20 APPLIED MICROBIOLOGY
Volume 20
Plastics are robust, ubiquitous, versatile materials, which make our everyday life easier. But these polymers properties make them both a blessing and a curse. The environmen- tal impact of plastics is immense, and so far, there are only a few strategies to deal with Wing-Jin Li plastic waste in an environmentally friendly and economically feasible way. To tackle this challenge, a strategy called bio-upcycling was developed, aiming for a biotechnological conversion of plastic waste like PET and PU. These polymers can be hydrolysed by en- Plastic monomer degradation zymes, releasing monomers like ethylene glycol (EG), 1,4-butanediol (BDO), and adipic acid (AA). These can be utilized as carbon source by microorganisms like the biotech- Engineering Pseudomonas putida nological workhorse Pseudomonas putida KT2440 to produce value-added compounds from plastic waste. KT2440 for plastic monomer utilization This thesis enabled P. putida KT2440 to efficiently metabolize the plastic monomers EG, BDO, and AA. Since P. putida KT2440 is not able to grow on EG, adaptive laboratory evolution (ALE) was performed to isolate the enhanced mutants. Genome resequencing and reverse engineering revealed that the deletion of one regulator, gclR, was sufficient to enable growth on EG. The deletion of two additionally identified genes, PP_2046 and PP_2662, could further enhance this growth. With this knowledge, EG metabolism
and its regulation in P. putida was further unraveled. A similar ALE-based strategy was KT2440 for plastic monomer utilization applied to enhance growth on BDO and to enlighten underlying degradation pathways. Targets like PP_2046 were identified via genome resequencing, and proteomic analysis gave insights to the involvement of dehydrogenases. With the overexpression of the operon PP_2047-51, higher growth rates were achieved. Further characterizations indi- cate that BDO may at least in part be metabolized through ß-oxidation. Adipic acid me- tabolism was enabled in P. putida by introducing the heterologous genes dcaAKIJP from Acinetobacter baylyi and subsequent ALE. Furthermore, genome resequencing analysis Pseudomonas putida suggests a hybrid AA metabolic pathway involving DcaAKIJP from A. baylyi combined with parts of native phenylacetate degradation, and other ß-oxidation pathways. In addition to enabling P. putida KT2440 to grow on these substrates individually, a strain was also engineered to metabolize all three of these plastic-derived compounds.
Thus, this work sets the basis for bio-upcycling of PET and PU and leads the way for the Plastic monomer degradation Engineering rational design of a consolidated plastic degrader. Wing-Jin Li
Plastic monomer degradation Engineering Pseudomonas putida KT2440 for plastic monomer utilization
Von der Fakultät für Mathematik, Informatik und Naturwissenschaften der RWTH Aachen University zur Erlangung des akademischen Grades einer Doktorin der Naturwissenschaften genehmigte Dissertation
vorgelegt von
Wing-Jin Li, Master of Science in der Biologie
aus
Wuppertal, Deutschland
Berichter: Prof. Dr. Lars M. Blank
Prof. Dr. Nick Wierckx
Tag der mündlichen Prüfung: 03. Dezember 2019
Diese Dissertation ist auf den Internetseiten der Universitätsbibliothek verfügbar.
Bibliografische Information der Deutschen Nationalbibliothek Die Deutsche Nationalbibliothek verzeichnet diese Publikation in der Deutschen Nationalbibliografie; detaillierte bibliografische Daten sind im Internet über https://portal.dnb.de abrufbar.
Wing-Jin Li:
Plastic monomer degradation Engineering Pseudomonas putida KT2440 for plastic monomer utilization
1. Auflage, 2020
Gedruckt auf holz- und säurefreiem Papier, 100% chlorfrei gebleicht.
Apprimus Verlag, Aachen, 2020 Wissenschaftsverlag des Instituts für Industriekommunikation und Fachmedien an der RWTH Aachen Steinbachstr. 25, 52074 Aachen Internet: www.apprimus-verlag.de, E-Mail: [email protected]
Printed in Germany
ISBN 978-3-86359-858-7
D 82 (Diss. RWTH Aachen University, 2019)
Eidesstattliche Erklärung Hiermit erkläre ich, Wing-Jin Li, dass diese Dissertation und die darin dargelegten Inhalte die eigenen sind und selbstständig, als Ergebnis der eigenen originären Forschung, generiert wurden.
Hiermit erkläre ich an Eides statt
1. Diese Arbeit wurde vollständig oder größtenteils in der Phase als Doktorand dieser Fakultät und Universität angefertigt;
2. Sofern irgendein Bestandteil dieser Dissertation zuvor für einen akademischen Abschluss oder eine andere Qualifikation an dieser oder einer anderen Institution verwendet wurde, wurde dies klar angezeigt;
3. Wenn immer andere eigene- oder Veröffentlichungen Dritter herangezogen wurden, wurden diese klar benannt;
4. Wenn aus anderen eigenen- oder Veröffentlichungen Dritter zitiert wurde, wurde stets die Quelle hierfür angegeben. Diese Dissertation ist vollständig meine eigene Arbeit, mit der Ausnahme solcher Zitate;
5. Alle wesentlichen Quellen von Unterstützung wurden benannt;
6. Wenn immer ein Teil dieser Dissertation auf der Zusammenarbeit mit anderen basiert, wurde von mir klar gekennzeichnet, was von anderen und was von mir selbst erarbeitet wurde;
7. Ein Teil oder Teile dieser Arbeit wurden zuvor veröffentlicht und zwar in Metabolic engineering 07. Juni 2018 (DOI:10.1016/j.ymben.2018.06.003), in Environmental Microbiology 05. Juni 2019 (DOI:10.1111/1462-2920.14703) und in Frontiers in Microbiology 17. März 2020 (DOI:10.3389/fmicb.2020.00382).
Aachen, 20. April 2020
Danksagung Als erstes möchte ich mich bei meinen Doktorvätern Lars Blank und Nick Wierckx bedanken. Ihr habt das innovative Projekt P4SB ins Leben gerufen und mich ins Boot geholt. Danke Lars, dass ich in dem großartigen Labor des iAMBs meine Arbeit machen durfte. Mit deiner wissenschaftlichen Expertise trugst Du zu dem Erfolg dieser Arbeit bei. Die Führung eines Instituts birgt so seine Herausforderungen, die unter deiner Leitung gemeistert werden konnten. Danke Nick, für die vollste Unterstützung und der besten Betreuung, die ich mir hätte erträumen können. Durch die vielen wissenschaftlichen Ratschläge, Diskussionen und Anmerkungen konnte sich diese Arbeit zum Erfolg entwickeln. Mit der unermesslichen Geduld, dem offenen Ohr und den vielen Freiheiten, die Du mir gabst, hast du mich motiviert, gefördert und zum Erfolg geleitet.
Weiterhin danke ich allen Mitgliedern des erfolgreichen Projektes P4SB und speziell meinen Partnern aus dem Institut, Sebastian und Till. Meinen Studenten, Stefan, Alexandra, Tristan, Paul, Julia, Jacky und auch Jan danke ich für die tatkräftige Unterstützung im Labor. Es war immer wieder lustig mit Euch und Eure Arbeiten trugen zu dem Erfolg dieser Dissertation bei.
