POPULATION DYNAMICS AND reproductive BIOLOGY OF BARNACLES, MEGABALANUS TINTINNABULUM FOUND ON Two ROCKY SHORES OF KARACHI, PAKISTAN
Thesis submitted to the University of Karachi in fulfillment of the
requirements for the Degree of Doctor of Philosophy in Marine Biology
Shaheena
Centre of Excellence in Marine Biology University of Karachi Karachi-75270 Pakistan 2017 This thesis by Shaheena is accepted in the present form by the Centre of
Excellence in Marine Biology, University of Karachi, Karachi-75270,
Pakistan as satisfying the requirements for the Degree of Doctor of
Philosophy in Marine Biology.
Internal Examiner………………………… (Thesis Supervisor)
External Examiner…………………………..
Director…………………………………… Centre of Excellence in Marine Biology, University of Karachi, Karachi-75270
Dated: ………………. ACKNOWLEDGEMENT
First of all, most respectfully my countless thanks to Almighty Allah who is the most Beneficent and the most merciful, for showering His blessings and giving me the capability to complete this work.
I express my deepest and sincere thanks to my research supervisor Prof. Dr. Zarrien Ayub, Centre of Excellence in Marine Biology, University of Karachi, Pakistan, for her diligence and guidance throughout my study. I have no words to thank her any way I just pray to Allah for her health, success and honour in every walk of life.
I want to express my gratitude to the Directors of the Centre of Excellence in Marine Biology, University of Karachi for their support during research work.
I would also like to express my immense gratitude to Prof. Dr. Ghazala Siddiqui, CEMB, University of Karachi, for her kind cooperation
The cooperation of all my lab colleagues is also hereby gratefully acknowledged. My thanks are due to Mr. Rohail Mustafa, Field Assistant of Centre of Excellence in Marine Biology for his help during the field trips.
I am also grateful to my family and my late father for their support during my research work and during compilation of my thesis.
Abstract
The large sized tropical origin barnacle, Megabalanus tintinnabulum was endemic to West Africa and parts of the Indo-Pacific. The population dynamics and reproductive pattern of the barnacles M. tintinnabulum were studied from January 2012 to December 2013 on two rocky coasts of
Karachi, Buleji and Manora bordering the northern Arabian Sea. The object was to get information related to various biological parameters of this species, which is almost negligible in the literature. The barnacles of M. tintinnabulum were identified based on the shell morphology and the identification of this species was further confirmed using the DNA barcoding approach based on the fragment of mitochondrial gene cytochrome c oxidase subunit I (COI).
The von Bertalanffy growth function (VBGF) and ELEFAN I were utilized to estimate the growth parameters with the aid of FiSAT software.
The population structure of M. tintinnabulum consisted of 2-3 cohorts at both sites. The average density of M. tintinnabulum was higher at Buleji
(101.9 ± 15.02 individual m-2) than Manora (76.0 ± 8.05 individual m-2).
Though the estimated asymptotic length, i.e., rostro-carinal diameter (L∞) equals to 51.98 mm at both sites but the growth coefficient (K) was higher at Manora (0.63 year−1) than Buleji (0.44 year−1). The population of M. tintinnabulum grew at a faster rate at Manora than Buleji thus attaining the rostro-carinal diameter of 31.8 mm in one year at Manora as compared to
23.7 mm at Buelji. Larger sized (>40 mm) barnacles were comparatively higher at Manora (17.2%) than Buleji (14.0%). Longevity was estimated to be 4.3 years at Manora and 6.4 years at Buleji, while natural mortality rate
(M) was 0.894 year−1 and 1.131 year−1 at Buleji and Manora, respectively.
The variability in the growth rates of M. tintinnabulum at two rocky shores may be attributed to the fact that the density of barnacles is lower and food supply (concentrations of chlorophyll-a) is higher at Manora, thus resulting in a faster growth rates at Manora than Buleji.
Reproduction in this species was studied using gonadal histology and brooding capacity. The gonads were absent in M. tintinnabulum smaller than 11 mm, after that size, the testes and ovaries appeared simultaneously in each individual. The minimum size at which M. tintinnabulum had mature testes and ovaries was 18 mm but the minimum size of brooding barnacle was 24 mm. Histologically the ovaries in M. tintinnabulum were categorized into four developmental stages, that is, the immature, growing, mature and spent stages. The testes were categorized into three developmental stages, that is, the immature, growing, mature stages. Though mature gonads (ovaries and testes) were found throughout the year in M. tintinnabulum but the brooding individuals were observed during the winter
(November to February) period showing that lower temperatures (20-24º C) are preferred as compared to higher temperatures (29-34º C). The reproductive capacity (number of eggs produced) of M. tintinnabulum was
7,914 ± 303 of eggs per brood. The reproductive capacity showed no significant difference at two sites, but the number of brooders were higher at Manora than Buleji.
In the present study concentrations of protein, carbohydrate and lipid were lowest in immature ovaries and highest in mature ovaries of M. tintinnabulum, that is, concentrations of these biochemical constituents increased in the ovaries with the advancement in ovarian maturation stages.
The concentrations of total proteins, carbohydrate and lipid in ovaries showed seasonal variations being higher in winter and comparatively lower in summer. Further studies should be conducted to examine the population dynamics and reproductive pattern of M. tintinnabulum in the Asian region including the larval supply and recruitment patterns of this species. Such studies will provide the baseline data for future comparative studies.
Table of Contents Page No.
Acknowledgement I
Abstract II
List of Tables VII
List of Figures XIV
List of Plates XVI
CHAPTER 1. GENERAL INTRODUCTION 1 1.1. TAXONOMY 2 1.2. GEOGRAPHICAL DISTRIBUTION 4 1.3. HABITATS 6 1.4. POPULATION ECOLOGY 7 1.5. REPRODUCTIVE BIOLOGY 8 1.6. ECONIMIC IMPOTANCE 9 1.7. MOTIVATION OF THIS STUDY 9
CHAPTER 2. DESCRIPTION OF SITES AND 12 PHYSICO-CHEMICAL PARAMETERS OF TWO ROCKY SHORES ON KARACHI COAST, PAKISTAN
2.1. INTRODUCTION 13
2.2. MATERIALS AND METHODS 14
2.2.1. Study Sites 14 2.2.1.1. Manora 15
2.2.1.2. Buleji 16
2.2.2. Tidal zone 16 2.2.3. Tidal distribution of barnacles at Buleji and Manora 17 2.2.4. Sampling and measurement 18 2.2.5. Physico-chemical parameters 18 2.3. RESULTS 19
2.3.1. Physico-chemical parameters 19 2.3.1.1. Seawater temperature 19
2.3.1.2. Salinity 19
2.3.1.3. Dissolved Oxygen 19
2.3.1.4. Chlorophyll-a 20
2.3.1.5. Precipitation 20 2.4. DISCUSSION
CHAPTER 3. DNA BARCODING OF 30 MEGABALANUS TINIINNABULUM
3.1. INTRODUCTION 31
3.2. MATERIALS AND METHODS 32
3.2.1. Procedure for DNA sequencing 32
3.3. RESULTS 33
3.4. DISCUSSION 34
CHAPTER 4. POPULATION STRUCTURE OF 42 MEGABALANUS TINIINNABULUM ON TWO ROCKY SHORES OF KARACHI COAST, PAKISTAN
4.1. INTRODUCTION 43
4.2. MATERIALS AND METHODS 45
4.2.1. Sampling and measurements 45
4.2.2. Allometric analysis 46
4.2.3. Population structure 46
4.2.4. Growth parameters and growth performance index 47
4.3. RESULTS 48
4.3.1. Densities of Megabalanus tintinnabulum 48
4.3.2. Allometric analysis 48
4.3.3. Population structure 49
4.3.4. Recruitment 51
4.3.5. Growth parameters 51
4.3.6. Age and growth 51
4.4. DISCUSSION 52
CHAPTER 5. REPRODUCTIVE PATTERN OF 73 MEGABALANUS TINIINNABULUM ON TWO ROCKY SHORES OF KARACHI COAST, PAKISTAN
5.1. INTRODUCTION 74
5.2. MATERIALS AND METHODS 77
5.2.1. Sampling 78 5.2.2. Gametogenesis 78
5.2.3. Brooding capacity and brooding period 79
5.2.4. Biochemical analysis of tissue and ovaries during gonadal 79 maturation stages 5.3 RESULTS 80
5.3.1. Macroscopic features of gonad 80
5.3.2. Histological features of gonad 80
5.3.2.1. Oogenesis 80
5.3.2.2. Testes and seminal vesicle 81 81 5.3.3. Relationship between macroscopic stages and histological stages of ovarian development 82 5.3.4. Temporal variation in the stages of gonadal development 83 5.3.5. Brooding period and brooding capacity
5.3.6. Biochemical analysis of ovaries and soft tissue 84 84 5.3.6.1. Biochemical composition of ovaries and soft tissue during gonadal maturation 85 5.3.6.2. Seasonal variation in biochemical composition of the ovaries and soft tissue 85 5.4. DISCUSSION
CHAPTER 6. ABNDANCE OF CYPRID LARVA ON 110 COAST OF KARACHI, PAKISTAN
6.1. INTRODUCTION 111
6.2. MATERIAL AND METHODS 112 6.3. RESULTS 113
6.4. DISCUSSION 114
7. GENERAL DISCUSSION 121
8. REFERENCES 124
Table No. Page No. LIST OF TABLES
2.1. Abundance of animals on the rocky shore of Buleji and 22 Manora. Species present throughout the year and very abundant = ++++; Species present throughout the year but moderately abundant = +++; Species not present throughout the year and less abundant = ++; species rare = +; species absent = - (Ahmed & Hameed, 1999; Nasreen et al., 2000; Rahman and Bartaki, 2012; Siddique, S., 2014). 2.2. Distribution and abundance of barnacles in intertidal zones 23 atBuleji and Manora:LTZ, Low tidal zone; MTZ, Mid tidal zone; HTZ, High tidal zone; abundant (+++); less abundant (++); rare (+); absent (-)
3.1. The mtDNA COI bp sequences of Megabalanus 35 tintinnabulum amplified by PCR. (mtDNA COI sequence
of 678 bp gene fragment) 3.2. GenBank Accession numbers of Megabalanus species used 36 for phylogenetic analysis.
3.3. Estimates of Evolutionary Divergence between sequences. 37
4.1. Morphometric relationships between rostro-carinal 60 diameter (r-c diameter), height of the carina (HTC), height of the rostrum (HTR), total weight (TW) and tissue weight (TiW) of Megabalanus tintinnabulum population at Buleji (N= 905) and Manora (N = 875) 4.2. Size cohorts of Megabalanus tintinnabulum summarized 61 from Figure 4.3. at Buleji. SD - Standard deviation.
4.3. Size cohorts of Megabalanus tintinnabulum summarized from 63 Figure 4.4.at Manora. SD - Standard deviation. 4.4. The regression equations of the relationship between the 65 shell increment and the time in Megabalanus tintinnabulum at Buleji. Y is the r-c diameter, X is the number of months. 4.5. The regression equations of the relationship between the 65 shell increment and the time in Megabalanus tintinnabulum at Manora. Y is the r-c diameter, X is the number of months. 4.6. Calculated length (mm) of Megabalanus tintinnabulum at 66 various ages (years) at Buleji and Manora. 5.1. The macroscopic and histological appearance of the ovaries 93 in Megabalanus tintinnabulum. 5.2. The macroscopic and histological appearance of the testes 94 in Megabalanus tintinnabulum. 5.3. Pearson’s correlation between mature ovaries or mature 95 testes in M. tintinnabulum and temperature, salinity and chlorophyll- a at Buleji and Manora. *Correlation is significant at the 0.01 level. 5.4. Pearson’s correlation between brooding barnacles and 96 temperature, salinity and chlorophyll-a at Buleji and Manora. * Correlation is significant at the 0.01 level. 5.5. Mean length and width± SD and size range of embryos of 97 brooding Megabalanus tintinnabulum. 5.6. The minimum, maximum, average with standard deviation 98 concentrations of protein, carbohydrate and lipid in the ovaries during the gonadal maturation stages of Megabalanus tintinnabulum.
5.7. The minimum, maximum, average (with standard deviation) 98 concentrations of protein, carbohydrate and lipid in the tissue during the gonadal maturation stages of Megabalanus tintinnabulum. 5.8. Seasonal concentrations of protein, carbohydrate and lipid 99 in the ovaries and tissues of Megabalanus tintinnabulum. 6.1. Minimum, maximum and mean ± STD (µm) of carapace 118 length and depth of cyprid larvae in the plankton samples collected from Karachi coast during the period from September 2012 to December 2013. 6.2. Carapace length and height of cyprid larvae in present 119 studyand comparison to other studies. 6.3. Numeric abundance (number per m3) of cyprid larvae in 120 the samples during the period from September 2012 to December 2013.
Figure No. Page No. LIST OF FIGURES 2.1. Map showing the collection sites, Buleji and Manora on the 24
coast of Karachi. Inset: showing the coastline of Pakistan.
2.2. Monthly variations in temperature (º C) and salinity (ppt) on the rocky 25 ledges of Buleji and Manora from January 2012 to December 2013. 2.3. Monthly variations in dissolved oxygen (mg/L) and chlorophyll-a (µg/L) on 26 the rocky ledges of Buleji and Manora from January 2012 to December 2013. 2.4. Monthly precipitation (mm) at Karachi from January 2012 to December 27 2013. 3.1. Phylogenetic tree based on Maximum Likelihood (ML) of 38 COI sequence. 3.2. Phylogenetic tree based on Maximum Parsimony (MP) of COI sequence. 39 3.3. Phylogenetic tree based on neighbor-joining (NJ) of COI sequence. 40 4.1. Seasonal variation of Megabalanus tintinnabulum density 67 (mean ± standard deviation) in low tidal zone over the study period . 4.2. Monthly size-frequency histograms of Megablanus tintinnabulum at Buleji. 68 Curves shows estimated modal sizes. 4.3. Alphabets with years refer to cohorts. Analyses used the Bhattacharya 69 method by the FiSAT software. 4.4. Monthly size-frequency histograms of Megablanus tintinnabulum at 70 Manora. Curves shows estimated modal sizes. Alphabets with years refer to 4.5. cohorts. Analyses used the Bhattacharya method by the FiSAT software. 71 4.6. Size (Growth) cohorts of Megabalanus tintinnabulum at Buleji and Manora from January 2012 to December 2013. 72 5.1. Recruitment of Megabalanus tintinnabulum at Buleji from January 2012 to December 2013. 101 5.2. Growth curve of Megabalanus tintinnabulum at Buleji and Manora. 5.3. Monthly variations in the stages of ovaries maturation in Megabalanus 102 tintinnabulum and percentage of brooders at Buleji (A) and Manora (B) during the period from January 2012 to December 2013. S represent spring 103 and A is autumn. 5.4. Monthly variations in the stages of testes maturation in Megabalanus 104 tintinnabulum at Buleji (A) and Manora (B) during the period from January 2012 to December 2013. S represent spring and A is autumn. 5.5. Monthly variations in the stages of seminal vesicle in Megabalanus 105 tintinnabulum at Buleji (A) and Manora (B) during the period from January 2012 to December 2013. S represent spring and A is autumn.
Plate No. Page No. LIST OF PLATES
2.1. A view of Manora rocky shore 28
2.2. A view of Buleji rocky shore 29
3.1. Megabalanus tintinnabulum A. In situ view, a. top view, b. 41 side view; B. Line drawing of internal and external view of scutum (a) and tergum (b); C. Parieties structure of acorn barnaclse 5.1. Photomicrographs showing the ovaries of Megabalanus 105 tintinnabulum. A – Immature stage, B – Growing stage; C – Mature stage; D – Spent stage. Og-Oogonia; Pvo-Pre- vitellogenic oocytes; Evo-Early vitellogenic oocytes; Mo- Mature oocytes (late vitellogenic oocytes); Ro-Relict oocytes; Ct-Connective tissue. Scale = 100µm.
5.2. Photomicrographs showing the ovaries of Megabalanus 106 tintinnabulum. A – Growing stage, B – Mature stage. Evo- Early vitellogenic oocytes; Mo-Mature oocytes; Yg-Yolk globules. Scale = 50µm.
5.3. Photomicrographs showing the testes of Megabalanus 107 tintinnabulum. A & B – Immature stage, C – Growing stage; D – Mature stage. Sg-permatogonia; Sc-Spermatocytes; St- Spermatids; Sz-Spermatozoa; Ct-Connective tissue. Scales: A & C = 100µm; B & D = 50µm.
5.4. Photomicrographs showing the seminal vesicle of 108 Megabalanus tintinnabulum. A – Immature stage, B – Growing stage; C – Mature stage. Sz-Spermatozoa Scales: = 100µm.
5.5. Photomicrographs showing the embryos of brooding 109 Megabalanus tintinnabulum. A – Multicellular, B – The embryo with limb buds; C – The embryo with limbs and a naupliar eye. Scales: = 100µm.
CHAPTER 1
General Introduction
1.1. Taxonomy
At first barnacles were considered to be molluscs due to the presence of a calcareous shell (Linnaeus, 1785). However, later when the nauplius and cypris larval stages in the life cycle of barnacles were recognized they were classified as crustaceans
(Thompson, 1830) belonging to the subclass Cirripedia. According to Darwin's (1854) classification, the subclass Cirripediawas divided into three major orders: the Thoracica
(limbs in thethoracic position), the Abdominalia (limbs in the abdominal position) and the Apoda (no limbs). The order Thoracica (Darwin, 1854; Newman and Ross, 1976) which includes typical barnacles has three sub-orders: Lepadomorpha, Verrucomorpha and Balanomorpha (Darwin, 1854; Pilsbry, 1916). The Lepadomorphare stalked barnacles while Verrucomorph and Balanomorph are non-stalked.
The new systematic revisions based on morphology and molecular study considered the infraclass Cirripedia to fall under the Class Maxillopoda and subclass
Thecostraca (Grygier, 1987; Newman, 1987, 1992; Spears et al., 1994). Subclass
Thecostraca contains three infraclasses the Facetotecta, Ascothoracida, and Cirripedia
(Martin and Davis, 2001). The subclass Cirripedia included three superorders, namely,
Acrothoracica, Rhizocephala and Thoracica (Hoeg’s, 1992). The Thoracica divided into two orders: Pedunculata (Newman, 1996) and Sessilia (Newman, 1987; Buckeridge,
1995). In order Pedunculata are included sub-orders Heteralepadomorpha, Iblomorpha and Scalpellomorpha and in order Sessilia are included the sub-orders,
Brachylepadomorpha, Verrucomorpha and Balanomorpha. In stalked barnacles,
Pedunculata the body is divided into a peduncle or stalk by which the animal is attached to the substratum and a capitulum containing feeding appendages (cirri and mouthparts) and other organs. The capitulum and sometimes the peduncle are armored with characteristic calcareous plates. In Sessilia the peduncle is absent and the capitulum possesses calcareous shell made up of a number of plates or parietes and adheres directly to the substrate. The Verrucomorph barnacles possess asymmetrical parietes along the rostro-carinal axis and are more frequent in deep-waters while the Balanomorph commonly called acorn barnacles, possess symmetrical parietes along the rostro-carinal axis and majority of species are found along the shore. The Balanomorpha can be divided intoeight families the Catophragmidae, Chthamalidae, Coronulidae, Bathylasmatidae,
Tetraclitidae, Archaeobalanidae, Balanidae and Pyrgomatidae (Pilsbry, 1916; Newman and Ross, 1976; Palmer, 1982). Each family differs mainly in the number, arrangement and specialization of the plates (Newman and Ross, 1976; Barnes, 1982).
The Family Balanidae comprised of approximately 94 extant and 114 fossil known species. The Family Balanidae included three subfamilies, that is, Balaninae,
Megabalaninae and Concavinae and 16 genera (Pitombo, 2004). The focus of present study is Megabalanus tintinnabulum, a species of the family Balanidae and sub-family
Megabalaninae (Newman, 1979). Darwin (1854) started his systematic account of B. tintinnabulum and its 11 varieties with the remark that “This, the first species of Balanus, is, perhaps with the exception of B. amphitrite, the most difficult and variable in the genus." After that several authors (Pilsbry, 1916; Ross, 1968; Beach, 1972) reviewed the
Megabalanus under subgenera. In a major revision of the balanomorph hierarchy,
Newman and Ross (1976) elevated Megabalanus to generic rank. Newman (1979), while reviewing the genus Megabalanus, proposed that the species of subfamily
Megabalaninae possessed wall which is tubiferous, basis is calcareous and radii are well-developed; radii with transverse tubes between denticulate septa. Newman (1979) included those species under Megabalanus Hoek, 1913 which have regular secondary denticles on both upper and lower sides of the primary denticles of the septa. While the species which possessed irregular secondary denticles only on the lower side of the primary denticles were placed under genus Austromegabalanus Newman, 1979 and
Notomegabalanus Newman, 1979. The genus Megabalanus included 27 species and other two genera Austromegabalanus and Notomegabalanus included 5 and 4 species, respectively. The two genera Austromegabalanus and Notomegabalanus showed an austral distribution, while genus Megabalanus is warm-temperate waters (Egan and
Anderson, 1987). The classification of Megabalanus tintinnabulum is summarized below:
Phylum: Arthropoda
Subphylum: Crustacea Brunnich, 1772
Class: Maxillopoda Dahl, 1956
Subclass: Thecostraca Gruvel, 1905
Infraclass: Cirripedia Burmeister, 1834
Superorder: Thoracica Darwin, 1854
Order: Sessilia Lamarck, 1818
Suborder: Balanomorpha
Superfamily: Balanoidea
Family: Balanoidae
Subfamily: Megabalaninae
Genus: Megabalanus Species: Megabalanus tintinnabulum (Linnaeus, 1758)
1.2. Geographical Distribution
Species of Thoracica occur from the intertidal zones to the depths of the oceansthus covering nearly all marine environments. Some species may occur in estuaries but not found in fresh water. The diversity of barnacles is greatest in the tropical Indo-Pacific, followed by the northeast Pacific and then the North Atlantic
(Henry, 1940, 1942; Cornwall, 1951, 1955; Ross, 1962; Zullo, 1966).
Megabalanus tintinnabulum exact place of origin has been suggested on the western coast of Africa and the Indo-Pacific regions but now considered as cosmopolitan species and its distribution covers the whole of tropical waters of the Pacific, Atlantic and Indian oceans (Young, 1998). It has been reported as a major component of fouling communities on the eastern and western Indian coasts (Anil, 1986; Venugopalane et al.,
1990; Rajagopal, 1991). This species has spread to various countries through attachments on ship’s hulls, when first observed in 1764 on ships in the Netherlands. This species then spread along the Belgian coast and were recorded mainly from buoys in the late
1990. The species has also been reported from the Mediterranean Sea and Australia and because of their big size competes with indigenous barnacles (Jones, 1992; Thiyagarajan et al., 1997; Kerckhof and Cattrijsse, 2001; Kerckhof et al., 2007; WoRMS, 2015). In the
South China Sea, Megabalanus tintinnabulum and other acorn barnacles along with mollusc, were found to be the primary fouler of hulls and other structures made by man on the shores. The presence of barnacles also provided substratum for algae, hydrozoans and bryozoans for attachments (Yan et al., 2000). The vessels over their cruise tracks (port-by-port) have been reported to develop fouling communities but not studied extensively (Darwin, 1854; Pilsbry, 1916; Kerckhof et al., 2010; Carlton et al., 2011; Chapman et al., 2013). Darwin (1854) reported the settlement of barnacle species on the hull of a vessel moving between Africa and South
America (South Atlantic Ocean). In this voyage settlement of Megabalanus tintinnabulum on the ship was reported in Namibia, West African coast; followed by settlement of Austromegabalanus psittacus on first species in Patagonia. On the return to
England, a third layer consisting of M. tintinnabulum settled on the A. psittacus. Pilsbry
(1916) reported that in six months voyage in the Caribbean and its return to Cape Cod in
New England, the vessel showed settlement of 4 barnacle species, one of which was M. tintinnabulum. Similarly Kerckhof et al. (2010) described the settlement of four species of barnacle, including M. tintinnabulum on a ship travelling along the west coast of
Africa for several months.
1.3. Habitats
The barnacles inhabit a vast variety of habitats in the marine environment, but as compared to stalked barnacles which are confined to deeper waters, the acorn barnacles are common on the rocky intertidal shores and form distinct 'barnacle zone' on the shore. Some species are abundant on the high tidal zones; some in mid tidal zones and other prefer low tidal zones. These barnacles are considered as biofouling organism and create problems during aquaculture, replanting of mangroves in swamps, on the offshore support structures and ship transport (Rawangkul et al., 1995; Molnar et al., 2008; Holm, 2012). Fouling by barnacles may cause economic loss and therefore, research is under progress for its prevention (Feng et al., 2009; Petrone et al., 2011; Guo et al., 2012).
Megabalanus tintinnabulum is are part of the fouling community found at the low water mark and sub-tidally and inhabits the hulls of ship, jetties and other submerged structures constructed on the coasts and offshores
1.4. Population Ecology
The determination of the biological characteristics of a species is essential requirement for any ecological study. Basic knowledge of growth, mortality, recruitment and reproduction are invaluable in any analyses of the structure and dynamics of biological communities until the present study is continued with future investigations. The structure and dynamics of any community cannot be understood until the effects of environmental factors are considered. Barnacles are suitable for such studies because of ease of access to intertidal areas, their sessile nature and their abundancc (Villalobos, 1979: Grosberg, 1982;Denny, 1988; Johnson and Strathmann,
1989: Dve, 1992; Satchell and Farrell, 1993;Sanford et al., 1994; Bertness et al., 1996;
Raffaelli and Hawkins, 1996; Jenkins et al., 2000, 2001: Morgan, 2001; Chan,
2001,Connolly et al., 2001; Garbary, 2007: Little et al., 2009) Information on the life history of barnacle species can be obtained through studies on population dynamics and reproductive biology. Barnacles are one of the major space occupiers on the shore along most of the intertidal regions of the world (Stephenson and Stephenson, 1949;
Ballantine, 1961; Reimer, 1976; Underwood et al., 2000), therefore, studies have been conducted on their biology and life histories (see Southward, 1987 for a review), taxonomy (Southward and Newman, 2003), distribution (Benedetti-Cecchi et al., 2000; Jenkins et al., 2001: Range and Paula, 2001; Herbert et al., 2003: Southward et al.,2004; Litulo, 2007), settlement and recruitment (Jenkins et al., 2000), population dynamics (Connell, 1961a, b; Wethey, 1983; Gaines and Roughgarden, 1985; Bertness,
1989; Chanand Williams. 2004) and reproduction (O'Riordan et al., 1995; Herbert et al., 2003: Tunnicliffe and Southward, 2004; Davenport et al., 2005).
1.5. Reproductive Biology
In most of the crustaceans the sexes are separate, with the exception of few e.g., some barnacles and pandalid shrimps where hermaphroditism occurs (Conn, 1991).
Hermaphroditism can adopt different forms, such as, simultaneous hermaphroditism, when male and female gonads developed in adult animals and both are functionally active in the same individual. In sequential hermaphroditism, when only one sex is present and functionally active in an animal and later change to other sex and become active (Ghiselin, 1969; Stubbings, 1975; Walker, 1992; Southward, 1998). Most of the barnacles are simultaneous hermaphrodites and cross-fertilization is the preferred method for copulation (Bertness et al., 1991; Southward, 1998), though in some species self- fertilization may occur (Barnes and Crisp, 1956; Furman and Yule, 1990; El-Komi and
Kajihara, 1991). Some barnacle species may be dioecious and androdioecious, in which males are very small sized called as dwarf males (Yamaguchi et al., 2013).
The spermatozoa are formed in a pair of testes which are located into the cephalic region but may extend into the thorax. The ducts from the testes lead to the paired seminal vesicles which unite into a long penis behind the sixth pair of cirri. The penis is supplied with blood and can be protruded out of the body to enter into the mantle cavity of another barnacle for the deposition of sperm. The ovaries are paired and located in the walls of the mantle. From each ovary the oviduct arise which open at or near the bases of the first pair of cirri. The eggs are fertilized inside the brood chamber and embryos are incubated in two lamellar structures (ovigerous lamellae) or the mantle cavity from weeks to months (Gerhart et al., 1990; Buhl-Mortensen and Høeg, 2006). In the ovigerous lamellae or mantle cavity the embryos develop into the first naupliar stage
(Lee et al., 1999; O’Riordan and Murphy, 2000) and released in the water column.
