45 construct (from Dr. Kukimoto) has a Histag at the Nterminus of the protein and pFastBACHFXTopBP1 (from Dr. Dunphy) has His and HA tags at the

Nterminus and Flag tag at Cterminus. The two constructs were transformated into E.coli component cells DH10Bac, bought from Invitrogen, and selected for ampicillinresistant

22 23

transformants. The DH10Bac competent cells were thawed on ice. Approximately 1ng pFastBACCdc45 and pFastBACHFXTopBP1 plasmids (in 5 l) were added to the

competent cells and gently mixed into the cells by tapping the side of tube. The mixtures

were incubated on ice for 30 min. Then the mixtures were heat shocked by transferring to

42° C water bath for 45 sec and then the mixture was put on ice for 2 mins. 900 l S.O.C.

medium was added to the mixture then the mixture was put in a shaking incubator at 37°

C with medium agitation for 4 hr. Cells were serially diluted by using S.O.C. medium to

10 1,10 2 and 10 3. 100 l of each dilution was spread on the plates with 50 g/ml

ampicillin. The plates were incubated for 24 hr48 hr at 37° C.

Isolation of recombinant bacmid DNA

Eight white clones were picked and streaked to fresh plates to verify the phenotype. After incubating overnight at 37° C, a single colony, confirmed as having

white phenotype on plates containing Bluogal and IPTG, was set up in liquid culture for

isolation of Cdc45 and TopBP1 recombinant bacmid DNA. A single, isolated bacterial

colony was inoculated into 2 ml LB medium supplemented with 50 g/ml kanamycin, 7

g/ml gentamicin, and 10 g/ml tetracycline. The culture was grown at 37° C overnight

with shaking at 250 to 300 rpm. 1.5 ml of the culture was transferred to a 1.5 ml micro

centrifuge tube and the recombinant bacmid DNA was isolated by using Plasmid Midi

Kit (Omega). The bacmid DNA was analyzed by agarose gel electrophoresis to confirm

the presence of high molecular weight DNA.

Analyzing recombinant bacmid DNA by polymerase chain reaction (PCR)

The Cdc45 and TopBP1 bacmid DNA were verified by PCR analysis. The M13

Forward and M13 Reverse primers were used for identifying Cdc45 bacmid DNA and the

TopBP1 upper and TopBP1 lower primers for TopBP1 bacmid DNA. The primers

sequences were the following:

M13 Forward: 5 , GTTTTCCCAGTCACGAC 3 ,

M13 Reverse: 5 , CAGGAAACAGCTAGAC 3 ,

TOPBP1 upper: 5 , AAGCCCATTCTTCTTCCTTCTTG 3 ,

TOPBP1 lower: 5 , AGGGAGTGCTCTGTGTCCTGTT 3 ,

The reactions contained in each sample (50 l):

10x PCR buffer: 5 l

MgCl 2: 50 M

dNTP: 200 M

P1/P2: 25 pmol each/50 l

Taq DNA polymerase: 2.5 units/50 l (Qiagen)

DNA template: 0.1 g

The PCR Cycle was performed as below:

95° C: 5 min (1x)

95° C: 1 min (34x)

55° C: 1 min (34x)

72° C: 2 min (34x)

72° C: 7 min (1x)

PCR products were subjected to 1% agarose gel and stained with ethidium bromide to

visualize the DNA.

Restriction enzyme digestion

The PCR products of Cdc45 bacmid DNA were digested with the restriction enzyme Pst I (Biolab). The restriction enzyme Bam HI (NEB) was used to digest the PCR products of TopBP1 bacmid DNA. Each 20 l restriction reaction contained 1 g PCR product and 10 units restriction enzyme (RE). The PCR product and RE mixture was

incubated in 37° C for at least 2 hr and then subjected to 1% agarose gel.

Transfection of Sf9 cells with recombinant bacmid DNA

9x10 5 cells in 2 ml of Sf900 II SFM containing 50 units/ml penicillin, 50 g/ml

streptomycin were seeded in each well of a 6well plate. Cells were allowed to attach at

27° C for at least 1 hr. The following solutions were prepared. Solution A : For each

transfection, 5 l of miniprep Cdc45 or TopBP1 bacmid DNA was diluted into 100 l

Sf900 II SFM without antibiotics. Solution B : For each transfection, 6 l CellFectin

Reagent (Invitrogen) was diluted into 100 l Sf900 II SFM without antibiotics and

mixed thoroughly by inverting the tube 510 times before removing the sample for

transfection. The two solutions were combined and mixed gently and incubated for 15 to

45 min at room temperature. Cells were washed once with 2 ml of Sf900 II SFM without

antibiotics. For each transfection, 0.8 ml of Sf900 II SFM was added to each tube

containing the lipidDNA complexes. The diluted lipidDNA complexes were mixed

gently and put onto cells. Cells were incubated for 5 hr in a 27° C incubator. The

transfection mixtures were removed and 2 ml of Sf900 II SFM containing antibiotics

was added. Cells were incubated in a 27 °C incubator for 72 hr. The virus from cell

culture medium at 72 hr posttransfection was harvested. The Cdc45 and TopBP1 baculoviruses were stored at 4° C, protected from light. For long term storage, fetal bovine serum (FBS) was added to a final concentration of 2% and stored at –70° C. For

amplifying viral stocks, High Five cells were infected with Cdc45 and TopBP1 P1 baculoviruses at a Multiplicity of Infection (MOI) of 0.01 to 0.1. The following formula

was used:

Innoculum required (ml): desired MOI (pfu/cells) x (total number of cells)

Titer of viral innoculum (pfu/ml)

The virus was harvested at 48 hr postinfection. Approximately 100fold amplification of the high titer Cdc45 and TopBP1 P2 baculoviruses were obtained. Using the same method, the highest titer of Cdc45 and TopBP1 P3 baculoviruses were obtained.

Baculovirus infection

High Five insect cells were infected individually or coinfected with P3 baculoviruses expressing either Cdc45, TopBP1, DUEB or CT DUEB. The

Multiplicity of Infection (MOI) of each baculoviruses infection was 5 or 10. After 48 hr,

the infected cells were harvested and used for Western blot analysis, co

immunoprecipitation or purification.

Western blot analysis

High Five cells infected with all the baculoviruses described above (Cdc45,

TopBP1, DUEB and CT DUEB) individually or together were harvested. Cells were lysed in NP40 containing lysis buffer (1% NP40, 150 mM NaCl, 300 mM Tris and complete protease inhibitor cocktail (Sigma) and whole cell extracts were resolved on a

10% acrylamide SDSPAGE gel for 1 hour at 120 volts and 2 hours at 200 volts. Proteins were then transferred to ImmobilonP membranes (Millipore) 1 hour at a constant current of 700 mA, then probed with DUEB, Cdc45 and TopBP1 antibodies which were used at dilutions of 1:2000 in 5% nonfat dry milk in Tris buffered saline with Tween 20 (TBST).

The horseradish peroxidaseconjugated secondary antibodies were used at dilutions of

1:10,000 in 5% nonfat dry milk in TBST as well. DUEB antibody was raised in rabbits against 6xHistagged recombinant human DUEB expressed in bacteria, which has been described previously (Casper et al., 2005). Cdc45 antibody was purchased form Santa

Cruz Biotechnology (sc20685). TopBP1 antibody was generously provided by Dr.

Karnitz (Mayo clinic).

Coimmunoprecipitation

High Five cells cultured in 150 x 25 mm plates were coinfected with two of

Cdc45, TopBP1, DUEB and CT DUEB baculoviruses, then harvested and lysed in 1 ml of Tritoncontaining lysis buffer (0.5% Triton X100, 20 mM HEPES (pH7.4), 150 mM NaCl, 12.5 mM βglycerophosphate, 1.5 mM MgCl 2, 10 mM NaF, 2 mM dithiothreitol, 1 mM sodiumorthovanadate, 2 mM EGTA, 1 mM phenylmethylsulfonyl fluoride and complete protease inhibitor cocktail (Sigma)). Cell extracts were incubated

overnight with 1 g of Cdc45, TopBP1 or DUEB antibody or preimmune serum

(negative control) and 20 l of protein ASepharose beads (prewashed and resuspended

in phosphate buffered saline at a 1:1 (v : v) ratio). After incubation, the beads were

washed three or four times with lysis buffer and resuspended in 20 l of lysis buffer. For

immunoblotting, the immunoprecipitates were separated by 10% SDSPAGE, transferred

to ImmobilonP membranes (Millipore), and analyzed by immunoblotting as described

above.

Recombinant Cdc45, TopBP1 and DUEB protein purification

High Five cells were washed once with cold PBS, then lysed in lysis buffer containing 300 mM NaCl, 50 mM NaH 2PO 4 pH 8, 20 mM imidazole and 1% NP40. 10

l protease inhibitor cocktail (Sigma) per 1 ml lysate, and 0.5 mM DTT were added to the lysis buffer. 1 ml lysis buffer was added for every 15 million cells. Cells were lysed for 1 hour rotating at 4° C then centrifuged in an Eppendorf microcentrifuge at a maximum speed for 30 minutes at 4° C. The supernatant was then incubated with the nickel nitrilotriacetic acid (NiNTA) agarose beads (Qiagen) in a volume of 10 l beads for ~1.5 ml whole cell extract for 4 hours at 4° C to purify the 6xHistagged recombinant

Cdc45, TopBP1 and DUEB proteins. Following three washes with the lysis buffer containing 20 mM imidazole, the purified protein was eluted using 500 l elution buffer containing 250 mM imidazole. The purified proteins were concentrated using Microcon

Centrifugal Filter Devices (Millipore). The proteins whose molecular weights are below

10 kDa were cut off.