Ich danke außerdem all den Mitgliedern des iAMBs und den Freunden, die ich am Institut von 2013 bis 2019 gewinnen konnte. Die tatkräftige Unterstützung, das herzliche Umfeld und das außergewöhnliche Arbeitsklima motivierte mich jeden Tag zum Institut zu kommen. Sowohl Arbeiten, Biertrinken, Abhängen, Grillen, Fifa spielen oder andere Aktivitäten, wie Karneval, Maiwanderungen, Insitutsausflüge und Weihnachtsfeiern machen das Institut für angewandte Mikrobiologie zu dem was es für mich ist, ein bisschen wie Zuhause. Spezielles Danke schön an Benedicht, Bibi, Carola, Eda, Halbfeld, Helmut, Isi, Jojo, Maiku, Manja, Prezi, Sebilein, Tillo und Vansi. Danke, dass Ihr mich über die Zeit begleitet habt und ich hoffe Euch und auch alle anderen außerhalb des Institutes wiederzusehen.
Meiner Familie möchte ich danken, dass sie stehts an mich geglaubt haben. Ohne Euch wäre ich nicht wie ich jetzt bin. Danke für Eure Rückendeckung und den Support.
Vielen Dank auch an all jene, die ich hier aus Platzgründen nicht speziell genannt habe. Das werde ich persönlich nachholen.
Als letztes danke ich meinem Lebensgefährten Jonas. Du zeigtest Geduld und hattest immer ein offenes Ohr für mich. Dein Rückhalt, deine Unterstützung und dein Verständnis gaben mir Kraft schwierige und stressige Zeiten durchzustehen. Ich freue mich auf neue Herausforderungen, die ich mit Dir an meiner Seite meistern werde.
Eidesstattliche Erklärung ......
Danksagung ......
Abstract ...... V
Zusammenfassung ...... VII
List of abbreviations ...... IX
List of figures ...... XII
List of tables ...... XVI
List of supporting information ...... XVI
1 General introduction ...... 3
1.1 Ubiquitous plastic ...... 3
1.2 The fate of plastic ...... 5
1.3 Alternative waste management and materials ...... 7
1.4 Pseudomonas for bio-upcycling ...... 11
1.5 Scope of this thesis ...... 14
2 Material and Methods ...... 19
2.1 Chemicals, media and cultivation conditions ...... 19
2.2 Molecular work ...... 26 DNA procedures ...... 26 2.3 Analytical methods ...... 26 Growth monitoring methods...... 26 Extracellular metabolites ...... 27 Genome sequencing ...... 27 Proteomics ...... 27 Detection of dehydrogenase and CoA activity ...... 28 Statistics ...... 28
3 Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440 ...... 32
3.1 Introduction ...... 32
3.2 Results and Discussion ...... 34
I Redox equivalent homeostasis in the utilization of ethylene glycol as co-substrate ... 34 Metabolic engineering approach for ethylene glycol utilization ...... 36 Isolation of mutants able to utilize ethylene glycol as sole carbon source by adaptive laboratory evolution ...... 37 Genomic and metabolic context of adaptive mutations ...... 39 Reverse engineering of ethylene glycol metabolism ...... 44 3.3 Conclusions ...... 47
4 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440 ...... 51
4.1 Introduction ...... 51
4.2 Results ...... 53 Isolation of strain with enhanced growth on 1,4-butanediol by ALE ...... 53 Developing leads for 1,4-butanediol degradation pathways ...... 55 Pathway validation ...... 62 4.3 Discussion ...... 69
4.4 Conclusion ...... 74
5 Consolidation for strains utilizing PU monomers ...... 79
5.1 Introduction ...... 79
5.2 Results ...... 80 Enabling growth on adipic acid ...... 80 The molecular basis for growth on adipic acid ...... 86 Investigation in genes responsible for adipic acid degradation ...... 89 Consolidation of the metabolism of adipic acid, 1,4-butanediol, ethylene glycol ...... 91
6 General discussion and outlook ...... 101
6.1 Plastic monomer degrading P. putida ...... 101
6.2 Challenges to overcome ...... 103 Plastic monomer co-utilization ...... 103 Developing plastic monomer utilizing strains for industrial production ...... 104
Appendix ...... 109
References ...... 133
II
Abstract
Abstract Plastics are robust, ubiquitous, versatile materials, which make our everyday life easier. But these polymers properties make them both a blessing and a curse. The environmental impact of plastics is immense, and so far, there are only a few strategies to deal with plastic waste in an environmentally friendly and economically feasible way. To tackle this challenge, a strategy called bio-upcycling was developed, aiming for a biotechnological conversion of plastic waste like PET and PU. These polymers can be hydrolysed by enzymes, releasing monomers like ethylene glycol, 1,4-butanediol, and adipic acid. These can be utilized as carbon source by microorganisms like the biotechnological workhorse Pseudomonas putida KT2440 to produce value-added compounds. With this strategy, plastic waste can be used to produce value-added materials.
This thesis aims to enable P. putida KT2440 to efficiently metabolize the plastic monomers ethylene glycol, 1,4-butanediol, and adipic acid. Since P. putida KT2440 is not able to grow on ethylene glycol, adaptive laboratory evolution (ALE) was performed to isolate the enhanced mutants. Genome resequencing and reverse engineering revealed that the deletion of one regulator, gclR, was sufficient to enable growth on EG. The deletion of two additionally identified genes, PP_2046 and PP_2662, could further enhance this growth. With this knowledge, ethylene glycol metabolism and its regulation in P. putida was further unraveled. A similar ALE-based strategy was applied to enhance growth on 1,4-butanediol and to enlighten underlying degradation pathways. Targets like PP_2046 were identified via genome resequencing, and proteomic analysis gave insights to the involvement of dehydrogenases. With the overexpression of the operon PP_2047-51, higher growth rates were achieved. Further characterizations indicate that 1,4-butanediol is at least in part metabolized through β-oxidation. Adipic acid metabolism was enabled in P. putida by introducing the heterologous genes dcaAKIJP from Acinetobacter baylyi and subsequent ALE. Furthermore, genome resequencing analysis suggests a hybrid adipic acid metabolic pathway involving DcaAKIJP from A. baylyi combined with parts of native phenylacetate degradation, and β-oxidation pathways.
In addition to enabling P. putida KT2440 to grow on these substrates individually, a strain was also engineered to metabolize all three of these plastic-derived compounds. Thus, this work sets the basis for bio-upcycling of PET and PU and leads the way for the rational design of a consolidated plastic degrader.
V
Zusammenfassung
Zusammenfassung Kunststoffe sind robuste, allgegenwärtige und vielseitige Materialien, die unseren Alltag erleichtern. Aber diese Polymereigenschaften machen sie zu Fluch und Segen zugleich. Die Umweltauswirkungen von Kunststoffen sind immens und es gibt bislang nur wenige Strategien, um mit Kunststoffabfällen umweltfreundlich und wirtschaftlich umzugehen. Um dieser Herausforderung zu begegnen, wurde eine Strategie namens Bio-Upcycling entwickelt, die auf eine biotechnologische Umwandlung von Kunststoffabfällen wie PET und PU abzielt. Diese Polymere können durch Enzyme hydrolysiert werden, wobei Monomere wie Ethylenglykol (EG), 1,4-Butandiol (BDO) und Adipinsäure (AA) freigesetzt werden. Diese können von Mikroorganismen, wie dem biotechnologisch relevanten Pseudomonas putida KT2440, als Kohlenstoffquelle genutzt werden, um wertschöpfende Verbindungen herzustellen. Mit dieser Strategie können aus Kunststoffabfällen Wertstoffe hergestellt werden.