Barnacle larva is comprised of two stages, the first is the nauplius, which is planktonic and while feeding and moulting change to the second stage. The second stage is called as cypris larva, which is non-feeding but strongly swimming. When the carapace form a shell, the cyprids settle down in an environment which is productive and safe, to metamorphosed into an adult looking barnacle. Therefore, the timing for the onset of reproduction in barnacles has been related to environmental factors such as temperature, food availability, photoperiod and salinity (Patel and Crisp, 1960; Barnes, 1963;
Fernando and Ramamoorthi, 1975; Hines, 1978; Page, 1984).
1.6. Economic importance
The market demand for many seafood products has resulted in an over exploitation of natural stocks and thus required an urgent need for diversifying marine products worldwide. There are about 12 species of barnacles which are commercially important, including the lepadomorph (stalked) barnacles, Pollicipes polymerus, P. pollicipes, P. elegans and Capitulum mitella and the balanomorph (acorn) barnacles,
Austromegabalanus psittacus, Balanus rostratus, B. nubilus, Tetraclita japonica, T. kuroshioensis, Megabalanus azoricus, M. rosa and M. tintinnabulum (Lopez et al.,
2010). The goose barnacles are traditionally more preferred for consumption and the world production amounted to 500 tonnes year-1, but none of them are cultured on a commercial scale. The harvest of 7 acorn barnacle species amounted to 200 tonnes year-1 per species (Lopez et al. 2010), but their culture is technically and economically feasible based on spat obtained from the wild and then grown in suspended systems (Bedecarratz et al., 2011).
1.7. Motivation of this study
The object of an ecological study is to describe the pattern and processes related to the distribution and abundance of an organism. A species may exist in one environment and may be absent in others. The existence of a species in a habitat depends on its arrival at the site, survival and reproduction, which in turn are dependent on the mechanisms of its dispersal and habitat selection, physio-chemical parameters tolerance, predation pressure and availability of food. Species of acorn barnacles, Chthamalus malayensis, Amphibalanus amphitrite, Tetraclita rufotincta and Megabalanus tintinnabulum are dominant inhabitant on exposed rocky shores of Pakistan (Haq et al.,
1978; Javed and Mustaquim, 1995; Rizvi and Moazzam, 2006). Despite the fact that the barnacle species are visually abundant on the rocky shores of Pakistan, the studies on the factors affecting their distribution, population dynamics and reproductive patterns, etc. are almost non-existent. Thus the object of present study was to ascertain the population dynamics and reproduction of the large-sized barnacle, Megabalanus tintinnabulum
(Linnaeus, 1758) and to compare their population dynamics on two rocky shores,
Manora and Buleji of Karachi. In literature studies on biology on barnacles, M. tintinnabulum are meagre. Sasikumar (1991) worked on some biological aspects of this species for his Ph. D. thesis. Naupliar stages of M. tintinnabulum have been described
(Daniel, 1958; Thiyagarajan et al., 1997). The present study includes:
Chapter 1. General Introduction
Chapter 2. The topography of two collection sites, that is, Manora and Buleji and the physico-chemical parameters experienced during the study period from January 2012 to
December 2013 at two sites are described. The tidal distribution of various barnacle species is also described.
Chapter 3.DNA barcoding of Megabalanus tintinnabulum.
Chapter 4. The population structure, age, growth and mortality of barnacle, Megabalanus tintinnabulum was described at two sites.
Chapter 5. The reproductive pattern based on macroscopic and microscopic examination of female and male gonad and the brooding season and brooding capacity in
Megabalanus tintinnabulum was studied. The correlation between brooding season and physico-chemical parameters (temperature, salinity and chlorophyll-a) was computed.
The maturation stages of gonads in marine invertebrates are often related to mobilization of the biochemical constituents between body tissue and gonads (Giese, 1959; Giese and
Pearse, 1974). An attempt has also been made to study the relationship of protein, carbohydrate and lipid concentrations between body tissue and ovaries.
Chapter 6.The abundance of cyprid larvae in the plankton samples was estimated in order to show relationship with brooding and recruitment patterns in the barnacle Megabalanus tintinnabulum. General Discussion. The general discussion and recommendations for future research are presented.
CHAPTER 2
Description of sites and physico-chemical parameters of two rocky shores on Karachi coast, Pakistan 2.1. Introduction
The term “vertical zonation” for barnacles is used as these animals are distributed vertically on the intertidal shore (Stephenson and Stephenson, 1972). The animals inhabiting the lower tidal zone are exposed to competition or predation (biotic factors), while the inhabitants of upper limit are exposed to particularly heat and desiccation
(physical factors) (Connell, 1961a). Lower limits of tidal levels provide favourable conditions for barnacle species, as longer immersions in the lower tidal zone prevent exposure to desiccation and a prolonged feeding time (Barnes, 1959; Achituv, 1972;
Hunt and Alexander, 1991). Due to above-mentioned factors, the sessile barnacles are inhabitant of lower tidal zone and are competed by other sessile organisms (Stanley and
Newman, 1980; Achituv, 1981; Paine, 1981). The distribution of barnacles in upper intertidal zone showed that these barnacles are more tolerant heat and desiccation
(Connell, 1961a; Foster, 1971a, b)
The distribution of barnacles along latitudinal gradients are affected by the oceanographic conditions, like, currents and upwelling (Connolly et al., 2001). The distribution and abundance of several barnacle species, Chthamalus challenger, C. malayensis, C. neglectus, Tetraclita squamosa, T. kuroshioensi, T. japonica japonica, T. japonica formosana and Megabalanus spp. were reported to vary along the latitudinal gradient from Japan, Taiwan to Hong Kong due to climatic conditions (Ren and Liu,
1979; Yamaguchi, 1973, 1987; Kado and Hirano, 1994; Hasegawa et al., 1996; Chan,
2001; Chan et al., 2007a, b).
Before the start of present study, a survey was conducted to examine the distribution of the barnacle population, on two shores, Buleji and Manora. Megabalanus tintinnabulum was chosen as model for this study as this species in the main space occupier in low tidal zone on the rocky shores of Karachi (personal observation;
Hameed, 1996; Kidwai and Ahmed, 2005; Hameed et al., 2005). This species has been reported to occur on rocky shores of Pakistan at or below low water mark and attached to submerged structures (Rizvi and Moazzam, 2006).
2.2. Materials and Methods 2.2.1. Study sites
The 1050 km long coastline of Pakistan bordering the Northern Arabian Sea, is further divisible into the Sindh (250 km) and the Balochistan (800 km) coasts. On its south-east lies the Indian border on the north-west is the Iranian border in (Figure 2.1.). Along the coast the summer (21° to 39° C) are warm and lengthy and winter (10° to 20° C) are mild and short with precipitation less than 250 mm annually prevails all along the coast of
Pakistan. The coast of Karachi situated at the south-eastern end of Pakistan coast, extends up to 135 km and is exposed to heavy pollution load of both domestic and industrial origins. The Layari and Malir rivers are the seasonal streams which flow into the sea. The domestic waste generated by a population (25 million) of Karachi and industrial wastes of about 1000 units are drained by Liayari River on the Eastern side of
Manora into the Manora channel. Therefore, most of the coastal pollution is concentrated in Manora Channel. Manora beach is situated on the western side of Liayari river from which it is separated by the protruded landmass, as a result of which the mixing of polluted beach sediments of Liayari to Manora beach are to a lesser extent.
Both Manora and Buleji are considered as moderately disturbed and polluted sites (Rahman and Barkati, 2004). Buleji is being listed as one of the most productive shore on the coast of Karachi (Saifullah, 1973; Ahmed and Hameed, 1999).
Like all rocky shores, the shores of Pakistan are inhabited by characteristics zonation pattern of organisms. In Pakistan, the information is available about the species diversity and their abundance on various rocky of Pakistan, including gastropods, echinoderms, crustaceans, seaweeds, cyanobateria, etc. (Qasim and Qari, 1988, 1994;
Siddiqui and Ahmed, 1991; Moazzam and Ahmed, 1994; Ahmed and Hameed, 1999;
Hameed and Ahmed, 1999; Nasreen et al., 2000; Bano and Siddiqui, 2003; Hameed et al., 2005; Ayub et al., 2006; Rehman and Barkati, 2012). Both Manora and Buleji rocky shores support the population of barnacle species, Megabalanus tintinnabulum,
Amphibalanus amphitrite, Tetraclita rufotincta and Chthamalus malayensis. The dominant molluscs on both shores are 4-5 species of Cerithium, Turbo coronatus and
Nerita albicilla. At Manora the gastropods, Tenguella granulate while at Buleji the small sized gastropod, Planaxis sulcatus are abundant. The species of Thais though found at both sites were comparatively higher at Manora. The bivalve Perna viridis was found abundantly in low tidal zone at Manora, while at Buleji it was rare. The hydrozoan colonies are equally abundant in low tidal zone at both sites. The echinoderms,
Holothuria arenicola are more abundant at Buleji than Manora while Echinometra mathaei are found only at Buleji. The abundant cyanobacteria at Buleji and Manora are
Oscillatoria sp. and Phormidium sp., while several seaweed species are abundant from
November to April on both shores (Table 2.1.).
2.2.1.1. Manora The rocky ledge of Manora (24°47'59.99" N, 66°57'59.99" E) is about one thousand meters long and two hundred meters wide (Figure 2.1. and Plate 2.1.). It is rocky cum sandy beach and the sandy beach lies above the rocky ledge in the supra tidal zone and is 30 m wide. The shore is gentle sloping shore and is under direct wave action.
Though shore is hard rocky type but in between plain surfaces are found. The high tidal zone of the ledge contain large sized boulders, while small sized boulders and rocky platforms are found in the mid and low tidal zones. In some parts of the ledge low profiled rocky overhangs and cave like shelters are found. Being an exposed shore it is completely submerged during high tide, but when the tide recedes, rock pools of various sizes and rocky cum sandy bottoms are visisble. The rocky beach of Manora is one of the most frequently visited site by local public and picnickers.
2.2.1.2. Buleji
The Buleji rocky ledge (24° 53' 36.16"N, 67° 1' 41.01"E) is gradually slopping triangular platform, protruding into the Arabian Sea (Figure 2.1. and Plate 2.2.). The ledge is divisible into an exposed and protected area. The exposed area is under direct wave action while the western sandy protected side is not under direct wave action. The exposed rocky beach consist of boulders of small and large sizes, coarse sandy substratum, rocky substratum and rock pools. Boulders of very large sizes are seen scattered mostly in the supratidal zone. There are deep narrow fissures and crevices produced as a result of gaping in the rock surface. The presence of these structures provides additional substratum to the animals. Buleji rocky ledge is a restricted site with no access to general public as is the other study site, Manora.
2.2.2. Tidal zone
There are 2 high and 2 low tides per day in the coast of Pakistan and the tidal range varies from 1.8 m to 3.2 m (Saifullah, 1973) and the tidal amplitude at Karachi ranges between -0.5 to 3.4 meters (annual tide tables). The shores were divided into low, mid and high tidal zones on the basis of tidal heights.
2.2.3. Tidal distribution of barnacles at Buleji and Manora
The two rocky shores Buleji and Manora were selected because the abundance of barnacles on these shores may be considered as good ‘representative’ of their population.
Secondly the two shores have easy access and located on the coast of Karachi.
Preliminary survey revealed that four species of barnacles, namely, Chthamalus malayensis Pilsbry, 1916, Amphibalanus amphitrite Darwin, 1854 Tetraclita rufotincta
Pilsbry, 1916 and Megabalanus tintinnabulum Linnaeus, 1758 occurred in the intertidal zone on the rocky shores of Manora and Buleji. The species of barnacles were identified based on the shell morphology following the literature of Rizvi and Moazzam (2006),
Chan et al. (2009) and Tsang et al. (2012). Megabalanus tintinnabulum are large-sized barnacles, T. rufotincta medium-sized, A. amphitrite are small-sized and Chthamalus malayensis are smallest in size. The distribution and abundance of these species varied with tidal height. These species have patchy distribution in the intertidal zone of shores.
Megabalanus tintinnabulum and A. amphitrite were limited from the mid tidal zone to low tidal zone. Tetraclita rufotincta was distributed in the whole of intertidal zone from the high to low tidal marks but is more common in the mid tidal zones, while Chthamalus malayensis occurred only in high tidal zone (Table 2.2.). Tetraclita rufotincta is the most abundant barnacle on two shores followed by M. tintinnabulum.
2.2.4. Sampling and measurements The sampling of barnacles, M. tintinnabulum were done each month from
January 2012 to December 2013. However, due to the strength of the sea, during June to
August in both years, comparatively fewer specimens were collected. A 100 m stretch parallel to sea was selected for sampling and barnacles were collected each month from the same area at low tides (-0.1 to -0.5 m tide). The sampling was done with the help of
50×50 cm quadrat being placed after every ten meter on the selected stretch. For density comparison similar quadrats were placed in the mid tidal zone and the density of M. tintinnabulum was counted. Approximately 150 randomly selected barnacles were measured for the basal rostro-carinal diameter (r-c diameter) using vernier calipers (± 0.1 mm) and fifty of them were collected and brought to the laboratory. The shells in the laboratory were measured again for rostral height, carinal height and the basal rostro- carinal diameter (r-c diameter) to the nearest ± 0.1 mm using Vernier caliper. Total weight of shell with tissue (TW) and wet weight of tissue (WW) was noted to the nearest
± 0.01 gm.
2.2.5. Physico-chemical parameters
The physical and chemical parameters were analyzed throughout the sampling period from January 2012 to December 2013. Temperature and salinity were measured in the field with the aid of thermometer and handheld refractometer (Atago, S/Mill-E). For estimation of dissolved oxygen the water sample was fixed by adding KI and KMnO4 in glass stoppered bottles and later analyzed by Winkler method (Parsons et al., 1984). The chlorophyll-a was measured with the help of spectrophotometer (Model S-20, Boeco-
Germany) after filtering the water samples through glass fiber and extracted in 90% acetone (Parsons et al., 1984). The precipitation data was obtained from the Pakistan
Meteorological Department.
2.3. Results 2.3.1. Physico-chemical parameters 2.3.1.1. Seawater temperature Karachi has two main seasons; summer (May to September) and winter
(November to February), with two transitions period, spring (March to April) and autumn (October). The seawater temperature at Buleji and Manora showed a clear seasonal pattern ranging from 20 to 24º C during November to February (winter) followed by an increase of water temperature (28-32º C) form March to October (Figure
2.2.). The water temperature did not differ significantly (paired t-test: t=1.856; df =23;
P=0.076) between two sites.
2.3.1.2. Salinity The level of precipitation is low for most of the year at Karachi with the result that the flow of perennial rivers is also scanty, therefore, the salinity in the coastal waters do not vary much. The salinity varied between 37 to 45 ppt at Buleji and between 37 to
42 ppt at Manora during the study period (Figure 2.2.). The salinity did not differ significantly (paired t-test: t= -0.499; df =23; P=0.622) between two sites.
2.3.1.3. Dissolved Oxygen The concentration of dissolved oxygen varied from 2.3 to 4.2 mg L-1 at Buleji and
3.0 to 6.0 mg L-1 at Manora (Figure 2.3.). The dissolved oxygen was higher in winter months (December to February) as compared to summer, spring and autumn. The water dissolved oxygen did not differ significantly (paired t-test: t= -4.144; df =23; P=0.001) between two sites.
2.3.1.4. Chlorophyll-a The concentration of chlorophyll-a varied from 3.0 to 5.4 µg L-1 at Buleji and from 3.4 to 6.5 µg L-1 at Manora (Figure 2.3.). The chlorophyll-a was comparatively higher during November to February period (winter) than summer. The chlorophyll-a did not differ significantly There was significant difference in chlorophyll-a (paired t-test: t=
-2.198; df =23; P=0.038) between two sites.
2.3.1.5. Precipitation The rainfall during most of the study period was either absent or almost negligible (traces) being highest 121.0 mm and 105.4 mm in September 2012 and August
2013, respectively (Figure 2.4.).
2.4. Discussion
The physico-chemical parameters, that is, temperature, salinity, dissolved oxygen and chlorophyll-a were recorded during the study period from January 2012 to December
2013. At both sites, the seawater temperature showed an increase during March-April period with the higher temperature (31-32° C) recorded during June-September. The seawater temperature was comparatively lower in winter (20-24° C). The salinity in the area did not vary much at two sites because both are typical oceanic sites exposed to strong winds and waves and at such sites salinity are maintained at a high level and fluctuate less.
Concentrations of chlorophyll-a in seawater is a convenient estimate to show the quantity of phytoplankton in seawater (Parsons et al., 1984). In this study, concentrations of chlorophyll-a showed some seasonality at both sites being higher in winter than in summer. The chlorophyll-a concentrations are normally <2 mg m-3 in tropical waters while in local waters, the concentrations of chlorophyll-a >10 mg m-3 is considered an indication of nutrient enrichment (To-yan, 2003), In the present study concentrations of chlorophyll-a varied between 3.0 to 6.5 µg L-1 at study sites indicating a moderate nutrient enrichment in our waters. The dissolved oxygen is generally related to temperature and salinity and is said to be higher in winter than summer. In present study the concentration of dissolved oxygen was higher in winter than in summer at both sites.
The high oxygen values indicated the increased photosynthetic activities which is evident from the fact that there was a correlation between concentrations of dissolved oxygen and chlorophyll-a concentration at both sites.
Balochistan Afghanistan 40´ Pakistan
Pakistan North Arabian Sea 30´ Iran India North Arabian Sea Karachi 20´ Northern Arabian Sea North Arabian Sea N N 10´ Sindh Buleji 25º Manora ^40 Channel km
20´ 30´ 40´ 50´ 67º 10´ 20´
Figure 2.1. Map showing the collection sites, Buleji and Manora on the coast of Karachi. Inset: showing the coastline of Pakistan.
Table 2.1. Abundance of animals on the rocky shore of Buleji and Manora. Species present throughout the year and very abundant = ++++; Species present throughout the year but moderately abundant = +++; Species not present throughout the year and less abundant = ++; species rare = +; species absent = - (Ahmed & Hameed, 1999; Nasreen et al., 2000; Rahman and Bartaki, 2012; Siddique, S., 2014).
Species Buleji Manora Molluscs Cerithium spp. ++++ ++++ Turbo coronatus ++++ +++ Nerita albicilla +++ +++ Monodonta canalifera ++ + Tenguella granulata ++ ++++ Planaxis sulcatus ++++ + Thais spp. ++ +++ Cellana karachiensis ++++ ++ Perna viridis + ++++ Hydrozoan colonies ++++ ++++ Echinoderms Holothuria arenicola ++++ +++ Echinometra mathaei +++ - Cyanobacteria Oscillatoria sp. ++ ++ Phormidium sp. ++ ++
Table 2.2. Distribution and abundance of barnacles in intertidal zones at Buleji and Manora: LTZ, Low tidal zone; MTZ, Mid tidal zone; HTZ, High tidal zone; abundant (+++); less abundant (++); rare (+); absent (-)
Species Buleji Manora LTZ MTZ HTZ LTZ MTZ HTZ Chthamalus malayensis - - ++ - - ++ Tetraclita rufotincta + +++ ++ + +++ ++ Amphibalanus amphitrite + ++ - + ++ - Megabalanus +++ + - +++ + - tintinnabulum
CHAPTER 3
DNA Barcoding of Megabalanus tintinnabulum 3.1. Introduction Barnacles are very common invasive species and thus once introduced into a new location, the identification of such species is often difficult particularly due to the unknown geographic origin (Cohen et al., 2014). The identification is difficult due to poor taxonomic information and variation in characters used to identify species (Henry et al., 1986, Cohen et al., 2014). The variability in characters may reflect the genetic differences or may also result due to environmental impacts at different range of distribution. Several types of molecular techniques have been developed for identification and discrimination of species. DNA barcoding is one such useful tool which in recent years has been commonly utilized for identification of species based on the analysis of short and standardized gene sequences. It has been extensively used to distinguish between cryptic species and now the taxonomic studies are supported by use of genetic data to support their results (Hebert et al., 2004; Hebert and Gregory, 2005). In most of the animals, the DNA barcoding approach based on the fragment of mitochondrial gene cytochrome c oxidase subunit I (COI) has been used (Hebert et al.,
2003; Radulovici et al., 2010; Bucklin et al., 2011). For barnacles, number of studies applied cytochrome c oxidase I (COI) for the identification of species and to clarify the intraspecific patterns of variability (e.g. Chan et al., 2007a, b; Tsang et al. 2008; Tsang et al., 2012; Chen et al., 2013). The other approach utilized are DNA sequences of the mitochondrial 12S rRNA (e.g. Appelbaum et al., 2002; Chan et al., 2007a, b), first internal transcribed spacer (ITS1) of nuclear rRNA (Chan et al., 2007a, b) or even Inter
Simple Sequence Repeats (ISSRs) (Pannacciulli et al., 2009). In the present study the barnacles Megabalanus tintinnabulum was identified based on the shell morphology (Rizvi and Moazzam, 2006; Chan et al., 2009; Tsang et al., 2012). Although morphological characters were clear to aid in identification, such as, parietes cylindrical to conical in shape, parietes without spines, smooth to roughened with darker lighter longitudinal striae, colour pale purple, pinkish purple or purple, surface smooth with lighter and darker stripes, radii wide, scutum triangular in shape, exterior of scutum clearly marked by longitudinal striae, inner surface with conspicuous articular ridge, tergum triangular, spur long and moderately broad, external surface with median furrow (Plate 3.1.). However, an attempt has been made to confirm the identification of M. tintinnabulum found in Pakistan by using DNA barcoding approach based on the fragment of mitochondrial gene cytochrome c oxidase subunit I (COI).
3.2. Materials and Methods
3.2.1. Procedure for DNA sequencing
The specimens of barnacle, Megabalanus tintinnabulum (n=4) from Buleji,
Karachi were collected and preserved in 95% ethyl alcohol following the standard procedure at the site. The samples were transported to the laboratory and placed in the refrigerator until further investigation. Total genomic DNA was isolated from muscle tissues using salting out method, extracted DNA was electrophoresed and concentrated
DNA was further diluted with DEPC water to reach working concentration (20ng/µl) for
PCR reactions. A fragment of CO1 gene was amplified by PCR using universal primers LCO1490
(5'-GGTCAACAAATCATAAAGATATTGG-3') and HCO2198 (5'-
TAAACTTCAGGGTGACCAAAAAATCA-3') (Folmer et al., 1994). The PCR mixture consisted of 0.2µM of each primer, 5.0µL of 10XTaq Plus polymerase buffer, 0.2mM of dNTPs, 2 units of Taq Plus DNA polymerase, and 1 µL of DNA template. The PCR conditions were as follows: denaturation at 94º C for 5 min, 35 cycles each of denaturation at 94º C for 30 seconds, annealing at 55º C for 30 seconds, and extension at
72º C for 30 seconds, and the final extension at 72º C for 10 min. The PCR products were electrophoresed on a 1.2% agarose gel to check integrity, and visualized, using
Molecular Imager Gel Doc XR system (Bio-Rad, USA). The PCR products were sequenced using ABI 3730 automated sequencer for which the same PCR primers were used. The DNA sequences were aligned using CLUSTALW and sequence composition was estimated using software MEGA 6 (Tamura et al., 2013). The phylogenetic tree was constructed to evaluate genetic relationship between the populations using MEGA 6
(Tamura et al., 2013).
3.3. Results
A fragment of 678 bp CO1 gene was amplified in M. tintinnabulum, the sequence is shown in Table 3.1. The obtained M. tintinnabulum sequence was conformed using
Nucleotide blast (BLASTN) program in the GenBank database
(www.ncbi.nih.nlm.gov/BLAST). The blast results testified our morphological identifications of the barnacle species being M. tintinnabulum. For construction of a phylogentic tree the other sister species sequences were retrieved from GenBank and their accession numbers are given in Table 3.2. The Maximum Likelihood (ML),
Maximum Parsimony (MP) and Neighbor-Joining (NJ) analyses supported an association between M. tintinnabulum Pakistan with M. tintinnabulum China and M. tintinnabulum
Taiwan (Figures 3.1. to 3.3). In general the phylogenetic tree of ML, NJ and MP denoted four lineages, the first lineage comprised of M. ajax, M. azoricus and M. occator. The second lineage comprised of Megabalanus tintinnabulum reported from Pakistan, China and Taiwan. The third lineage indicated M. rosa and Megabalanus sp and the fourth lineage included M. coccopoma, M. concinnus and M. zebra (Figures 3.1. to 3.3). The genetic distance between M. coccopoma, M. concinnus M. zebra, Megabalanus sp., M. ajax, M. azoricus, M. tintinnabulum, M. occator and M. rosa are provided in Table 3.3.
The COI sequences of M. tintinnabulum were 15.6-20.5% different from other species of
Megabalanus published COI data.
3.4. Discusssion
Megabalanus tintinabulum is the only species of Megabalanus to occur on the coast Pakistan (Rizvi and Moazzam, 2006). This study is the first to identify and confirm this species at the molecular level on the coast of Karachi. The COI barcoding was implemented to compare sequences with other species of the same genus. Using sequences posted in the GenBank database, it was possible to show that the sequence for the studied species (M. tintinnabulum) matches with M. tintinnabulum from China and
Taiwan. The divergence for COI is typically under 3% among individuals of the same
Megabalanus species (Cohen et al., 2014), while in present study it was < 1% (Table
3.3.). As M. tintinnabulum has been reported to occur all along the coast of Pakistan (Rizvi and Moazzam, 2006), the samples should be procured to identify if same species,
M. tintinnabulum only exists or other species of Megabalanus are also found on coasts of
Pakistan as 26 species of Megabalanus have been described (Henry and McLaughlin,
1986).
Figure 3.1. Phylogenetic tree based on Maximum Likelihood (ML) of COI sequence.
Table 3.1. The mtDNA COI bp sequences of Megabalanus tintinnabulum amplified by
PCR. (mtDNA COI sequence of 678 bp gene fragment)
TACTTTTGGAGCTTGATCAGCCATGGTTGGAACAGCTCTTAGAATACTAATTCGAGCCGAATTAGG GCAACCTGGAAGTCTAATCGGAGATGACCAAATTTACAATGTAATTGTTACAGCCCACGCTTTCAT TATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTCGGAAACTGACTTCTACCACTCATA TTGGGAGCCCCAGATATGGCATTCCCTCGTCTTAATAACATAAGTTTCTGACTTCTTCCCCCAGCC TTAATACTTCTAATTAGAGGTTCTCTCGTAGAAGCGGGGGCAGGAACAGGATGAACTGTATACCCC CCTTTATCAAGTAATATCGCCCATTCAGGTGCTTCCGTAGACTTATCAATTTTTTCTCTACATCTTG CAGGGGCATCATCAATTTTAGGTGCTATTAATTTTATATCCACTGTAATTAACATACGAGCAGAAA CTTTAACATTTGACCGTTTACCTTTATTTGTATGAAGAGTTTTTATTACTGTGATCTTACTTTTACTC TCCCTACCTGTTTTAGCAGGAGCAATTACAATACTATTAACAGATCGTAATTTAAATACCTCATTCT TTGATCCTACAGGAGGAGGGGACCCTATTCTATATCAACATTTATTCTGATTTTTTGGCACCCCGG GAAATTTAAAAAT
Figure 3.2. Phylogenetic tree based on Maximum Parsimony (MP) of COI sequence.
Table 3.2. GenBank Accession numbers of Megabalanus species used for phylogenetic analysis.
NCBI S # Name of Species bp length References Accession No.