Coomassie staining

High Five cells infected with Cdc45 or TopBP1 were harvested and lysed. Whole cell extracts were resolved on a 10% acrylamide SDSPAGE gel and proteins were then transferred to ImmobilonP membranes (Millipore). The membrane was stained with the

0.1% (w/v) Coomassie blue R250, 20% (v/v) methanol, and 10% (v/v) acetic acid at room temperature for 15 to 20 min with gentle agitation. The Coomassie stain was removed after staining, and the membranes were incubated in the destain solution (50%

(v/v) methanol in water with 10% (v/v) acetic acid) and allowed the membranes to destain with gentle agitation until the protein bands were seen without background.

Silver staining

Purified Cdc45, TopBP1 and DUEB proteins were subjected to SDSPAGE gel.

The gel was placed in several gel volumes of MilliQ water and shaken for 30 min. The water was replaced by fixing solution (50% ethanol, 10% glacial acetic acid) and shaken for 10 min. Then fixing solution was replaced by rinse solution (50% ethanol) and shaken for 5 min. Rinse solution was replaced by sensitizer (0.02% sodium thiosulphate) and shaken for 2 min. Sensitizing solution was replaced by MilliQ water and shaken for 2 min. The water was replaced with cold staining solution (0.1% silver nitrate (Sigma

Ultrapure) and shaken for 20 min. The gel was washed with water for 1 min (2X). After second wash, developing solution (2% (10 g) sodium carbonate, 200 ul (of 37% v/v) formaldehyde, 20 ml sensitizer) was added and shaken for 1 min. The developing solution was changed and shaken for 5 – 10 min as required or until the expected bands appear. The developing solution was discarded and stop solution (1% acetic acid) was

added and shaken for at least 5 min. The gel was washed with MilliQ water (3X).

The binding assay of TopBP1, Cdc45 and DUEB trimeric complex formation

The TopBP1, Cdc45 and DUEB purified from insect High Five cells were put into 500 l of 50 mM sodium phosphate buffer and pulled down overnight with 1 g

FLAG antibody and 20 l of protein GSepharose beads (prewashed and resuspended in phosphate buffered saline at a 1:1 ratio). After incubation, the beads were washed three or four times with immunoprecipitate lysis buffer and resuspended in 500 l of sodium phosphate buffer containing 400 g/ml Flag peptide (Sigma F3290). After 4 hr incubation, the supernatant was then incubated overnignt with 1 g DUEB antibody and

20 l of protein ASepharose beads. After incubation, the beads were washed three or four times with immunoprecipitate lysis buffer and boiled with 20 l sample buffer for 10 min. For immunoblotting, the immunoprecipitates were separated by 10% SDSPAGE, transferred to ImmobilonP membranes (Millipore), and analyzed by immunoblotting with Cdc45 and DUEB antibodies described above. A flow chart for this procedure is shown below (Figure 5):

HisDUEB, HisCdc45 and FLAHis TopBP1

Exclude DUEB/ Cdc45 complex IP with FLAG Antibody

Resuspend the beads in NaPO4 buffer

Add FLAG Peptide Release the complexes from beads

Keep the supernatant

IP with DUEB Antibody Exclude TopBP1 /Cdc45 complex

IP sample is run SDSPAGE gel for Western Blotting

Probe with Cdc45 antibody and exclude DUEB / TopBP1 complex

Figure 5. Flow chart for assay of trimeric complex formation. The mixture of purified DUEB, Cdc45 and TopBP1 proteins was performed experiment according this procedure. Only Cdc45 in the trimeric DUEB/Cdc45 /TopBP1 complex is visualized.

Mass spectrometry analysis sample preparation

2 g of purified Sf9 DUEB or HeLa DUEB, as mentioned above, was dissolved in 100 mM ammonium bicarbonate, pH 8.5. The trypsin (Sigma T6567) was dissolved in

1 mM HCl at a concentration of 1 mg/ml. The trypsin solution was added to the substrate protein solution at a ratio 1:20 (w/w) of enzyme to substrate. The enzyme and protein mixture was incubated 18 hours at 37 ° C. Then 2 l 1% HCl was added to stop reaction.

The digested protein samples were characterized by mass spectrometry at the Proteome

Analysis Laboratory, Wright State University.

RESULTS

Generation of recombinant Cdc45 and TopBP1 bacmid and baculoviruses

Our laboratory has demonstrated that DUEB is essential for DNA replication

(Casper et al., 2005) and proposed that it is the metazoan homolog of Sld3. Sld3 interacts

with Cdc45 and Dpb11 and affects their loading to chromatin at preIC formation. To

examine whether DUEB has similar function as Sld3, DUEB, Cdc45 and TopBP1

recombinant baculoviruses need to be generated. Dr. Michael Kemp previously generated

DUEB and Cterminal truncated DUEB ( CT DUEB) baculoviruses, therefore Cdc45

and TopBP1 recombinant baculoviruses were generated by using the BactoBac

Baculovirus Expression System (Figure 6).

The pFAStBac TM donor plasmid containing human Cdc45 or TopBP1 cDNA was transformed into DH10Bac competent E. coli . Cdc45 and TopBP1 genes were integrated into parent bacmid with a laczminiattTn7 fusion to form two kinds of recombinant bacmid. The recombinant Cdc45 and TopBp1 bacmids were isolated by using Mini

Plasmid Extraction kit (Omega). PCR analysis and restriction enzyme digestion were performed to identify if Cdc45 and TopBP1 genes were correctly integrated into baculovirus DNA (Figure 7). The M13F and M13R primers were used to identify the recombinant Cdc45 bacmid. Three of four chosen Cdc45 transformed clones had the correct 4.1 kb PCR products but not clone 4 (Figure 7A). The four PCR products of

Cdc45 bacmid DNA were digested with the restriction enzyme Pst I. The 4.1 kb

33 34

PCR products showed the 2.5 kb, 1.0 kb and 0.5 kb three correct size bands (Figure 7B).

The recombinant TopBP1 bacmid DNAs were amplified by PCR using TopBP1F and

TopBP1R primers giving the correct 2.5 kb products (Figure 7C). The restriction enzyme

BamH I was used to digest the 2.5 kb PCR products to get the correct 2.0 kb and 0.5 kb bands, which confirmed that the PCR products were TopBP1 cDNA (Figure 7D). All

these PCR and restriction enzyme results showed human Cdc45 and Xenopus TopBP1

genes successfully integrated into parent bacmid.

Recombinant Cdc45 and TopBP1 bacmid DNA were isolated and transfected into

Sf9 insect cells by using Cellfectin (Invitrogen). After 3 days, pure and lowtiter

recombinant Cdc45 and TopBP1 baculoviruses, called P1 baculoviruses, were obtained.

Then the hightiter recombinant Cdc45 and TopBP1 baculoviruses (P2 and P3) were produced by using P1 baculoviruses to infect High Five insect cells.

Optimization of the expression of recombinant Cdc45 and TopBP1 proteins in High

Five insect cells

To obtain the high expression of recombinant Cdc45 and TopBP1 proteins in insect cells, the different concentration of recombinant baculovirus used to infect High

Five cells and the time course for harvesting infected cells must be performed to determine the point of maximum expression. Hightiter P3 recombinant Cdc45 and

TopBP1 baculovirses (MOI (multiplicity of infection) = 5 and 10) were used to infect

High Five cells, and the cells were harvested 1 and 2 days after infection. Cells were lysed with lysis buffer containing 1% NP40 and whole cell extracts were analyzed by western blotting by probing with Cdc45 and TopBP1 antibodies (Figure 8). The western

Figure 6. Generation of recombinant baculovirus and gene expression with the Bac to Bac® Expression System. The gene of interest is cloned into a pFAStBac TM donor plasmid, and the recombinant plasmid is transformed into DH10Bac TM competent cells which contain the bacmid with a miniattTn7 target site on the bacmid in the presence of transposition proteins provided by the helper plasmid. Colonies containing recombinant bacmids are identified by disruption of the lacZ gene. High molecular weight minipre DNA is prepared from selected E.coli clones containing the recombinant bacmid, and this DNA is then used to transfect insect cells.