Diese Arbeit soll es P. putida KT2440 ermöglichen, die Kunststoffmonomere EG, BDO und AA effizient zu metabolisieren. Da P. putida KT2440 nicht auf EG wachsen kann, wurde eine adaptive Laborevolution (ALE) durchgeführt, um die adaptierten Mutanten zu isolieren. Genom- Resequenzierung und Reverse Engineering zeigten, dass die Deletion eines Regulators, gclR, ausreichte, um Wachstum auf EG zu ermöglichen. Die Deletion von zwei zusätzlich identifizierten Genen, PP_2046 und PP_2662, konnte dieses Wachstum weiter verstärken. Mit diesem Wissen wurde der EG-Metabolismus und seine Regulation in P. putida weiter enträtselt. Eine ähnliche ALE- basierte Strategie wurde angewendet, um das Wachstum von BDO zu verbessern und die zugrunde liegenden Abbauwege aufzuklären. Ziele wie PP_2046 wurden durch Genom-Resequenzierung identifiziert, und die Proteomanalyse lieferte Erkenntnisse über die Beteiligung von Dehydrogenasen. Mit der Überexpression des Operons PP_2047-51 wurden höhere Wachstumsraten erreicht. Weitere Charakterisierungen deuten darauf hin, dass BDO zumindest teilweise durch β-Oxidation metabolisiert wird. Der AA-Stoffwechsel wurde in P. putida durch Einführung der heterologen Gene dcaAKIJP aus Acinetobacter baylyi und anschließendem ALE ermöglicht. Darüber hinaus legt die Genom-Resequenzierungsanalyse einen hybriden AA-Stoffwechselweg nahe, an dem DcaAKIJP von A. baylyi in Kombination mit Teilen des nativen Phenylacetat-Abbaus und β-Oxidationswegen beteiligt ist.
Zusätzlich dazu, dass P. putida KT2440 auf diesen Substraten individuell wachsen kann, wurde ein Stamm entwickelt, um alle drei dieser aus Kunststoff abgeleiteten Verbindungen zu metabolisieren. Somit legt diese Arbeit die Grundlage für das Bio-Upcycling von PET und PU und ist wegweisend für das rationelle Design eines konsolidierten Kunststoff-degradierenden Organismus.
VII
List of abbreviations
List of abbreviations * Stop codon A adenine a average A. baylyi Acinetobacter baylyi a.u. alternative unit aa amino acid AA adipic acid ALE adaptive laboratory evolution Ampr ampicillin resistance cassette ATP adenosine-triphosphate BC before christi BDO 1,4-butanediol BHET bis(2-hydroxyethyl) terephthalate BLAST basic local alignment search tool bp base pairs BS binding site C cytosine C carbon cdw cell dry weight CoA Coenzyme A Cyt Cytochrome d days DNA deoxyribonucleic acid dTDP-L-rhamnose deoxythymidine diphosphate-L-rhamnose E glutamate e.g. exempli gratia EDTA ethylenediaminetetraaceticacid EG ethylene glycol EtOH ethanol EU European Union f/c Fold changes fwd/fw forward G glycine G guanin G value Green pixel value GHB 4-hydroxybutyrate GHB 4-hydroxybutyrate Glu glucose Gmr gentamycin resistance cassette HAA 3-(3-hydroxyalkanoyloxy) alkanoic acid HPLC high-performance liquid chromatography HTH helix-turn-helix i.e. id est iAMB Institute for Applied Microbiology IGV Integrative Genomics Viewer
IX List of abbreviations
InDel Insertion deletion polymerophism IPTG isopropyl-β- ᴅ- thiogalactopyranosid IR Inverted repeats Kanr kanamycin resistance cassette kbp kilo base pairs KT[A] P. putida KT2440 from Aachen KT[S] P. putida KT2440 from Stuttgart LB lysogeny broth LFQ Label-free quantification log logarithm M9 Mineral salt medium 9 MA Massachusetts mcl medium chain length MCS multiple cloning site MDI methylendiphenylisocyanate MHET mono(2-hydroxyethyl) terephthalate mRNA messenger ribonucleic acid MS Mass Spectrometer MSM mineral salt medium n/a not available NAD(P)+ nicotinamide adenine dinucleotide phosphate (oxidized) NAD(P)H nicotinamide adenine dinucleotide phosphate (reduced) NAD+ nicotinamide adenine dinucleotide (oxidized) NADH nicotinamide adenine dinucleotide (reduced) nm nano meter
OD600 optical density at 600 nm ORF Open Reading Frame oriV origin of replication ox oxidated P. aeruginosa Pseudomonas aeruginosa P. putida Pseudomonas. putida P4SB From plastic waste to plastic value using Pseudomonas putida synthetic biology PBAT polybutylene adipate terephthalate PCL polycaprolacton PCR polymerase chain reaction PE polyethylene PET polyethylene terephthalate PHA polyhydroxyalkanoate PLA polylactic acid PQQ pyrroloquinoline quinone PS polystyrene PU polyurthane PVA polyvinyl PVC polyvinylchloride qRT-PCR reverse transcription polymerase chain reaction RBS ribosomal binding site
X List of abbreviations red reduced rev reverse rpm revolutions per minute RWTH Rheinisch-Westfälische Technische Hochschule SEVA Standard European Vector Architecture Smr Streptomycin resistance cassette SNP single nucleotide polymorphism sp. species T thymine t time TA terephthalic acid TAE Tris acetate- EDTA TCA tricarboxylic acid Tetr tetracycline resistance cassette TF Transcription factor Tris Tris (hydroxymethyl) aminomethane UCD University of Dublin UK United Kingdom USA United States of America UV Ultraviolet w/o without w/v weight per volume wt wildtype
XI List of figures
List of figures Figure 1 Chemical structure of A) polyethylene terephthalate and its monomers terephthalate and ethylene glycol and B) polyurethane and possible monomers ethylene glycol, adipic acid, 1,4- butanediol, and diphenylmethane- 4,4´-diisocyanat...... 4 Figure 2 Amount of plastics in the European Union, Norway, and Switzerland, and how they were treated in 2016 (PlasticsEurope 2018a) ...... 5 Figure 3 Plastics categorized by polymer, usage, properties and recyclability (Ritchie und Roser 2019). ... 6 Figure 4 The division of plastics based on their source and degradability Bioplastics can be bio- or fossil-based and biodegradable or not...... 8 Figure 5 Microbial contribution to the production and development of plastic with PET as an example. Conventionally, fossil-based plastic will be either burned, dumped, or recycled...... 9 Figure 6 Approach to develop P. putida KT2440 strains utilizing the plastic monomers ethylene glycol (EG), 1,4-butanediol (BDO), and adipic acid (AA)...... 14 Figure 7 Reaction scheme of the ethylene glycol metabolism in P. putida KT2440...... 34 Figure 8 Co-feeding of P. putida KT2440 in C-limited chemostats on MSM with 30 mM acetate supplemented with 30 mM ethylene glycol (black), 30 mM glyoxylate (green), or no co-feed (grey) at a dilution rate of 0.2...... 36 Figure 9 Adaptive laboratory evolution of P. putida KT2440 on ethylene glycol and characterization of adapted strains...... 39 Figure 10 Schematic representation of genomic regions mutated after adaptive laboratory evolution on ethylene glycol...... 41 Figure 11 Biomass concentration of P. putida KT2440 and ALE strains E6.1 and E6.2 after 25 h in MSM containing 20 mM allantoin and/or 20 mM ethylene glycol (EG)...... 42 Figure 12 Box-and-whisker plot of relative expression levels of genes implicated in ethylene glycol metabolism in cells of P. putida KT2440 with several knockout background and cells of evolved mutants growing on 20 mM ethylene glycol and 40 mM acetate determined by qRT-PCR. (Experiment performed by MaryAnn Franden) ...... 43 Figure 13 Growth comparison between E6.1 and reverse engineered P. putida KT2440 strains in MSM containing 120 mM ethylene glycol...... 45 Figure 14 Adaptive laboratory evolution of P. putida KT2440 on 1,4-butanediol...... 54 Figure 15 Biomass growth of P. putida KT2440 and the evolved strains B10.1 and B10.2 cultivated in MSM with 13.3 mM glucose (A) or 20 mM 1,4-butanediol (B)...... 57 Figure 16 Proteins with significantly different levels of expression between the evolved strain B10.1 and wild type P. putida KT2440 (A), the evolved strain B10.2 and wild type P. putida KT2440 (B),