1. Megabalanus ajax KF501046 1540 bp Chan et al (2009)
2. Megabalanus azoricus KM575951 658 bp Chan et al (2013)
3. Megabalanus coccopoma HG970519 599 bp Chan et al (2009)
4. Megabalanus concinnus KJ769119 678 bp Chan et al (2013)
5. Megabalanus occator KC138484 642 bp Chan et al (2009)
6. Megabalanus rosa JX503004 658 bp Chan et al (2009)
7. Megabalanus sp KU204249 665 bp Chan et al (2009)
8. Megabalanus zebra KX538961 656 bp Chan et al (2009)
9. Megabalanus tintinnabulum from China JQ035527 653 bp Chan et al (2012)
Megabalanus tintinnabulum from Taiwan 10. KC138488 642 bp Chan et al (2009) Megabalanus tintinnabulum from Pakistan 11. Present study 656 bp Present study
Figure 3.3. Phylogenetic tree based on neighbor-joining (NJ) of COI sequence.
Table 3.3. Estimates of Evolutionary Divergence between sequences.
Species 1 2 3 4 5 6 7 8 9 10 11 1. Megabalanus ajax ------2. Megabalanus azoricus 0.166 ------3. Megabalanus coccopoma 0.238 0.217 ------4. Megabalanus concinnus 0.205 0.175 0.154 ------5. Megabalanus occator 0.178 0.194 0.206 0.201 ------6. Megabalanus rosa 0.198 0.174 0.145 0.108 0.193 ------7. Megabalanus sp 0.193 0.176 0.146 0.130 0.164 0.060 ------8. Megabalanus tintinnabulum from China 0.156 0.187 0.203 0.158 0.171 0.159 0.159 ------9. Megabalanus tintinnabulum from Pakistan 0.163 0.187 0.205 0.160 0.164 0.162 0.161 0.007 ------10. Megabalanus tintinnabulum from Taiwan 0.160 0.182 0.201 0.156 0.173 0.159 0.159 0.008 0.008 ------11. Megabalanus zebra 0.198 0.160 0.142 0.111 0.188 0.110 0.118 0.175 0.175 0.170 - - -
CHAPTER 4
Population dynamics of Megabalanus tintinnabulum on two rocky shores of Karachi coast, Pakistan 4.1. Introduction
Barnacles play an important role in the community dynamics of intertidal rocky shores as being prey for predators, provides habitat for many organisms and aids in the establishment of successional species, for example mussels (Connell, 1961a; Paine,
1966; Menge, 1976). There are several biotic factors that affect the population structure of the barnacles on the shore, such as, competition (Menge, 1976, 2000; Grant, 1977;
Leonard, 2000; Buschbaum, 2001; Kent et al., 2003), predation (Connell, 1961a, b;
Bertness, 1989), and mutualism and commensalism (Raimondi, 1988; Bertness, 1989;
Bertness et al., 1998; Barnes, 1999; Buschbaum, 2001; Holmes et al., 2005).
The population structure of a species is regulated by a balance of inputs
(immigration and birth) and losses (death and emigration) to the population (Begon et al.,
1996). If the population of any species increases, it showed that the birth and immigration being greater than the death and emigration and vice versa. In populations of barnacle the recruitment of larvae can be from other shores (immigration) and from the same shore (birth) and this recruitment is sensitive to climatic and hydrographic changes (Southward and Crisp, 1954, 1956). For example it was reported from Britain that Chthamalus stellatus exhibited great variation in recruitment between years as a result of climatic and hydrographic changes, with the result that some shores had no recruitment for long periods and population sizes to drop (Southward and Crisp, 1954,
1956). However, in barnacles the effect of emigration is non-existent as they are sessile organisms (Darwin, 1854; Rainbow, 1984) therefore, their populations are reduced due to mortality, which is often caused by physical stress and predation (Connell, 1961b; Minchinton and Scheibling, 1991; Caroll, 1996; Hunt and Scheibling, 1997; Morgan,
2001).
The life cycle of barnacles consist of two phases, first a planktonic larva and second sessile phase after settlement. The distribution and abundance of the barnacles depend on the larval supply, their settlement, mortality after settlement and finally recruitment in the adult barnacle population (Jenkins et al., 2001; Morgan, 2001). The settlement and recruitment are dependent on density and under the influence of climatic and hydrographic changes (Southward and Crisp, 1954, 1956). The other factors which may influence the populations parameters of barnacles are the supply of food with the water flow and availability of space for the settlement (Gaines and Roughgarden, 1985;
Roughgarden et al., 1985; Bertness et al., 1991; Minchinton and Scheibling, 1993;
Sanford et al., 1994).
Studies were conducted on the spatial and temporal variations in settlement and recruitment of barnacles and the impacts of such variations to adult populations
(Hawkins and Hartnoll, 1982; Caffey, 1985; Kendall et al., 1985; Pineda, 1994; Carroll,
1996). Comparatively, fewer studies have been conducted on the spatial variability in adult population dynamics (Bertness et al., 1991; Hyder et al., 1998; Benedetti-Cecchi et al., 2000).
The life history parameters of intertidal invertebrates were reported to vary inter- and intra-specifically due to genetic differences and environmental influences (Bowman and Lewis, 1986). Studies revealed that the population structure of same species differed between shores due to intra- and inter-specific competition and availability of food
(Fletcher, 1987; Bosman and Hockey, 1988). Temporal and spatial variations have been reported to exist in population dynamics and density of barnacles (Carroll, 1996; Jenkins et al., 2000). The variations in the abundance of two barnacle species, Tetraclita squamosa and T. japonica between shores in Hong Kong were related to variability in pattern of settlement, mortality after settlement and finally recruitment (Chan, 2001). In the present study the hypothesis that the life history parameters of same species may vary between shores was considered and thus a comparison was made between the population dynamics and reproduction of barnacle, Megabalanus tintinnabulum on two rocky shores, Manora and Buleji off Karachi, Pakistan.
4.2. Materials and Methods 4.2.1. Sampling and measurements In the preliminary survey it was observed that the barnacle, Megabalanus tintinnabulum was found in the mid stretch of the shores at Buleji and Manora. Samples of barnacles were collected each month during January 2012 to December 2013, except from June to August in both years, when the adverse sea condition allowed the collection of fewer specimens. On both sites, a 100 m stretch on the shoreline was selected for the sampling and the sampling was done from the same area every month on lowest tides. At each shore, ten 50×50 cm quadrats were randomly selected in the mid and low tidal zones and the density of M. tintinnabulum was counted within these quadrats. The higher densities and most persistent populations occur in the low tidal zone, therefore, the study was focused in the low zones of the intertidal shore at Buleji and Manora. The r-c diameter (rostro-carinal diameter) of approximately 150 barnacles was measured with vernier caliper to the nearest ± 0.1 mm. Each month fifty individuals were removed with the help of chisel and hammer and were brought to the laboratory. A total of 2679 individuals of M. tintinnabulum were measured for their basal rostro-carinal diameter (r- c diameter) and 905 were brought to laboratory for further study. From Manora 2476 individuals of same species were measured and 875 brought to laboratory for further study. The shells in the laboratory were measured for rostral height (HTR), carinal height
(HTC) and r-c diameter to the nearest ± 0.1 mm using vernier caliper. Total weight of animal (TW) and wet weight of tissue (TiW) was noted to the nearest ± 0.01 gm.
4.2.2. Allometric analysis
The relationship between two different variables (lengths and weights) is commonly described by the allometric power equation W = aLb, where W is the total weight (g), L is the length (mm), a is the intercept and b is the slope. The linear regression analysis was applied to estimate a and b values from the log10 transformed values of lengths and weights, that is, Log10 Y = a + b Log10 X (Zar, 1999).
Furthermore, relationships were estimated for: length/ tissue weight, length/ carinal height, length/rostral height, rostral height/ carina height. The coefficient of determination (r2) was used as an indicator of the quality of the linear regression. The estimated b values were compared from the isometric value (b = 1 or b = 3) at a significance level of 0.05 by Student’s t-tests.
4.2.3. Population structure
Von Bertalanffy growth function predicts length as a function of age and commonly used in growth analysis of shelled animals (Maronas et al., 2003; Fiori and
Morsan 2004; Peharda et al., 2007). The data on r-c diameter were grouped into 2 mm size-classes for the analysis of population structure of M. tintinnabulum by using Modal
Progression Analysis (Gayanilo et al., 2005). The cohorts were separated by using Bhattacharya’s method (Bhattacharya, 1967) with the aid of FiSAT software (Sparre and
Venema, 1998). The software FiSAT has now been extensively used for growth analysis of bivalves, gastropod and barnacles (To-yan 2003; Cob et al., 2008; Iwasaki and
Yamamoto 2014; Sousa et al., 2017).
For comparison of the growth of the various cohorts, regression lines were fitted to the growth curves. Variations in r-c diameter of barnacle populations at two sites were compared by t-tests.
4.2.4. Growth parameters and growth performance index The size frequency data was used to estimate the theoretical growth parameters, K and L∞ by using ELEFAN I (Sparre and Venema, 1998). The values of K and L∞ were utilized to estimate the growth performance index (ϕ’) (Pauly and Munro, 1984) through the equation: ϕ’ = 2 log10L∞ + log10K.
The length at any age in fish and invertebrates can be calculated by using Von
Bertalanffy equation (Bertalanffy, 1938): Lt = L∞ [1 – e - K (t – to)] where
Lt is the length at age t, L∞ is the asymptotic length or maximum theoretical length of barnacle, K is the growth coefficient (the rate of growth of barnacle to its maximum size), and t0 the theoretical age at length 0 . t0 can be calculated using the K and L∞ values (Lopez Veiga, 1979) by the formula: t0 = 1/K * ln [(L∞ - Lc)/L∞] where K is the growth coefficient, L∞ is the asymptotic length, and Lc is the length at age t = 0 or length of recruits.
The potential longevity (A0.95) was estimated as A0.95 = t0 + 2.996/K ((Taylor,
1968; Pauly and David, 1981).
The instantaneous natural mortality coefficient (M) was calculated by equation described by Pauly (1980): Log M = -0.0066 - 0.279 (log10 L ∞) + 0.6543 (log10 K) + 0.4634 (log10 T) where K = growth coefficient (year−1)
L∞ = asymptotic length (mm)
T = annual mean temperature in the habitat (ºC).
4.3. Results
4.3.1. Densities of M. tintinnabulum
In the low tidal zone, the average density of M. tintinnabulum was higher at
Buleji (101.9 ± 15.02 individual m-2) than Manora (76.0 ± 8.05 individual m-2). At Buleji density was higher in March and April’12 with 117.0 and 125.5 individual m-2, respectively (Figure 3.1.). There was an additional peak in October and November in the same year. Almost the same trend was recorded with higher density in March to April and October to November in the year 2013 (Figure 4.1.). At Manora, the average density was higher in March and April of both years, 2012 and 2013 (Figure 4.1.). The density of barnacles was significantly higher at Buleji than Manora (F= 41.58, P<0.001) in the low tidal zones. There was no significant difference in the density of M. tintinnabulum during years 2012 and 2013 at Buleji (F= 0.002, P= 0.964) and Manora (F= 0.018, P= 0.896).
The densities of barnacles were very low in the mid tidal zones with 2.5 to 4.2 individuals m-2 at Buleji and 2.0 to 4.0 individuals m-2 at Manora during the study period.
4.3.2. Allometric analysis Length-length relationships and the coefficient of determination r2 are given in
Table 4.1. The barnacles at Buleji and Manora showed a positive allometric growth for-r- c diameter and rostral height and r-c diameter and carinal height, that is, heights increased faster than the r-c diameter. For the length weight relationship, the growth coefficient obtained for M. tintinnabulum was 0.655. The r-c diameter and total weight relationship showed negative allometry at both sites. T-test showed that the b value deviated significantly from the theoretical value of b = 3 (Table 4.1.).
4.3.3. Population structure The monthly size-frequency histograms were polymodal in distribution with two modal classes in most of the month at Buleji. In January’12, the population of M. tintinnabulum at Buleji comprised of two cohorts, cohort-A and B with mean r-c diameter of 38.68 mm and 23.54 mm, respectively. The cohort-A disappeared from population in May’12 ((Table 4.2. & Figure 4.2.). From January to March'12, the population comprised of two cohorts while in April’12, a small, thin population occurred
(cohort-C, approx. 13 individuals) making the population structure tri-modal ((Table 4.2.
& Figure 4.2.)). From May to October’12 the population structure of M. tintinnabulum at
Buleji was bimodal and no new cohort was observed during this period. Cohort-B remained in the population till December’12 and then disappeared in next month. The cohort-C which appeared in April’12 with mean r-c diameter of 9.04 mm disappeared from the population in May’13 and attained growth of 30.90 mm during 13 months.
From May to October’12, the population structure of M. tintinnabulum was bi-modal and no new cohort was observed. In November’12 a new settlement, cohort-D (mean r-c diameter of 20.50 mm, approx. 20 individuals) occurred which could be recognized till
October’13. In March’13, cohort-E (mean r-c diameter of 16.07 mm) occurred in the population and remained in the population till the end of study period, December’13. A small settlement joined the population as cohort-F in September’13 with mean r-c diameter of 11.83 mm (Table 4.2. & Figure 4.2.).
The monthly size-frequency histograms were polymodal in distribution with three modal classes in most of the month at Manora. In January’12, the population of M. tintinnabulum at Manora comprised of three cohorts, the cohort-A (mean r-c diameter
36.18 mm) and cohort-B (mean r-c diameter 18.94 mm) while third cohort reached to maximum length of 44.50 mm and disappeared from the population in February’ 12
(Table 4.3. & Figure 4.3). The cohort-A disappeared in the period of June-August’12 and cohort-B in November’12. A small, thin population occurred (cohort-C, approx. 22 individuals) with mean r-c diameter of 17.77 mm in March’12 and disappeared in
December’12. In 9 months, cohort-C attained a growth of 23.66 mm, that is, 2.96 mm per month. The cohort-D appeared in September’12 with r-c diameter of 20.50 mm and then appeared to merge with older cohorts in December’12. The cohort-E and cohort-F with mean r-c diameter of 20.50 mm and 17.83 mm appeared in November and
December’12, respectively. The cohort-E and cohort-F attained growth of 10.31 mm and
12.21 mm in 3 and 5 months, respectively after which these two cohorts appeared to merge with older cohorts. Two small settlements joined the population as cohort-G
(approx. 25 individuals) and cohort-H (approx. 27 individuals) in May’13 and
September’13, respectively and remained in the population till end of study,
December’13 (Table 4.3. & Figure 4.3).
For comparison of the growth of various cohorts (Figure 4.4.) regression lines were fitted to the growth curves (Tables 4.4. & 4.5.). Different cohorts at Buleji and
Manora showed different growth rates, such as, cohort-B grew at a rate of 1.54 mm/month at Buleji while the same cohort-B grew at a rate 2.1 mm/month at Manora.
The cohort-C grew with almost the same rates, that is, 2.75 mm/month and 2.92 mm/month at Buleji and Manora respectively (Tables 4.4. & 4.5.).
4.3.4. Recruitment
The smallest sized individuals of M. tintinnabulum were of diameter 8 mm at
Buleji which were considered as recruits. Based on this size the recruitment at Buleji was observed in April to May and September in the year 2012 and again during March to
May and September in the year 2013 (Figure 4.5.). At Manora the smallest sized individuals were of 14 mm, therefore, recruitment cannot be estimated.
4.3.5. Growth parameters
The growth coefficient (K) of VBGF was 0.44 year−1 with asymptotic length
(L∞) of 51.98 mm for M. tintinnabulum at Buleji while the K value was 0.63 year−1 with
L∞ of 51.98 mm at Manora. The growth performance index (ϕ) were 2.718 and 3.030 at
Buleji and Manora, respectively.
4.3.6. Age and growth
In the age and growth analysis of Von Bertalanffy growth equation, t0 is assumed to be zero, but in the present study lengthy of recruits (t0) was estimated to be -0.38 mm in M. tintinnabulum at Buleji. By using the t0 value the sizes attained by this species were
23.7, 33.7, 40.2, 44.4, 47.1 and 48.8 mm at the age of 1, 2, 3, 4, 5 and 6 years, respectively (Table 4.6.). The calculated average growth rate was 1.97, 0.84, 0.54, 0.35,
0.22 and 0.14 mm/month in 1st, 2nd, 3rd, 4th, 5th and 6th years, respectively (Figure 4.6.). At Buleji, 27.4% of the populations of M. tintinnabulum were between age 0-1 year and
38.3% were between ages 1-2 years. Life span was estimated to be 6.4 years at Buleji.
The t0 was estimated to be -0.50 mm at Manora. The sizes attained by M. tintinnabulum were 31.8, 41.2, 46.2, 48.9, 50.4 and 51.1 mm at the age of 1, 2, 3, 4, 5 and
6 years, respectively at Manora (Table 4.6.). The calculated average growth rate was
2.65, 0.79, 0.42, 0.22, 0.12, 0.06 mm/month in 1st, 2nd, 3rd, 4th, 5th and 6th years, respectively (Figure 4.6.). Among the population at Manora, 56.7% of the populations of
M. tintinnabulum were between age 0-1 year and 28.1% were between ages 1-2 years.
Life span was estimated to be 4.3 years at Manora.
The natural mortality rate (M) was 0.894 year−1 and 1.131 year−1 for M. tintinnabulum at Buleji and Manora, respectively.
4.4. Discussion
The present study provides the knowledge on an abundantly present species of barnacle, M. tintinnabulum in the intertidal zones of the coast of Pakistan and in the regions of the Indo-Pacific. The distribution of M. tintinnabulum at Buleji and Manora showed the preference of habitat by this species, as the low tidal zone was inhabited by large number of barnacles, while few number of barnacles inhabited the mid tidal zone and were completely absent in the high tidal zone. The absence of M. tintinnabulum in the high tidal zone showed that this species avoid the heat and desiccation and preferred to live in the wet tidal zone. It has been reported that the distribution of barnacles in upper limits of intertidal zone showed that these barnacles can tolerate heat and desiccation to greater extent (Connell, 1961b; Foster, 1971a, b). The species inhabiting high shores showed greater tolerance to physical stress than species inhabiting low shores (Raffaelli and Hawkins, 1996; Stillman and Somero, 1996; Tomanek and Somero,
1999; Stillman, 2002; Stenseng et al., 2005) which has been confirmed during a comparative study to examine the behavioral and physiological responses of twbarnacle species to heat and desiccation stress (Wong et al., 2014). They (Wong et al., 2014) monitored the body temperature and hemolymph osmolality profiles of two barnacle species on the shore on daily basis and their thermal responses under laboratory conditions. They observed that barnacle species (T. japonicus) in the higher shore was more tolerable to desiccation and heat exposure than the low-subtidal species (M. volcano).
Favourable abiotic conditions are provided to barnacles at the lower limits of tidal levels (Barnes, 1959; Achituv, 1972; Hunt and Alexander, 1991), as longer immersion in water offers a prolonged feeding time and preventions of longer exposure to desiccation.
Due to these positive aspects, the lower intertidal shores are competed by sessile barnacles (e.g., Stanley and Newman, 1980; Achituv, 1981; Paine, 1981). The present study observed that barnacles, Amphibalanus amphitrite, Tetraclita rufotincta and
Megabalanus tintinnabulum occupied the lower tidal zone but M. tintinnabulum competed the others, being dominant in the low tidal zone. However, the lower tidal zones provide unfavourable biotic conditions, such as, competition and predation, as reported that barnacle species inhabiting low tidal zone are at risk by gastropod predators
(Connell, 1961b; Strathmann and Branscomb, 1979). Seven to eight species of the gastropod predators, Thais are found in fair numbers at Buleji and Manora (Ahmed and
Hameed, 1999; Nasreen et al., 2000). The length-weight relationship is important in fisheries research for the adequate fisheries management and sustainable yield of the stocks (Ecoutin et al., 2005). The length and weight relationships in M. tintinnabulum was significantly lower from the theoretical value of b = 3, thus showing negative allometric growth. The b values obtained in the present study for M. tintinnabulum (< 1.0) is much lower than b values of
2.5 to 3.5 obtained in most marine species (Froese 2006). From this it can be concluded that the "cube law" could be not applied for the length weight relationship in barnacle species (Ricker 1973). However, Zeinalipour (2015) showed that relationship between orifice diameter and dry weight would be more appropriate to estimate the b values in barnacles, where b was 2.6 in B. improvises.
The population of barnacles, M. tintinnabulum showed variability in density, size and growth rates between two rocky shores (18 kilometer apart). This finding is similar to studies where variability has been found between sites with similar conditions, like variations in density and size were recognized in Semibalanus balanoides between exposed shores of north Wales at the scale of meters and kilometers (Hyder et al., 1998).
From the NW Mediterranean, the growth of Chthamalus stellatus showed highest variability at the scales of 100 km and cm and negligible variability at the scale of meters to 100 meters (Benedetti-Cecchi et al., 2000). While comparing the population parameters at spatial scales of 100s of kilometres, 1000s of metres and 10s of metres, it was observed that the highest variability in size, density, absolute growth and instantaneous mortality of Semibalanus balanoides occurred over the largest spatial scale
(Jenkins et al. 2001). Though above studies showed that the greatest variations occurred at very small spatial scales (<1 m) and at very large spatial scales (100s to 1000s of kilometres) but in present study variations occurred at medium spatial scale of 10s of kilometer. In present study the variations in density, size and growth rates of M. tintinnabulum at medium spatial scale of 18 kilometer is similar to the study of Chan and
Williams (2004) who reported that population dynamics of Tetraclita spp. exhibited variations on two shores of Hong Kong which are about 5 km apart. The population dynamics of acorn barnacles was found to vary between two sites, sheltered bays and exposed open shores where large environmental differences occurred (Bertness et al.,
1991). Though environmental conditions were considered the cause of variation in population parameters but indirectly biological factors were also possible causes of the observed patterns.
In the present study the recruitment in the population of M. tintinnabulum was observed at Buleji only, while at the other site Manora, recruitment cannot be traced as smaller sized individuals were not observed at that site. Variations in recruitment at two sites in the present study is similar to other studies where variations in recruitment dynamics has been recorded between shores in number of barnacle species, Semibalanus balanoides, S. cariosus, Tesseropora rosea, Pollicipes polymerus, Chthamalus anisopoma and C. dentatus (Hawkins and Hartnoll, 1982; Caffey, 1983; Raimondi, 1990;
Dye, 1993; Pineda, 1994; Caroll, 1996). The barnacle C. stellatus has been reported to exhibit great variation in recruitment between years due to climatic and hydrographic changes with the result that some shores showed no recruitment for long periods and population sizes to dropped (Southward and Crisp, 1954, 1956). The recruitment intensity of Tetraclita serrata has also been shown to vary between localities and some shores can experience no recruitment for a number of years (Sutherland, 1987). The cyprid larvae were known to settle higher on the substrate where larger numbers of adult barnacles are settled because the larvae showed gregariousness and respond to the stimuli of the established adult population (Crisp, 1974). Therefore, the recruitment noticed at
Buleji in our study may be related to higher density of adult barnacles M. tintinnabulum at Buleji than Manora. There are several possibilities for variations in the recruitment at two sites, more studies need to be conducted to examine that to what extent these factors affect barnacle’s settlement and recruitment at various sites.
In present study the recruitment of M. tintinnabulum was observed from March to
May just after the reproductive season and then again in September. It was observed that species of Megabalanus require 10 to 23 days to develop into the cypris stage in the laboratory (Egan and Anderson, 1987, 1988; Choi et al., 1992; Thiyagarajan et al., 1997;
Yan and Chan, 2001; Sevirino and Resgalla, 2005; Lopez et al., 2008; Doinisio et al.,
2014). Therefore, it can be suggested that the March to May settlers may have come from the local population but September settlers may have come from population elsewhere.
This is similar to the study of Chan and Williams (2004) on Tetraclita spp. from Hong
Kong in which the recruitment after the reproductive season was related to the larval populations around Hong Kong and the recruitment prior to reproductive season was related to the larval populations from elsewhere. Along the California coast, the gene flow between populations of T. rubescens was high, suggesting the recruits of this species were from both local and geographic populations (Ford and Mitton, 1993).
The largest sized barnacles of M. tintinnabulum collected from Buleji and
Manora were 50.0 mm and 53.0 mm, respectively but were very few in numbers. The individuals of M. tintinnabulum larger than 40 mm size were higher at Manora (16.2%) than Buleji (12.4%). The maximum size attained by another species of Megabalanus, M. azoricus is 40 mm but in few specimens it exceed 55 mm in Portuguese waters (Dionisio et al., 2007; Pham et al., 2011). The maximum size attained by M. peninsularis in
Malpelo Island, Columbia was approximately 40 mm (Velásquez-Jiménez et al., 2016).
The estimated growth rates (K) of 0.63 year-1 at Manora is higher than of 0.44 year-1 at Buleji for M. tintinnabulum. Factors such as population density, the availability of food and the supply of food through water currents (Bertness et al., 1991; Leonard et al., 1998; Benedetti-Cecchi et al., 2000) are indicated as influencing growth rates in barnacles. The other factors which may influence growth are temperature and/or photoperiod that changes with latitude (Clarke et al., 2004). Population density has been considered as an important factor that affects the growth of benthic animals, as with an increase in density, the competition for food increases and so the growth rate decreases
(Carroll, 1996; Silina and Ovsyannikova, 1999; Chan and Williams, 2004). The density of barnacles is significantly higher at Buleji as compared to Manora, therefore, more food availability and less competition for food for barnacles at Manora than Buleji.
Similar results of elevated growth rates at one site than the other site has been reported in barnacles, Semibalanus balanoides (Jenkins et al. 2001) and Tetraclita squamosa and T. japonica (Chan and Williams, 2004) due to differences in population density.
Food supply (the concentration of chlorophyll-a in the surface water) may be considered as another factor which showed difference in the growth rate between Manora and Buleji, as the concentration of chlorophyll-a varied significantly at two sites being higher at Manora. Similarly in Hong Kong, the organic matter content suspended in water was higher signifying higher food availability and thus a higher growth rate of barnacles at Heng Fa Chuen than Middle Bay (Chan and Williams, 2004). A lower growth rate in Balanus amphitrite was correlated to low food availability during monsoons (Dattesh and Anil, 2005). Desai et al. (2006) also showed that the size of
Balanus amphitrite was positively correlated to the concentrations of chlorophyll-a in
Indian waters. A positive relationship between the growth rates and food availability has been observed in other invertebrates (Bosman and Hockey, 1988; Brethes et al., 1994;
Nichole, 2005).
The rate of growth in M. tintinnabulum was highest during the first six months of their life attaining 16.7 mm at Buleji and 24.3 mm at Manora then slowed down as the age proceeds. Similarly, highest rate of growth was observed during the first few months after settlement in Tetraclita spp and growth slowed down as barnacles come close to maturity (Chan and Williams, 2004). The slower growth rates after few months of settlement is probably due to the fact that the energy is utilize in gonad development and other metabolic changes instead of growth (Crisp, 1960).
The natural mortality rate estimated for M. tintinnabulum was comparatively higher at Manora (1.131 year−1) than Buleji (0.894 year−1). Mortality of barnacles inhabiting low-shore waters is due to biotic factor, predation by whelks (Connell, 1961b;
Minchinton and Scheibling, 1993). Whelks were reported to feed on barnacle species and may cause high mortality (Tong 1986). Whelks were comparatively more common at
Manora than Buleji ,therefore, predation may be considered as one of the processes influencing mortality of barnacles at Manora. The other mechanism which may influence mortality in barnacles is the overgrowth of algae (Denley and Underwood 1979; Bertness et al., 1983; Bertness, 1991). On both sites algae are equally abundant, therefore, it needs to be analyzed whether algae killed barnacles or barnacles are killed due to other reasons after which algae grow over them.
In the present study the growth parameters of barnacles M. tintinnabulum were estimated by using FiSAT software (Sparre and Venema, 1998), which is commonly used in fishes and other marine invertebrates to compare inter- and intra-specific growth patterns. The information on the population parameters of the barnacles, M. tintinnabulum, is negligible, therefore, this study presented some population parameters of this species on the coast of Pakistan, Northern Arabian Sea. It is suggested that further studies should be conducted to investigate the population parameters of M. tintinnabulum in the coastal waters of Asian countries including the larval supply, recruitment and settlement patterns of this species, in order to provide baseline data for future comparative studies.
Table 4.1. Morphometric relationships between rostro-carinal diameter (r-c diameter), height of the carina (HTC), height of the rostrum (HTR), total weight (TW) and tissue weight (TiW) of Megabalanus tintinnabulum population at Buleji (N= 905) and Manora (N = 875) .