A B M - 1 2 3 4 M 1 2 3 4

2.5 kb 4.1 kb 1.0 kb

0.5 kb

C D M + - 1 2 3 4 M 1 2 3 4

2.0 kb 2.5 kb 0.5 kb

Figure 7. Generation of Cdc45 and TopBP1 recombinant bacmid. The pFAStBac TM donor plasmid containing human Cdc45 or Xenopus TopBP1 cDNA was transformed into DH10Bac competent E. coli and formed Cdc45 and TopBP1 expression recombinant bacmids. (A) PCR identification of Cdc45 recombinant bacmid. The bacmid DNA of four Cdc45 clones were isolated and amplified by PCR using M13F and M13R primers. Three of four clones had the correct PCR products. (B) Restriction enzyme digestion of Cdc45 PCR products. The four PCR products of Cdc45 bacmid DNA were digested with the restriction enzyme Pst I and separated using 1% agarose gel electrophoresis. (C) PCR identification of TopBP1 recombinant bacmid. The bacmid DNA of four TopBP1 clones were isolated and amplified by PCR using TopBP1F and TopBP1R primers. All four clones had the correct PCR products (D) Restriction enzyme digestion of TopBP1 PCR products. The four PCR products of TopBP1 bacmid DNA were digested with the restriction enzyme BamH I and separated using 1% agarose gel electrophoresis (M: marker; +: plamid as template; : no template; 1,2,3,4 represent the individual picked clones.)

result suggested that the maximum expression of both Cdc45 and TopBP1 was at 2 days

after infection. High expression of Cdc45 and TopBP1 protein was obtained using high

titer P3 recombinant baculovirus (MOI=10) (Lane 9). The results also showed that the proteins expressed in High Five insect cells were the correct Cdc45 and TopBP1 proteins.

The molecular weights of Cdc45 and TopBP1 are 62 kDa and 170 kDa respectively. The particular concentration of baculoviruses (MOI=10) and the time course (2 days infection)

were used in all the experiments in this thesis.

Fulllength DUEB interacts with Cdc45 and TopBP1 in High Five insect cell

Although our laboratory has shown that DUEB binds to chromatin and is

required for Cdc45 and TopBP1 loading on chromatin using the Xenopus egg extract

system (Chowdhury, unpublished data), and other groups (Schmidt et al., 2007) showed

the interaction of human Cdc45 and TopBP1 in HeLa cells, all these experiments cannot

eliminate the effects of additional replication factors. In order to test if DUEB can bind

Cdc45 and TopBP1 and minimize the contribution of other proteins, human Histagged

DUEB, Histagged Cdc45 and Xenopus HisFlagtagged TopBP1 were overexpressed in

High Five insect cells and immunoprecipitation experiments were performed to

determine the binding of DUEB, Cdc45 and TopBP1.

High Five insect cells were coinfected with two of the three recombinant DUEB,

Cdc45 and TopBP1 baculoviruses and harvested 2 days after infection and lysed with lysis buffer. The whole cell extracts were used for coimmunoprecipitation experiments.

All the inputs and immunoprecipitated samples were subjected to SDS/PAGE gel and

Figure 8. Optimization of the expression of recombinant Cdc45 and TopBP1 proteins in High Five insect cells. Cdc45 and TopBP1 recombinant baculovirses (MOI (multiplicity of infection) = 5 and 10) were used to infect High Five cells, and the cells were harvested 1 and 2 days after infection. The whole cell extracts were used to perform western blotting experiments. Insect cells expressing recombinant Cdc45 and TopBP1 proteins were lysed in buffer containing 1% NP40 and whole cell lysates were used for western blotting analysis. Lane 1 is lysate from uninfected High Five cells; Lanes 25 are the whole lysates of Cdc45 baculovirus infected High Five cells probed with Cdc45 antibody; Lanes 69 are the whole lysates of TopBP1 baculovirus infected High Five cells probed with TopBP1 antibody. (Lane 2, 3, 6, 7 insect cells harvested 1 day after infection; Lane 4, 5, 8, 9 insect cells harvested 2 days after infection; Lane 2, 4, 6, 8 insect cell infected with MOI=5 baculoviruses; Lane 3, 5, 7, 9 insect cell infected with MOI=10 baculoviruses; nonspecific bands were used as loading control.).

39 probed with DUEB, Cdc45 and TopBP1 antibodies. As shown in Figure 9, when whole

cell extracts coinfected with recombinant Cdc45 and DUEB baculoviruses were

immunoprecipitated with Cdc45 antibody and probed with DUEB and Cdc45 antibodies,

the DUEB protein was pulled down together with Cdc45 (Lane 6). Similar results were

obtained when lysates were immunoprecipitated with DUEB antibody (Lane 7). This

result suggested that overexpressed DUEB binds to Cdc45 in High Five insect cells. The

whole cell extracts from cells coinfected with recombinant Cdc45 and TopBP1 baculoviruses were immunoprecipitated with Cdc45 (Lane 8) or Flagtag antibody (Lane

9), and both results showed that overexpressed Cdc45 also interacts with TopBP1 in

insect cells. The interaction of DUEB and TopBP1 was identified by co

immunoprecipitation experiments with Flagtag (Lane 10) or DUEB antibody (Lane 11).

These are very exciting results because it is the first time to show that DUEB interacts

with human Cdc45 and Xenopus TopBP1, especially since these interactions occur in insect cells, which almost rules out the effects of other replication proteins. After these results were obtained, Shere Myers in our lab also got the similar results in Xenopus egg extract and HeLa cells (Myers, unpublished data). All these results suggested that overexpressed human DUEB, Cdc45 and Xenopus TopBP1 interact with each other after minimizing the effects of other human replication proteins. In other words, each pair of these three proteins binds to each other directly. These results also suggested that DUEB had the similar function as yeast Sld3 protein, which is essential for loading Cdc45 and

TopBP1 on chromatin at initiation of DNA replication.

Figure 9. DUEB interacts with Cdc45 and TopBP1 in High Five insect cells. High Five insect cells were coinfected with two of the recombinant DUEB, Cdc45 and TopBP1 baculoviruses and harvested l day after infection. The whole cell extracts were used for coimmunoprecipitation experiments. All the input and immunoprecipitated samples were subjected to SDS/PAGE gel and probed with DUEB, Cdc45 and TopBP1 antibodies. Lanes 14: input (Lane 1: uninfected High Five cells; Lane 2: infected with Cdc45 and DUEB recombinant baculoviruses; Lane 3: infected with Cdc45 and TopBP1 recombinant baculoviruses; Lane 2: infected with TopBP1 and DUEB recombinant baculoviruses). Lanes 511: immunoprecipitated samples (Lane 5: uninfected High Five insect cells, immunoprecipitated with IgG antibody; Lanes 67: coinfected with Cdc45 and DUEB recombinant baculoviruses, Lane 6 immunoprecipitated with Cdc45 antibody and lane 7 immunoprecipitated with DUEB antibody; Lanes 89: infected with Cdc45 and TopBP1 recombinant baculoviruses; Lane 8 immunoprecipitated with Cdc45 antibody and lane 9 immunoprecipitated with Flagtag antibody; Lane 1011: infected with TopBP1 and DUEB recombinant baculoviruses, Lane 10 immunoprecipitated with DUEB antibody and lane 11 immunoprecipitated with Flagtag antibody; Black circles indicated antibodies used for immunoprecipitation).

DUEB interacts with Cdc45 and TopBP1 through its cterminal region in High Five

insect cells

Now, we want to know which part of DUEB is response for the interaction with

Cdc45 and TopBP1. The crystal structure of DUEB showed that human DUEB had an extra Cterminal 59 amino acids compared to bacterial and yeast homologs. DUEB binds to dsDNA using its Cterminal tail (Kemp et al., 2007). To test whether the Cterminal tail of DUEB is responsible for the interaction with Cdc45 and TopBP1, the overexpressed Cterminal truncated DUEB ( CT DUEB) protein was used to check the interaction with Cdc45 or TopBP1 (Figure 10).

High Five insect cells were coinfected with the recombinant CT DUEB and

Cdc45 or CT DUEB and TopBP1 baculoviruses and harvested l day after infection.

Cells were lysed in coimmunoprecipitation lysis buffer and the whole cell extracts were

used for coimmunoprecipitation experiment. The whole cell extracts coinfected with

recombinant Cdc45 and CT DUEB baculoviruses were immunoprecipitated with

Cdc45 and probed with DUEB and Cdc45 antibodies (Lane 3). The result showed that

only Cdc45 protein was pulled down by Cdc45 antibody, but not DUEB. This result

suggested that Cterminal truncated DUEB cannot interact with Cdc45 in High Five

insect cells. The reverse immuniprecipitation experiment, immunoprecipitated with DUE

B antibody, also got similar result (Lane 4). The whole cell extracts overexpressing both

CT DUEB and TopBP1 proteins were performed for immunoprecipitation experiment.

Lane 6 was immunoprecipitated with Flagtag antibody and probed with DUEB

antibody. Only Flagtagged TopBP1 but not DUEB showed in the lane. A similar result

was given with antiDUEB antibody (Lane 7). So CT DUEB does not bind to TopBP1

Figure 10. DUEB interacts with Cdc45 and TopBP1 through its Cterminal region in High Five insect cells. High Five insect cells were coinfected with the recombinant CT DUEB, and Cdc45 or CT DUEB and TopBP1 baculoviruses and harvested l day after infection. The whole lysates were used for coimmunoprecipitation experiments. All the input and immunoprecipitated samples were subjected to SDS/PAGE gel and probed with DUEB, Cdc45 and TopBP1 antibodies. Lane 1: immunoprecipitated with IgG antibody; Lanes 2 4: coinfected with Cdc45 and CT DUEB recombinant baculoviruses, lane 2: input; Lane 3 immunoprecipitated with Cdc45 antibody and lane 4 immunoprecipitated with DUEB antibody; Lanes 57: coinfected with TopBP1 and CT DUEB recombinant baculoviruses, lane 5: input; Lane 6 immunoprecipitated with Flagtag antibody and lane 7 immunoprecipitated with DUEB antibody. (Black circles indicated antibodies used for immunoprecipitation)

in insect cells either. Together these results indicated that DUEB suggested with Cdc45

and TopBP1 through its Cterminal region in High Five insect cells.