XII List of figures between the two evolved strains (C), and the proteins showing the same trend of upregulation or downregulation in the evolved strains compared to the wild type (D)...... 59 Figure 17 Hypothetic pathways for 1,4-butanediol metabolism (A) and selected protein concentrations detected from by proteomic analysis (B)...... 62 Figure 18 Biomass growth of P. putida KT2440 and the evolved strains B10.1 and B10.2 compared with P. putida KT2440 ΔPP_0411-14 on MSM containing 20 mM 1,4-butanediol...... 63 Figure 19 Biomass growth (A) and 1,4-butanediol concentration (B) of P. putida KT2440 (black circle) and ΔpedE-I (crossed circle) in comparison with B10.1 (purple triangle up) and B10.2 (purple triangle down)...... 64 Figure 20 Strains on MSM plates with 20 mM 1,4-butanediol after A) 24 h and B) 48 h...... 64 Figure 21 Biomass growth of P. putida KT2440 ΔPP_2046 transformants harboring an overexpressing construct for PP_2046 or PP_2046E and the empty vector cultivated in MSM with 20 mM 1,4- butanediol...... 65 Figure 22 Biomass growth (A) and 1,4-butanediol concentrations (B) during the cultivation of P. putida KT2440 (black, circles), B10.1, B10.2 (purple, triangles) and P. putida KT2440 ΔPP_2046::14g (black, circled cross) in MSM medium with 20.1 ± 0.5 mM 1,4-butanediol...... 66 Figure 23 Biomass growth of P. putida KT2440 (black, circles), both evolved strains B10.1 (purple, triangles up) and B10.2 (purple, triangle down), and P. putida KT2440 knockout strains (circles) ΔPP_2046 (grey), ΔPP_2049 (green), ΔPP_2051 (orange) and ΔPP_2046::14g (crossed) on 20 mM 4- hydroxybutyrate...... 67 Figure 24 Dehydrogenase activity assay with 4-hydroxybutyrate (GHB) (A) or ethanol (EtOH) (B) as substrate and coupled CoA-ligase/ acyl-CoA dehydrogenase assay with 4GHB as substrate (C)...... 68 Figure 25 Growth of P. putida KT2440 (black, circles), B10.1, B10.2 (purple, triangles) and ΔPP_2046 (grey, circles) on 1,4-butanediol (A), 1,6-hexanediol (B), 1,7-heptanediol (C) and 1,8-octanediol (D)...... 69 Figure 26 Biomass growth of P. putida KT2440 (black, circles) and the evolved strains (purple) B10.1 (triangle up) and B10.2 (triangle down) in MSM with 20 mM butanol...... 69 Figure 27 P. putida KT2440 sequence of PP_2046 encoding for a LysR-transcriptional regulator...... 73 Figure 28 Growth comparison of wildtype P. putida KT2440, the evolved strains on ethylene glycol, E6.1 and E6.2, and the evolved strains on 1,4-butanediol, B10.1 and B10.2, cultivated in MSM with 20 mM 1,4-butanediol...... 74 Figure 29 Overview of genes and enzymes involved in adipic acid metabolism ...... 81 Figure 30 Adaptive laboratory evolution of P. putida KT2440 harboring pBNT_dcaAKIJP on adipic acid. . 84 Figure 31 Growth of biomass and adipic acid detection of the isolated ALE strains A6.1p and A12.1p growing on adipic acid in a shake flask cultivation in salicylate and kanamycin supplemented MSM with 18.8 ± 0.8 mM adipic acid...... 85
XIII List of figures
Figure 32 Growth of the P. putida KT2440 wildtype (black circle) and the evolved strain A6.1 (green triangle) harboring the empty vector (pBNT_mcs, light-colored) or expressing the native (pBNT_dcaAKIJP, medium colored) or evolved version (pBNT_dcaAKIJPcpi, dark-colored) of dcaAKIJP in kanamycin supplemented MSM containing 20 mM adipic acid (n = 1) with (A) and without (B) the addition of salicylate as inducer...... 86 Figure 33 Biomass growth of strains growing in salicylate and kanamycin supplemented MSM with 20 mM adipic acid...... 90 Figure 34 Biomass growth (A) and extracellular metabolites (B) of ΔgclR deletion in P. putida KT2440 (circle), the evolved strains A6.1p (triangle up) and A12.1p (triangle down). Cultures were grown in MSM with 24.4± 0.9 mM ethylene glycol and 29.9± 0.9 mM adipic acid...... 93 Figure 35 Biomass growth (A) and extracellular metabolites (B) of P. putida B10.1 (rectangle), KT2440 ΔgclR ΔPP_2046::14g ΔPP_2662::14d (circle), and E6.1 (triangle) cultivated in MSM with 6.4± 0.5 mM ethylene glycol and 13.8± 0.4 mM 1,4-butanediol...... 94
Figure 36 Biomass growth of P. putida KT2440 ΔgclR ΔPP_2046::14g ΔPP_2662::14d ΔPpaaF::14g
(circle) and E6.1 ΔPpaaF:.14g (square) harboring either the empty vector (black) or pBNT_dcaAKIJPcpi (green)...... 95
Figure 37 Biomass growth of P. putida KT2440 ΔgclR ΔPP_2046::14g ΔPP_2662::14d ΔPpaaF:.14g
(circle) (A) and E6.1 ΔPpaaF::14g (square) (D) harboring either the empty vector (pBNT_mcs; grey, yellow) or pBNT_dcaAKIJPcpi (black, orange) and the corresponding extracellular metabolites during cultivation in MSM with salicylate and kanamycin supplemented MSM with 9.8± 0.1 mM adipic acid (green), 22.9± 0.2 mM ethylene glycol (black) and 12.8± 0.3 mM 1,4-butanediol (blue) (B, C; E, F)...... 96 Figure 38 First consolidated strains for PET monomer utilization. Growth of P. putida KT2440, the evolved strain E6.1 and KT2440 ΔgclR ΔPP_2046 ΔPP_2662::14d baring pBT_tph cultivated in kanamycin supplemented MSM containing 20 mM terephthalate (A) and 30 mM ethylene glycol and 20 mM terephthalate (B)...... 103 Figure 39 PHA production in relation to biomass formation in evolved strains...... 105
Figure S1 Growth of P. putida KT2440 in MSM medium containing 28.6 mM acetate and 29.8 mM ethylene glycol in duplicates...... 119 Figure S2 Growth of P. putida KT2440 in 50 mL (250 mL Erlenmeyer flask) of modified M9 medium (Wehrmann et al. 2017) containing 20 mM ethylene glycol...... 119 Figure S3 A: Growth comparison of P. putida KT2440 and all adapted strains in MSM containing 30 mM ethylene glycol (in light colors) and 120 mM ethylene glycol (in darker colors)...... 120 Figure S4 Comparison of growth rate and maximum biomass concentrations of P. putida KT2440 strains E6.1, E6...... 120
XIV List of figures