Sites Relation a S.E.(a) b S.E. (b) r2 t-test
Buleji r-c diameter/ HTC 0.811 0.003 1.083 0.006 0.968 12.220*
r-c diameter/ HTR 0.674 0.004 1.177 0.009 0.948 18.693*
HTR/HTC 1.184 0.001 0.901 0.004 0.981 -22.545*
r-c diameter/ TW 4.520 0.006 0.655 0.012 0.761 -183.723*
r-c diameter/ TiW 1.515 0.010 0.769 0.021 0.611 -104.478*
Manora r-c diameter/ HTC 0.792 0.003 1.105 0.006 0.974 16.529*
r-c diameter/ HTR 0.670 0.004 1.185 0.009 0.954 20.289*
HTR/HTC 0.859 0.002 1.074 0.004 0.983 15.172*
r-c diameter/ TW 15.375 0.004 0.817 0.009 0.908 -238.444*
r-c diameter/ TiW 8.857 0.008 0.947 0.017 0.790 -119.093* a, intercept; b, slope; S.E, standard error; r2, coefficient of determination; *statistically significant values, P< 0.001
Table 4.2. Size cohorts of Megabalanus tintinnabulum summarized from Figure 4.3. at Buleji. SD - Standard deviation.
Months Cohort Mean ± SD Population January ‘2012 B 23.54 ± 3.19 70 A 38.68 ± 2.95 54
February B 29.26 ± 1.48 32 A 39.04 ± 2.19 71
March B 29.71 ± 6.50 92 A 42.84 ± 2.83 41
April C 9.04 ± 1.63 13 B 29.76 ± 7.31 119 A 45.75 ± 2.97 32
May C 12.92 ± 3.21 33 B 29.81 ± 3.75 109
June-August C 18.82 ± 2.80 14 B 33.69 ± 2.79 22
September C 22.57 ± 4.29 72 B 37.17 ± 2.70 32
October C 24.91 ± 2.95 69 B 38.55 ± 4.08 131
November D 20.50 ± 2.40 20 C 29.27 ± 2.46 88 B 42.24 ± 2.83 43
December D 20.50 ± 1.70 16 C 31.04 ± 1.63 20 B 42.76 ± 2.50 68
January ‘2013 D 23.83 ± 2.11 34 C 34.13 ± 1.79 71
February D 25.50 ± 3.05 77 C 39.50 ± 1.20 38
March E 16.07 ± 4.97 39 D 26.30 ± 2.70 50 C 39.50 ± 1.35 32
April E 17.83 ± 2.46 34 D 26.80 ± 1.32 42 C 39.94 ± 1.38 51
May E 20.13 ± 1.79 54 D 32.20 ± 4.89 57
June-August E 22.22 ± 1.56 18 D 35.30 ± 1.98 13
September F 11.83 ± 3.400 17 E 25.11 ± 2.330 46 D 42.50 ± 3.040 39
October F 19.66 ± 2.700 20 E 28.57 ± 2.370 59 D 42.56 ± 4.220 49
November F 26.66 ± 4.960 139 E 38.50 ± 2.240 27
December G 14.50 ± 2.950 27 F 27.00 ± 1.840 36 E 39.50 ± 1.480 19
Table 4.3. Size cohorts of Megabalanus tintinnabulum summarized from Figure 4.4. at Manora. SD - Standard deviation.
Months Cohort Mean ± SD Percent population January ‘2012 B 18.94 ± 1.960 43 A 36.18 ± 3.900 61 44.50 ± 1.920 12
February B 22.00 ± 4.160 41 A 39.03 ± 2.640 80
March C 17.77 ± 1.390 22 B 28.82 ± 1.670 47 A 40.22 ± 2.870 43
April C 19.83 ± 2.400 31 B 30.42 ± 2.320 62 A 42.50 ± 3.720 58
May C 20.50 ± 1.490 22 B 30.50 ± 2.660 59 A 43.18 ± 6.120 72
June-August C 25.50 ± 1.700 9 B 34.19 ± 1.990 19
September D 20.50 ± 1.700 31 C 28.66 ± 2.620 62 B 40.69 ± 1.420 39
October E 20.44 ± 3.290 39 D 30.50 ± 1.700 16 C 39.80 ± 1.960 45 B 44.50 ± 1.940 12
November E 20.50 ± 1.700 32 D 31.50 ± 2.220 26 C 41.43 ± 4.800 42
December F 17.83 ± 3.810 30 E 28.25 ± 1.240 39 D 37.25 ± 3.330 39
January 2013 F 18.50 ± 3.370 29 E 30.75 ± 1.470 53 D 43.75 ± 3.170 21
February F 22.33 ± 4.800 81 E 38.50 ± 3.140 38
March F 23.83 ± 2.700 42 E 38.92 ± 5.270 71
April F 26.64 ± 4.110 58 E 40.51 ± 4.020 66
May G 21.23 ± 1.260 25 F 30.04 ± 1.990 35 E 43.17 ± 3.400 24
June-August G 23.26 ± 1.180 9 F 35.88 ± 2.610 20
September H 19.44 ± 2.400 27 G 26.97 ± 2.920 73 F 42.67 ± 2.680 64
October H 20.50 ± 1.630 34 G 31.54 ± 3.720 62 F 47.50 ± 3.970 36
November H 27.50 ± 2.080 59 G 37.76 ± 3.700 47
December I 19.83 ± 2.400 23 H 30.16 ± 1.720 43 G 43.06 ± 3.480 28
Table 4.4.The regression equations of the relationship between the shell increment and the time in Megabalanustintinnabulumat Buleji. Y is the r-c diameter, X is the number of months.
Cohorts Equations r Cohort-A Y = 2.50 X + 35.27 0.964 Cohort-B Y = 1.53 X + 23.68 0.966 Cohort-C Y = 2.75 X + 6.33 0.992 Cohort-D Y = 2.07 X + 16.81 0.978 Cohort-E Y = 2.50 X + 11.26 0.927 Cohort-F Y = 5.27 X + 8.1 0.947
Table 4.5.The regression equations of the relationship between the shell increment and the time in MegabalanustintinnabulumatManora. Y is the r-c diameter, X is the number of months.
Cohorts Equations r Cohort-A Y = 1.74 X + 34.98 0.981 Cohort-B Y = 2.41 X + 18.17 0.957 Cohort-C Y = 2.92 X + 11.97 0.927 Cohort-D Y = 5.34 X + 16.70 0.975 Cohort-E Y = 3.56 X + 16.61 0.969 Cohort-F Y = 2.85 X + 12.98 0.982
60 Buleji
Manora 50
40
30
20
10
0 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5 5.5 6
The Length at any age in fish and invertables can be calculated by using Von Betalanffy equation (Betalanffy ,1938): Lt=L∞ ⌊1 − 푒−푘(푡−푡표)⌋ where Lt is the length at age t, L∞ is the asymptotic thngth or maximum theoretical length of barnacle, K is the growth coefficient (the rate of growth of barnacle to its maximum size), And 푡표 the theoretical age at length 0. Table 4.6. Calculated length (mm) of Megabalanus tintinnabulum at various ages (years) at Buleji and Manora.
Age (years) Buleji (mm) Manora (mm) 0.5 16.7 24.3 1.0 23.7 31.8 1.5 29.3 37.2 2.0 33.7 41.2 2.5 37.3 44.1 3.0 40.2 46.2 3.5 42.6 47.8 4.0 44.4 48.9 4.5 45.9 49.8 5.0 47.1 50.4 5.5 48.1 50.8 6.0 48.8 51.1
CHAPTER 5
Reproductive pattern of Megabalanus tintinnabulum on two rocky shores of Karachi
coast, Pakistan 5.1. Introduction
Reproductive output indirectly determines the population fitness of different species and their recruitment and subsequent interactions within intertidal communities
(Burrows et al., 1992). Invertebrates possess a variety of reproductive patterns, for example, some species reproduce for a very short duration during a year, while others reproduce throughout the year (Barnes, 1989; Hadfield and Strathmann, 1996). The reproductive period is not constantly fixed for a species but may vary with environmental conditions (Sastry, 1975; Giese and Kanatani, 1987). For example, a species may reproduce for multiple seasons in order to achieve a successful recruitment in an environment which is highly variable (Hadfield and Strathmann, 1996).
The reproductive patterns of barnacles has been well studied in temperate species
(Barnes, 1989), while less information is available on the reproductive patterns of tropical and subtropical barnacles (Yan et al., 2006). Barnacles in tropics possess a shorter life span than the barnacles in temperate (Connell, 1985; Chan and Williams,
2004) from which it is anticipated that the barnacles in tropical waters invest more energy into reproduction during their shorter life span as compared to the temperate barnacles. The reproductive patterns in barnacles are under the influence of various environmental factors, such as, temperature (Barnes, 1963; Crisp and Patel, 1969; Barnes and Stone, 1973; Hines, 1978), food availability (Barnes and Barnes, 1967, 1975; Page,
1983; Bertness et al., 1991), population density (Wethey, 1984; Leslie, 2005), salinity
(Barnes and Barnes, 1968; O’Riordan and Murphy, 2000) and light (Crisp, 1959; Barnes et al., 1963; Hines, 1978). Several species of barnacles in warm temperate and subtropical waters produce numerous small broods in rapid succession during summer. The extent of brooding season is dependent on temperature (Crisp, 1950; Patel and Crisp,
1960a, b; Hines, 1978; Desai et al., 2006), as some species breed over a wide range of temperature while others prefer a particular temperature to breed. In tropical waters, the barnacles are known to breed continuously as there no significant temperature variation there, although reproductive efforts may decline due to high rainfall during monsoon seasons (Fernando, 1999). Beside temperature, the availability of food also influences the breeding cycle of the barnacles (Barnes and Barnes, 1967, 1975) as favorable nutritional conditions control and enhance the eggs production and poor nutritional conditions cease breeding. The temperature and food availability may act together to regulate reproductive periods.
Environmental conditions at a specific habitat may influence the fecundity
(number of eggs) or brooding capacity (number of larvae) in invertebrates. Fecundity may vary as a function of depth (Barber et al., 1988), intertidal height (Barnes and
Barnes, 1968; Qian and Chia, 1991; Honkoop and van der Meer, 1997; Leslie et al.,
2005), and wave exposure (Etter, 1989; Bertness et al., 1991). Variations in the reproductive patterns along a vertical gradient have been reported (Leslie et al., 2005;
Phillips, 2007).
The Cirripedia (e.g., barnacles) are hermaphrodites (Charnov, 1987) as compared to the other crustaceans which are generally dioecious. This hermaphroditism in barnacles has been suggested as an adaptation to their sessile existence. The common acorn barnacles are simultaneous hermaphrodites and produced sperms and eggs simultaneously (Anderson, 1994), while cross-fertilization is more common than self- fertilization (Barnes and Crisp, 1956; Patel and Crisp, 1961; Furman and Yule, 1990; El-
Komi and Kajihara, 1991).
The adult barnacles can produce hundreds to thousands of eggs in their ovary.
The eggs are kept in the mantle cavity or egg lamellae where fertilization occurs. The fertilized eggs develop into eyed-nauplii and ready to be released into the water. The planktonic nauplii then moult to become cypris larvae, which finally settle on a hard substratum in the intertidal zone, provided the environmental conditions are suitable.
The reproductive biology of tropical barnacles, Chthamalus malayensis, Balanus amphitrite communis and Amphibalanus amphitrite has been reported (Karande and
Palekar, 1963; Pillay and Nair, 1972; Swami and Karande, 1988; Dhandapani and
Fernando, 1994; Yan and Miao, 2004; Desai and Anil, 2005; Koh et al., 2005; Desai et al., 2006; Satheesh and Wesley, 2009). However, the above studies do not include a commonly occurring large sized barnacle, Megabalanus tintinnabulum. Therefore, the present study examine the reproductive cycle of M. tintinnabulum through macroscopic features and histological characterization of gonadal development. The object was to ascertain whether the reproduction in this species exhibited spatial (between sites) and temporal (seasonal) variation. For this purpose the brooding capacity was estimated at two sites. The period of brooding activity and percent of brood barnacles at two sites were also investigated. The information obtained in this study, has been compared with the reproductive patterns of other tropical barnacle species. The correlation between physico-chemical parameters, such as, temperature, salinity and chlorophyll-a and brooding activity of barnacle has been estimated.Tables 5.3 & 5.4 and Figure 5.1. The changes in the biochemical composition of the body tissue, ovaries and digestive gland during gonadal maturation stages can determine the reproductive changes in marine invertebrates (Giese, 1959, 1969; Giese and Pearse, 1974). The concentrations of carbohydrate, protein, lipid, etc. have been determined during the embryonic development in barnacle species, Tetraclita squamosa rufotincta, Balanus perforatus, B. balanoides, Chthamalus dentatus, C. stellatus, Euraphia depressa, Octomeris angulosa,
Pollicipes cornucopia (Achituv and Barnes, 1976, 1978; Achituv et al., 1980; Achituv,
1981; Achituv and Wortzlavski, 1983; Mizrahi and Achituv, 1991). These studies showed that proteins and lipids provided most of the energy for the development of fertilized eggs. The concentrations of carbohydrate, lipid and protein in the body tissue of C. stellatus did not vary with seasons though the body weight of barnacle showed seasonal changes (Barnes, 1972). Contradictory to study of Barnes (1972), the increase in body weight was related to the increase in total lipids, carbohydrates and proteins in the body tissue of C. stellatus and E. depressa from the Mediterranean coast of Israel and after breeding the biochemical components of body tissue decreased in these two species
(Mizrahi and Achituv, 1990, 1991).
From Pakistan, studies on biochemical changes in gonads and tissue during maturation in shrimps and crabs have been conducted (Nisa and Sultana, 2010; Fatima et al., 2013; Fatima, 2013) but no such study is available on barnacles. In present study, the protein, lipid and carbohydrate have been measured in the body tissue and ovaries with the progress of maturation in barnacle Megabalanus tintinnabulum . The seasonal variations of these constituents in the ovaries and body tissue have also been studied.
5.2. Materials and Methods 5.2.1. Sampling
The collection of barnacles is described in Chapter 2 (see page 18). Each month,
50 specimens of M. tintinnabulum were brought to the laboratory from January 2012 to
December 2013.
5.2.2. Gametogenesis
The gonadal development of M. tintinnabulum was determined through macroscopic observation and histological examination. After dissection each individual was examined for gonadal maturation based on macroscopic features, like, size, colour and texture of the female and male gonad (Barnes, 1963; Hines, 1978; Lewis and Chia,
1981; Burrows et al., 1992; O’Riordan et al., 1995; Koh, 2005). The female and male gonads were removed for fixation and histological examination. The female gonad was weigh to the nearest ± 0.01 gm. The presence or absence of egg mass was recorded in each specimen.
For histological examination, each month the ovaries, testis and seminal vesicle were separately fixed in Davidson’s Fixative (alcohol, seawater, formaldehyde, glycerol and acetic acid in the ratio of 3:3:2:1:1) (Shaw and Battle, 1957) for 24 hours and transferred to 70% alcohol. The gonadal tissue was then processed for dehydration, infiltration, embedded in paraffin wax and sectioned at 7 µm. The cut sections of gonad were stained with Delafield’s Haematoxylin and counter stained with Eosin (Humason,
1967) and seen under the light microscope for the maturation stages based on the size of follicle and the presence of oogonia, pre-vitellogenic, early-vitellogenic and late- vitellogenic oocytes in ovaries and spermatogonia, spermatocytes, spermatids and spermatozoa in testes and seminal vesicles. Temporal variations in the gonadal maturation stages were noted. The characteristics of each stage are described in Tables
5.1. & 5.2. The minimum size for maturity in the testes and ovaries was identified by the presence of sperm (Cruz and Hawkins, 1998) and presence of egg masses at the bottom of the mantle cavity, respectively. Pearson’s correlation between mature ovaries or mature testes in M. tintinnabulum and temperature, salinity and chlorophyll-a was computed.
The histological examination to determine the stages of gonad maturity in barnacles has been reported by various workers (Korn and Kolotukhina, 1984; Walker,
1992; Molares et al., 1994; Cruz and Hawkins, 1998). Comparison of gonadal maturation stages based on macroscopic and histological examinations has been made in barnacles
(Yan et al., 2006).
5.2.3. Brooding capacity and brooding period
During the study, presence or absence of egg mass in each barnacle was examined and the brooding period was recorded. Egg mass were fixed in 4% formalin solution for 4-5 days. The total number of eggs per brood (brooding capacity) was estimated by diluting the fixed eggs in 10 ml of water. Three sub-samples of 0.5 ml each were taken from the dilution to count the number of eggs. The developmental stage of eggs was based on the criteria described by Yan et al. (2006) for Chthamalus malayensis who proposed that the egg consist of few cells, the egg is multicellular, the larvae with limb bud, limbs and spines and larvae with naupliar eye. The length and width of egg, along the widest part were taken under the ocular micrometer. Pearson’s correlation between brooding barnacles and temperature, salinity and chlorophyll-a was computed.
5.2.4. Biochemical analyses of tissue and ovaries during gonadal maturation stages
The biochemical analysis was done on the samples of M. tintinnabulum collected each month from January 2012 to December 2013 on the Buleji rocky shore. The body tissue and their respective ovaries (immature, growing and mature stages) were removed and estimated for protein, carbohydrate and lipid following the method as described by
Fatima et al. (2013). The tissue and ovaries were washed and homogenized with phosphate buffer of pH 7. The Folin-Ciocalteu method (Lowry et al., 1951) was used to estimate the total protein with bovine serum albumin (BSA) as the standard. The estimation of carbohydrate and lipids were carried out by Phenol Trichloroacetic acid method (Dubois et al., 1956) and Sulpho-phospho vanillin method (Barnes and
Blackstock, 1973), respectively. Each sample was run in triplicate. One-way ANOVA
(P<0.05) was used to test the biochemical composition of ovaries and soft bodies with maturation stages as factor followed by the Tukey test. The seasonal variations in the concentrations of protein, carbohydrate and lipid of ovaries and soft tissue were analyzed through one-way ANOVA (P<0.05) followed by the Tukey test. For statistical analysis
SPSS 14.0 software was used. Seasons were divided into spring (March to April), summer (May-September), autumn (October) and winter (November-February).
5.3. Results
5.3.1. Macroscopic features of gonad Megabalanus tintinnabulum, like all other acorn barnacles are hermaphrodites with development of testes and ovaries simultaneously. The three macroscopic stages, immature, growing and mature differed mainly in relation to colour, size and texture of the ovaries. The characteristics of each ovarian maturation stage are described in Table
5.1. The three stages of maturation in testes differed on the visibility, diameter of seminal vesicle in relation to alimentary canal and oozing of fluid. (Table 5.2.).
5.3.2. Histological features of gonad
5.3.2.1. Oogenesis
The ovarian follicles were found to contain four types of cells, that is, oogonia, pre-vitellogenic, early-vitellogenic and late-vitellogenic oocytes (mature oocytes) (Table
5.1. & Plate 5.1.). The oogonia possess a nucleus and thin layer of cytoplasm, the oogonia diameter was between 4-6 µm. The pre-vitellogenic oocytes have a nucleus but the cytoplasmic area become more visible. The diameter of oocyte ranged between 30 to
60 µm with mean diameter of 45.2 ± 7.35 µm. In early-vitellogenic oocytes the cells showed the presence of granules and the diameter ranged between 60 to 120 µm (mean diameter of 94.8 ± 16.32 µm). Late-vitellogenic oocytes (mature oocytes), were filled with yolk globules and diameter ranged between 150 to 240 µm with mean diameter of
190.2 ± 20.75 µm (Table 5.1. & Plate 5.2.). On the basis of histological features the ovaries can be divided into four stages, that is, immature, growing, mature and spent stages. The characteristics of each stage are described in Table 5.1.
5.3.2.2. Testes and Seminal vesicle
Different type of germ cells, that is, spermatogonia, spermatocytes, spermatids and spermatozoa were present in the testes (Table 5.2. & Plate 5.3.). On the basis of histological features the testes can be divided into three stages, that is, immature, growing and mature (Table 5.2.). Similarly, the seminal vesicle can also be divided into three stages basis (Table 5.2. & Plate 5.4.). In stage 1, when the seminal vesicle was thin, on histological examination connective tissue was observed. In stages 2 and 3, the spermatozoa were found in seminal vesicle, however, in stage 3 the spermatozoa were more concentrated as compared to stage 2 (Plate 5.4).
5.3.3. Relationship between macroscopic stages and histological stages of ovarian development
The ovaries of M. tintinnabulum classified as stage 1 and 3 on macroscopic examination, when examined microscopically revealed to be in the same stages, that is, immature (stage 1) and mature stage (stage 3). An ovary which was assigned macroscopically as stage 2, miscroscopically was either in growing (stage 2) or spent
(stage 4) stages (Table 5.1.). The macroscopic stage 2 ovaries on histological examination revealed that 4.5% of the ovaries at Buleji and 5.9% of the ovaries Manora were in spent stage, while 39.2% and 40.7% were in growing stage at Buleji and Manora, respectively. The barnacles with ovaries in spent stage were found to possess the egg masses.
5.3.4. Temporal variation in the stages of gonadal development
There was synchrony in the ovaries and testes gametogenesis in M. tintinnabulum as different stages of gonad development occurred throughout the year at Buelji and
Manora, however, their percentages varied with the season (Figure 5.1.). In the present study the gonad in barnacles was absent in individuals smaller than 11 mm, after that size the testes and ovaries appeared simultaneously in each barnacle. At Buleji, mature ovaries in barnacles were observed throughout the year, showing a peak from February to April’12 (46.8 to 50.0%) and again from March to April’13 (44.0 to 50.0%). The barnacles with immature ovaries ranged between 8.0 to 32.0% during the study period.
At other site Manora, the barnacles with mature ovaries were found throughout the study period with peaks during March to May’12 (44.4 to 55.6%) and March to May’13 (43.5 to 61.5%). The barnacles with immature ovaries ranged between 5.9 to 32.1% during the study period.
Testes of M. tintinnabulum in immature, growing and mature stages were found throughout the year (Figure 5.2.).The mature testes in barnacles ranged from 17.6% to
52. 9% at Buleji and 15.4% and 57.1% at Manora, however, in most of the months the percentage of barnacles with mature testes were greater than 30%. The peak of barnacles with mature testes was found from April to June at both sites. The seminal vesicles filled with sperm (stage 3) were found throughout the year (Figure 5.3.). A penis was observed even in smallest sized barnacle with the exception of those in which the gonad was totally absent.
The mature ovaries and mature testes were observed throughout the year and were in synchrony in this species (Figure 5.4.). No significant correlation was found between mature ovaries and temperature, mature ovaries and salinity and mature ovaries chlorophyll-a at Buleji and Manora with the exception of significant positive correlation between mature ovaries and temperature at Manora (r = 0.517; P = 0.010; n= 24). No significant correlation was found between mature testes and physico-chemical parameters at both sites (Table 5.3.). 5.3.5. Brooding period and brooding capacity
The minimum size at which M. tintinnabulum had mature male and female gonads was 18 mm but the minimum size of brooding barnacles was 24 mm. In present study the brooding barnacles were recognized from October to February but the peak of brooding barnacles was in winter (November to February) at both sites (Figure 5.1.). The peak of brooders was recorded in November’12 (14.6%) and November’13 (14.3%) at
Buleji (Figure 5.1.). While at Manora, the peak of brooders occurred in December’12
(20%) and December’13 (15%) (Figure 5.1.). No brooding barnacles were found from
March to September at both sites. The number of brooders at Buleji (M = 1.70; SD =
2.29) and Manora (M = 2.21; SD = 2.92) varied significantly, being higher at Manora than Buleji (t = -2.769; P = 0.011; n =24).
Brooding barnacles and temperature showed a significant negative correlation at
Buleji (r = -0.900; P = 0.001; n= 24) and Manora (r = -0.944; P = 0.001; n= 24). There was no significant correlation between brooding barnacles and salinity but a significant positive correlation between brooding barnacles and chlorophyll-a at both sites (Table
5.4.).
The eggs in the brooding M. tintinnabulum were observed in three stages of development, that is, stage 1 (multicellular), stage 2 (the embryo with limb buds) and stage 3 (the embryo with limbs and a naupliar eye) (Plate 5.5.). It was observed that in a single brooding M. tintinnabulum, all the embryos were in the same stage of development. The number of eggs in the mantle cavity of M. tintinnabulum decreased with the development of embryo, e.g. the number of eggs, when the stage was multicellular, ranged between 12,000 to 16,000, which decreased to the range between 9,800 to 11,360 when embryos had limb bud and to the range between 7,269 to 8,540 when embryos had naupliar eye after which it is released into the water. Therefore, M. tintinnabulum released 7,914 ± 303 of eggs per brood. Analysis of variance showed no significant difference in the brooding capacity (number of eggs per brood) of barnacles at
Buleji and Manora (F = 0.002; df = 1; P = 0.964). The length and width of embryos in brooding M. tintinnabulum increased with developmental stages (Table 5.5.), as the mean length of embryos in stage 1 was 216.8 ± 14.06 µm which increased to 270.0 ±
12.94 µm in stage 3. Similarly the mean width of embryo increased from 115.6 ± 5.77
µm in stage 1 to 138.4 ± 12.51 µm in stage 3 (Table 5.5.).
5.3.6. Biochemical analyses of ovaries and soft tissues
5.3.6.1. Biochemical composition of ovaries and soft tissues during gonadal maturation
The protein concentration varied from 24.0 to 62.0 mg g-1 in the ovaries of M. tintinnabulum. The carbohydrate and lipid concentrations varied from 5.0 to 11.0 mg g-1 and from 11.0 to 22.5 mg g-1, respectively in the ovaries (Table 5.6.). The concentration of protein, carbohydrate and lipid in the tissue of varied from 15.0 to 45.0 mg g-1, 4.5 to
10.0 mg g-1 and 6.8 to 15.0 mg g-1, respectively (Table 5.7). The protein, carbohydrate and lipid concentrations in both the ovaries and tissue increased significantly with ovarian maturation (P < 0.05) (Figure 5.5.).
5.3.6.2. Seasonal variations in biochemical composition of the ovaries and soft tissues The highest concentrations of protein (P<0.05) (P<0.05) in ovaries was observed in winter and autumn which decreased in spring and summer. The concentrations of carbohydrate and lipids (P<0.05) in ovaries reached maximum values in winter and autumn and the lowest values were recorded in summer (Table 5.8.). Seasonal variations in the concentrations of total proteins and lipid (P < 0.05) in tissues was observed, being higher in winter and autumn but the concentration of carbohydrate did not vary in different seasons (Table 5.8.).
5.4. Discussion
It has been reported that marine animals inhabiting the tropical waters breed throughout the year while those inhabiting the subtropical waters showed seasonality in breeding (Giese and Pearse, 1974). In the present study the brooding individuals of M. tintinnabulum on coast of Pakistan which lies outside the tropics, were observed during the autumn-winter (October to February) period, particularly peaked in winter showing that lower temperatures (20-24º C) are preferred as compared to higher temperatures (29-
34º C). Though mature gonads were found throughout the year in M. tintinnabulum but it appeared that the barnacles waited for lower temperatures for brooding thus avoiding higher temperatures. The presence of brooding barnacles from October to February on the coast of Pakistan supported the statement of Ahmed (1980) that most invertebrate species living on the open shores of Pakistan avoid larval settlement during monsoon
(May to August) season due to turbulence, delaying it till post monsoon (October-
November) when conditions are calmer. Two peaks of larval abundance were observed, one in March-April and second in October-November on the coast of Pakistan (Ahmed,
1980). The phytoplankton production due to local upwelling along the coast of Pakistan, increased from September to November (Banse, 1968). Two peaks of phytoplankton abundance were reported in the north-east monsoon (November–February) and south- west monsoon (June–September), on the west coast of India (Parab et al., 2006). So the presence of brooding individuals of M. tintinnabulum during October-February period coincided with peak of phytoplankton abundance in October-February in coastal waters of Pakistan (Banse, 1968; Parab et al., 2006). Thus, the food availability and temperature appeared to influence the breeding of M. tintinnabulum on the coast of Pakistan. The onset of breeding in various barnacle species has been reported to be regulated by low or high temperature though they live in the same regions (Hines, 1978; Malusa, 1986; Chan and Williams, 2004; Yan and Miao, 2004, Yan et al., 2006).