Purification of High Five insect cells expressing DUEB, Cdc45 and TopBP1

proteins

As mentioned before, fulllength DUEB interacts with Cdc45 and TopBP1

through its Cterminal region in High Five insect cell. Although these experiments were performed in High Five insect cells and minimized the effects of other human replication proteins, such as ORC, MCM27, there still exist many insect proteins, which may affect

the binding of these three proteins. To definitely eliminate the effect of other proteins,

Histagged DUEB, Histagged Cdc45 and Hisflagtagged TopBP1 proteins

overexpressed in High Five insect cells were purified and used to check the interaction between these three proteins.

Whole cell extracts from High Five cells expressing the DUEB, Cdc45 and

TopBP1 proteins with Histag were purified using NiNTA agarose separately. Silver

staining and western blotting experiments were performed to check purified DUEB,

Cdc45 and TopBP1 proteins. Figure 11A indicated Sf9 HistaggedDUEB, Histagged

Cdc45 and HisFlagtaggedTopBP1 proteins were obtained. The concentration of small

molecular weight protein DUEB (Lane1), 24kDa, was much higher than Cdc45 (Lane 2)

and TopBP1 (Lane 3). Compared with BSA control (Lane 46), the HistaggedDUEB protein concentration was about 500 ng/ l. The concentration of HistaggedCdc45 and

HisFlagtaggedTopBP1 were about 20 ng/ l. The results of western blotting probed

with DUEB, Cdc45 and TopBP1 antibodies confirmed that the purified proteins were the

Figure 11. Purification of High Five insect cells expressed DUEB, Cdc45 and TopBP1 proteins. Whole cell extracts from High Five cells expressing the DUEB, Cdc45 and TopBP1 proteins with Histag were purified using NiNTA agarose separately. (A) Silver staining to check purified DUEB, Cdc45 and TopBP1 proteins. Three kinds of purified and concentrated proteins were subjected to SDS/PAGE gel and staining with silver nitrate. Lane 1: DUEB; Lane 2: Cdc45; Lane 3: TopBP1; Lanes 46: BSA standard series used for estimate the concentration of all the purified proteins, the concentration of BSA are 200 ng, 50 ng and 500 ng; Land 7: protein marker. (B) The purified DUEB, Cdc45 and TopBP1 proteins were subjected to SDS/PAGE gel and probed with DUEB, Cdc45 and TopBP1 antibodies. Lane 1: DUEB; Lane 2: Cdc45; Lane 3: TopBP1.

expected Sf9 DUEB (Lane 1), Cdc45 (Lane 2) and TopBP1 (Lane 3) proteins (Figure

11B).

DUEB directly interacts with Cdc45 and TopBP1 in vitro

After the purified HisDUEB, HisCdc45 and FlagHis TopBP1 proteins were

obtained from High Five insect cells, interaction experiments between the three proteins

were performed in vitro to test if DUEB, Cdc45 and TopBP1 bind to each other directly.

The purified HisDUEB, HisCdc45 and FlagHis TopBP1 proteins were mixed together in sodium phosphate buffer and coimmunoprecipitation experiments were performed. All immunoprecipitated samples were subjected to SDS/PAGE gel and probed with DUEB, Cdc45 and TopBP1 antibodies. As showed as Figure 12, when immunoprecipitated with Cdc45 antibody and probed with TopBP1, DUEB and Cdc45 antibodies, the TopBP1 and DUEB protein were pulled down together with Cdc45 (Lane

3). Similar results were obtained when immunoprecipitated with DUEB and Flagtag antibody (Lane 4, 5). The three proteins, DUEB, Cdc45 and TopBP1 were pulled down together. All the data suggest that DUEB, Cdc45 and TopBP1 interact with each other directly.

DUEB, Cdc45 and TopBP1 form one trimeric complex in vitro

All the results from the insect cells and in vitro experiments indicate that DUEB,

Cdc45 and TopBP1 interact with each other directly. However, these experiments cannot prove whether these three proteins form one complex. To check whether the three proteins form one complex, the competitive coimmunoprecipitation experiment was performed (Figure 13).

Figure 12. DUEB directly interacts with Cdc45 and TopBP1 in vitro. Three kinds of DUEB, Cdc45 and TopBP1 proteins purified from High Five insect cells were added to 50 mM Na 2PO4 and performed immunoprecipitation experiment. All immunoprecipitated samples were subjected to SDS/PAGE gel and probed with DUEB, Cdc45 and TopBP1 antibodies. Lane 1: mixture of 100 ng Cdc45, 100 ng TopBP1 and 500 ng DUEB purified proteins; lane 2 immunoprecipitated with IgG antibody; Lane 3 immunoprecipitated with Cdc45 antibody; lane 4 immunoprecipitated with DUEB antibody; Lane 5 immunoprecipitated with Flag antibody.

Figure 13. DUEB, Cdc45 and TopBP1 form one complex in vitro. The DUEB, Cdc45 and TopBP1 proteins purified from High Five insect cells were added to 500 l 50 mM Na 2PO4 buffer and pulled down with 1 g Flag antibody and 20 l of protein GSepharose beads (prewashed and resuspended in phosphate buffered saline at a 1:1 ratio) overnight. After incubation, the beads were washed three or four times with Na 2PO4 buffer and resuspended in 500 l of Na 2PO4 buffer containing 400 g/ml FLAG peptide. After 4 hrs incubation, the supernatant was then incubated with 1 g DUEB antibody and 20 l of protein ASepharose beads overnight. After incubation, the beads were washed three or four times with Na 2PO4 buffer and boiled with 20 l sample buffer for 10 mins. All samples were subjected to SDS/PAGE gel and probed with DUEB and Cdc45 antibodies described above. Lane 1: whole cell extract infected with DUEB and Cdc45 baculoviruses. Lane 2, the sample including the mixture of purified DUEB, Cdc45 and TopBP1 proteins. Lane 3: the sample including the mixture of purified Cdc45 and TopBP1 proteins.

The purified HisDUEB, HisCdc45 and FlagHis TopBP1 proteins were mixed

together in sodium phosphate buffer and pulled down with Flag antibody, which would be expected not to immunoprecipitate dimeric complexes of DUEB and Cdc45. Excess

Flag peptide was added into the product of the pull down and then the supernatant of

released protins were immunoprecipitated with DUEB antibody. This is expected not to

immunoprecipitate dimeric complexes of Cdc45 and TopBP1. The DUEB

immunoprecipitation sample was probed with Cdc45 (Lane 2). As the Lane 2 shows, the

Cdc45 protein was pulled down together with DUEB, which suggested that DUEB,

Cdc45 and TopBP1 proteins interact simultaneously to form one complex in vitro . As a

negative control, TopBP1 and Cdc45 were mixed and the same reactions were performed

(Lane 3). In the absence of DUEB, Cdc45 cannot immunoprecipitated with DUEB

antibody.

Mass spectrometry to identify the covalent modification sites of Sf9 DUEB and

HeLa DUEB

The phosphorylation of DUEB appears to regulate its function. The previous data from our laboratory showed that Sf9 DUEB functions as a dominant negative form and inhibited DNA replication in Xenopus egg extracts. But HeLa DUEB (recombinant

DUEB expressed in HeLa cells) did not inhibit DNA replication and restored DNA replication to DUEB depleted egg extracts (Casperet al., 2005). The Cterminus region of Sf9 DUEB and HeLa DUEB were phosphorylated at different sites (Kemp et al.,

2007). CK2 phosphorylated Sf9 DUEB binds Cdc45 weaker than the unphosphorylated form in Xenopus egg extracts (Chowdhury, unpublished data). According to these data,

we proposed that the covalent modification, i.e. phosphorylation, of DUEB affects its

activity.

To identify the different covalent modification sites of Sf9 DUEB and HeLa

DUEB, purified DUEB proteins from High Five cells and HeLa cells were digested by trypsin and then characterized by mass spectrometry (Figure 14). The results of Sf9

DUEB showed that there is no covalent modification in all peptides detected by mass spectrometry, because the observed values and the expected values of all the peptides are the same. If there are covalent modifications, such as phosphorylation, the peptide mass should be increased 80 Da for each phosphate group. The mass spectrometry analysis of

HeLa DUEB is currently being done, but we expect that there may be covalent modifications in the HeLa DUEB.

Figure 14. Mass spectrometry analysis of Sf9 DUEB. Purified Sf9 DUEB was digested with trypsin and analyzed by mass spectrometry by the Proteome Analysis Laboratory, Wright State University.

DISCUSSION

The DNA unwinding element binding protein (DUEB) was identified by our laboratory (Casper et al., 2005; Ghosh et al., 2006) and proven to be required for DNA replication. DUEB is conserved throughout evolution, from bacteria to humans, but contains a unique 59 amino acid C terminus present only in vertebrates. In Xenopus egg

extracts, DUEB is essential for the replication of sperm chromatin, acting after preRC

formation and before origin unwinding (Casper et al., 2005; Ghosh et al., 2006). The

DUEB purified from HeLa cells, but not from Sf9 cells, can restore the DNA replication

of DUEBimmunodepleted Xenopus egg extracts (Casper et al., 2005). DUEB co

localizes to origin DUEs with MCM and Cdc45 proteins in vivo and it is involved in

loading Cdc45 and TopBP1 to chromatin in egg extracts (Chowdhury, unpublished data).