Figure S5 Growth of P. putida KT2440 in 20 mL (125 mL Erlenmeyer flask) of M9 medium containing 20 mM ethylene glycol (black circles), 60 mg L-1 xanthine (green circles) or a mixture of 20 mM ethylene glycol and 60 mg L-1 xanthine (green circles with black fill)...... 123 Figure S6 Growth of P. putida KT2440 Δped (PP_2673-80), E6.1 Δped (PP_2673-80) and E6.2 Δped (PP_2673-80) in 50 mL (500 mL Erlenmeyer flask) of MSM medium containing 30 mM ethylene glycol in duplicates...... 125 Figure S7 Long-term phenotypic robustness of E1.1, E6.1 and KT2440 ΔgclR ΔPP_2046 ΔPP_2662::14d. 20 single colonies, picked after 134 (E1.1), 116 (E6.1) and 134 (KT2440 ΔgclR ΔPP_2046 ΔPP_2662::14d) generations of cultivation in LB medium, were cultivated in MSM containing 30 mM ethylene glycol (black bars, n = 1) and compared to their corresponding parental strain (grey bars, error bars indicate the standard deviation; n = 3)...... 126
XV List of tables
List of tables Table 1. Strains used in this work with listed genotype and references...... 19 Table 2 Concentrations of C-sources used in MSM ...... 24 Table 3. Antibiotics used in this work ...... 24 Table 4 Media composition for ALE of P. putida KT2440 on adipic acid ...... 25 Table 5 Overview of tested constructs in P. putida KT2440 for growth on MSM containing 30 mM ethylene glycol and antibiotics for plasmid maintenance (*= Schmidt (2017)) ...... 36 Table 6 List of all mutations found for wildtype P. putida KT2440 and both evolved strains B10.1 and B10.2...... 55 Table 7 List of mutations (Single Nucleotide Polymorphisms (SNP) and Insertion-Deletion polymorphisms (InDel)) found in the genome of the evolved strains B10.1 (not underlined) or B10.2 (underlined) but not in our laboratory P. putida KT2440...... 56 Table 8 Protein sequence comparison of A. baylyi and P. putida KT2440 ...... 82 Table 9 Carbon source composition in two-fold buffered MSM for adaptive laboratory evolution of P. putida KT2440 to enable growth on adipic acid ...... 83 Table 10 Summary of identified mutations in strain A6.1p and A12.1p...... 87 Table 11 List of main affected genes found after genome resequencing analysis of both A6.1p and A12.1p...... 88
Table S 1 List of used oligonucleotides ...... Fehler! Textmarke nicht definiert. Table S 2 Plasmids used in this work with listed genotype and references...... 116 Table S3 List of all mutations found for all sequenced strains...... 121 Table S4 List of GntR binding sites ...... 122 Table S5 List Selection of found proteins. Protein concentrations and fold changes (fc) of wildtype P. putida KT2400 grown in MSM with glucose (glu) compared to cultivation with 1,4-butanediol (BDO) and the evolved strains B10 (the average of both strains) compared to wildtype P. putida KT2440 grown in MSM with 1,4-butanediol are shown...... 127
List of supporting information Supporting information 1: GclR binding sites (BS) mutation in P. putida E6.2 ...... 121 Supporting information 2: Bprom analysis of mutated sequence in P. putida E6.2: ...... 121 Supporting information 3: Regprecise (http://regprecise.lbl.gov/RegPrecise) analysis of gclR: ...... 122 Supporting information 4: Locating Tn4652 using read coverage analysis ...... 124
XVI List of supporting information
Supporting information 5: Mapped transposon Tn4652 and the resulting putative promotor insertion124 Supporting information 6: Bprom analysis of 3´ transposon site of Tn4652 ...... 125 Supporting information 7 Promotor predictions for the intergentic region between paaF and paaY .... 128 Supporting information 8 Bprom analysis of the intergenic region of paaF and paaY (5´- 3´) ...... 128 Supporting information 9 Bprom analysis of the intergenic region of paaF and paaY (3´- 5´) ...... 129
XVII
Chapter 1 Introduction
Contributions: This chapter was written by Wing-Jin Li and was reviewed by Lars M. Blank and Nick Wierckx.
General introduction
1 General introduction
1.1 Ubiquitous plastic Natural plastics were already used in approximately 1600 BC, when mesoamerivan people processed natural latex from Castilla elastic with an extract from Ipomoea alda, to produce rubber balls and artifacts (Hosler D. et al. 1999). The modern development of plastic began in the nineteenth century when, for example, polystyrene (PS) and polyvinylchloride were developed (Andrady und Neal 2009). Further, in the past 70 years abundant other synthetic plastic came to the market. Nowadays, a world without plastics is unimaginable. Whereas the production in 1950 was 2 million tones, the global production of plastics was predicted to reach 335 million tones worldwide in 2016, in which Europe has a share of 60 million tones (Geyer et al. 2017; PlasticsEurope 2018a).
What makes this material so profitable is its versatility. It possesses plenty of properties, dependent on the polymer and the manufacturing, including its usage at a wide range of temperatures, being thermally and electrically insulating, chemically as well as light, water, and shock-resistant. Moreover, it is strong and tough, yet malleable and light in weight. Therefore, this material can replace many products, which previously were made of steel, aluminum or other material. Furthermore, with low production costs due to a low oil price and the ability to be produced in cost- effective mass production, a wide range of application unveils. Plastics are used in the building and construction industry as well as in automotive or electronical industry and further in agriculture, households and many more sectors. Due to all the different areas of usage for all kinds of plastic, a world without taking advantage of these materials is most likely not possible anymore. (PlasticsEurope 2018a; Thompson et al. 2009; Venkatachalam et al. 2012)
Since this material has different characteristics, plastics are divided into thermoplastics and thermosets. Whereas thermoplastics can be melted, molded, and reshaped, thermosets change their chemical characteristic during production and cannot be reformed.
One of the thermoplastics is polyethylene terephthalate (PET) which was first patented by Whinfield and Dickson in 1941 (Scheirs und Long 2003). This polyester is made of terephthalate and ethylene glycol (Figure 1) and show high mechanical strength, toughness, and fatigue resistance up to 150- 175°C as well as good chemical, hydrolytic, and solvent resistance. Moreover, fibers are highly persistent towards washing. Blended with cotton or other cellulosic fibers, it is used in apparel, curtains, and industrial fibers. The most prominent products made of PET are in the packaging sector for all kinds of solutions and products, from beverages to food and chemicals. Being transparent,
3 Chapter 1 gloss, and resistant to certain permeations like carbon dioxide, it’s the ideal lightweight container. (Andrady und Neal 2009)
A O
O
O O n
polyethylene terephthalate
HO OH OH HO O O terephthalate ethylene glycol
B O O O NH NH O O O O O n polyurtheane
O ONH NHO HO OH O adipic acid diphenylmethane- 4,4'- diisocyanat
OH OH HO HO
ethylene glycol 1,4- butanediol
Figure 1 Chemical structure of A) polyethylene terephthalate and its monomers terephthalate and ethylene glycol and B) polyurethane and possible monomers ethylene glycol, adipic acid, 1,4-butanediol, and diphenylmethane- 4,4´-diisocyanat.