The Indian waters which lie within the tropics, the intertidal barnacle
Amphibalanus amphitrite was reported to breeds round the year on different coasts
(Karande, 1965; Daniel, 1958; Fernando and Ramamoorthi, 1975; Satheesh and Wesley,
2009). However, in this species the breeding intensity was lowered during monsoon due to the lowering of salinity (Fernando and Ramamoorthi, 1975) and the increased breeding activity during March-May was positively correlated with surface water temperature and phytoplankton abundance (Satheesh and Wesley, 2009). Contradictory to this, Desai et al. (2006) while evaluating the influence of temperature and food concentration on the breeding of A. amphitrite reported that the breeding frequency in this species decreased with an increase in temperature and increased with an increase in food concentration.
Dionisio et al. (2007) reported two reproductive peaks in Megabalanus azoricus during a year from temperate waters of Azores, Portugal. A strong positive correlation was observed between GSI and environmental factors, that is, water temperature and photoperiod in M. azoricus (Dionisio et al., 2007). The mature gonads in Chthamalus malayensis were found throughout the year in Singapore waters which lie close to the equator (Koh et al., 2005). Contradictory to this, the same species C. malayensis showed a seasonal gonad developmental pattern, from April to November in Hong Kong which lies just below the Tropic of Cancer and experiences cool winters and hot summers (Yan et al., 2006).
It has been reported that animals in some places produce more offspring than the other places (being 10s to 100s of kilometers apart) and this have been linked to genetic or environmental variation (Barnes and Barnes, 1968; Bertness, et al., 1991; Hughes et al., 2000). The reproductive output vary along horizontal gradient in barnacles (Leslie et al., 2005; Berger, 2009) and mussels (Phillips, 2007), indicating that the contribution of all sites is not equivalent in the larval pool. Food availability is another factor which influences the total reproductive output in barnacle, when food is limited; the ovarian maturation is delayed and the numbers of broods produced are also reduced (Patel and
Crisp, 1960; Barnes & Barnes, 1967, 1975; Hines, 1978; Page, 1983). When food is abundant, ovarian tissues are built up and stored enough yolky material for broods
(Barnes et al., 1963; Barnes and Barnes, 1967; Wu and Levings, 1978; Hines, 1978).
Waters with high primary productivity were found to possess higher reproductive output in barnacles than habitats with low primary productivity (Bertness et al., 1991;
Leslie et al., 2005, Berger, 2009). Because phytoplankton is considered as a major food resource for barnacles (Barnes, 1959), and primary productivity in the system can be studied by the measurement of chlorophyll a concentration (Menge et al., 1997). In present study, it was expected that population of M. tintinnabulum at Manora, because of higher concentrations of chlorophyll-a, would have greater reproductive or brooding capacity than Buleji. However, the results showed that both sites are equivalent in their brooding capacity at least for this species, though possess significantly different concentrations of chlorophyll-a.
The reproductive output of barnacles was reduced in the boreo-arctic to temperate regions due to high temperatures (Barnes, 1963; Tighe-Ford, 1967; Crisp and Patel,
1969; Hines, 1978; Page, 1984; O’Riordan and Murphy, 2000, Berger, 2009). However, that is not the case with the barnacles inhabiting the boreo-arctic to temperate regions only, as in the present study the barnacles, M. tintinnabulum on Karachi coast, which lies just outside tropics, were found to brood when the temperatures were lower (20º to 24º
C) avoiding higher temperature (29º to 34º C), a difference of 9º to 10º C in temperature.
Wu and Levings (1978) reported that a large proportion of energy budget (67.4%) was lost in respiration followed by egg production (12.3%) shell production (6.6%), production of body tissue (3.9%) and molting (2.3%) in Balanus glandula. Page (1983) recognized that reproduction in the barnacle Pollicipes polymerus was decreased above a critical temperature, because at higher temperature the energy is utilized for increase in metabolism. The allocation of energy for reproduction is less; therefore, animals prefer to breed at lower temperatures as is the case with brooding activity of M. tintinnabulum which broods at lower temperatures avoiding higher temperatures. The other reason of avoiding period from May to September for brooding by barnacles on the coast of
Pakistan supports the statement of Ahmed (1980) that most invertebrate species living on the open shores of Pakistan avoid larval settlement during monsoon (May to August) season due to turbulence, delaying it till post monsoon (October-November) when conditions are calmer.
Salinity is another factor which may influence the reproductive cycle and brooding in barnacles. For example, the brooding barnacles of C. malayensis were observed throughout the year in west Malaysia (2º N) but were absent for 4-5 months in east Malaysia (2º N) and Singapore (1º N), though all these sites lie within the equatorial belt and experience narrow temperature range of 23-25º C and abundant rainfall (Koh et al., 2005). The same species, C. malayensis was reported to breed in warmer months in waters of Australia (19º S), Bombay (19º N) and Hong Kong (22º N), but breeding intensity declined due to decrease in salinity during monsoon periods when there is heavy rainfall (Karande and Palekar, 1963; Bryan, 1965; Yan and Miao, 2004).
The decrease in breeding activity of Balanus amphitrite amphitrite at Bombay (Rege et al., 1980) and B. amphitrite communis at Cochin (Pillay and Nair 1972) was also observed at lower salinity. Contradictory to this, the breeding activity of tropical C. fissus was higher during the rainy seasonl in Costa Rica ((10º N) (Sutherland, 1990). Similarly the breeding activity in C. malayensis was not affected by high and low rainfall at west
Malaysia (Koh et al., 2005). It was suggested that salinity and rainfall are not the decisive factors affecting the production of embryos in tropical barnacles near the equator (Sutherland, 1990; Koh et al., 2005) as compared to barnacles inhabiting away from the equator (Karande and Palekar, 1963; Pillay and Nair, 1972; Rege et al., 1980).
The coast of Pakistan which is farther away from the equator does not experience much rainfall, thus no significant salinity variations. The salinity ranged between 37 to 45 ‰ at
Buleji and 37 to 42 ‰ at Manora during the study. Therefore, in the present study no correlation could be established between salinity and the number of brooders in the barnacle population.
The barnacle M. tintinnabulum produced 12,000 to 16,000 fertilized eggs per brood but eyed-embryos in eggs (releasing eggs) were 7466 to 8000 in numbers per brood. This showed that the survival rate is approximately 55 percent from fertilized egg to egg containing eyed-embryo. The reproductive capacity in A. amphitrite varied from
1,000 to 10,000 eggs per brood (El-Komi and Kajihara, 1991). Semibalanus balanoides is known to produce 4,000 to 10,000 small eggs which hatch into planktotrophic nauplii
(Crisp, 1986). The brood size of B. perforatus was reported to be 7,250 (Barnes and
Barnes, 1968) and 6,730 (Herbert et al, 2003) from English Channel. The average number of embryos were 3784 in B. amphitrite in mangroves at southern Mozambique
(Litulo, 2007). In another species, B. glandula fecundity was highest in oceanic waters, being 7,431 eggs and lowest 1,642 eggs in riverine waters at Oregon coast USA (Berger,
2009). On the whole the number of eggs per brood showed not much variation in different barnacle species at various locations.
The concentrations of biochemical constituents in an animal reflect its adaptive capacity in an environment. A number of biotic and abiotic factors including reproduction, food availability, temperature, humidity, salinity, dissolved oxygen may influence the biochemical and physiological conditions of crustaceans (Rosa and Nunes,
2003a, b; Oliveira et al., 2004; Vinagre et al., 2007).
In the present study protein, carbohydrate and lipid concentrations increased in the ovaries of M. tintinnabulum with the progression in gonadal maturation. The lowest concentrations of these biochemical constituents in immature ovaries and highest in mature ovaries is similar to other crustaceans where it has been reported that there is an increase in concentrations of protein, carbohydrate and lipid in ovaries with progression of maturation (Pillay and Nair, 1973; Read and Caulton, 1980; Rosa and Nunes, 2003a, b; Fatima et al., 2013; Fatima, 2013). The concentrations of protein, carbohydrate and lipid increased in the body tissue of M. tintinnabulum with progression in maturation in their respective ovaries. In other crustaceans, during the reproductive period an increase of protein in gonads, hepatopancreas and muscle have been reported (Rosa and Nunes,
2003a, b). Hepatopancreas are the main storage organ in crustaceans (Garcia et al.,
2002), but lipids get stored in muscle tissue and ovaries (Komatsu and Ando, 1992). In barnacles the tissue appeared to serve as a storage site, as hepatopancreas is absent in these animals. The concentration of carbohydrate was also highest in mature ovaries and their respective tissues indicating that carbohydrate is utilized during the maturation of ovaries along with protein and lipid in M. tintinnabulum. Glucose are required for proper functioning of various systems in crustaceans and its levels in hemolymph are maintained by storing in the form of glycogen in the hepatopancreas and muscles
(Vinagre and Da Silva, 2002; Oliveira et al., 2003).
The decrease of biochemical contents in the ovaries and tissue of M. tintinnabulum in summer after winter (brooding period) is similar to the study of Mizrahi and Achituv (1990, 1991) which reported that the biochemical components of body tissue decreased after breeding in two barnacle species, C. stellatus and E. depressa from the Mediterranean coast of Israel.
Proteins are the principal components of the eggs (García-Guerrero et al., 2003) and the protein concentrations were higher in winter in barnacles, which is the brooding period. It has been reported that feed containing higher protein contents facilitated faster naupliar development and better quality of cyprids (Baragi and Anil, 2015). Lipid is considered as energy provider during reproduction (Antunes et al., 2010), and in present study concentrations of lipid increased in gonad and tissue of barnacles during the brooding period.
The present study examined the reproductive pattern of barnacles, M. tintinnabulum and observed that breeding was not continuous in this species but preferred the winter season (lower temperature) for breeding on the coast of Pakistan, though in our waters the environmental conditions are stable and animals are expected to breed throughout the year. Reproduction in barnacles has been affected by temperature, salinity, photoperiod and food supply but it appeared that the expected factor may or may not affect the breeding in a particular latitude or location. For example rainfall and salinity are expected to affect the breeding in tropical barnacles near the equator, as there is heavy rainfall near equator which may change the salinity as well. But it has been reported that rainfall and salinity make no affect in the breeding of barnacles at equator
(Koh et al., 2005) as compared to barnacles away from the equator where these factors do decrease or increase breeding (Karande and Palekar, 1963; Pillay and Nair, 1972;
Rege et al., 1980).
Table 5.1. The macroscopic and histological appearance of the ovaries in Megabalanus tintinnabulum.
Maturity stage Macroscopic appearance Histological appearance Immature A thin light yellow ovary Ovary contains oogonia and pre- present in the basal vitellogenic oocytes. The follicle membrane. The weight of filled with connective tissues. The ovary ranged from 0.20 to oogonia has nucleus and a thin 0.78 gm with average layer of cytoplasm while thepre- weight 0.469 ± 0.125 gm. vitellogenic oocytesare larger in size and the cytoplasmic area more visible.
Growing stage Ovary filled one third of the The follicles filled with large mantle cavity, colour yellow number of early-vitellogenic or yellow with brownish oocytes and few pre-vitellogenic tinge. The weight of ovary oocytes. In early-vitellogenic ranged from 0.49 to 0.98 gm oocytes the oocyte showed he with average weight 0.721 ± presence of granules. 0.112 gm.
Mature stage Ovary filled the greater part The follicles contained late- of the mantle cavity, dark vitellogenic (mature) oocytes. In yellow in colour. The mature oocytes the yolk globules weight of ovary ranged are visible. from 0.74 to 1.50 gm with average weight 1.002 ± 0.178 gm.
Spent stage Follicles contain atretic oocytes, residual materials and some mature oocytes.
Table 5.2. The macroscopic and histological appearance of the testes in Megabalanus tintinnabulum.
Maturity stage Macroscopic appearance Histological appearance Immature Testes poorly developed and Testis showed the visible on teasing of tissue. The presence of spermatids diameter of the seminal vesicle and spermatogonia is less than the diameter of alimentary canal. Growing stage Testes moderately developed Testis showed the and visible through the cuticle. presence of spermatocytes The diameter of the seminal and spermatozoa vesicle is equal to the diameter of alimentary canal, milky white in colour. When pressed hardly white fluid oozes out. Mature stage Testes well developed and The testes densely packed occupying much of body cavity with spermatozoa clearly visible through the cuticle. The diameter of the seminal vesicle is greater than the diameter of alimentary canal, milky white in colour. On slight pressure the white fluid oozes out.
Table 5.3. Pearson’s correlation between mature ovaries or mature testes in M. tintinnabulum and temperature, salinity and chlorophyll-a at Buleji and Manora. *Correlation is significant at the 0.01 level.
Sites Temperature Salinity Chlorophyll-a
Mature ovaries Buleji Pearson Correlation 0.371 0.400 -0.196 Sig. (2-tailed) 0.074 0.055 0.358 N 24 24 24
Manora Pearson Correlation 0.517* 0.000 -0.237 Sig. (2-tailed) 0.010 0.999 0.197 N 24 24 24
Mature testes Buleji Pearson Correlation 0.104 -0.138 0.066 Sig. (2-tailed) 0.628 0.420 0.760 N 24 24 24
Manora Pearson Correlation 0.034 -0.055 0.067 Sig. (2-tailed) 0.857 0.800 0.756 N 24 24 24
60 Buleji Mature ovaries Mature testis 50
40
30
20
10
0 J F M A M J J A S O N D J F M A M J J A S O N D
70 Manora
60
50
40
30
20
10
0 J F M A M J J A S O N D J F M A M J J A S O N D
Table 5.4. Pearson’s correlation between brooding barnacles and temperature, salinity and chlorophyll-a at Buleji and Manora. *Correlation is significant at the 0.01 level.
Sites Temperature Salinity Chlorophyll-a
Brooding barnacles Buleji Pearson Correlation -0.900* -0.094 0.770* Sig. (2-tailed) 0.000 0.663 0.000 N 24 24 24
Manora Pearson Correlation -0.944* -0.134 0.783* Sig. (2-tailed) 0.000 0.531 0.000 N 24 24 24
Table 5.5. Mean length and width ± SD and size range of embryos of brooding Megabalanus tintinnabulum.
Stages Characteristics of Range (Average width Range (Average length ± embryo ± SD) µm SD) µm 1 Multicelluar 110-130 (115.6 ± 5.77) 190-240 (216.8 ±14.06)
2 Embryo with limb buds 110-140 (123.4 ± 7.45) 200-250 (227.6 ± 13.93)
3 Embryo with limbs and 120-160 (138.4 ± 12.51) 240-290 (270.0 ± 12.94) a naupliar eye
Table 5.6. The minimum, maximum, average with standard deviation concentrations of protein, carbohydrate and lipid in the ovaries during the gonadal maturation stages of Megabalanus tintinnabulum.
Mean concentrations (mg g-1) in ovaries Stage Protein Carbohydrate Lipid Min Max Av ± STD Min Max Av ± STD Min Max Av ± STD Immature 24.0 32.0 27.5 ± 2.4 5.0 6.5 5.5 ± 0.5 11.0 14.0 12.3 ± 0.9 Growing 33.0 45.0 36.8 ± 3.0 5.0 8.0 6.9 ± 1.0 10.5 16.0 13.5 ± 1.5 Mature 45.0 62.0 51.0 ± 5.4 5.9 11.0 7.8 ± 1.2 17.0 22.5 19.2 ± 1.6
Table 5.7. The minimum, maximum, average (with standard deviation) concentrations of protein, carbohydrate and lipid in the tissue during the gonadal maturation stages of Megabalanus tintinnabulum.
Mean concentrations (mg g-1) in tissue Stage Protein Carbohydrate Lipid Min Max Av ± STD Min Max Av ± STD Min Max Av ± STD Immature 15.0 21.0 17.2 ± 1.3 4.5 7.0 5.6 ± 0.7 6.8 9.4 7.8 ± 0.8 Growing 17.0 28.0 22.9 ± 2.8 5.0 8.0 7.0 ± 0.8 7.0 12.0 10.2 ± 1.6 Mature 35.0 45.0 38.3 ± 2.4 7.0 10.0 8.3 ± 0.6 10.0 15.0 12.6 ± 1.2
Table 5.8. Seasonal concentrations of protein, carbohydrate and lipid in the ovaries and tissues of Megabalanus tintinnabulum.
Ovaries Winter Spring Summer Autumn Protein mg g-1 42.8 ± 2.1a 36.9 ± 1.9b 37.1 ± 2.2b 40.2 ± 1.2ab
Carbohydrate 7.8 ± 0.3a 7.1 ± 0.1b 6.9 ± 0.2b 7.9 ± 0.3a -1 mg g
Lipid mg g-1 16.2 ± 0.9a 14.3 ± 0.1b 14.0 ± 0.7b 15.8 ± 0.4a
Tissues -1 a b b ab Protein mg g 27.6 ± 1.6 24.7 ± 1.5 25.4 ± 0.7 26.0 ± 0.0
Carbohydrate 7.2 ± 0.4 7.3 ± 0.2 6.7 ± 0.5 7.1 ± 0.0 -1 mg g Lipid mg g-1 10.8 ± 0.8a 9.2 ± 0.6b 9.1 ± 0.7b 10.8 ± 0.0a
Values in a row with different superscripts are significantly different ( P<0.05). Values without a superscript are not significantly different.
CHAPTER 6
Abundance of cyprid larvae on coast of Karachi, Pakistan 6.1. Introduction
The life cycle of marine invertebrates consist of a planktonic larval phase and an attached adult phase (Barnes, 1982). The marine invertebrate planktonic larvae found in high latitude waters do not have stored food and thus feed (planktotrophic) while those in lower latitude waters usually have stored food and do not need to feed (lecithotrophic)
(Crisp, 1985). After their planktonic larval stage, the larvae settle on the shore and metamorphose into sessile or motile adults to complete their life cycle (Barnes, 1982).
Barnacle larvae possess a planktonic larval stage consisting of six naupliar stages and one cypris stage which undergo settlement by attaching itself to the substratum and metamorphosis to recruit in the sessile adult population (Barnes, 1982; Caffey, 1985;
Connell, 1985). During their plankton life, larvae may be transported by currents and disperse over long distances (Scheltema 1968, 1986), thus recruiting in the adult population at localities that are often far from their parental sites. The time interval for the newly-settled individuals to become recruit varied between different organisms. In barnacles, the individuals younger than 30 days are called as settlers (Caffey, 1985;
Connell, 1985) and after 30 days of settlement the individuals which survived are called as recruits (Caffey, 1985). The location on the shore where the barnacle cypris settles is of prime importance to determine the probability of survival, the recruitment in the population and the reproductive success (Hui and Moyse,1987; Anderson, 1994).
Unfortunately, no accurate keys are available for identification of naupliar and cyprid larvae up to species level, though few identification keys for some cyprid barnacle species are available from US waters (Standing, 1980; Miller and Roughgarden, 1994).
Kamiya et al. (2012) discovered that the fluorescence patterns inside the cypris carapace are helpful for identification but only for live specimens. The SEM-based identification though reliable, is time consuming and not suitable for large-scale ecological survey of quantitative larval sampling (Chen et al., 2013). The other tool utilized for accurate identification of individual larvae is molecular-based identification (Power et al., 1999;
Endo et al., 2010; Yorisue et al., 2012).
The most prominent morphological characteristics of cyprids are an enclosing bivalve carapace that is anteriorly rounded and posteriorly tapering. It possesses a pair of antennules, six pairs of biramous thoracic limbs, and a pair of caudal appendages
(Walley, 1969; Warker et al., 1987). For the discrimination of cyprid larvae to genus or species level, several previous workers have utilized two morphological measurements, that is, carapace length and carapace height. For example, the cyprids of Chthamalus stellatus and C. montagui in British waters were differentiated on the basis of carapace length (Burrows et al., 1999), which was verified by molecular study using mt DNA
RFLP profiles (Power et al., 1999). Later it was established that length of the cypris carapace can be a diagnostic characteristics for distinguishing two chthamalid barnacle species, C. stellatusand C. montagui (O’Riordan et al., 2001). Pineda et al. (2002) identified the cyprids of Semibalanus balanoides by using the carapace length and seasonal presence.
The object of study was to monitor the temporal variation in cyprid larvae abundance in the coastal waters of Karachi on the basis of carapace length and height, as in the present study the recruitment was observed during March to May and September and the brooding activity was observed during October to February in Megabalanus tintinnabulum.
6.2. Materials and Methods
The zooplankton samples were collected during the high tide at a fixed site within
1.0 km off Buleji coast, Karachi from September 2012 to December 2013. The samples were collected with a boat towing the bongo net of 56 cm mouth diameter and 300 m mesh horizontally at uniform speed in subsurface water for about 100 m. Towing times varied according to the sea condition, but the water sample averaged to 23 m−3 in each tow. Samples were collected in 300 ml plastic bottles and preserved in 4% formaldehyde-seawater. Three subsamples of 10 ml were analyzed for the numeric abundance of cyprid larvae. The numeric abundance was presented as number per m3 based on the volume of water filtered through the net which was calculated as V= πr2 d.
Where, V is the volume of water filtered through the net, r is radius of the mouth of plankton net and d is distance through which the net towed. The carapace length of a cyprid was defined as the maximum distance from anterior to posterior margins of the carapace. The carapace height was defined as the maximum distance between the dorsal and ventral margin of carapace at the deepest point. The length and height of carapace of
10 cyprids was taken each month.
6.3. Results
During the study two species of cyprid larvae were identified based on the carapace length as Megabalanus tintinnabulum (range 620-740 µm) and Chthamalus malayensis (range 300-390 µm) (Table 6.1.). The cyprid of two other species,
Amphibalanus amphitrite and Tetraclita rufotincta, which are found on the shore were missing from the samples. The carapace length and height (depth) of cyprid larvae of some barnacle species as reported by various sources is shown in Table 6.2. The length and height of cyprid’s carapace of M. tintinnabulum is reported for the first time in this study while the length and height of cyprid’s carapace of C. malayensis in present study is almost similar to length and height of the same species from Hong Kong (Yan and
Chan, 2001). The cyprid larvae of M. tintinnabulum in the coastal waters were found during autumn and winter and their number ranged between 2-9 individuals m−3 being highest in January’13 and lowest in October’13 (Table 6.3.). The cypris of C. malayensis was present in late winter-spring and their number ranged between 1-5 individuals m−3
(Table 6.3.).
6.4. Discussion
In the present study the morphometric characteristics, carapace length and height of cyprids were used for identification and the study showed the presence of cyprids of two barnacle species, M.tintinnabulum and C.malayensis. Though it has been pointed out that the size range of the carapace can vary between areas and under different nutrient conditions (Crisp1962; Standing 1980) but there are several studies which have based the identification of cyprid larvae on carapace lengths. For example, Burrows et al. (1999) used the carapace length to differentiate the cyprids of Chthamalus stellatus and C. montagui in British waters. The differentiation of two species on the basis of carapace length was later verified by molecular study using mt DNA RFLP profiles (Power et al.,
1999). The length and height of the carapace of cyprids was used as a diagnostic characteristics for distinguishing two chthamalid barnacle species, C. stellatus and C. montagui (O’Riordan et al., 2001). Pineda et al. (2002) identified the cyprids of
Semibalanus balanoides by using the carapace length and seasonal presence. Later carapace length and height have been used to identify species (Jenkins, 2005). However, the use of carapace length and height is useful to distinguish between some species of cyprids which differ in sizes but is not of use where many species are found together and are similar in size, e.g., in the Mangrove forest waters of Malaysia (Wong et al., 2014).
At Buleji, four species of acorn barnacles are found in the intertidal zone,
Amphibalanus amphitrite, Tetraclita rufotincta, Megabalanus tintinnabulum and
Chthamalus malayensis. In relation to adult size, the four species differed and the biggest is M. tintinnabulum and the smallest C. malayensis, the same phenomenon applies to the larvae (Burrows et al. 1999; Ross et al. 2003; Doinisio et al., 2014).When we compare the carapace length and carapace height of the cyprids in the present study to the other reported wild or laboratory reared cyprids (Table 5.4.), it can be concluded that based on carapace length and height the two cyprids are of M. tintinnabulum and C. malayensis.
Discrepancy in carapace length and height of cyprids of the same species in different studies has been related to environmental and geographical factors (O’Riordan et al.,
2001; Desai et al., 2006).
The plankton samples in our study contained only two species of cyprids, M. tintinnabulum and C. malayensis, though 4 species of adult barnacles are abundantly present on the coast of Buleji and other coasts of Pakistan. The absence of cyprids of two barnacle species, A. amphitrite and T. rufotincta may be due to the fact that the cyprid larvae are poor swimmers and thus the ocean currents influence their horizontal distribution and water density affect the vertical distribution of the larvae (Govindarajan et al., 2015). In present study the sampling was done in the subsurface waters only, therefore, there is need to cover various depth in water column to analyze the distribution and abundance of cyprid larvae. Furthermore, there is a need to confirm the morphometric based identification of cyprid larvae in the present study through molecular-based techniques.
In the present study the cyprid larvae of M. tintinnabulum were found during the period from October to February (autumn-winter) when the brooding activity was observed in the adults of this species at Buleji and Manora. The recruitment at Buleji was observed from March to May and in September while at Manora smaller individuals were not encountered (see Chapter 3). Therefore, it can be suggested that the March to
May settlers may have come from the local population which are breeding from October to February but September settlers may have come from population elsewhere. This is similar to the study of Chan and Williams (2004) on Tetraclita spp. from Hong Kong in which the recruitment after the reproductive season was related to the larval populations around Hong Kong and the recruitment earlier than the reproductive season of Tetraclita spp. was related to the larval populations which may have come from elsewhere. The populations of T. rubescens along the California coast possessed a high gene flow, suggesting that the recruits came from both local and geographic populations (Ford and
Mitton, 1993). A correlation between larval supply and settlement has been reported
(Minchinton and Scheibling, 1991; Jeffery and Underwood, 2000; Ross, 2001; Ma,
2005), while some authors reported that no such correlation exist (Miron et al., 1995;
Olivier et al., 2000; Porri et al., 2006; Rilov et al., 2008). Though in present study it was not possible to identify the cypris larvae at molecular level but there is a need to pay attention on the detection and monitoring of larval supply of the barnacle species in the wild plankton samples along the coast of
Pakistan. As the taxonomic keys available showed no accuracy for identification of naupliar and cypris larvae to the species level, therefore, molecular-based identification should be utilized for accurate identification of individual larvae.The identification of cyprids in the plankton samples could serve as early warning of unwanted invasive species present in the coastal waters and which in future could pose problems in future as biofoulers.
Table 6.1. Minimum, maximum and mean ± STD (µm) of carapace length and depth of cyprid larvae in the plankton samples collected from Karachi coast during the period from September 2012 to December 2013.
Cyprid larvae of Carapace length Carapace depth M. tintinnabulum (µm) (µm) Minimum 620 290 Maximum 740 350 Mean ± STD 685.3 ± 28.8 315.7 ± 17.9 Cyprid larvae of C. malayensis Minimum 300 150 Maximum 390 190 Mean ± STD 347.1 ± 25.1 178.6 ± 12.8
Table 6.2. Carapace length and height of cyprid larvae from various sources. N/A = not available.
Species Carapace Carapace Reference length (µm) height (µm) Amphibalanus amphitrite 510 N/A Karande (1974) 450.0 ± 20.0 N/A Egan and Anderson (1986) 550 250 Glenner and Hoeg (1995) 421-480 211-230 Anil et al. (2001) 480.75 ± 38.04 227.79±18.03 Wong et al. (2014)
Tetraclita squamosa 589 290 Chan (2003) T. japonica 557 313 Chan (2003) T.rufotincta 589 Barnes and Achituv (1981)
Chthamalus malayensis 300-390 150-190 This study C. malayensis 410-440 210-230 Yan and Chan (2001) C. montagui 375-525 Power et al. (1999) C. stellatus 525-700 Power et al. (1999) C. dalli 448 229 Miller et al. (1989) C. fissus 493 246 Miller et al. (1989)
Megabalanus tintinnabulum 685.3 ± 28.8 315.7 ± 17.9 This study M. azoricus 602 ± 6.8 306 ± 9.8 Dionisio et al. (2013)
Table 6.3. Numeric abundance (number per m3) of cyprid larvae in the samples during the period from September 2012 to December 2013.