DUEB binds to the origin DNA transiently and it comes off DNA as the origin unwinds

during DNA replication (Chowdhury, unpublished data). These results suggest that

depletion of DUEB inhibits DNA replication by preventing the loading of Cdc45 on

chromatin.

All the evidence supports the possibility that DUEB may be the metazoan

homolog of yeast Sld3. The coimmunoprecipitation experiments show that DUEB not

only binds to Cdc45 and TopBP1 in vivo (Figure 9) and in vitro (Figure 12), but also binds to the two proteins directly (Figure 12). The Araki group (Kamimura et al., 2001)

reports that in yeast Sld3 (synthetically lethal with dpb111) binds to the TopBP1

homolog Dpb11 and loads Cdc45 at the origin unwinding and polymeraseloading steps

51 52

of chromosomal DNA replication. These results indicate DUEB has the similar property

of interacting with Cdc45 and TopBP1. These data also confirm the Hanel group’s data

(Schmidt et al., 2007) that human TopBP1 binds to human Cdc45 in vitro and in vivo and

is required for Cdc45 loading on chromatin.

The TopBP1 Xenopus homolog Xmus101 and yeast homolog Dpb11 are required

for the recruitment of XCdc45 to origins of DNA replication (Van Hatten, et al., 2002;

Kamimura et al., 2001). The interaction between Sld3 and Dpb11 is required for the

loading of SCdc45 on chromatin. Sld3 binds to the Nterminal BRCT repeats of TopBP1

though its Cterminal region (Araki et al., 1995; Tanaka et al., 2007; Zegerman et al.,

2007), and in a similar fashion, DUEB binds to TopBP1 through its Cterminus (Figure

10). There is no data to show which part of Sld3 binds to SCdc45. Our data show that

DUEB binds to Cdc45 also through its Cterminus, which provides a clue that Sld3 may

interact with SCdc45 through its Cterminal region.

The data that DUEB, Cdc45 and TopBP1 interact with each other (Figure 9 and

12) suggests that these three proteins could form one complex. The data from Figure 13 shows that DUEB, Cdc45 and TopBP1 form a heterotrimetric complex in vitro . The interaction between Sld3, Cdc45 and Dpb11 has been reported by several groups

(Kamimura et al., 2001; Van Hatten, et al., 2002; Tanaka et al., 2007; Zegerman et al.,

2007).

The Sf9 DUEB appears to function as dominant negative DUEB because its modification is different from functional HeLa DUEB, which is supported by the mass spectrometry (Figure 14). There is no phosphorylation in the Cterminal region of Sf9

DUEB, the region that is involved in DNA replication. But Cterminal region of HeLa

DUEB is phosphorylated at three sites (Kemp et al, 2007). So the phosphorylation of

DUEB is necessary for its replication function. Sld3 is an essential CDK substrate and phosphorylation of Sld3, together with Sld2, is the minimal requirement for CDK

dependent activation of the initiation of DNA replication in budding yeast (Masumoto et

al; 2002; Zegerman et al., 2007; Tanaka et al., 2007). Sld3 phosphorylated by CDK is

required for binding to the Cterminal BRCT3 region of the TopBP1 yeast homolog

Dpb11, which leads to polymerase loading in cooperation with Sld3SCdc45 complex

(Araki et al., 1995; Tanaka et al., 2007; Zegerman et al., 2007). However, the interaction between DUEB, TopBP1 and Cdc45 is not required DUEB phosphorylation by Sphase

kinases (Figure 9, 12, 13). The DUEB phosphorylation plays a role in releasing Cdc45

on chromatin (Chowdhury, unpublished data).

The metazoan homolog of Cdc45 and Dpb11 have already been isolated, but not the Sld3 homolog. The main reason is that Sld3, even within fungi, is very poorly conserved. S. pombe Sld3 shares only 14% identity and 24% similarity with S. cerevisiae

Sld3. On the other hands, Cdc45 is well conserved from yeast to higher eukaryotes and

the Nterminal BRCT repeats of Dpb11 are conserved in its metazoan homolog TopBP1

(Makiniemi et al., 2001; Yamamoto et al., 2000). All this evidence suggests that Sld3

should, like other important replication proteins such as Cdc45 and TopBP1, have a

metazoan homolog.

Although human DUEB only shares 4% identity and 14% similarity with S.

cerevisiae Sld3, the Cterminal of DUEB shares nearly 16%identity and 50% similarity

with S. cerevisiae Sld3 and S. pombe Sld3 (Figure 2). The Nterminus of Sld2, another

Sld family member, shares 20% identity with its metazoan homolog RecQL4 (Sangrithi

et al., 2005).

All these evidence supports the hypothesis that the human DNA replication protein DUEB is the potential functional homolog of yeast Sld3.

To more directly test if DUEB functions as the Sld3 metazoan homolog, DUEB will be transformed into Sld3 temperature sensitive fission yeast strains to check whether

DUEB can restore the Sld3 function.

REFERENCES

1. AbdelAziz, W., Malkas, L.H., Wills, P.W., and Hickey, R.J. (2003). The DNA synthesome: its potential as a novel in vitro model system for studying Sphase specific anticancer agents. Crit. Rev. Oncol. Hematol. 48, 1933.

2. Aparicio, T., Ibarra, A., and Mendez, J. (2006) Cdc45MCMGINS, a new power player for DNA replication. Cell Division 1. 18.

3. Aparicio, O.M., Weinstein, D.M., and Bell, S.P. (1997). Components and dynamics of DNA replication complexes in S. cerevisiae: redistribution of MCM proteins and Cdc45p during S phase. Cell 91, 5969.

4. Aparicio, O.M., Stout, A.M., and Bell, S.P. (1999). Differential assembly of Cdc45p and DNA polymerases at early and late origins of DNA replication. Proc. Natl. Acad. Sci. U. S. A. 96, 91309135.

5. Araki, H., Leem, S.H., phongdara, A., and Sugino, A. (1995). Dbp11, which interacts with DNA poymerase II ε in Saccharomyces Cerevisiae, has a dual role in Sphase progression and at a cell cycle checkpoint. Proc. Natl. Acad. Sci. 92, 1179111795.

6. Arias, E.E., and Walter, J.C. (2007). Strength in numbers: preventing rereplication via multiple mechanisms in eukaryotic cells. Genes Dev. 21, 497518.

7. Arias, E.E., and Walter, J.C. (2006). PCNA functions as a molecular platform to trigger Cdt1 destruction and prevent rereplication. Nature Cell Biol. 8, 84 90.

8. Ballabeni, A., Zamponi, R., Caprara, G., Melixetian, M., Bossi, S., Masiero, L., and Helin, K. (2008). Human CDT1 associates with CDC7 and recruits Cdc45 to chromatin during S phase. J. Biol. Chem. 284, 30283036.

9. Bauerschmidt, C., Pollok, S., Kremmer, E., Nasheuer, HP, and Grosse F. (2007). Interaction of human Cdc45 with the Mcm27 complex, the GINS complex, and DNA polymerases σ and ε during S phase. Genes Cells 12, 745 758.

10. Bell, S.P., and Dutta, A. (2002). DNA replication in eukaryotic cells. Annu. Rev. Biochem. 71, 333374.

55 56

11. Bell, S.P. and Stillman, B. (1992). ATPdependent recognition of eukaryotic origins of DNA replication by a multiprotein complex. Nature 357, 128134.

12. Blow, J.J. (2001). Control of chromosomal DNA replication in the early Xenopus embryo. EMBO J. 20, 32933297.

13. Boner, W., Taylor, E.R., Tsirimonaki, E., Yamane, K., Campo, M.S., and Morgan, I.M. (2002). A functional interaction between the human papillomavirus 16 transcription/replication factor E2 and the DNA damage response protein TopBP1. J Biol. Chem. 277, 2229722303.

14. Burrows, A.E., and Elledge, S.J. (2008). How ATR turns on: TopBP1 goes on ATRIP with ATR. Genes & Dev. 22, 14161421.

15. Callebaut, I., and Mornon, J.P. (1997). From BRCA1 to RAP1: a widespread BRCT module closely associated with DNA repair. FEBS Lett. 400, 2530.

16. Casper, J.M., Kemp, M.G., Ghosh, M., Randall, G.M., Vaillant, A., and Leffak, M. (2005). The cmyc DNAunwinding elementbinding protein modulates the assembly of DNA replication complexes in vitro. J. Biol. Chem. 280, 1307113083.

17. Carpenter, P. B., Mueller, P. R., and Dunphy, W.G. (1996). Role for a Xenopus Orc2related protein in controlling DNA replication. Nature 379, 357360.

18. Chen, S., and Bell, S.P. (2007). Orc6 is required for dynamic recruitment of Cdt1 during repeated Mcm27 loading. Genes Dev. 15, 28972907.

19. Chou, D.M., Petersen, P., Walter, J.C., and Walter, G. (2002). Protein phosphatase 2A regulates binding of Cdc45 to the prereplication complex. J. Biol. Chem. 277, 4052040527.