Polyurethane (PU) is one representative of thermoset plastics discovered by Otto Bayer 1937. Started with aliphatic diisocyanate and diamine forming polyurea, the monomers to form PU expanded to di- or tri poly-isocyanates reacting with a polyol, creating a wide range of different forms of PU with different properties (Figure 1). By adding chain extenders, catalysts or other additives, even more varieties are possible. Depending on the composition, possible applications are in painting and coating material, in building insulation as sealants as well as in foams and absorbents, and many more end-user products like pillows and mattresses. (Sharmin und Zafar 2012; PlasticsEurope 2018a)
4 General introduction
1.2 The fate of plastic All products undergo a life cycle of different life span. A single used package or water bottle only lasts a couple of days or even just hours, whereas building insulation shall last decades, but what happens after use? Nowadays there are several ways to manage plastic waste. In 2016, in the European Union and, Norway and Switzerland, 27.1 million tons of plastic waste were collected and treated in three major ways, (i) landfill, (ii) energy recovery or (iii) recycling Figure 2 (PlasticsEurope 2018a).
Landfill 27.30% 7.40 mt
total= Energy recovery 27.1 41.60% 11.27 mt r xx mt Recycling 31.10% 8.43 mt
Figure 2 Amount of plastics in the European Union, Norway, and Switzerland, and how they were treated in 2016 (PlasticsEurope 2018a)
However, all three strategies bear limitations and disadvantages. Landfill appears to be one of the easiest methods to handle mixed plastic waste. However, space is limited and more important the environmental impact of long term storage is uncertain since the leakage and release of those plastics are unavoidable (Lenaïc 2017). Moreover, since the original source of plastics and their monomers are mainly fossil-based and therefore consist of high energy content, its potential energy is lost. To profit from the energy, 41.6% of the collected plastics is used for energy recovery during incineration. With this method, also mixed waste can be burned to generate energy. Nevertheless, the way of combusting plastic in incinerators differ greatly. All incinerators generate greenhouse gases and are contributing to global warming, but in modern plants, technics are used to generate electric energy and heat and prevent the release of pollutant residues. However, existing outdated factories are inefficient in energy recovery and are not equipped with flue gas cleaning facilities and thereby releasing volatile metal chlorides, sulfoxides, nitrogen oxides persistent organic pollutants, and heavy metals. (Astrup et al. 2009)
Another strategy is recycling. Current methods are mainly based on mechanical or chemical strategies. Mechanical technologies depend on previous costly plastic sorting since only several thermoplastics can be remolded and processed Figure 3. But the quality after remolded plastic is often lower and finally of too low quality to be utilized for the same application and has to be blend
5 Chapter 1 with virgin resin, to be reused again. Finally, lower quality plastic accepting applications are chosen, with the consequence of down-cycling (van Eygen et al. 2018; Hestin et al. 2018). Furthermore, depending on their properties, not all thermoplastics are suitable for recycling (e.g., polystyrol, polyurethane). Also, thermosets once manufactured, cannot be remolded again. The chemical way of dealing with waste is pyrolysis (thermolysis) to produce gases, fuels, or other products. This strategy is, however, associated with high energy costs and therefore not common (Geyer et al. 2017; Garcia und Robertson 2017; PlasticsEurope 2018a). Other chemical strategies are glycolysis (Carta et al. 2003), which is partially commercialized and academic strategies, for example for PET, to the two corresponding diols, which simplifies purification, and yields high-value molecules (Westhues et al. 2018).
Figure 3 Plastics categorized by polymer, usage, properties and recyclability (Ritchie und Roser 2019). For instance, 58.2 % of European Union´s PET plastic bottles are recycled (petcore Europe 14.12.2018).
6 General introduction
The three above mentioned strategies deal with collected waste, which is in a managed system. Not counted in is all the plastics ended up in open dumps or accumulating in the natural environment, causing impacts on land as well as finally in rivers and in the oceans. Since there are data lacking for terrestrial and freshwater habitats, most data available are from the marine environment. Plastics from municipal waste reach the ocean via littering and improper waste disposal, either direct or more often indirect through rivers, landfill leachates, wastewater discharges or weather events (Beaman et al. 2016; Andrady und Neal 2009; Mani et al. 2015). Already in the 1960s, from different countries in the world, seabirds harboring plastic in their stomachs were reported (New Zealand: Harper and Fowler (1962), Hawaiian islands: Kenyon and Kridler (1969); Canada: Rothstein in 1962) (Bergmann et al. 2015; Ryan 2015)). These were the first sign, that plastic entered the environment, entangling marine organisms. With the increasing production of plastic, the influence of plastic debris also grew. From then on, environmental impacts of plastic litter became of interest to academics. Now we know, once entered the environment, plastic even encounter their developers when consuming contaminated comestibles, as it was reported, that plastic is ingested by human (Smith et al. 2018). Plastic is ubiquitous, being found in all habitats, and all life forms from mammalians to insects, even in phytoplankton, and is associated with bacteria and other microbes (Prata et al. 2019).
1.3 Alternative waste management and materials
Alternatives to reduce the impact of post-consumer plastics, and still to benefit from plastic, is, for example, to replace conventional plastics with bioplastics (Narancic und O'Connor 2017). Since this term has several meanings, one should define the term “bioplastic”. The confusion is based on the prefix “bio” since there are differences between bio-based, biodegradable, and non-biodegradable (persistent) materials. Often bioplastic means material being produced from renewable resources
(i.e., biomass or CO2), independent whether it is biodegradable or not (Figure 4 in green). Plastic monomers, like ethylene glycol, adipic acid, 1,4-butanediol being produced by bacteria and then chemically polymerized to plastics can be called to be bio-based (Figure 5 rosé arrow) (Yue et al. 2012; Yu et al. 2014; Burgard et al. 2016). Moreover, there are bioplastics, which are fossil-based and yet biodegradable (Figure 4 in blue). Therefore, one should first differentiate bioplastic to the three categories. Bio-based PVC or PE isnot degradable in water, soil or in industrial composts. Though, polyhydroxyalkanoates, as well as starch, cellulose or enzyme-based polymers, are biodegradable. Additionally, polylactic acid is another bio-based plastic, which is degradable in soil and industrial composts (Karan 2019). Also, even though produced from fossil-based substrates, polybutylene adipate terephthalate, and polycaprolactone are biodegradable (Ferreira et al. 2019; Saad und Suter 2001).
7 Chapter 1
biobased
PHA, starch, cellulose or PVC, PE enzyme based polymers
PLA
non biodegradable biodegradable
conventional PBAT, PCL plastics
fossilbased
Figure 4 The division of plastics based on their source and degradability Bioplastics can be bio- or fossil-based and biodegradable or not. PVC = polyvinylchloride, PE = polyethylene, PLA = polylactic acid, PHA = polyhydroxyalkanoate, PBAT = polybutylene adipate terephthalate, PCL = polycaprolactone. (adapted from European Bioplastics (January 2016))
Besides causing less environmental burden, for instance in form of less release of compounds like toxic substances and microplastics, being able to be degraded by bacteria is one of the benefits of biodegradable plastics. Products like disposal cutlery and food packaging as well as used as agriculture mulch foils es are examples for the use of these materials. Biodegradable polymers even reached the medical field and can be used in tissue engineering or hydrogel bioprinting (Cai et al. 2019). Since the properties of bio-based plastics become more diverse, many products made of conventional plastic can be replaced by bio-based and biodegradable ones (Karan et al. 2019). As for persistent bio-based plastics, they can be used as long-term carbon sink. Build from renewable sources, non-bio-degradable products in the building and infrastructure industry can act as carbon storage and therefore reduce temporarily CO2 concentrations in the air.