Months Cyprid of Cyprid of M. tintinnabulum C. malayensis September 2012 0 0 October 0 0 November 0 0 December 8 0 January 2013 9 0 February 2 1 March 1 3 April 0 5 May 0 0 June 0 0 July 0 0 August 0 0 September 0 0 October 2 0 November 6 0 December 5 0
7. General Discussion Megabalanus tintinnabulum is a tropical barnacle of large size, with place of origin being West Africa and parts of the Indo-Pacific. With the passage of time this species has been reported to spread in tropics of the Pacific, Atlantic and Indian oceans
(Young, 1998). It has spread to the Netherlands, Belgium, Mediterranean Sea and
Australia coasts and to other countries through attachments on ship’s hulls (Jones, 1992;
Thiyagarajan et al., 1997; Kerckhof & Cattrijsse, 2001; Kerckhof et al., 2007; WoRMS,
2015). However, in literature no information is available on the population parameters and reproduction of this species.
The present study throw light on the population dynamics and reproductive pattern of acorn barnacles, M. tintinnabulum from two rocky shores of the Karachi, namely, Manora and Buleji during the period from January 2012 to December 2013.
Preliminary survey revealed four species of barnacles, namely, Chthamalus malayensis,
Amphibalanus Amphitrite, Tetraclita rufotincta and Megabalanus tintinnabulum occurred on two rocky shores. The barnacles were identified based on the shell morphology following the literature of Rizvi and Moazzam (2006), Chan et al. (2009) and Tsang et al. (2012). Though morphological approach helped in the identification of
M. tintinnabulum, the identification was further confirmed by using DNA barcoding approach based on the fragment of mitochondrial gene cytochrome c oxidase subunit I
(COI).
Tetraclita ehsani was described and identified as a new species from T. rufotincta due to diagnostic differences in tergum morphology from Iranian waters (Shahdadi et al.,
2011). Tetraclita ehsani has been reported from the Iranian coast and NW India (Tsang et al., 2012). The coast of Pakistan extends from the Iranian border in the north-west to the Indian border on the south-east. Therefore, the barnacles of T. rufotincta found along the coast of Pakistan should be checked for the presence of T. ehsani although only T. rufotincta has been reported along the coast of Pakistan (Rizvi and Moazzam, 2006) and reported from two rocky shores in present study.
In present study the cyprid of barnacles were identified on the basis of carapace length and height and by comparing their sizes with other similar species reported from elsewhere. In order to confirm the cyprid of M. tintinnabulum and other species found in the coastal waters of Pakistan, there is need to culture their eggs in the laboratory to study the characteristics of nauplii and cyprids for future identification. The identification of cyprid larvae can be based on molecular approach for further confirmation.
The analyses of population parameters of M. tintinnabulum on two rocky shores
(18 km apart) revealed that there was significant variations in the density, size and growth rate of this species at two sites, though the environmental conditions were similar. While comparing the population parameters at spatial scales of 1000s to100s of kilometres, 1000s of metres, 10s of metres and less than a metre, it was observed that the highest variability occurred over the largest spatial scale (100s to 1000s of kilometres) and very small spatial scales (<1 m) (Hyder et al., 1998; Benedetti-Cecchi et al., 2000;
Jenkins et al., 2001) but in present study variations occurred at 10s of kilometer. There is need to undertake studies on the population parameters of barnacle species on the coasts of Pakistan and investigate the variations at different large spatial scale between shores and sites within the shore. To study the role of the ecological and biogeophysical processes initiating spatial variation in reproductive capacity is important. It has been reported that the reproductive output vary along horizontal gradient with the result that animals in some places produce more offspring than the other places and this have been linked to genetic or environmental variation (Barnes and Barnes, 1968; Bertness, et al., 1991; Hughes et al.,
2000; Phillips, 2007). It has been demonstrated that all intertidal sites are not similar in terms of their reproductive capacity in the barnacle species (Leslie et al., 2005; Berger,
2009). However, in the present study the reproductive capacity showed no difference in
M. tintinnabulum at Manora and Buleji which were 18 km apart. There is a need to study the spatial and temporal variations in the population parameters and reproductive capacity of various barnacle species found on coasts of Pakistan.
Though M. tintinnabulum is used in some localized parts of the world as food
(Lopez et al., 2010) but the size that it attained in two years at Buleji (33.7 mm) and
Manora (41.8 mm) appeared to be suitable for harvest. Barnacles, M. azoricus of size >
28 mm has been considered suitable for harvesting and has potential for mariculture
(Pham et al., 2011). Considering the size attained by M. tintinnabulum in Pakistan, it can be fished on commercial scale and utilized for mariculture in future. The present study provides information on the biological aspects of the barnacle species, M. tintinnabulum, which can be utilized for its effective management. It is suggested that further studies should be conducted on the population parameters and brooding pattern of M. tintinnabulum in the Asian region including the larval supply settlement and recruitment of this species, in order to provide basic data for future comparative studies.
8. REFERENCES
Achituv Y (1972). The zonation of Tetrachthamalus oblitteratus Newman, and Tetraclita
squamosa rufotincta Pilsbry in the Gulf of Eilat Red Sea. Journal of Experimental
Marine Biology and Ecology, 8:73-81.
Achituv Y (1981). The biochemical composition of the nauplius stages of Tetraclita
squamosa rufotincta (Pilsbry). Journal of Experimental Marine Biology and
Ecology, 51:241-246.
Achituv Y and Barnes H (1976). Studies in the biochemistry of cirripde eggs. V.
Changes in the general biochemical composition during development of
Chthamalus stellatus(Poli). Journal of Experimental Marine Biology and
Ecology, 22:263-267.
Achituv Y and Barnes H (1978). Studies in the biochemistry of cirripede eggs. VI.
Changes in the general biochemical composition during development of
Tetraclita squamosa rufotincta (Pilsbry), Balanus perforatus (Brug) and Pollicipes
cornucopia (Darwin). Journal of Experimental Marine Biology and Ecology,
32:171-176.
Achituv Y and Wortzlavski A (1983). Studies in the biochemistry of cirripede eggs. VII.
Changes in the general biochemical composition during development of
Chthamalus dentatuskrauss and Octomeris angulosasowerby. Journal of
Experimental Marine Biology and Ecology, 69:137-144. Achituv Y, Blackstock J, Barnes M and Barnes H (1980). Some biochemical constituents
of stage I and II nauplii of Balanus balanoides (L.) and the effect of anoxia on
stage I. Journal of Experimental Marine Biology and Ecology, 42:1-12.
Ahmed M (1980). The breeding and recruitment of marine animals of the coast of
Pakistan bordering the Arabian Sea. In: Proceedings of First Pakistan Congress of
Zoology, Published by Zoological Society of Pakistan, Pakistan, pp. 55-96.
Ahmed Mand Hameed S (1999a). Species diversity and biomass of marine animal
communities of Buleji rocky ledge, Karachi, Pakistan. Pakistan Journal of
Zoology, 31: 81-91.
Ahmed M and Hameed S (1999b). A comparative study of the biomass of animals and
seaweeds of the rocky shore of Buleji near Karachi, Pakistan. Pakistan Journal of
Biological Sciences, 2:365-369.
Anderson DT (1994). Barnacles:Structure, function, development and evolution.
London, Chapman and Hall.Pp. 377.
Anil A(1986). Studies on marine biofouling in the Zuari estuary (Goa) west coast of
India. Ph. D. Thesis, University of Karnataka, India.
Antunes GF, Amaral APN, Ribarcki FP, Wiilland EF, Zancan DE and Vinagre AS
(2010). Seasonal variations in the biochemical composition and reproductive
cycle of the ghost crab Ocypode quadrata (Fabricius, 1787) in Southern Brazil.
Journal of Experimental Zoology, 313:280-291.
Appelbaum L, Achituv Y and Mokday O (2002). Speciation and the establishment of
zonation in an intertidal barnacle: specific settlement vs. selection. Molecular
Ecology, 11:1731-1737. Ayub Z, Siddiqui G and Ahmed M (2006). Molluscan biodiversity in Pakistan. World
Aquaculture Magazine, 37:44-48 and 64.
Baber BJ, Getchell R, Schumway S and Shick D (1988). Reduced fecundity in a deep-
water population of the giant Scallop Placopecten magallanicus in the Gulf of
Maine, USA. Marine Ecology Progress Series, 42:207-212.
Ballantine WJ (1961). A biologically-defined exposure scale for the comparative
description of rocky shores. Field Study, 1:1-19.
Bano A and Siddiqui PJZ (2003). International cynobacterial diversity on rocky shore at
Buleji near Karachi, Pakistan. Pakistan Journal of Botany, 35: 27-36.
Banse K (1968). Hydrography of the Arabian Sea shelf of India and Pakistan and effects
on demersal fishes. Deep Sea Research, 15:45-79.
Banse K (1987). Seasonality of phytoplankton chlorophyll in the central and northern
Arabian Sea. Deep Sea Research, 34:713-723.
Baragi LV and Anil AC ( 2015). Interactive effect of elevated pCO2 and temperature on
the larval development of an inter-tidal organism, Balanus amphitrite Darwin
(Cirripedia:Thoracica). Journal of Experimental Marine Biology and Ecology,
471: 48-57.
Barnes H and Barnes M (1967). The effect of starvation and feeding on the time of
production of egg masses in the boreoarctic cirripede Balanus balanoides (L.).
Journal of Experimental Marine Biology and Ecology, 1:1-6.
Barnes H and Barnes M (1968). Egg numbers, metabolic efficiency of egg production
and fecundity; local and regional variations in a number of common cirripedes.
Journal of Experimental Marine and Biology and Ecology, 2:35-53. Barnes H and Barnes M (1975). The general biology of Verruca stroemia (O. F. Miiller).
V. Effect of feeding, temperature, and light regime on breeding and moulting
cycles. Journal of Experimental Marine Biology and Ecology, 19:227-32.
Barnes Hand Blackstock J (1973). Estimation of lipid in marine animals and tissues:
Detailed investigation on the sulpho-phospho vanillin method for total lipid.
Journal of Experimental Marine Biology and Ecology, 12:103-118.
Barnes H and Crisp DJ (1956). Evidence of self-fertilization in certain species of
barnacles. Journal of the Marine Biological Association of the United Kingdom,
35:6321-639.
Barnes H and Stone RL (1973). The general biology of Verruca stroemia (O. F. Miiller).
II. Reproductive cycle, population structure, and factors affecting release of
nauplii. Journal of Experimental Marine Biology and Ecology, 12:279-97.
Barnes H (1959). Stomach contents and micro-feeding of some common cirripedes.
Canadian Journal of Zoology, 37:231-236.
Barnes H (1963). Light, temperature and the breeding of Balanus balanoides.Journal
California. Biological Bulletin,154:262-281.
Barnes H, Barnes M, Finlayson DM and Platigorsky J (1963). The effect of desiccation
and anaerobic conditions on the behaviour, survival and general metabolism of
three common cirripedes. Journal of Animal Ecology, 82:233-252.
Barnes M(1989).Egg production in cirripedes. Oceanography and Marine Biology: an
annual Review, 27:91-166.
Barnes M (1992). The reproductive periods and condition of the penis in several species
of common cirripedes. Oceanography and Marine Biology, 30:483-525. Barnes M (1999). The mortality of intertidal cirripedes. Oceanography and Marine
Biology, 37:153-244.
Barnes RD (1982). Invertebrate Zoology.Holt-Saunders International Edition.
Bedecarratz PC, López DA, López BA and Mora OA (2011). Economic feasibility of
aquaculture of the giant barnacle, Austromegabalanus psittacus in southern Chile.
Journal of Shellfish Research, 30:147-157.
Beach DB (1972). Reassignment of Balanus tintinnabulum maroccana Broch. Quarterly
Journal of the Florida Academy Sciences, 35:5-7.
Begon M, Harper JL and Towsend CR (1996). Ecology:individuals, populations and
communities. Oxford: Blackwell Science.
Benedetti-Cecchi L, Acunto S, Bulleri F, Cinelli F (2000). Population ecology of the
barnacle Chthamalus stellatus in the northwest Mediterranean. Marine Ecology
Progress Series, 198:157-170.
Benny NC and Gray AW (2004). Population dynamics of the acorn barnacles, Tetraclita
squamosal and Tetraclita japonica (Cirripedia:Balanomorpha), in Hong Kong.
Marine Biology, 146:149-160.
Berger MS (2009). Reproduction of the intertidal barnacle Balanus glandula along an
estuarine gradient. Marine Ecology, 30: 346-353.
Bertalanffy L Von (1938). A quantitative theory of organic growth (inquiries on growth
laws – II). Human Biology, 10:181-213.
Bertness MD, Gaines SD, Bermudez D and Sandford E (1991).Extreme spatial variation
in the growth and reproductive output of the acorn barnacle Semibalanus
balanoides. Marine Ecology Progress Series, 75:91-100. Bertness MD and Leonard GH (1997). The role of positive interactions in communities:
lessons from intertidal habitats. Ecology, 78:1976-1989.
Bertness MD (1989). Intraspecific competition and facilitation in a northern acorn
barnacle population. Ecology, 70: 257-268.
Bertness MD, Gaines SD and Yeh SM (1998). Making mountains out of barnacles: the
dynamics of acorn barnacle hummocking. Ecology, 79:1382-1394.
Bertness MD, Gaines SD, Bermudez D and Sandford E (1991). Extreme spatial variation
in the growth and reproductive output of the acorn barnacle Semibalanus
balanoides. Marine Ecology Progress Series, 75:91-100.
Bertness MD, Gaines SD and Whale RA (1996). Wind-driven settlement patterns in the
acorn barnacle Semibalanus balanoides. Marine Ecology Progress Series, 137:
103-110.
Bhattacharya CG (1967). A simple method of resolution of a distribution into Gaussian
components. Journal of Biometrics Society, 23:115–135.
Bosman AL and Hockey PAR (1988a). Life-history patterns of populations of the limpet
Patella granularis: the dominant roles of food supply and mortality rate.
Oecologia, 75: 412-419.
Bosman AL and Hockey PAR (1988b). The influence of primary production rate on the
population dynamics of Patella granularis, an intertidal limpet. Marine Ecology,
9:181-198.
Bowman RSand Lewis JR (1986). Geographical variation in the breeding cycles and
recruitment of Patella spp. Hydrobiologia, 142:41-56. Brethes JC, Ferreyra G and De La Vegas S (1994). Distribution, growth and reproduction
of limpet Nacella (Patinigera) concinna (Strebel, 1908) in relation to potential
food availability, in Esperanza Bay (Antarctic Peninsula). Polar Biology, 14:16-
170.
Brünnich MT (1772). Zoologiae Fundamenta PraelectionibusAcademicis Accomodata.
Pelt, Copenhagen. (Published in Latin 1771-1772).
Buckeridge JS (1995). Phylogeny and biogeography of the primitive Sessilia and a
consideration of a Tethyan origin for the group. New Frontiers in Barnacle
Evolution, Crustacean issues, 10:255-268.
Bucklin A, Steinke D and Blanco-Bercial L (2011). DNA barcoding of marine metazoa.
Annual Review of Marine Science, 3:471-508
Buhl-Mortensen L and Høeg JT (2006). Reproduction and larval development in three
scalpellid barnacles Scalpellum scalpellum (Linnaeus, 1767), Ornatoscalpellum
stroemii (M. Sars 1859) and Arcoscalpellum michelottianum (Seguenza 1876),
Crustacea: Cirripedia: Thoracica): Implications for reproduction and dispersal in
the deep-sea. Marine Biology, 149: 829-844.
Burrows MT, Hawkins SJ and Southward AJ (1992). A comparison of reproduction in
co-occurring chthamalid barnacles, Chthamalus stellatus (Poli) and Chthamalus
montagui. Canadian Journal of Zoology, 59:893-901.
Burrows M, Hawkins S and Southward A (1999). Larval development of the intertidal
barnacles Chthamalus stellatus. Journal of the Marine Biological Association of
the United Kingdom, 79: 93-101. Buschbaum C (2001). Selective settlement of the barnacle Semibalanus balanoides (L.)
facilitates its growth and reproduction on mussel beds in the Wadden Sea.
Helgoland Marine Research, 55:128-134.
Caffey HM (1985). Spatial and temporal variation in settlement and recruitment of
intertidal barnacles. Ecological Monographs, 55:313-332.
Carlton JT, Newman WA and Pitombo FB (2011). Barnacle invasions: Introduced,
cryptogenic, and range expanding Cirripedia of North and South America. In
Galil, BA, Clark PF and Carlton, JT (eds.) In the Wrong Place – Alien Marine
Crustaceans: Distribution, Biology and Impacts. Invading Nature - Springer
Series in Invasion Ecology, 6. Dordrecht, Springer. Pp. 159-213.
Carroll ML (1996). Barnacle population dynamics and recruitment regulation in south
central Alaska. Journal of Experimental Marine Biology and Ecology, 199: 285-
302.
Chan BKK (2001). Studies on Tetraclita squamosa and Tetraclita japonica (Cirripedia:
Thoracica) I. Adult morphology. Journal of Crustacean Biology, 21:616-630.
Chan BKK, Williams GA (2004). Population dynamics of the acorn barnacles Tetraclita
squamosa and Tetraclita japonica in Hong Kong. Marine Biology, 146:149-160.
Chan BKK, Prabowo R and Lee KS (2009). Crustacea fauna of Taiwan: Barnacles, Vol.
1 - Cirripedia: Thoracica excluding the Pyrgomatidae and Acastinae. National
Taiwan Ocean University Press, Keelung. Pp 297.
Chan BKK, Tsang LM and Chu KH ( 2007a). Morphological and genetic differentiation
of Tetraclita in E. Asia: description of a new species of Tetraclita. Zoological
Scripta, 36:79-91. Chan BKK, Tsang LM and Chu KH (2007b). Cryptic diversity of the Tetraclita
squamosa complex (Crustasea: Cirripedia) in Asia: Description of a new species
from Singapore. Zoological Studies, 4:46-56.
Chapman JW, Breitenstein RA and Carlton JT (2013). Port-by-port accumulations and
dispersal of hull fouling invertebrates between the Mediterranean Sea, the
Atlantic Ocean and the Pacific Ocean. Aquatic Invasions, 8:249-260.
Chapman T, Arnqvist G, Bangham J and Rowe L (2003). Sexual conflict: Trends
Ecological. Evolution, 18:41-47.
Charnov EL (1987). Sexuality and hermaphroditism in barnacles: a natural selection
approach. In Southward AJ (ed.) Barnacle Biology, Crustacean
issues5,.Rotterdam: A A Balkema. Pp. 89-104.
Chen HN, Høeg J TandChan BK (2013). Morphometric and molecular identification of
individual barnacle cyprids from wild plankton: an approach to detecting fouling
and invasive barnacle species. Biofouling, 29:133-145.
Choi K, Anderson D and Kim C (1992). Development of the Megabalanine
BalanomorphMegabalanus rosa(Pilsbry) (Cirripedia:Balanidae). Proceedings of
the Linnean Society of New South Wales, 113:175-184.
Clarke A, Prothero-Thomas E, Beaumont JC, Chapman AL and Brey T (2004). Growth
in the limpet Nacella concinna from contrasting sites in Antarctica. Polar
Biology, 28: 62-71.
Cob ZC, Arshad A, Bujang JP and Ghaffar MA (2008). On the biology and basic
characteristics of the population dynamic of the dog conch, Strombus canarium
Linnaeus, 1758 (Strombidae). Journal of Biosciences, 19:73-89. Cob ZC, Arshad A, Bujang JS, Nurul Amin, SM and Mazlan AG (2008). Growth,
mortality, recruitment and yield-per-recruit of Strombus canariumLinnaeus, 1758
(Mesogastropoda:Strombidae) from the West Johor Straits, Malaysia. Research
Journal of Fisheries and Hydrobiology, 32:71-77.
Cohen OR, Walters LJ and Hoffman EA (2014). Clash of the titans: a multispecies
invasion with high gene flow in the globally invasive titan acorn barnacle.
Biological Invasions, 16:1743-1756.
Conn DB (1991). Atlas of Invertebrate Reproduction and Development. New
York:Wiley-Liss.
Connell JH (1961a). Effects of competition and predation by Thais lapillus and other
factors on natural populations of the barnacle Balanus balanoides. Ecological
Monographs, 31:61-104.
Connell JH (1961b). The influence of interspecific competition and other factors on the
distribution of the barnacle Chthamalus stellatus. Ecology, 42:710-723.
Connell JH (1985). The consequences of variation in initial settlement vs post settlement
mortality in rocky intertidal communities. Journal of Experimental Marine
Biology and Ecology, 93:11-45.
Connolly SR, Menge BA and Roughgarden J (2001). A latitudinal gradient in
recruitment of intertidal invertebrates in the northeast Pacific Ocean. Ecology,
82:1799-1813.
Cornwall IE (1951). The barnacles of California. Wasmann Journal of BioIogy, 9:311-
346. Cornwall IE (1955). The barnacles of British Columbia. British Columbia Provincial
Museum Handbook, 7:1-69.
Crisp DJ (1950). Breeding and distribution ofChthamalus stellatus.Nature (London),
166: 311-312.
Crisp DJ (1959). The rate of development of Balanus balanoides (L.) embryos in vitro.
Journal of Animal Ecology, 28:119-132.
Crisp DJ (1960). Factors influencing growth-rate in Balanus balanoides. Journal of
Animal Ecology, 29:95-116.
Crisp DJ(1962).The planktonic stages of the Cirripedia Balanusbalanoides (L.) and
Balanus balanus (L.) from north temperatewaters. Crustaceana, 3:207-211.
Crisp DJ (1974). Factors influencing the settlement of marine invertebrate larvae. In:
Grant PT and Mackie AM (eds.) Chemoreception in marine organisms. Academic
Press, London, pp. 177-265.
Crisp DJ(1985). Recruitment of barnacle larvae from the plankton. Bulletin of Marine
Science, 37:478-486.
Crisp DJ (1986). A comparison between reproduction of high- and low-latitude
barnacles, including Balanus balanoides and Tetraclita (Tesseropora) pacifica. I:
Thompson M F, Sarojini R and Nagabhushanam R (eds.) Biology of Benthic
Marine Organisms: Techniques and Methods as Applied to the Indian Ocean.
Oxford and IBH Publishing Co., New Delhi. Pp. 69-84.
Crisp DJ and Patel B (1961). The interaction between breeding and growth rate in the
barnacle Elminius modestus Darwin. Limnology and Oceanography, 6:105-115. Cruz T and Hawkins SJ (1998). Reproductive cycle of Pollicipes pollicipes at Cabo de
Sines, south-west coast of Portugal. Journal of the Marine Biological Association
of the United Kingdom, 78:483-496.
Dahl E (1956). Some crustacean relationships. In: Wingstrand KG (ed.) Bertil Hanstrom.
Zoological papers in honors of his sixty-fifth birthday. Zoological Institute, Lund,
Sweden. Pp. 138-147.
Dang C, de Montaudouin X, Gam M, Paroissin, C, Bru N and Caill-Milly N (2010). The
Manila clam population in Arcachon Bay (SW France): can it be kept
sustainable? Journal of Sea Research, 63:108-118.
Daniel A (1958). The development and metamorphosis of three species of sessile
barnacles. Journal of Madras University, 28:23-47.
Darwin C (1854). A monograph of the subclass Cirripedia.Ray Society Publications,
London.Pp. 684.
Dattesh DVand Anil A (2005). Recruitment of the barnacle Balanus amphitritein a
tropical estuary: implications of environmental perturbation, reproduction and
larval ecology. Journal of the Marine Biological Association of the United
Kingdom, 85:909–920.
Davenport J, Berggren MS, Brattegard T, Brattenborg N, Burrows M, Jenkins S,
McGrath D, MacNamara1 R, Sneli JA, Walker G, Wilson S (2005). Doses of
darkness control latitudinal difference in breeding date in the barnacle
Semibalanus balanoides. Journal of the Marine Biological Association of the
United Kingdom, 85:59-63. Denley EJ, Underwood AJ (1979). Experiments on factors influencing settlement,
survival, and growth of two species of barnacles in New South Wales. Journal of
the Marine Biological Association of the United Kingdom, 36:269-293
Denny MW (1988). Biology and the mechanics of the wave-swept environment.
Princeton University Press, Princeton N. J. Pp. 329.
Desai DV, Anil AC and Venkat K (2006). Reproduction in Balanus amphitrite Darwin
(Cirripedia: Thoracica): influence of temperature and food concentration. Marine
Biology, 149:1431-1441.
Desai DV and Anil AC (2005). Recruitment of the barnacle Balanus amphitritein a
tropical estuary; implications of environmental perturbation, reproduction and
larval ecology. Journal of the Marine Biological Association of the United
Kingdom, 8:909-920.
Dhandapani K and Fernando SA (1994). Fecundity of some sessile barnacles with
emphasis on fugitive forms from Poto Novo, South India. In Thompson MF,
Nagabhushanam R, Sarojini R and Fingerman M (eds.) Recent Developments in
Biofouling Control. Rotterdam: A. A. Balkema. Pp. 133-140.
Dionisio M, Rodrigues A and Costa A (2007). Reproductive biology of Megabalanus
azoricus (Pilsbry), the Azorean barnacle. Invertebrate Reproduction and
Development, 50:155-162.
Dionisio M, Rodrigues A and Cost A (2014). A description of the larval development of
Megabalanus azoricus (Pilsbry, 1916) reared in the laboratory. Helgoland Marine
Research, 68:89-98. Dubios M, Gilles KA, Hamilton JK, Rebers PA and Smith F (1956). Colorimetric
method for determination of sugars and related substances. Analytical Chemistry,
28:305-356.
Dye AH (1992). Recruitment dynamics and growth of the barnacle Tetraclita serrata on
the east coast of southern Africa. Estuarine, Coastal and Shelf Science, 35:167-
177.
Dye AH (1993). Aspects of the population dynamics of Chthamalus dentatus (Crustacea:
Cirripedia) on the Transkei coast of Southern Africa. South African Journal of
Marine Science, 13:25-32.
Ebert TA and Russell MP (1994). Allometry and model II non-linear regression. Journal
of Theoretical Biology, 168:367-372.
Ecoutin JM, Albaret J Jand Trape S (2005). Length-weight relationships for fish
populations of a relatively undisturbed tropical estuary: the Gambia. Fisheries
Research, 72:347–51.
Egan A and Anderson D (1987). Larval development of the Megabalanine Balanomorph
Austromegabalanus nigrescens (Lamarck) (Cirripedia, Balanidae). Australian
Journal of Marine and Freshwater Research, 38:511-522.
Egan A and Anderson D (1988). Larval development of the coronuloid barnacles
Austrobalanus imperator (Darwin), Tetraclitella purpurascens (Wood) and
Tesseropora rosea (Krauss) (Cirripedia: Tetraclitidae). Journal of Natural
History, 22:1379-1405.
El-Komi MM and Kajihara T (1991). Breeding and moulting of barnacles under rearing
conditions. Marine Biology, 108:83-9. Endo N, Sato K, Matsumura K, Yoshimura E, Odaka Y and Nogata Y (2010). Species-
specific detection and quantification of common barnacle larvae from the
Japanese coast using quantitative real-time PCR. Biofouling, 26:901-911.
Etter RJ (1989). Life history variation in the intertidal snail Nucella lapilius across a
wave-exposure gradient. Ecology, 70:1857-1876.
Fatima A (2013). Changes in the biochemical composition of mud crab Scylla serrata
during maturation cycle. M. Phil. Thesis. Centre of Excellence in Marine
Biology, University of Karachi, Karachi.Pp 64.
Fatima H, Ayub Z, Ali SA and Siddiqui G (2013). Biochemical composition of
hemolymph, hepatopancreas, ovary and muscle during ovarian maturation in the
penaeid shrimps, Fenneropenaeus merguiensis and F. penicillatus (Crustacea:
Decapoda). Turkish Journal of Zoology, 37:334-347.
Feng DO, Ke CH, Lu CYandLi SJ (2009). Herbal plants as a promising source of natural
antifoulants: evidence from barnacle settlement inhibition. Biofouling, 25:181-
190.