20. Coleman, T.R., Carpenter, P.B., and Dunphy, W.G. (1996). The Xenopus Cdc6 protein is essential for the initiation of a single round of DNA replication in cellfree extracts. Cell 87, 5363.

21. Delacroix, S., Wagner, J.M., Kobayashi, M., Yamamoto, K., and Karnitz, L.M. (2007). The Rad9Hus1Rad1 (911) clamp activates checkpoint signaling via TopBP1. Genes & Dev. 21, 14721477.

22. DePamphilis M.L. (1999). Replication origins in eukaryotic chromosomes: fact or fiction? Bioessays 21, 516.

23. Dierov, J., Dierova, R., and Carroll, M. (2004). BCR/ABL translocates to the nucleus and disrupts an ATRdependent intraS phase checkpoint. Cancer Cell

5, 275285.

24. Diffley, J.F. (2001). DNA replication: building the perfect switch. Curr. Biol. 11, R367R370.

25. Diffley, J.F. (1996). Once and only once upon a time: specifying and regulating origins of DNA replication in eukaryotic cells. Genes Dev. 10, 28192830.

26. Dolan, W.P., Sherman, D.A. and Forsburg, S.L. (2004). Schizosaccharomyces pombe replication protein Cdc45/Sna41 requires Hsk1/Cdc7 and Rad4/Cut5 for chromatin binding. Chromoosoma 113, 145156.

27. Ferenbach, A., Li, A., BritoMartins, M., and Blow, J. (2005). Functional domains of the Xenopus replication licensing factor Cdt1. Nucleic Acids Research 33, 316324.

28. Forsburg, S.L. (2004) Eukaryotic MCM proteins: beyond replication initiation. Microbiol. Mol. Biol. Rev. 68, 109131.

29. Francon, P., Maiorano, D., Mechali, M. (1999). Initiation of DNA replication in eukaryotes: questioning the origin. FEBS Lett. 452, 8791.

30. DePamphilis, M.L. (1999). Replication origins in metazoan chromosomes: fact or fiction? Bioessays 21, 516.

31. FerriFioni, ML, Schmitt, E., Soutourina, J., Plateau, P., Mechulam, Y., and Blanquet, S. (2001). Structure of crystalline DtyrtRNATyr deacylase, a representative of a new class of tRNAdependent hydrolysis. J. Biol. Chem. 276, 4728547290.

32. Fujita, M., Yamada, C., Goto, H., Yokoyama, N., and Kuzushima, K. (1999). Cell cycle regulation of human CDC6 protein. Intracellular localization, interaction with the human mcm complex, and CDC2 kinasemediated hyperphosphorylation. J. Biol. Chem. 274, 2592725932.

33. Furuya, K., Poitelea, M., Guo, L., Caspari, T., and Carr, A.M. (2004). Chk1 activation requires Rad9 S/TQsite phosphorylation to promote association with Cterminal BRCT domains of Rad4TopBP1. Genes & Dev. 18, 1154 1164.

34. Gambus, A., Jones, R.C., SanchezDiaz, A., Kanemaki, M., van Deursen, F., Edmondson, R.D., and Labib, K. (2006). GINS maintains association of Cdc45 with MCM in replisome progression complexes at eukaryotic DNA replication forks. Nat. Cell Biol. 8, 358366. 80.

35. Gauthier, L., Dziak, R., Kramer, D.J., Leishman, D., Song, X., Ho, J., Radovic, M., Bentley, D., and Yankulov, K. (2002). The role of the carboxyterminal domain of RNA polymerase II in regulating origins of DNA replication in Saccharomyces cerevisiae. Genetics 162, 11171129.

36. Garcia, V., Furuya, K., and Carr, A.M. (2005). Identification and functional analysis of TopBP1 and its homologs. DNA repair 4, 12271239.

37. Gentner, N.E., Werner, M.M., Hannan, M.A., and Nasim, A. (1978). Contribution of a caffeinesensitive recombinational rapair pathway to survival and mutagenesis in UVirradiated Schizosaccharomyces prmbe. Mol. Gen. Genet. 167, 4349.

38. Ghosh, M., Kemp, M., Liu, G., Ritzi, M., Schepers, A., and Leffak, M. (2006). Differential Binding of Replication Proteins across the Human cmyc Replicator. Mol. Cell. Biol. 26, 52705283.

39. Gopalakrishnan, V., Simancek, P., Houchens, H.A., Snaith, M.G., Frattini, S., Sazer, S., and Kelly, T.J. (2001). Redundant control of rereplication in fission yeast. Proc.Natl. Acad. Sci. U.S.A. 98, 1311413119.

40. Hardy, C.F.J. (1997). Identification of Cdc45p, an essential factor required for DNA replication. Gene 187, 239246.

41. Harper, J.W., and Elledge, S.J. (2007). The DNA damage response: ten years after. Mol. Cell 28, 739745.

42. Harwell, L.H. (1973). Three additional genes required for deoxyribonucleic acid synthesis in Saccharomyces cerevisiae. J. Bacteriol. 115, 966974.

43. Hashimoto, Y., and Takisawa, H. (2003). Xenopus Cut5 is essential for a CDKdependent process in the initiation of DNA replication. EMBO J. 22, 25262535.

44. Hennessy, K., Lee, A., Chen, E., and Botstein, D. (1991). A group of interacting yeast DNA replication genes. Genes Dev, 5, 958969.

45. Herold, S., Wanzel, M., Beuger, V., Frohme, C., Beul, D., Hillukkala, T., Syvaoja, J., Saluz, A.P., Haenel, F., and Eilers, M. (2002). Negative regulation of the mammalian UV response by Myc through association with Miz1. Mol. Cell 10, 509521.

46. Hofmann, J.F., and Beach, D. (1994). Cdt1 is an essential target of the Cdc10/ Sct1 transcription factor: requirement for DNA replication and inhibition of mitosis. EMBO J. 13, 425434.

47. Hussain, T., Kruparani, S. P., Pal, B., DockBregeon, AC., Dwivedi, S., Shekar, M. R., Sureshbabu, K., and Sankaranarayanan. R. (2006). Post transfer editing mechanism of a DaminoacyltRNA deacylaselike domain in threonyltRNA synthetase from archaea. EMBO J. 25, 41524162.

48. Manke, I.A., Lowery, D.M., Nguyen, A., and Yaffe, M.B. (2003). BRCT repeats as phosphopeptidebinding modules involved in protein targeting. Science 302, 636639.

49. Ishimi, Y., KomauraKohno, Y., You, Z., Omori, A., and Kitagawa, M., (2000). Inhibition of Mcm4, 6, 7 helicase activity by phosphorylation with cyclin A/Cdk2. J. Biol. Chem. 275, 1623516241.

50. Ishimi, Y., and KomauraKohno, Y. (2001) Phosphorylation of Mcm4 at specific sites by cyclindependent kinase leads to loss of Mcm4, 6, 7 helicase activity. J.Biol. Chem. 276, 3442834433.

51. Jeon, Y., Lee, K.Y., Ko, M.J., Lee, Y.S., K, S., and Hwang, D.S. (2007). Human TopBP1 participates in cyclin E/CDK2 activation and preinitiation complex assembly during G1/S transition. J. Biol. Chem. 282, 1488214890.

52. Kamimura, Y., Tak, Y.S., Sugina, A., and Araki, H. (2001) Sld3, which interacts with Cdc45 (Sld4), functions for chromosomal DNA replication in Saccharomyces cerevisiae. EMBO J. 20, 20972107.

53. Kanemaki, M., and Labib, K. (2006). Distinct roles for Sld3 and GINS during establishment and progression of eukaryotic DNA replication forks. EMBO J. 25, 17531763.

54. Kawaski, Y., Hiraga, S., and Sugino, A. (2000). Interactions between Mcm10p and other replication factors are required for proper initiation and elongation of chromosomal DNA replication in Saccharomyces cerevisiae. Genes Cells 5, 975989.

55. Kelly, T.J., and Brown, G.W. (2000). Regulation of Chromosome Replication. Annu. Rev. Biochem. 69. 829880.

56. Kemp, K., Bae, B., Yu, J. P., Ghosh, M., Leffak, M., and Nair. S.K. (2007). Structure and fnction of the cmyc DNAunwinding elementbinding protein DUEB. J. Biol. Chem. 282, 1044110448.

57. Kobayashi, T., Rein, T., and DePamphilis, M.L. (1998). Identification of primary initiation sites for DNA replication in the hamster dihydrofolate reductase gene initiation zone. Mol. Cell. Biol. 18, 32663277.

58. Krude, T., Jackman, M., Pines, J., and Laskey, R.A. (1997). Cyclin/Cdk

dependent initiation of DNA replication in a human cellfree system. Cell 88, 109119.

59. Krude, T., Musahl, C., Laskey, R.A., and Knippers, R. (1996). Human replication proteins hCdc21, hCdc46 and P1Mcm3 bind chromatin uniformly before Sphase and are displaced locally during DNA replication. J. Cell Sci. 109, 309318.

60. Kukimoto, I., Igaki, H., and Kanda, T. (1999). Human Cdc45 protein binds to minichromosome maintenance 7 protein and the p70 subunit of DNA polymerase α. Eur. J. Biochem. 265, 936943.

61. Labib, K., and Gambus, A. (2007). A key role for the GINS complex at DNA replication forks. Trends Cell Biol. 17, 271278.