However, the major drawback of bioplastics are the production costs. No matter if the bioplastic is produced bio-based or fossil-based. The development of plastics with similar properties like the fossil-based ones are still ongoing and mass production has not matured, and therefore is costly. Furthermore, although the society is aware of the necessity of changing from fossil-based plastics to bio-based, the majority is not willing to pay more for a “green” product (Nielson 2011).
One step further would be to combine waste management with the production of bioplastics to achieve a circular economy, being both, economically and ecologically sound. Instead of landfill, energy recovery or recycling, microorganisms shall utilize post-consumer waste to produce new bio- based products and conduct bio-upcycling (Wierckx et al. 2015; Salvador et al. 2019) (Figure 5).
8 General introduction
CH3 O
O upcycled bioplastic (PHA)
OH HO
HO OH
O O
OH HO O
HO OH O
O O O O
fossil TA & EG PET
Figure 5 Microbial contribution to the production and development of plastic with PET as an example. Conventionally, fossil-based plastic will be either burned, dumped, or recycled. Via bacteria, plastics, other valuable chemicals, and materials can be produced using renewable sources or utilize plastic waste for bio-upcycling.
In recent years, several organisms capable of metabolizing plastics have been identified. With evolution over time, nature developed a way to metabolize plastics or compounds of plastic. These include bacteria in the gut of the wax worm Plodia interpunctella capable of degrading polyethylene (PE) (Yang et al. 2014) and the bacterium Ideonella sakaiensis, which can depolymerize PET and grow on the resulting terephthalate component (Yoshida et al. 2016b).
How could microorganisms perform bio-upcycling? Taking PET as an example, conventionally, this material can be depolymerized thermochemically, but this approach has a high energy cost, which cannot be covered by selling the resulting syngas or fuels. Also, presorting for these plastics are demanding efforts und are tied to costs. Various studies show enzymes with hydrolyzation activity towards PET resulting in bis(2-hydroxyethyl)terephthalate (BHET), mono(2- hydroxyethyl)terephthalate (MHET), and finally the monomers ethylene glycol and terephthalate (Yoshida et al. 2016b; Barth et al. 2015). Despite enzymatic PET degradation is depended on crystallinity and orientation of the substrate, enzyme concentration, temperature, and incubation time, degradation can be monitored by quantification of the hydrolysis products like terephthalate. According to Kawai (2019), depending on the mechanism of PET degradation, there are PET surface– modifying enzymes and PET hydrolases, which degrade inner blocks of PET. Slow but detectable
9 Chapter 1 hydrolyzation of amorphous PET films is catalyzed by the two secreted mesophilic enzymes from Ideonella sakaiensis. After biofilm formation, attachments between cells and the plastic film are build, a PETase and MHETases are secreted to cleave the polymer to trimers, dimers, and monomers as mentioned above (Yoshida et al. 2016b). This PETase, which was defined as surface–modifying enzyme, was engineered to perform more efficiently (Kawai et al. 2019). By introducing two mutations and thereby modifying the PETase-active site being more cutinase like, the performance of that PETase was enhanced by crystallinity reduction and product release of MHET and terephthalate. (Austin et al. 2018; Ma et al. 2018) Whereas the original PETases mainly release BHET and MHET, further degradation of those two intermediates to terephthalate and ethylene glycol is catalyzed by MHETases. Additional studies show, PET is biologically degraded via hydrolases like esterase, lipases, and cutinases from various moderate thermophilic actinomycetes, which act as degrader of inner blocks of PET (Han et al. 2017; Sulaiman et al. 2012; Kawai et al. 2019). TfCut2, a PET hydrolase from Thermobifida fusca, for instance, has great thermal stability, is not depended on metal ions and show respectable binding performance to the substrate (Roth et al. 2014). The enzymatic plastic degradation, for example, is developed by Carbios in collaboration with Novozymes for degradable PET material (Boisart et al. 2016).
After the process with PET surface–modifying enzymes or PET hydrolases, the plastic monomers terephthalate and ethylene glycol will be released and can be further utilized. For terephthalic acid degradation, Wang et al. (1995) isolated Comamonas testosteroni YZW-D and identified the gene cluster, responsible for the transport and conversion of terephthalic acid to protocatechuate. A gene encoding for a transporter for terephthalic acid (tphR) is followed by genes encoding for two subunits for a dioxygenase (tphA2A3), a dehydrogenase (tphB), and a reductase (tphA1). This operon is controlled by the regulator TphR. After the formation of protocatechuate, this can be further degraded to intermediates of the TCA cycle (Wang et al. 1995). I. sakaiensis also harbors two terephthalate degradations gene clusters, highly identical to the ones in Comamonas. These are also able to convert terephthalic acid to protocatechuate, which further is metabolized via the β- ketoadipate pathway to TCA cycle intermediates. Another terephthalic acid degrading bacterium, Pseudomonas putida GO16, was isolated from a PET plant. Characterization showed, it is able to utilize terephthalic acid from PET pyrolysis oil (Kenny et al. 2008) and produces mcl-PHA (medium chain length) (Kenny et al. 2012).
Pseudomonas strains are also reported to grow on ethylene glycol. Pseudomonas putida JM37 is able to grow on ethylene glycol as well as on its oxidized products glycolate and glyoxylate. After the oxidation of ethylene glycol to glyoxylate, two pathways enable P. putida JM37 to utilize ethylene glycol. Therefore, glyoxylate either forms malate by the fusion with acetyl-CoA via GlcB, or Gcl
10 General introduction catalyzes two glyoxylate to tartronate semialdehyde, which can be further converted to 3- phosphoglycerate (Mückschel et al. 2012).
Besides PET, other plastics like polyester PU, for example, composed of adipic acid, 1,4-butanediol, ethylene glycol, and an isocyanate methylendiphenylisocyanate (MDI) are also of interest as carbon source (Wierckx et al. 2015). In general, microorganisms are able to degrade PU (Cregut et al. 2013). Though PU degradation is slow it may offer an alternative to landfill or combustion in the future.
For research purposes and to determine PU degradation, an aqueous polyester PU dispersion with a solid content of about 40 %, namely Impranil, is used as a model substrate. Four polyester hydrolases LC cutinase, Tfcut2, Tcur1278, Tcur0390 are found to have hydrolytic activity towards this colloidal polyester PU dispersion. Furthermore, those enzymes show significant weight loss of PU and show surface erosions with solid PU thermoplastic. Several tests show indications, that cleavage of ester bonds are responsible for the degradation. (Schmidt et al. 2017). Additionally, Hung et al. (2016) identified two secreted lipases from Pseudomonas protegens (PueA and PueB) responsible for the degradation of Impranil. So basically, PU is, to a certain extent, biodegradable. Recently, more screening effort identified more fungi and isolated enzymes to degrade PU (Magnin et al. 2019a; Magnin et al. 2019b).