Fernando AS and Ramamoorthi K (1975). Reproductive biology of barnacles. Bulletin of
the Department of Marine Science, University of Cochin, 4:721-732.
Fernando SA (1999). Reproductive biology of tropical barnacles. In Thompson M. F. and
Nagabhushanam, R. (ed.) Barnacles: The Biofoulers. Regency, New Delhi. Pp.
51-64.
Fiori SM and Morsan M (2004). Age and individual growth of Mesodesma mactroides
(Bivalvia) in the southern most range of its distribution. ICES Journal of Marine
Science, 61:1253-1259. Fletcher WJ (1987). Life history dynamics of the limpet Patelloida alticostata in
intertidal and subtidal environments. Marine Ecology Progress Series, 39:115-
127.
Folmer O, Black M, Hoeh W, Lutz R and Vrijenhoek R (1994). DNA primers for
amplification of mitochondrial cytochrome c oxidase subunit I from diverse
metazoan invertebrates. Molecular Marine Biology and Biotechnology,
3:294-299.
Ford MJ and Mitton JB (1993). Population structure of the pink barnacle, Tetraclita
squamosa rubescens along the California coast. Molecular Marine Biology and
Biotechnology, 2:147-153.
Foster BA (1971a). Desiccation as a factor in the intertidal zonation of barnacles. Marine
Biology, 8:12-29.
Foster BA (1971b). On the determinants of the upper limit of intertidal distribution of
barnacles (Crustacea: Cirripedia). Journal of Animal Ecology, 40:33-48.
Froese R (2006). Cube law, condition factor and weight-length relationships: history,
meta-analysis and recommendations. Journal of Applied Ichthyology, 22:241–
53.
Furman ER and Yule AB (1990). Self-fertilization in Balanus improvises Darwin.
Journal of Experimental Marine Biology and Ecology, 144:235-239.
Gaines S and Roughgarden J (1985). Larval settlement rate: A leading determinant of
structure in an ecological community of the marine intertidal zone. Proceedings
of the National Academy of Sciences of the United States of America, 82:3707-
3711. Garbary DJ (2007). The margin of the sea: survival at the top of the tides. In Seckbach, J.
(ed.) Algae and cyanobacteria in extreme environments:(Springer-Verlag,
Berlin). Pp 173-191.
Garcia- Guerrero M, Racotta LS and Villarreal H (2003). Variation in lipid, protein, and
carbohydrate content during the embryonic development of the crayfish Cherax
quadricarinatus (Decapoda: Parastacidae). Journal of Crustacean Biology, 23:1-
6.
Garcia F, Gonzalez-Baro M and Pollero R (2002). Transfer of lipids between
hemolymph and hepatopancreas in the shrimp Macrobrachium borellii. Lipid,
37:581-585.
Gayanilo FCJ, Sparre P and Pauly P (2005). FAO-ICLARM stock assessment tools
(FISAT) User’s Guide. FAO Computerized Information Series (Fisheries) No. 8,
Revised version. FAO, Roma, Italia.
Ghiselin MT (1969). The triumph of the Darwinian method.University of California
Press, Berkeley, California, USA.
Giese ACand Pearse JS (1974). Introduction: general principles. In: Giese AC, Pearse
VB (eds) Reproduction of Marine Invertebrates, Academic Press, New York. Pp.
2-38.
Giese AC and Kanatani H (1987). Maturation and spawning. In Giese, AC and Pearse,
VB (eds.). Reproduction of Marine Invertebrates Volume IX General aspect:
seeking unity in diversity. Blackwell Scientific Publication, Palo Atlo, CA. Pp.
252-329. Giese AC (1959). Comparative physiology: Annual reproductive cycles of marine
invertebrates. Annual Review of Physiology, 21:547-576.
Giese AC (1969). A new approach to biochemical composition of the mollusk body.
Oceanography and Marine Biology: Annual Review, 7:175-229.
Govindarajan AF, Pineda J, Purcell M andBreier JA (2015). Species- and stage-specific
barnacle larval distributions obtained fromAUV sampling and genetic analysis in
Buzzards Bay, Massachusetts, USA. Journal of Experimental Marine Biology and
Ecology, 472: 158-165.
Grant WS (1977). High intertidal community organization on a rocky headland in Maine,
USA. Marine Biology, 44:15-25.
Grosber RK (1982). Intertidal Zonation of Barnacles: The Influence of Planktonic
Zonation of Larvae on Vertical Distribution of Adults. Ecology, 63:894-899.
Grovel IA (1905). Monographie des cirripedes ou thecostraces. Paris, Pp. 472.
Grygier MJ (1987). New record, external and internal anatomy and systematic position
of Hanscen's, Y-Iarvae (Crustacea: Maxillopoda: Facetotecta). Sarsia, 72: 261-
278.
Guo S, Lee HP, Teo SLM and Khoo BC (2012). Inhibition of barnacle cyprid settlement
using low frequency and intensity ultrasound. Biofouling, 28:131-141.
Hadfield MG and Strathmann MF (1996). Variability, flexibility and plasticity in life
histories of marine invertebrates. Oceanologica Acta, 19:323-334.
Hameed S and Ahmed M (1999). Distribution and seasonal biomass of seaweeds on the
rocky shore of Buleji, Karachi Pakistan. Pakistan Journal of Botany, 31:199-210. Hameed S, Nasreen H and Ahmed M (2005). Distribution and biomass of abundant
marine macro-algae on the exposed rocky ledge of Manora Island, Karachi,
Pakistan. Pakistan Journal of Oceanography, 23:23-32.
Hankoop PJC and Van Der Meer J (1997). Reproductive output of Macoma balthica
populations in relation to winter- temperature and intertidal- height mediated
changes of body mass. Marine Ecology Progress Series, 149:155-162.
Haq SM, Moazzam M and Niaz-Rizvi SH (1978). Studies on the marine fouling
organisms from Karachi coast. I. Preliminary observations on the intertidal
distribution and ecology of fouling organisms at Paradise Point. Pakistan Journal
of Zoology, 10: 103-116.
Hasegawa T, Yamaguchi T, Kojima S and Ohta S (1996). Phylogenetic analysis among
three species of intertidal barnacles of the genus Tetraclita
(Cirripedia:Balanomorpha) by nucleotide sequences of a mitochondria gene.
Benthos Research, 51:33-39.
Hawkins SJ and Hartnoil RG (1982). Settlement patterns of Semibalanus balanoides (L.)
in the Isle of Man (1977-1981). Journal of Experimental Marine Biology and
Ecology, 62:271-283.
Hebert PDN, Cywinska A, Ball SL and DeWaard, JR (2003). Biological identifications
through DNA barcodes. Proceedings of the Royal Society of London. Series B,
270: 313-321.
Hebert PDN and Gregory TR (2005). The Promise of DNA Barcoding for Taxonomy.
Systematic Biology, 54:852-859. Hebert PDN, Penton EH, Burns JM, Janzen DH and Hallwachs W (2004). Ten species in
one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly
Astraptes fulgerator. Proceedings of the National Academy of Sciences of the
United States of America, 101:14812-14817.
Henry DP (1940). Notes on some pedunculate barnacles from the North
Pacific.Proceedings of the United States National Museum, 88:225-236.
Henry DP (1942). Studies on the sessile cirripedia of the Pacific coast of North America.
University of Washington Publications in Oceanography, 4:95-134.
Henry DP and McLaughlin PA (1986). The recent species of Megabalanus (Cirripedia:
Balanomorpha) with special emphasis on Balanus tintinnabulum (Linnaeus)
sensu lato. Zool. Verb. Leiden, 235:1-69.
Herbert RJH, Hawkins SJ, Sheader M and Southward AJ (2003). Range extension and
reproduction of the barnacle Balanus perforatus in the eastern English Channel.
Journal of the Marine Biological Associationof the United Kingdom, 83:73–82.
Herbert RJH, Hawkins SJ, Sheader M, Southward AJ (2003). Range extension and
reproduction of the barnacle Balanus perforatus in the eastern English Channel.
Journal of the Marine Biological Association of the United Kingdom, 83:73-82.
Hines AH (1978). Reproduction in three species of intertidal barnacles from central
California. Biology Bulletin, 154:262-281.
Høeg JT (1992). The phylogenetic position of Rhizocephala: Are they truly barnacles?
Acta Zoology, 73:323-326.
Hoek PPC (1913). The Cirripedia of the Siboga-Expedition. B. Cirripedia Sessilia.
Siboga Expedition Monograph, 31:129-275. Holm ER (2012). Barnacles and Biofouling. Integrative and Comparative Biology,
52:348-355.
Holmes SP, Walker G and van der Meer J (2005). Barnacles, limpets and periwinkles:
the effects of direct and indirect interactions on cyprid settlement and success.
Journal of Sea Research, 53:181-204.
Hughes TP, Baird AH, DinsdaleEA, Moltschaniwskyj A, Pratchett MS, Tanner, JE and
Willis BL (2000). Supply side ecology works both ways: the link between
benthic adults, fecundity, and larval recruits. Ecology, 18: 2241-2249.
Hui E and Moyse J (1987). Settlement patterns and competition for space. In: Southward,
AJ (ed.) Crustacean Issues 5, Barnacle Biology. A. A. Balkema, Rotterdam. Pp.
363-378.
Humason GL (1967). Animal tissue techniques.2nd Edition. W. H. Freeman, San Franc.
Pp. 569.
Hunt HL and Scheibling RE (1997). Role of early post-settlement mortality in
recruitment of benthic marine invertebrates. Marine Ecology Progress Series,
155:269-301.
Hunt MJ and Alexander GC (1991). Feeding mechanisms in the barnacle, Tetraclita
squamosa (Bruguiere). Journal of Experimental Marine Biology and Ecology,
154:1-28.
Hyder K, Johnson MP, Hawkins SJ and Gurney WSC (1998). Barnacle demography:
evidence for an existing model and spatial scales of variation. Marine Ecology
Progress Series, 174:89-99. Iwasaki K and Yamamoto H (2014). Recruitment and population structure of the non-
indigenous brackish-water mytilid Xenostrobus securis (Lamark, 1819) in the
Kino River, Japan. Aquatic Invasions, 9:479-487
Javed M and Mustaquim J (1995). The occurrence of fouling organisms on navigational
buoys in the Manora Channel, Pakistan. In: Thompson M F and Tirmizi N M
(ed.) The Arabian Sea: Living Marine Resources and the Environment. Vanguard
Books (Pvt.) Ltd. Lahore. Pp. 99-106.
Jeffery CJ and Underwood AJ (2000). Consistent spatial patterns of arrival of larvae of
the honeycomb barnacle Chamaesipho tasmanica Foster and Anderson in New
South Wales. Journal of Experimental Marine Biology and Ecology, 252:109-
127.
Jenkin JS (2005). Larval habitat selection not larval supply determines settlement
patterns and adult distribution in two chthamalid barnacles. Journal of Animal
Ecology, 74: 893-904.
Jenkins SR, Aberg P, Cervin G, Coleman RA, Delany J, Della Santina P, Hawkins SJ,
LaCroix E, Myers AA, Lindegarth M, Power AM, Roberts MF and Hartnoll RG
(2000). Spatial and temporal variation in settlement and recruitment of the
intertidal barnacle Semibalanus balanoides (L.)(Crustacea:Cirripedia) over a
European scale. Journal of Experimental Marine Biology and Ecology, 243:209-
225.
Jenkins SR, Aberg P, Cervin G, Coleman RA, Delany J, Hawkins SJ, Hyder K, Myers
AA, Paula J, Power AM, Range P and Hartnoll RG (2001). Population dynamics
of the intertidal barnacle Semibalanus balanoides at three European locations:spatial scales of variability. Marine Ecology Progress Series, 217:207–
217.
Johnson LE and Strathmann RR (1989). Settling barnacle larvae avoid substrata
previously occupied by a mobile predator. Journal of Experimental Marine
Biology and Ecology, 128:87-103.
Jones DS (1992). A review of Australian fouling barnacles. Asian Marine Biology,89–
100.
Kado R and Hirano R (1994). Larval development of two Japanese Magalaninae
barnacles, Megabalanus volcano and Megabalanus rosa (Cirripedia: Balanidae),
reared in the laboratory. Journal of Experimental Marine Biology and Ecology,
175:17-41.
Kamiya k, Yamashita K, Yanagawa T, Kawabata T and Watanabe T (2012). Cypris
Larvae (Cirripedia:Balanomorpha) Display Auto-Fluorescence in Nearly Species-
Specific Patterns. Zoological Society of Japan. Zoological Science, 29:247-253.
Karande AA and Palekar VC (1963). Observations on the breeding activity of the sessile
barnacle Chthamalus malayensis Pilsbry in Bombay Harbour. Defence Science
Journal, 13:130-137.
Karande AA (1965). On cirripede crustaceans (barnacles), an important fouling group in
Bombay waters. Proceeding Symposium Crustacean. Journal of Marine
Biological Association India, 4:1245-1250.
Kendall MA, Bowman RS, Williamson P and Lewis JR (1985). Annual variation in the
recruitment of Semibalanus balanoides on the North Yorkshire coast. Journal of
the Marine Biological Association of the United Kingdom, 65:1009-1030. Kent A, Hawkins SJ and Doncaster P (2003). Population consequences of mutual
attraction between settling and adult barnacles. Journal of Animal Ecology,
72:941-952.
Kerckhof F and Cattrijsse A (2001). Exotic Cirripedia (Balanomorpha) from buoys off
the Belgian coast. Senckenbergiana Maritima, 31:245-254.
Kerckhof F, Haelters J and Degraer S (2010). The barnacles Chirona Striato balanus
amaryllis (Darwin 1854) and Megabalanus coccopoma (Darwin1854)
(Crustacea: Cirripedia): two invasive species new to tropical WestAfrican waters.
African Journal of Marine Science, 32:265-268.
Kerckhof F, Haelters J and Gollasch S (2007). Alien species in the marine and brackish
ecosystem: the situation in Belgian waters. Aquatic Invasions, 2:243-257.
Kidwai S and Ahmed A (2005). Do barnacles on the Buleji rocky beach, Pakistan
(Arabian Sea) show preferences. Pakistan Journal of Oceanography, 1:9-22.
Koh LL, O’Riordan RM and Lee WJ (2005). Sex in the tropics: reproduction of
Chthamalus malayensisPilsbury (Class Cirripedia) at the equator. Marine
Biology, 147:121-133.
Komatsu M and Ando S (1992). Isolation of crustacean egg yolk lipoproteins by
deferential density gradient ultra-centrifugation. Comparative Biochemistry and
Physiology, 103:363-368.
Korn OM and Kolotukhina NK (1984). Reproduction of the barnacle Chthamalus dalli in
the Sea of Japan. Soviet Journal of Marine Biology, 9:84-91.
Lamarck JBPA de M (1818). Histoire naturelle des animaux sans vertebres. Vol 5,
Deterville, Paris. Pp. 612. Lee C, Shim JM and Kim CH (1999). Larval development of Balanus reticulatus
Utinomi, 1967 (Cirripedia, Thoracica) and a comparison with other barnacle
larvae. Journal of Plankton Research, 21:2125-2142.
Leonard GH, Levine JM, Schmidt PR and Bertness MD (1998). Flow-driven variation in
intertidal community structure in a Maine estuary. Ecology, 79(4):1395-1411
Leonard GH (2000). Latitudinal variation in species interactions: a test in the New
England rocky intertidal zone. Ecology, 81:1015-1030.
Leslie HM (2005). Positive intraspecific effects trump negative effects in high density
barnacle aggregations. Marine Biology, 86:2176-2725.
Leslie MH, Breck EN, Chan F, Lubchenco J and Menge BA (2005). Barnacle
reproductive hotspots linked to nearshore ocean conditions. Proceedings of the
National Academy of Sciences, 102:10534-10539.
Lewis CA and Chia FS (1981). Growth, fecundity and reproductive biology in the
pedunculate cirripede Pollicipes polymerus at San Juan Island, Washington.
Canadian Journal of Zoology, 59:893-901.
Linnaeus C (1758). Systema Naturae per regna triae naturae, secundum classes, ordines,
genera, species, cum characteribus, differentiis, synonymis, locis, ed. Holmiae,
101: 1-824.
Little C, Williams GA and Trowbridge CD (2009). The biology of rocky shores.Oxford
University Press New York.
Litulo C (2007). Distribution, abundance and reproduction of the Indo-Pacific acorn
barnacle Balanus amphitrite (Crustacea:Cirripedia). Journal of the Marine
Biological Association of the United Kingdom, 87:723-727. Lopez DA, Espinoza EA, Lopez BA and Santibalnez AF (2008). Molting behaviour and
growth in the giant barnacle Austromegabalanus psittacus (Molina 1782). Revista
de Biologica Marina Oceanografy, 43:607-613.
Lopez Veiga EC (1979). Fitting Von Bertalanffy growth curves, a new approach.
Investigacion Pesquera, 43:179-186.
López DA, López BA, Pham CK, IsidroEJ and De Girolamo M (2010). Barnacle
culture: background, potential and challenges. Aquaculture Research, 41:367-
375.
Lowry OH, Rosenbrough NJ, Farr AL and Randall RJ (1951). Protein measurement with
the Folin Phenol reagent. Journal of Biological Chemistry,193:265-275.
Ma H (2005). Spatial and temporal variation in surf clam (Spisula solidissima) larval
supply and settlement on the New Jersey inner shelf during summer upwelling
and down welling. Estuarine, Coastal and Shelf Science, 62:41-53.
Malusa JR (1986). Life-history and environment in two species of intertidal barnacles.
Biological Bulletin, 170:409-428.
Maronas ME, Darrigan GA, Sendra ED and Breckon G (2003). Shell growth of the
golden mussel Limnoperna fortunei (Dunker, 1857) (Mytilidae), in the Rio de la
Plata, Argentina. Hydrobiologia, 495:41-45.
Martin JW and Davis GE (2001). An updated classification of the recent
Crustacea.National History of Museum Los Angeles. Catalysis Science Series,
39:1-124. Menge BA (1976). Organization of the New England rocky intertidal community: role of
predation, competition, and environmental heterogeneity. Ecological
Monographs, 46:355-393.
Menge BA (2000). Recruitment vs. post-recruitment processes as determinants of
barnacle population abundance. Ecological Monographs, 70:265-288.
Menge BA, Daley BA, Wheeler PA, Dahlhoff, Sanford E and Strub PT (1997). Benthic–
pelagic links and rocky intertidal communities: Bottom-up effects on top-
down control? Proceedings of the Natural Academy of Sciences United States of
America, 94: 14530-14535.
Miller KM and Roughgarden J (1994). Descriptions of the larvae of Tetraclita rubescens
and Megabalanus californicus with a comparison of the common barnacle larvae
of the central California coast. Journal of Crustacean Biology, 14:579-600.
Minchinton TE and Scheibling RE (1991). The influence of larval supply and settlement
on the population structure of barnacles. Ecology, 72:1867-1879.
Minchinton TE and Scheibling RE (1993). Variations in sampling procedure and
frequency estimates of recruitment of barnacles. Marine Ecology Progress Series,
99:83-88.
Miron G, Boudreau B and Bourget E (1995). Use of larval supply in benthic ecology:
testing correlations between larval supply and larval settlement. Marine Ecology
Progress Series, 124:301-305.
Mizrahi L and Achituv Y (1990). Seasonal changes in body weight and biochemical
components of Mediterranean Chthamalus stellatus (Poli) and Euraphia depressa
(Poli). Journal of Experimental Marine Biology and Ecology, 137:185-193. Mizrahi L and Achituv Y (1991). Studies in the biochemistry of cirripede eggs. VIII.
Changes in general biochemical composition during the development of
Chthamalus stellatus (Poli) and Euraphia depressa (Poli). Journal of
Experimental Marine Biology and Ecology, 152:135-143.
Moazzam M and Ahmed J (1994). Prospects of development of molluscan fisheries in
Pakistan. In: Majid, A., Khan, M. Y., Moazzam, M. and Ahmed, J. (Eds.).
Proceedings of national seminar on fisheries policy and planning. Marine
Fisheries Department, Govt. of Pakistan, pp. 41-76.
Molares J, Tilves F, Quintana R, Rodriguez S and Pascual C (1994). Gametogenesis of
Pollicipes cornucopia (Cirripedia: Scalpellomorpha) in North West Spain.
Marine Biology, 120:553-60.
Molnar JL, Gamboa RL, Revenga C and Spalding MD (2008). Assessing the global
threat of invasive species to marine biodiversity. Frontiers in Ecology and the
Environment, 6:485-492.
Morgan SG (2001). The larval ecology of marine communities. In Bertness, M. D.,
Gaines S. D.and Hay, M. E. (ed.) Marine community ecology, Sinauer
Sunderland Massachusetts. Pp. 159-181.
Nasreen H, Ahmed M and Hameed S (2000). Seasonal variation in biomass of marine
macro invertebrates occurring on the exposed rocky ledge of Manora Island,
Karachi Pakistan. Pakistan Journal of Zoology, 32:343-350.
Newman WA and Ross A (1976). Revision of the balanomorph barnacles: including a
catalogue of the species. Memoir of the San Diego Society of Natural History,
9:1-108. Newman WA (1979). On the biogeography of balanomorph barnacles of the southern
ocean including new balanid taxa; a subfamily, two genera and three species. In:
Proceedings of the International Symposium on Marine Biogeography and
Evolution in the Southern Hemisphere. New Zealand Department of Scientific
Industrial Research Information Series, 137:279-306.
Newman WA (1987). Evolution of cirripedes and their major groups. In Southward, A. J.
(ed) Barnacle biology. Crustacean Issues, 5:3-42.
Newman WA (1996). Cirripedia; suborders Thoracica and Acrothoracica. In Forest, J.
(ed) Traite de Zoologie, 7:453-540.
Nicole EP (2005). Growth of filter feeding benthic invertebrates from a region with
variable upwelling intensity. Marine Ecology Progress Series, 295:79-85.
Nisa KU and Sultana R (2010). Variation in the proximate composition of shrimp,
Fenneropenaeus penicillatus at different stages of maturity. Pakistan Journal of
Biochemistry Molecular Biology, 43:135-139.
O’Riordan RM, Delany j, McGrath D, Myers AA, Power AM, Ramsay NF, Alvarez D,
Cruz T, Pannacciulli FG, Rang P and Relini G (2001). Variation in the sizes of
the Chthamalid barnacle post settlement cyprids on European shores. Marine
Ecology, 22:307-322.
O’Riordan RM and Murphy O (2000). Variation in the reproductive cycle of Elminius
modestus in Southern Ireland. Journal of the Marine Biological Association of the
United Kingdom, 80:607-616.
Oliveira GT, Rossi IC, Kucharski LC and De Silva SM (2004). Hepatopancreas
gluconeogenesis and glycogen content during fasting in crabs previously maintained on a high-protein or carbohydrate-rich diet. Comperative
Biochemistry and Physiology, 137:383-390.
Oliveira GT, Fernandes FA, Bond-BuckupG, Bueno AA and Silva RSM (2003).
Circadian and seasonal variations in the metabolism of carbohydrates in Aegla
ligulata (Crustacea:Anomura: Aeglidae). Memoirs Museum Victoria, 60:9-62.
O'Riordan RM, Myers AA, Cross TF (1995). The reproductive cycles of Chthamalus
stellatus (Poli) and C. montagui (Southward) in south-western Ireland. Journal of
Experimental Marine Biology and Ecology, 190:17-38.
Page H (1983). Effect of water temperature and food on energy allocation in the stalked
barnacle, Pollicipes polymerus. Journal of Experimental Marine Biology and
Ecology, 69:189-202.
Page HM (1984). Local variation in reproductive patterns of two species of intertidal
barnacles, Pollicipes polymerus Sowerby and Chthamalus fissus Darwin. Journal
of Experimental Marine Biology and Ecology, 74:259-272.
Paine RT (1966). Food web complexity and species diversity. American Naturalist.
100:65-75.
Paine R (1981). Barnacle ecology: is competition important? The forgotten roles of
predation and disturbance. Paleobiology, 7:553-560.
Palmer AR (1982). Predation and parallel evolution: recurrent parietal plate reduction in
balanomorph barnacles. Paleobiology, 8:31-44.
Pannacciulli FG, Manetti G and Maltagliati F (2009). Genetic diversity in two barnacle
species, Chthamalus stellatus and Tesseropora atlantica (Crustacea, Cirripedia), with different larval dispersal modes in the archipelago of the Azores. Marine
Biology, 156:2441-2450.
Parab SG, Prabhu MSG, Gomes HR and Goes JI (2006).Monsoon driven changes in
phytoplankton populations in the eastern Arabian Sea as revealed by microscopy
and HPLC pigment analysis. Continental Shelf Research, 26:2538–2558.
Parsons TR, Maita Y and Lalli CM (1984). A Manual of Chemical and Biological
Methods for Seawater Analysis. United Kingdom: Pergamon Press.
Patel B and Crisp DJ (1960a). Rates of development of the embryos of several species of
barnacles. Physiological Zoology, 33:104-119.
Patel B and Crisp DJ (1960b). The influence of temperature on the breeding and the
moulting activities of some warm-water species of operculate barnacles. Journal
of the Marine Biological Association of the United Kingdom, 39:667-680.
Patel B and Crisp DJ (1961). Relation between breeding and moulting cycles in
cirripedes. Crustaceana, 2:89-107.
Pauly D (1980). On the interrelationships between natural mortality, growth parameters
and mean environmental temperature in 175 fish stocks. Journal du Conseil /
Conseil Permanent International pour l'Exploration de la Me, 39: 175-192.
Pauly D and David N(1981).ELEFAN I, a BASIC program for the objective extraction
of growth parameters from length-frequency data. Ber Deut Wiss Komm, 28:205-
11.
Pauly D and Munro JL (1984). Once more on the comparison of growth in fish and
invertebrate. Fish Byte, 2:1-21. Peharda M, Richardson CA, Mladineo I, Sestanovic S, Popovic Z, Bolotin J, Vrgoe N
(2007). Age, growth and population structure of Modiolus barbatus from the
Adriatic. Marine Biology, 151:629-638.
Peharda M, Richardson CA, Mladineo I, Sestanovic S, Popovic Z, Bolotin J and Vrgoe N
(2007). Age, growth and population structure of Modiolus barbatus from the
Adriatic. Marine Biology, 151:629-638.
Petrone L, Di Fino A, Aldred N, Sukkaew P, EderthT, Clare AS and Liedberg B (2011).
Effects of surface charge and free energy on the settlement behavior of barnacle
cyprids Balanus amphitrite. Biofouling, 27:1043-1055.
Pham CK, De Girolamo M, Isidro EJ (2011). Recruitment and growth of Megalabanus
azoricus (Pilsbry, 1916) on artificial substrates: first steps towards commercial
culture in the Azores. Arquipelago Life and Marine Sciences, 28:47-56.
Phillips NE (2007). A septial gradient in the potential reproductive output of the sea
mussel Mytilus californianus. Marine Biology, 151:1543-1550.
Pillay K and Nair N (1972). Reproductive biology of the sessile barnacle, Balanus
Amphitrite communis (Darwin), of the south-west coast of India. Indian Journal
of Marine Science, 1:8-16.
Pillay KK and Nair NB (1973). Observations on the biochemical changes in gonads and
ot her organs of Uca annulipes, Portunus pelagicus and Metapenaeus affinis
(Decapoda:Crustacea) during the reproductive cycle. Marine Biology, 18:167-
198. Pilsbry HA (1916). The sessile barnacles (Cirripedia) contained in the collection of the
U.S. National Museum: including a monograph of the American species. Bulletin
of the United States National Museum, 93:241-353.
Pineda J and Lopez M (2002). Temperature stratification and barnacle larval settlement
in two Californian sites. Continental Shelf Research, 22:1183-1198.
Pineda J (1994). Spatial and temporal patterns in barnacle settlement rate along a
southern California rocky shore. Marine Ecology Progress Series, 107:125-138.
Pineda J, Riebensahm D and Medeiros-Bergen D (2002). Semibalanus balanoides in
winter and spring: Larval concentration, settlement, and substrate occupancy.
Marine Biology (Berlin), 140:789-800.