62. Leatherwood, J. (1998). Emerging mechanisms of eukaryotic DNA replication initiation. Cuur. Opin. Cell Biol. 10, 742748.

63. Lee, J., Kumagai, A., and Dunphy, W.G. (2007). The Rad9Hus1Rad1 checkpoint clamp regulates interaction of TopBP1 with ATR. J. Biol. Chem. 282, 2803628044.

64. Lei, M. (2005). The MCM complex: its role in DNA replication and implications for cancer therapy. Curr. Cancer Drug Targets 5, 365380.

65. Liu, G., Malott, M., and Leffak. M. (2003). Multiple functional elements comprise a mammalian chromosomal replicator. Mol. Cell. Biol. 23, 1832 1842.

66. Liu, K., Luo, Y., Lin, F.T., and Lin W.C. (2004). TopBP1 recruits Brg1/Brm to repress E2Finduced apoptosis, a novel pRbindependent and E2F1specific control for cell survival. Genes Dev. 18,673686.

67. Liu, K., Lin, F.T., Ruppert, J.M., and Lin W.C. (2003). Regulation of E2F1 by BRCT domaincontaining protein TopBP1. Mol. Cell Biol. 23, 32873304.

68. Lutzmann, M., and Mechali, M. (2008). MCM9 bubds Cdt1 and is required for the assembly of prereplication complexes. Mol. Cell 31, 190200.

69. Lutzmann, M., Maiorano, D., and Mechali, M. (2006). A Cdt1geminin complex licenses chromatin for DNA replication and prevents rereplication during S phase in Xenopus. EMBO J. 25, 57645774.

70. Lutzmann, M., Maiorano, D., and Mechali, M. (2005). Identification of full genes of MCM9, a novel, vertebtatespecific member of the MCM28 protein family. Gene 362, 5156.

71. Maiorano, D., Moreau, J., and Mechali, M. (2000). XCDT1 is required for the assembly of prereplication complexes in Xenopus laevis. Nature 404, 622 625.

72. Makiniemi, M., Hillukkala, T., Tuusa, J., Reini, K., Vaara, M., Huang, D., Pospiech, H., Majuri, I., Westerling, T., Makela, T.P., and Syvaoja, J.E. (2001). BRCT domaincontaining protein TopBP1 functions in DNA replication and damage response. J. Biol. Chem. 276, 3039930406.

73. Marahrens, Y. and Stillman, B. (1992). A yeast chromosomal origin of DNA replication defined by multiple functional elements. Science 14, 255(5046), 81723.

74. Masuda, T., Mimura, S., and Takisawa, H. (2003). CDKand Cdc45 dependent priming of the MCM complex on chromatin during Sphase in Xenopus egg extracts: possible activation of MCM helicase by association with Cdc45. Genes Cells 8, 145161.

75. Masumoto, H., Muramatsu, S., Kamimura, Y., and Araki, H. (2002). SCdk dependent phosphorylation of Sld2 essential for chromosomal DNA replication in budding yeast. Nature 415, 651655

76. Masumoto, H., Sugino, A., and Araki, H. (2000). Dpb11 controls the association between DNA polymerases alpha and epsilon and the autonomously replicating sequence region of budding yeast. Mol. Cell. Biol. 20, 28092817.

77. Matsuno, K., Kumano, M., Kubota, Y., Hashimoto, Y., and Takisawa, H. (2006). The Nterminal noncatalytic region of Xenopus RecQ4 is required for chromatin binding of DNA polymerase alpha in the initiation of DNA replication. Mol. Cell. Biol. 26, 48434852.

78. Mendez, J., and Stillman, B. (2003). Prepetuating the double helix: molecular machines at eukaryotic DNA replication origins. Bioessays 25, 11581167.

79. Mendez, J., and Stillman, B. (2000). Chromatin association of human origin recognition complex, cdc6, and minichromosome maintenance proteins during the cell cycle: assembly of prereplication complexes in late mitosis. Mol. Cell. Biol. 20, 86028612.

80. Meng, X., Chen, J., Yang, Q., Wang, S., Chao, Y., Ying, K., Xie, Y., and Mao, Y. (2002). Cloning and identified of a novel cDNA which may be associated with activated chromatin of the human cmyc gene in vivo. Biochem. Genet. 40, 303310.

81. Merchant, A.M., Kawasaki, Y., Chen, Y. R., Lei, M., and Tye, B.K. (1997). A

lesion in the DNA replication initiation factor Mcm10 induces pausing of elongation forks through chromosomal replication origins in Saccharomyces cerevisiae. Mol. Cell. Biol. 17, 32613271.

82. Mimura, S., Masuda, T., Matsui, T., and Takisawa, H. (2000). Central role for cdc45 in establishing an initiation complex of DNA replication in Xenopus egg extracts.Genes Cells 5, 439452.

83. Mimura, S., and Takisawa, H. (1998). Xenopus Cdc45dependent loading of DNA polymerase alpha onto chromatin under the control of Sphase Cdk. EMBO J. 17, 56995707.

84. Moir, D., Stewart, S. E., Osmond, B.C., and Botstein, D. (1982). Cold sensitive celldivisioncycle mutants of yeast: isolation, properties, and pseudoreversion studies. Genetics 100, 547563.

85. Moldovan, GL., Pfander, B., and Jentsch, S. (2007). PCNA, the maestro of the replication fork. Cell 129, 665679.

86. Mordes, D.A., Glick, G.G., Zhao, R., and Cortez, D. (2008). TopBP1 activates ATR through ATRIP and PIKK regulatory domain. Genes & Dev. 22, 1478 1489.

87. Moyer, S.E., Lewis, P.W., and Botchan, M.R. (2006). Isolation of the Cdc45/Mcm27/GINS (CMG) complex, a candidate for the eukaryotic DNA replication fork helicase. Proc. Natl. Acad. Sci. U. S. A.

88. Nakajima, R., and Masukata, H. (2002). SpSld3 is required for loading and maintenance of SpCdc45 on chromatin in DNA replication in fission yeast. Mol. Biol. Cell 13, 14621472.

89. Natale, D. A., Umek, R. M., and Kowalski. D. (1993). Ease of DNA unwinding is a conserved property of yeast replication origins. Nucleic Acid Research. 21, 555560.

90. Newlon, C.S. (1996). In DNA Replication in Eukarytoic Cells, ed. Ml DePamphilis. Plainview, NY. Cold Spring Harbor Lab. 873914.

91. Nguyen, V.Q., Co, C., and Li, J.K. (2001). Cyclindependent kinases prevent DNA rereplication through multiple mechanisms. Nature 411,10681073.

92. Nishitani, H., Lygerou, Z., Nishimoto, T., and Nurse, P. (2000). The Cdt1 protein is required to license DNA for replication in fission yeast. Nature 404, 625628.

93. Ouchi, T., Monteiro, A.N., August, A., Aaronson, S.A., and Hanafusa, H.

(1998). BRCA1 regulates p53dependent gene expression. Proc. Natl. Acad. Sci. U.S.A. 95, 23022306.

94. Pacek, M., Tutter, A.V., Kubota, Y., Takisawa, H., and Walter, J.C. (2006). Localization of MCM27, Cdc45, and GINS to the site of DNA unwinding during eukaryotic DNA replication. Mol. Cell 21, 581587.

95. Petersen, B.O., Wagener, C., Marinoni, F., Kramer, E.R., and Melixetian, M. Cell cycle and cell growthregulated proteolysis of mammalian CDC6 is dependent on APCCDH1. (2000). Genes. Dev. 14, 23302343.

96. Petersen, P., Chou, D.M., You, Z., Hunter, T., Walter, J.C., and Walter. G. (2006). Protein phosphatase 2A antagonizes ATM and ATR in a Cdk2and Cdc7independent DNA damage checkpoint. Mol. Cell. Biol. 26, 19972011.

97. Piatti, S., Bohm, T., Cocker, J. H., Diffley, J.F., and Nasmyth, K. (1996). Activation of Sphasepromoting CDKs in late G1 defines a "point of no return" after which Cdc6 synthesis cannot promote DNA replication in yeast. Genes Dev. 10, 15161531.

98. Pollok, S., and Grosse, F. (2007). Cdc45 degradation during di erentiation and apoptosis. Biochemical Biophysical Research communications 362, 910915.

99. Pollok, S., Stoepel, J., Bauerschmidt, C., Kremmer, E., and Nasheuer, H.P. (2003). Regulation of eukaryotic DNA replication at the initiation step. Biochem Soc Trans. 31, 266269.

100. Rao, H., and Stillman, B. (1995). The origin recognition complex interacts with a bipartite DNA binding site within yeast replicators. Proc. Natl. Acad. Sci. USA 92, 22242228.

101. Ricke, R.M., and Bielinsky, A.K. (2004). Mcm10 regulates the stability and chromatin association of DNA polymerasealpha. Mol. Cell 16, 173185.

102. Romanowski, P., Madine, M.A., Rowles, A., Blow, J.J., and Laskey, R.A. (1996). The Xenopus origin recognition complex is essential for DNA replication and MCM binding to chromatin. Curr. Biol. 6, 14161425.

103. Rowles, A., Chong, J.P.J., Brown, L., Howell, M., Evan, G.I., and Blow, J.J. (1996). Interaction between the origin recognition complex and the replication licensing system in Xenopus. Cell 87, 287296.