Pitombo FB (2004). Phylogenetic analysis of the Balanidae (Cirripedia: Balanomorpha).
Zoologica Scripta, 33:261-276.
Porri F, McQuaid CD and Radloff S (2006). Spatio-temporal variability of larval
abundance and settlement of Perna perna: differential delivery of mussels.
Marine Ecology Progress Series, 315:141-150.
Power AM, Piyapattanakorn S, O’Riordan RM, Iyengar A, Myers A, Hawkins SJ,
Delany J, McGrath D and Maclean N (1999). Verification of cyprid size as a tool
in the identification of two European species of Chthamalus barnacles using
mtDNA-RFLP analysis. Marine Ecology Progress Series, 191:251-256.
Qari Rand Qasim R (1988). Seasonal change in the standing crop of intertidal seaweeds
from the Karachi coast.In Thompson, M. F. and Tirmizi, N. M. (ed.) Proceedings
of Marine Science of the Arabian Sea .American Institutes of Biological
Sciences, Washington D. C. Pp. 449-456. Qari Rand Qasim R (1994). Seasonal change in the standing crop of intertidal seaweeds
from Manora coast, Karachi.In Majid A., Khan, M. Y., Moazzam M. and Ahmed
J. (ed.) Proceeding of National Seminar on Fish Policy and Planning. Marine
Fisheries Department, Govt of Pakistan. Pp. 279-286.
Qian P and Chia JH (1991). Fecundity and egg size are mediated by food quality in the
polychaet worm Capitella sp. Journal of Experimental Marine Biology and
Ecology, 148:11-25.
Radulovici AE, Archambault P and Dufresne F (2010). DNA barcodes for marine
biodiversity: moving fast forward? Diversity, 2:450-472.
Raffaelli D and Hawkins S (1996). Intertidal ecology.Chapman & Hall, London.Pp. 356.
Rahman S and Barkati S (2004). Development of Abundance – Biomass Curves
indicating pollution and disturbance in molluscan communities on four beaches
near Karachi, Pakistan. Journal of Zoology, 36:111-123.
Rahman S and Barkati S (2012). Spatial and temporal variation in species composition
and abundance of benthic molluscs along four rocky shores of Karachi. Turkish
Journal of Zoology, 36:291-306.
Raimondi PT (1988). Settlement cues and determination of the vertical limit of an
intertidal barnacle. Ecology, 69:400-407.
Raimondi PT (1990). Patterns, mechanisms, consequences of variability in settlement
and recruitment of an intertidal barnacle. Ecological Monographs, 60:283-309.
Rainbow PS (1984). An introduction to the biology of British littoral barnacles. Field
Studies, 6:1-51. Rajagopal S (1991). Biofouling problems in the condenser cooling circuit of a power
station with special reference to green mussel, Perna viridis (L.).Ph.D. Thesis,
University of Madras, India.Pp. 13.
Rajagopal S, Sasikumar N, Azariah J and Nair KK (1991). Some observations on
biofouling in the cooling water conduits of a coastal power plant. Biofouling,
3:131-141.
Ramenofsky M, Faulkner DJ and Ireland C (1974). Effect of juvenile hormone on
cirriped metamorphosis. Biochemical and Biophysical Research Communities,
60:172-178.
Range P and Paula J (2001). Distribution, abundance and recruitment of Chthamalus
(Crustacea:Cirripedia) populations along the central coast of Portugal. Journal of
the Marine Biological Association of the United Kingdom, 81:461- 468.
Rawangkul S, Angsupanich S and Panitchart S (1995). Prelirninary study of barnacles
damaging the mangrove plantation (Rhizophora mucronata) at Tha Phae canal,
Nakorn Si Thammarat. In: Proceedings of the Ninth National Seminar on
Mangrove Ecology “Mangrove Conservation for Thai Society in Next Decade”
The National Research Council of Thailand, Bangkok (Thai). pp. 1-15.
Read GHL and Caulton MS (1980). Changes in mass and chemical composition during
the moult cycle and ovarian development in immature and mature Penaeus
indicus Milne Edwards. Compound Biochemistry Physiology, 66:431-437.
Rege MS, Joshi SS and Karande AA (1980). Breeding in Balanus Amphitrite Darwin
inhabiting polluted waters off Bombay coast. Indian Journal of Geo-Marine
Science, 9:15-18. Reimer AA (1976a). Description of a Tetraclita stalactifera panamensis community on a
rocky intertidal Pacific shore of Panama. Marine Biology, 35:239-251.
Ren X and Liu R (1979). Studies on Chinese Cirripedia (Crustacean) II: Family
Tetraclitidae. Oceanologia et Limnologia Sinica, 10:338-353.
Ricker WE (1973). Linear Regressions in Fishery Research. Journal Fisheries Research
Board Canada, 30:409-434.
Rilov G, Dudas SE, Menge BA, Grantham BA, Lubchenco J and Schiel DR (2008). The
surf zone:a semi-permeable barrier to onshore recruitment of invertebrate larvae?
Journal of Experimental Marine Biology and Ecology, 361:59-74.
Rizvi NSH and Moazzam M (2006). Sessile barnacles (Cirripedia) from the Pakistan
coast. Pakistan Journal of Marine Science, 15:91-118.
Rosa R and Nunes ML (2003a). Biochemical composition of deep-sea decapod
crustaceans with two different benthic life strategies of the Portuguese south
coast. Deep Sea Research, 50:119-130.
Rosa R and Nunes ML (2003b). Changes in organ indices and lipid dynamics during the
reproductive cycle of Aristeus antennatus, Parapenaeus longirostris and
Nephrops norvegicus (Crustacea:Decapoda) females from the south Portuguese
coast. Crustaceana, 75:1095-1105.
Ross A (1968). Bredin-Archbold-Smithsonian biological survey of Dominica. 8. the
intertidal balanomorph Cirripedia. Proceeding of the United States National
Museum, 125:1-23. Ross A (1962). Results of the Puritan-American Museum of Natural History Expedition
to Western Mexico. 15. The littoral Balanomorph Cirripedia. American Museum
Novitates, 2084:1-44.
Ross PM (2001). Larval supply, settlement and survival of barnacles in a temperate
mangrove forest. Marine Ecology Progress Series, 215:237-249.
Ross P, Burrows M, Hawkins S, Southward A and Ryan K (2003). A key for the
Chthamalus montagui identification of the nauplii of common barnacles of the
British Isles, with emphasis on Chthamalus. Journal of Crustacean Biology,
23:328-340.
Roughgarden J, Iwasa Y and Baxter C (1985). Demographic theory for an open marine
population with space-limited recruitment. Ecology, 66:54-67.
Saifullah SM (1973). A preliminary survey of the standing crop of seaweeds from the
Karachi coast. Botanical Marina, 16:139-144.
Sanford E, Bermudez D, Bertness MD and Gaines SD (1994). Flow, food supply and
acorn barnacle population dynamics. Marine Ecology Progress Series, 104:49-62.
Sasikumar N (1991). Ecology and control of biofouling in a coastal power station with
special reference to Megabalanus tintinnabulum. Doctoral Thesis, University of
Madras, Madras, India.Pp. 73.
Sastry AN (1975). Physiology and ecology of reproduction in marine invertebrates.In
Venberg, F. J. (ed.) Physiological Ecology of Estuarine Organisms. University of
South Carolina Press, Columbia. Pp. 279-299.
Satchell ER and Farrell TM (1993). Effects of settlement density on spatial arrangement
in four intertidal barnacles. Marine Biology, 116:241-245. Satheesh S andWesley SG (2009). Breeding biology of the barnacleAmphibalanus
Amphitrite (Crustacea:Cirripedia): influence of environmental factors in a tropical
coast. Journal of the Marine Biological Association of the United Kingdom, 89:
1203-1208.
Scheltema RS (1968). Dispersal of larvae by Equatorial ocean currents and its
importance to the zoogeography of shoal-water tropical species. Nature,
217:1159-1162.
Scheltema RS (1986). On dispersal and planktonic larvae of benthic invertebrates: An
eclectic overview and summary of problems. Bulletin of Marine Science, 39:290-
322.
Severino A and Resgalla C (2005). Larval development of the Megabalanus coccopoma
(Darwin, 1854) and temporal variation in Itapocoroyb By (Santa Catarina,
Brazil). Atlantica, 27:5-16.
Shahdadi A, Chan BKK and Sari A (2011). Tetraclita ehsani sp. n.
(Cirripedia,Tetraclitidae), a common intertidal barnacle from the Gulf of Oman,
Iran. Zookeys, 136: 1-2.
Shaw BL and Battle HI (1957). The gross microscopic anatomy of the digestive tract of
the oyster Crassostrea virginica (Gmelin). Canadian Journal of Zoology, 35:325-
347.
Silina AV and Ovsyannikova I (1999). Growth of the barnacle Balanus rostratus in the
Sea of Japan. Russian Journal of Marine Biology,25:18-22. Sousa R, Delgado J, Pinto AR and Henriques P (2017). Growth and reproduction of the
north eastern Atlantic keystone species Patella aspera (Mollusca:
Patellogastropoda). Helgoland Marine Research,71:8.
Southward AJ and Crisp DJ (1954). Recent changes in distribution of the intertidal
barnacles Chthamalus stellatus Poli and Balanus balanoides L. in the British
Isles. Journal of Animal Ecology, 23:163-177.
Southward AJ and Crisp DJ (1956). Fluctuations in the distribution and abundance of
intertidal barnacles. Journal of the Marine Biological Association of the United
Kingdom, 3: 211-229.
Southward AJ and Newman WA (2003). A review of some common Indo-Malayan and
western Pacific species of Chthamalus barnacles (Crustacea:Cirripedia). Journal
of the Marine Biological Association of the United Kingdom, 83:797-812.
Southward AJ (1987). Barnacle biology.Crustacean Issues V. 5. A. A. Balkema,
Rotterdam. Pp. 443.
Southward AJ (1998). New observations on barnacles (Crustacea: Cirripedia) of the
Azores region. Arquipelago Life and Marine Sciences, 1:11-27.
Southward AJ, Hiscock K, Elfimov AS and Moyse J (2004). Habitat and distribution of
the warm-water barnacle Solidobalanus fallax (Crustacea:Cirripedia). Journal of
the Marine Biological Association of the United Kingdom, 84:1169-1177.
Sparre P and Venema SC (1998). Introduction to tropical fish stock assessment. Part 1
Manual FAO Fisheries Technical Paper No. 306, Rome, pp. 407. Spears T, Abele LG and Applegate MA (1994). Phylogenetic study of cirripedes and
selected relatives (Thecostraca) based on 18S rDNA sequence analysis. Journal of
Crustacean Biology, 14641-656.
Standing JD (1980). Common inshore barnacle cyprids of Oregonian faunal province
(Crustacea:Cirripedia). Proceedings of the Biological Society of Washington, 93:
1184-1203.
Stanley SM and Newman WA (1980). Competitive exclusion in evolutionary time: the
case of the acorn barnacles. Paleobiology, 6:173-183.
Stenseng E, Braby CE, Somero GN (2005). Evolutionary and acclimation-induced
variation in the thermal limits of heart function in congeneric marine snails
(genus Tegula): implications for vertical zonation. Biological Bulletin 2: 138-
144.
Stephenson TA and Stephenson A (1949). The universal features of zonation between
tide-marks on rocky coasts. Journal of Ecology, 37:289-305.
Stephenson TA and Stephenson A (1972). Life between tide marks on rocky shores.
W.H. Freeman &Co., San Francisco, Reading, England.Pp. 425.
Stillman JH and Somero GN (1996). Adaptation to temperature stress and aerial
exposure in congeneric species of intertidal porcelain crabs (genus Petrolisthes):
Correlation of physiology, biochemistry and morphology with vertical
distribution. Journal of Experimental Biology, 199:1845-1855.
Stillman JH (2002). Causes and Consequences of Thermal Tolerance Limits in Rocky
Intertidal Porcelain Crabs, Genus Petrolisthes. Integrative and
Comparative Biology, 42:790-796. Strathmann RR and Branscomb ES (1979). Adequacy of cues to favourable sites used by
settling larvae of two intertidal barnacles.In Stancyk, S.E. (ed.) Reproductive
Ecology of Marine Invertebrates.University of South Carolina Press, Columbia,
South Carolina. Pp. 77-89.
Stubbings HG (1975). Balanus balanoides. L. M. B. C. Memoir No. 37 Liverpool
University press, Liverpool. Pp. 175.
Sutherland JP (1987). Recruitment limitation in a tropical intertidal barnacle: Tetraclita
panamensis (Pilsbury) on the Pacific coast of Costa Rica. Journal Experimental
Marine Biology Ecology, 113:267-282.
Swami KS and Karande AA (1988). Recruitment and growth of biofouling Invertebrates
during monsoon in Bombay waters, west coast of India. Indian Journal of Marine
Science, 17:143-149.
Tamura K, Stecher G, Peterson D, Filipski A and Kumar S (2013). MEGA6: Molecular
Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution,
30: 2725-2729.
Taylor CC (1958). Cod growth and temperature.Journal du Conseil / Conseil Permanent
International pour l'Exploration de la Mer, 23(3):366-70.
Taylor BJR (1965). The analysis of polymodal frequency distributions. Journal of
Animal Ecology, 34: 445-452.
Tenjing SY, Thippeswamy S and Narasimhaiah N (2016). A first study on growth,
mortality and survivorship of the eared horse mussel, Modiolus auriculatus
Krauss, 1848) from India. Indian Journal of Geo-Marine Sciences, 45:323-332. Thiyagarajan V, Venugopalan VP, Subramoniam T and Nair KVK (1997). Description
of the naupliar stages Megabalanus tintinnnabulum (Cirripedia: Balanidae).
Journal of Crustacean Biology, 17:332-342.
Thompson JV (1830). Zoological researches and illustration. Memoirs, 4:69-82.
Tighe-Ford DJ (1967). Possible mechanism for the endocrine control of breeding in a
cirripede. Nature, 216:290-921.
Tomanek L and Somero GN (1999). Evolutionary and acclimation-induced variation in
the heat-shock responses of congeneric marine snails (genus Tegula) from
different thermal habitats: implications for limits of thermo tolerance and
biogeography. Journal of Experimental Biology, 202:2925-2936.
Tong LKY (1986). The feeding ecology of Thais clavigera and Morula musiva
(Gastropoda: Muricidae) in Hong Kong. Asian Marine Biology, 3:145-162.
To-yan L (2003). The ecology and reproductive biology of two intertidal barnacles,
Capitulum mitella and Ibla cumingi (Cirripedia: Pedunculata) in Hong Kong. Ph.
D. Thesis, The University of Hong Kong, pp. 226.
Tsang LM, Chan BKK, Wu TH, Ng WC, Chatterjee T, Williams GA and Chu KH
(2008). Population differentiation in the barnacle Chthamalus malayensis:
postglacial colonization and recent connectivity across the Pacific and Indian
Oceans. Marine Ecology Progress Series, 364:107-18.
Tsang LM, Wu TH, Shih TH, Williams GA, Chu KH and Chan, BKK (2012). Genetic
and morphological differentiation of the Indo-West Pacific intertidal barnacle
Chthamalus malayensis. Integrative and Comparative Biology, 52:388-409. Tunnicliffe V and Southward AJ (2004). Growth and breeding of a primitive stalked
barnacle Leucolepas longa (Cirripedia: Scalpellomorpha: Eolepadidae:
Neolepadinae) inhabiting a volcanic seamount off Papua New Guinea. Journal of
the Marine Biological Association of the United Kingdom, 84:121-132.
Underwood AJ and Chapman MG (1996). Scale of spatial patterns of distribution of
intertidal invertebrates. Oecologia, 107:212-224.
Underwood AJ, Chapman MG and Connell SD (2000). Observations in ecology:You
can’t make progress on processes without understanding the patterns. Journal of
Experimental Marine Biology and Ecology, 250:97-115.
Velásquez-Jiménez L, Acosta1 A, Cortés-Chong N andGarcía S (2016).Population
structure of Megabalanus peninsularis in Malpelo Island, Colombia. Revista de
Biología Marina y Oceanografía, 51: 461-468.
Villalobos CR (1979). Variations in population structure in the genus Tetraclita
(Crustacea: Cirripedia) between temperate and tropical populations I. Fecundity,
recruitment, mortality and growth in T. rubescens. Revista de Biologia Tropical,
27: 279-291.
Vinagre AS and Da Silva RSM (2002). Effects of fasting and refeeding on metabolic
processes in the crab C. granulatus (Dana, 1851). Canadian Journal of Zoology,
80: 1413-1421.
Vinagre AS, Amaral APN, Ribarcki FP, Silveira EF and Périco E (2007). Seasonal
variation of energy metabolism in ghost crab Ocypode quadrata at Siriú Beach
(Brazil). Comparative Biochemistry and Physiology A, 14:514-519. Walker G (1980). A study of the oviducal glands and ovaries of Balanus balanoides (L.),
togaether with comperative observations on the ovisacs of Balanus
hameri(Ascanius) and the reproductive biology of the two species. Philosophical
Transaction of the Royal Society, 291:147-162.
Walker G (1985). The cypris larvae of Sacculina carcini Thompson (Crustacea:
Cirripedia: Rhizocephala). Journal of Experimental Marine Biology and Ecology,
93:131-145.
Walker G (1992). Cirrepedia. In Harrison, F. W. and Humes, A.G. (eds) Microscopic
Anatomy of Invertebrates, Vol. 9, Crustacea. Wiley-Liss, New York. Pp. 249-
311.
Walley LJ (1969). Studies on larval structure and metamorphosis of Balanus balanoides
(L.). Philosophical Transactions of the Royal Society of London B, 256:237-280.
Warker G, Yule AB and Nott JA (1987). Structure and function in balanomorph larvae.
In Southward, A. J. (ed.) Crustacean Issues 5 Barnacle Biology. A A Balkema
Press, Rotterdam. Pp. 307-328.
Wethey DS (1983). Geographic limits and local zonation: The barnacles Semibalanus
(Balanus) and Chthamalus in New England. Biological Bulletin, 165:330-34.
Wethey DS (1984). Spatial pattern in barnacle settlement: day to day changes during the
settlement season. Journal of the Marine Biological Association of the United
Kingdom, 64:687-698.
Wong JY, Chen HN, Chan BKK, Tan KPT and Chong VC (2014). A combined
morphological and molecular approach in identifying barnacle cyprids from the Matang Mangrove Forest Reserve in Malaysia: Essentials for larval ecology
studies. Raffles Bulletin of Zoology, 62:317-329.
WoRMS (2015). Megabalanus tintinnabulum (Linnaeus, 1758). Accessed through World
Register of Marine Species at http://www.marinespecies.org
Wu RSS and Levings CD (1978). An energy budget for individual barnacles (Balanus
glandula). Marine Biology, 45:225-235.
Yamaguchi S, Yusa Y, Sawada k and Takahashi S (2013). Sexual systems and dwarf
males in barnacles: Integrating life history and sex allocation theories. Journal of
Theoretical Biology, 320:1-9.
Yamaguchi T (1973). On Megabalanus (Cirripedia: Thoracica) of Japan. Publications of
Seto Marine Biological Laboratory, 21:115-140.
Yamaguchi T ( 1987). Changes in the barnacle fauna since the Miocene and the
infraspecific structure of Tetraclita in Japan (Cirripedia: Balanomorpha).
Bulletin of Marine Science, 41: 337-350.
Yan T, Yan W, Liang G, Dong Y, Wang H and Yan Y (2000). Marine biofouling in
offshore areas south of Hainan Island, northern South China Sea. Chinese Journal
of Oceanology and Limnology, 18: 132-139
Yan Y and Chan BKK (2001). Larval development of Chthamalus malayensis Pilsbry
(Cirripedia: Thoracica) reared in the laboratory. Journal of the Marine Biological
Association of the United Kingdom, 81:623-632.
Yan Y and Miao S (2004). The effect of temperature on the reproductive cycle of the
tropical barnacle, Chthamalus malayensis Pilsbury (Cirripedia). Crustaceana,
77:205-212. Yan Y, Benny K and Williams A (2006). Reproductive development of the barnacle
Chthamalus malayensis in Hong Kong: implications for the life-history patterns
of barnacles on seasonal, tropical shores. Marine Biology, 148:875-887.
Yorisue T, Matsumura K, Hirota H, Dohmae N and Kojima S (2012). Possible molecular
mechanisms of species recognition by barnacle larvae inferred from multi-
specific sequencing analysis of proteinaceous settlement-inducing pheromone.
Biofouling, 28: 605-611.
Young PS (1998). Cimpedia (Crustacea) from the Campagne Bi Azores in the Azores
region, including a generic revision of Verrucidae. Zoosystema, 20:31-92.
Zar JH (1999). Biostatistical analysis, 4th Edition. Prentice-Hall, Upper Saddle River,
NJ, pp. 663.
Zeinalipour M (2015). The comparison of the Balanus improvises (Crustacea: Cirripeia)
growth, population dynamics and larval recruitment in the southern coasts of the
Caspian Sea. Journal Life Science, 9:416-422.
Zullo VA (1966). Zoogeographic affinities of the balanomorpha (Cirripedia: Thoracica)
of the Eastern Pacific. Proceedings of the Galapagos International Scientific
Project of 1964. University of California Press, Berkeley. Pp. 139-144.
Appendix I
Determination of Protein
Protein was determined by the Lowry’s method (Lowry et al., 1951).
Reagents
1. 0.1M Phosphate buffer pH 7.0 (Sodium hydrogen phosphate [Na2HPO4] and
Potassium dihydrogen phosphate [KH2PO4] 2. 0.1 N NaOH 3. Alkaline reagent (Mix solution of A, B and C in ratio 200:1:1).
Solution A: 2 gm Na2CO3 (sodium carbonate) in 0.1 N NaOH Solution B: 4% Na-K tartarate (sodium potassium tartarate)
Solution C: 2% CuSO4 (copper sulfate). 4. Commercial Folin-Ciocalteu’s phenol reagent [2N] was diluted 1:1 (v/v) with distilled water Procedure
For tissue analysis 1 gm of wet tissues (ovary, hepatopancreas and muscle) was homogenized in Homogenizer (Model Polytron PT-MR 2100, Kinematic AG, Switzerland) with 10 ml of 100 mM Phosphate buffer pH 7.0. Take 1 ml of tissue homogenate and add 1 ml of 0.1 NaOH and keep it for 30 minutes at room temperature, now add 8 ml of distilled water and Centrifuge (Model 80-2, Pakistan) at 4000 rpm for 30 minutes. Take 0.1 ml of supernatant and add 0.9 ml of distilled water to make volume 1 ml. For protein analysis in hemolymph, sample was diluted 1:100 with distilled water. 0.1 ml of hemolymph was used for further analysis. Add 5 ml of alkaline reagent leave it for 40-45 minutes at room temperature. Add 0.5 ml of Folin- phenol reagent, vortex immediately leaves it for 30 minutes at room temperature. The color intensity was measured at 750 nm against reagent blank on spectrophotometer (Model 6306, Jenway, UK). A calibration curve using bovine serum albumin (BSA) as a standard was constructed. Preparation of standard curve
Stock standard solution (1mg/ml): 100 mg of bovine serum albumin (BSA) was dissolved in 100 ml distilled water. Working standard solution (0.5 mg/mL): 5 ml of stock standard diluted with 5 ml of distilled water. For the preparation of standard curve 0.1 ml, 0.2 ml, 0.3 ml, 0.4 ml, 0.5 ml, 0.6 mL, 0.7 ml, 0.8 ml, 0.9 ml and 1.0 ml of working standard solution was taken in series of test tubes and volume was made up to 1 mL with distilled water. The same procedure was done as for the samples. The intensity of color was noted at 750 nm on spectrophotometer already calibrated with a reagent blank. The obtained optical densities were plotted in a linear curve against concentrations.
Preparation of blank
1 mL distilled water and 5 ml alkaline reagent was mixed in a test tube and allowed to stand for 40-45 minutes and then treated with 0.5 ml of Folin phenol reagent and again allowed to stand for 30 minutes at room temperature. The spectrophotometer was set with this reagent blank at 750 nm optical density.
Determination of Lipid
The total lipids were determined by Sulpho-phosphovanillin method of Barnes and Blackstock (1973).
Reagents
1. Mixture of chloroform and methanol in a ratio of 2:1, v/v 2. Concentrated H2SO4 3. Phospho-vanillin reagent (1.2 g vanillin dissolved in 200 ml distilled water and then add 800 ml of concentrated orthophosphoric acid) Preparation of sample
1 g of wet tissues (ovary, hepatopancreas and muscle) was homogenized in Polytron (Model PT-MR 2100 Kinematic AG, Switzerland) with 25 ml of Chloroform: Methanol (2:1, v/v) and left over night at 4º C in tightl stopper tube for complete extraction. the homogenate was mixed and centrifuged (Model 80-2 Pakistan) at 3000 rpm for 20 minutes. After centrifugation, 0.5 ml of Supernatant was taken in a test tube and was evaporated in warm water bath until dryness and then cooled in running water, add 2 ml of Conc. H2SO4, was added covered with aluminum foil and placed in boiling water for 10 minutes.the sample tube was then left in cold water bath for 5 minutes. 0.1 ml of this mixture was transferred to a new tube, from the cool test tube, 5 ml of sulphophospho vanillin reagent added and incubated for 15 minutes at 37º C. The absorbance was read at 540 nm against blank on spectrophotometer (MODEL 6306 Jenway, UK) at 540 nm.
Hemolymph 0.1 ml was taken for lipid analysis and 2 ml Conc. H2SO4 added and analysed as described for tissue sample. A calibration curve using cholesterol as a standard was constructed.
Preparation of Standard Curve Stock standard solution 10 mg/ ml: 100 mg cholesterol was dissolved in 10 ml of chloroform-methanol solution( 2:1, v/v) . The solution was closed tightly and stored in refrigerator. Working standard solution: Stock standard was taken in a series as 0.2, 0.4, 0.6, 0.8, and 1.0 ml and volume was mad up to 1 ml with ethanol. For standard curve 0.1 ml of each working standard in triplicate was taken in separate test tubes. Then the same procedure was adopted as for sample. Preparation of reagent blank
H2SO4 (conc.) 0.1 ml was taken in a test tube. Then the same procedure was adopted as for sample. The spectrophotometer was set with this reagent blank at 540 nm optical density.
Determination of Carbohydrate
The carbohydrate was determined according to method described by Dubois et al. (1956). Reagents 1. Trichloroacetic acid (TCA) 10%
2. Concentrated H2SO4 3. Phenol reagent 5% Procedure 0.1 ml of hemolmph was taken for carbohydrate analysis. For tissues, 1 gm of wet tissues (ovary, hepatopancreas and muscle) was homogenized in Polytron (Model PT-MR 2100, Kinematic AG, Switzerland) with 10 ml of 10 % trichloroacetic acid and centrifuged (Model 80-2, Pakistan) at 3000 rpm for 30 minutes. 0.1 ml supernatant was diluted with
0.9 ml of distilled water.to this 1 ml of 5% Phenol reagent and 5 ml of Conc. H2SO4. Were added, mixed well and kept for 30 minutes at room temperature. The color intensity was measured at 490 nm against reagent blank on spectrophotometer (Model 6306, Jenway, UK) at 540 nm. Preparation of standard curve Stock standard solution 1mg/ ml: 100 mg of glucose was dissolved in 100 ml distilled water. Working standard solution (0.1 mg/ ml): 1 ml of stock standard solution make up to 10 ml with distilled water. For the preparation of standard curve 0.1 ml, 0.2 ml, 0.3 ml, 0.4 ml, 0.5 ml, 0.6 ml, 0.7 ml, 0.8 ml, 0.9 ml, and 1.0 ml of working standard solution (glucose) was taken in series of test tubes and the volume was made up to 1 ml with distilled water. Then the same procedure was adopted as for sample. The color intensity was measured at 490 nm against reagent blank on spectrophotometer. The graph was plotted between optical density and concentration which resulted in a linear curve.
Preparation of reagent blank
1 ml of distilled water in a test tube, 1 ml Phenol reagent and 5 ml H2SO4 (conc.) were added and mixed well. It was allowed to stand at room temperature for 30 minutes. The spectrophotometer was set with this reagent blank at 490 nm optical density.