104. Rowles, A., Cocker, J.H., Harwood, J., and Diffley, J.F. (1995). Initiation complex assembly at budding yeast replication origins begins with the recognition of a bipartite sequence by limiting amounts of the initiator, ORC. EMBO J. 14, 26312641.

105. Saha, P., Chen, J., Thome, K.C., Lawlis, S.J., and How, Z.H. (1998). Human CDC6/Cdc18 associates with Orc1 and cyclincdk and is selectively eliminated from the nucleus at the onset of S phase. Mol. Cell. Biol. 18, 2758 2767.

106. Saha, P., Thome, K.C., Yamaguchi, R., Hou, Z.H., Weremowicz, S., and Dutta, A. (1998). The human homolog of Saccharomyces cerevisiae Cdc45. J. Biol. Chem. 273, 1820518209.

107. Saja, Y., Esashi, F., Matsusaka, T., Mochida, S., and Yanagida. M. (1997). Damage and replication checkpoint control in fission yeast is ensured by interactions of Crb2, a protein with BRCT motif, with Cut5 and Chk1. Genes Dev. 11, 33873400.

108. Saka, Y., and Yanagida, M. (1993). Fission yeast cut5+, required for S phase onset and M phase restraint, is identical to the radiationdamage repair gene rad4+. Cell 74, 383393.

109. Sangrithi, M.N., Bernal, J.A., Madine, M., Philpott, A., Lee, J., Dunphy, W.G., and Venkitaraman, A.R. (2005). Initiation of DNA replication requires the RECQL4 protein mutated in RothmundThomson syndrome. Cell 121, 887 898.

110. Saxena, S., and Dutta, A. (2005). GemininCdt1 balance is critical for genetic stability. Mutation Research 569,111121.

111. Sclafani, R.A., and Holzen, T.M. (2007). Cell Cycle Regulation of DNA Replication. Annu. Rev. Genet. 41, 237280.

112. Shimizu, K., Bourillot, P.Y., Nielsen, S.J., Zorn, A.M., and Gurdon. J.B. (2001). Swift is a novel BRCT domain coactivator of Smad2 in transforming growth factor beta signaling. Mol. Cell Biol. 21, 39013912.

113. Speck, C., Chen, Z., Li, H., and Stillman, B. (2005). ATPasedependent cooperative binding of ORC and Cdc6 to origin DNA. Nat. Struct. Mol. Biol. 12, 965971.

114. Speck, C., and Stillman, B. (2007). Cdc6 ATPase activity regulates ORC CDC6 stability and the selection of specific DNA sequences as origins of DNA replication. J. Biol. Chem. 282, 1170511714.

115. Soutourina, J., Blanquet, S., and Plateau, P. (2000). DtyrosyltRNAtyr metabolism in Saccharomyces cerevisiae. J. Biol, Chem. 275, 1162611630.

116. Suh, MH., Ye, P., Dutta, A.B., Zhang, M., and Fu, J. (2005). An agarose

acrylamide composite native gel system suitable for separating ultralarge protein complexes. Analytical Biol. 343, 166175.

117. Takayama, Y., Kamimura, Y., Okawa, M., Muramatse, S., Sugina, A., and Araki, H. (2003). GINS, a novel multiprotein complex required for chromosomal DNA replication in budding yeast. Genes Dev. 17, 11531165.

118. Takisawa, H., Mimura, S., and Kubota, Y. (2000). Eukarytoci DNA replication: from prereplication complex to initiation complex. Curr Opin Cell Bio. 12, 690696.

119. Tanaka, S., Umemori, T., Hirai, K., Muramatsu, S., Kamimura, Y., and Araki, H. (2007a). CDKdependent phosphorylation of Sld2 and Sld3 initiates DNA replication in budding yeast. Nature 445, 328332.

120. Tanaka, S., Tak, YS., and Araki, H. (2007). The role of CDK in the initiation step of DNA replication in eukaryotes. Cell Division 2, 16.

121. Tanaka, S., and Diffley, J.F. (2002). Interdependent nuclear accumulation of budding yeast Cdt1 and Mcm27 during G1 phase. Nat. Cell Biol. 4, 198207.

122. Tercero, J.A., Labib, K., and Diffley, J.F.X. (2000). DNA synthesis at individual replication forks requires the essential initiation foctor Cdc45p. EMBO J. 19, 20822093.

123. Tye, BK. (1999). MCM proteins in DNA replication. Annu. Rev. Biochem. 68, 649686.

124. Uchiyama, M., Griffiths, D., Arai, K., and Masai, H. (2001). Essential role of Sna41/Cdc45 in loading of DNA polymerase alpha onto minichromosome maintenance proteins in fission yeast. J. Biol. Chem. 276, 2618926196.

125. Schmidt. U., Wollmann, Y., Franke, C., Grosse, F., SaluZ, HP., and Hanel, F. (2008). Characterization of the interaction between the human DNA topoisomerase II β binding protein 1 (TopBP1) and the cell division cycle protein 45 (Cdc45). 409, 169177.

126. Van Hatten, R.A., Tutter, A.V., Holway, A.H., Khederian, A.M., Walter, J.C., and Michael, W.M. (2002). The Xenopus Xmus101 protein is required for the recruitment of Cdc45 to origins of DNA replication. J. Cell Biol. 159, 541547.

127. Vaughn, J.P., Dijkwel, P.A., and Hamlin, J.L. (1990). Replication initiates in a broad zone in the amplified CHO dihydrofolate reductase domain. Cell 61, 10751087.

128. Vas, A., Mok, W., and Leatherwood, J. (2001). Control of DNA rereplication

via Cdc2 phosphorylation sites in the origin recognition complex. Mol. Cell. Biol. 21, 57675777.

129. Walter, J., and Newport, J. (2000). Initiation of eukaryotic DNA replication: origin unwinding and sequential chromatin association of Cdc45, RPA, and DNA polymerase alpha. Mol. Cell 5, 617627.

130. Wang, H., and Elledge, S.J. (2002). Genetic and physical interactions between DPB11 and DDC1 in the yeast DNA damage response pathway. Genetics 160, 12951304.

131. Yabuuchi, H., Yamada, Y., Uchida, T., Sunathvanichkul, T., Nakagawa, T., and Masukata, H. (2006). Ordered assembly of Sld3, GINS and Cdc45 is distinctly regulated by DDK and CDK for activation of replication origins. EMBO J. 25, 46634674.

132. Yamada, Y., Nakagawa, T., and Masukata, H. (2004). A novel intermediate in initiation complex assembly for fission yeast DNA replication. Mol. Biol. Cell 15, 37403750.

133. Yamamoto, R.R. Axton, J.M., Yamamoto, Y., Saunders, R.D., Glover, D.M., and Henderson, D.S. (2000). The Drosophila mus101 gene, which links DNA replication and condensation of heterochromatin in mitosis, encodes a protein with seven BRCA1 Cterminus domains. Genetics 156, 711721.

134. Yamane, K., Wu, X., and Chen, J. (2002). A DNA damageregulated BRCT containing protein, TopBP1, is required for cell survival. Mol. Cell. Biol. 22, 555566.

135. Yamane, K., and Tsuruo, T. (1999). Conserved BRCT regions of TopBP1 and of the tumor suppressor BRCA1 bind strand breaks and termini of DNA. Oncogene 18, 51945203.

136. Yamane, K., Kawabata, M., and Tsuruo, T. (1997). A DNAtopoisomeraseII binding protein with eight repeating regions similar to DNArepair enzymes and to a cellcycle regulator. Eur. J. Biochem. 250, 794799.

137. Yanow, S.K., Lygerou, Z., and Nurse, P. (2001). Expression of Cdc18/Cdc6 and Cdt1 during G2 phase induces initiations of DNA rplication. EMBO J. 20, 46484656.

138. Yoshida, K., Kuo, F., Geoger, E.L., Sharpe, A.H., and Dutta, A. (2001). Requirement of Cdc45 for postimplantation mouse development. Mol. Cell Biol. 21, 45984603.

139. Yoo, H.Y., Kumagai, A., Shevchenko, A., and Dunphy, W.G. (2007). Ataxia

telangiectasia mutated (ATM) –dependent activation of ATR occurs through phosphorylation of TopBP1 by ATM. J Biol. Chem. 282, 1750117506.

140. Yu, X., Chini, C.C., He, M., Mer, G., and Chen, J. (2003). The BRCT domain is a phosphoprotein binding domain. Science 302, 639642.

141. Zegerman, P., and Diffley, J.F. (2007). Phosphorylation of Sld2 and Sld3 by cyclindependent kinases promotes DNA replication in budding yeast. Nature 445, 281285.

142. Zou, L., and Stillman, B. (2000). Assembly of a complex containing Cdc45p, replication protein A, and Mcm2p at replication origins controlled by Sphase cyclindependent kinases and Cdc7pDbf4p kinase. Mol. Cell. Biol. 20, 3086 3096.

143. Zou, L., and Stillman, B. (1998). Formation of a preinitiation complex by S phase cyclin CDKdependent loading of Cdc45p onto chromatin. Science 280, 593596.

144. Zou, L., Mitchell, J., and Stillman, B. (1997). Cdc45, a novel yeast gene that functions with the origin recognition complex and MCM proteins in initiation of DNA replication. Mol. Cell Biol. 17, 553563.