Being the monomers of PU, it is likely that adipic acid, 1,4-butanediol, ethylene glycol, and an isocyanate methylendiphenylisocyanate (MDI) are released during the process of depolymerization. As described before, ethylene glycol is degradable by for example P. putida JM37. Further, released adipic acid can be degraded by CoA activating adipic acid and subsequent degradation via β-oxidation from Acinetobacter baylyi (Parke et al. 2001). Also knowing that adipic acid, as well as 1,4-butanediol, can be produced microbiologically, it shall be possible to degrade those compounds. (Polen et al. 2013; Yu et al. 2014; Burgard et al. 2016)
Certainly, more microbial strategies to deal with the carbon-rich plastic wastes to produce valuable compounds like mcl- PHA are investigated in (Nikodinovic-Runic et al. 2013; Brandon und Criddle 2019). In this paragraph, examples for required technology to implement microbial waste management and to work on bio-upcycling are presented. Nevertheless, the combination of all traits into one desired organism remains a challenge, since not one bacterium is capable to depolymerize and utilize plastics and additionally produce a bioplastic like PHA.
1.4 Pseudomonas for bio-upcycling
Associated with environmental matrices, Pseudomonas species were isolated to degrade a broad spectrum of plastic polymers with a wide range of efficiencies (Wilkes und Aristilde 2017). Shimao et
11 Chapter 1 al. (2001) were able to identify Pseudomonas degrading polyvinyl (PVA). Also, Pseudomonas like
P. fluorescence or P. aeruginosa are reported to degrade PU (Shimao 2001; Cregut et al. 2013).
Pseudomonads belong to the proteobacteria and are aerobic gram-negative soil bacteria (Palleroni 1993). The genus is ubiquitous, surviving in aquatic as well as terrestrial habitats. They can live in physicochemical nutritional niches and tolerate endogenous and exogenous stresses. Their natural environment requires them to retain a versatile and flexible and yet robust metabolism to cope with changing conditions (e.g., availability of C-sources, oxidative stressors, temperature changes). (Nelson et al. 2002) Some Pseudomonas species are able to synthesize bioactive compounds including virulence factors towards humans and plants (Balasubramanian et al. 2013).
P. putida is one of the flexible and engineerable species found to be tolerant towards toluene, other solvents and aromatics (Ramos et al. 1998; Volkers et al. 2010). The strain used in this work is P. putida KT2440 (Regenhardt et al. 2002; Bagdasarian et al. 1981), which is a derivative of the environmental isolate known as P. arvilla mt-2, not harboring its mega-plasmid. Since P. putida is missing ORFs encoding for virulent factors, from 1982 on it is one of the first biosafety strains, and harbor the status as host-vector system with safety level 1 (Federal Register 1982; Kampers et al. 2019). Nelson et al. (2002) showed that P. putida KT2440 has a lot of advantages due to its versatile metabolism. Being able to degrade aromatics, possessing different transporters and a complex repertoire of chemosensory systems, P. putida is able to adapt to various environmental conditions. Its single circular chromosome is 6.18 Mb in size and contains an average GC content of 61.5 %. 4,610 out of 5,420 open reading frames (ORFs) (85 %) share homologos towards its relative P. aeruginosa PA01 (Nelson et al. 2002). With the revisited sequence new protein encoding genes and reannotation of genes were identified (Belda et al. 2016). This enables a better understanding and more precise molecular work. Now, P. putida KT2440 functions as a model organism in bioremediation and work horse in biotechnology and synthetic biology (Nikel et al. 2014; Nikel und Lorenzo 2018; Grunwald 2014).
The principle of synthetic biology is to use basics from engineering to create synthetic biological systems. By performing manipulations on the living, knowledge shall be gained to influence the system to act as desired (Peretó 2007). This wouldn’t be able without biologists working on tools enabling molecular work. Transformations, gene and genome editing, driving mechanisms within the cell are necessary to inflict bacteria to carry out the desired purpose. In all the years in which biotechnologist are working with Pseudomonas, tools are developed and are still in progress of optimization (Filloux und Ramos 2014; Martínez-García und Lorenzo 2017).
12 General introduction
For the introduction of plasmids with for example heterologous genes, protocols adapted from E. coli (Hanahan 1983; Dower et al. 1988) and P. aeruginosa are used (Choi et al. 2006). Moreover, genes can be integrated to the genome using Tn7 constructs (Lambertsen et al. 2004; Choi und Schweizer 2006). Procedures for gene manipulations are developed to edit the genome by introducing mutations, inserting or deleting whole genes or clusters. With the method from Martínez-Garcia (2011) even markerless mutations can be achieved. To manipulate a regulatory machinery not only deletion of genes are possible. The genomic introduction of synthetic calibrated promotors enables adjustments of expression levels as desired (Zobel et al. 2015).
Besides of gaining knowledge about metabolic pathways and mechanisms, having tools in hand enables the manipulation of Pseudomonas for applications like the production of their natural carbon storage in form of PHA (Prieto et al. 2016; Borrero-de Acuña et al. 2014) and detergent production (Wittgens et al. 2018; Tiso et al. 2016).
All in all, P. putida is a promising candidate to combine all necessities for bio-upcycling plastics waste to plastic values using synthetic biology (Project “P4SB”, EU Horizon 2020, grant agreement no. 633962).
13 Chapter 1
1.5 Scope of this thesis To benefit from P. putida KT2440´s advantages and to further enable the bio-upcycling approach, this organism shall be biotechnologically modified to enable the metabolism of depolymerized PET and PU. This work mainly focuses on the monomers ethylene glycol, dissociated from either PET or PU depolymerization, and 1,4-butanediol and adipic acid, which are compounds from polyurethane break down. For this, metabolic engineering technics as well as adaptive laboratory evolution with subsequent genome sequencing and reverse engineering shall empower P. putida KT2440 to metabolize the beforehand described substrates and shall give insights in novel degradation pathways for those compounds.
The metabolism of ethylene glycol is dealt with in chapter three. After characterizing P. putida KT2440 behavior on ethylene glycol and adaptive laboratory evolution, molecular methods give insights into the degradation of ethylene glycol. Thereby, regulatory elements and the underling degradation pathway are elucidated.
Chapter four is designated to the metabolism of 1,4-butanediol. Proposed pathway strategies are tested and enlightened.
To bring all together, chapter five processes the degradation of adipic acid. By introducing heterologous genes, P. putida KT2440 is enabled to grow on this substrate. Finally, a strain is developed to grow on the three monomers ethylene glycol, 1,4-butanediol, and adipic acid.
wild type EG, BDO, AA Pseudomonas utilizing strains putida KT2440
metabolic engineering
genome ALE reverse engineering re-seq
Figure 6 Approach to develop P. putida KT2440 strains utilizing the plastic monomers ethylene glycol (EG), 1,4- butanediol (BDO), and adipic acid (AA).
14
Chapter 2 Material and methods
Contributions: This chapter was written by Wing-Jin Li and was reviewed by Lars Blank and Nick Wierckx.
Material and Methods
2 Material and Methods
2.1 Chemicals, media and cultivation conditions The chemicals used in this work were obtained from Carl Roth (Karlsruhe, Germany), Sigma-Aldrich (St. Louis, MO, USA), or Merck (Darmstadt, Germany) unless stated otherwise. Glycerol was kindly provided by Bioeton (Kyritz, Germany).
All bacterial strains used for this are listed in Table 1. Cultivations were performed in LB – complex medium (10 g L-1 trypton, 5 g L-1 yeast extract and 5 g L-1 sodium chloride) or, for quantitative microbiology experiments, in mineral salt medium (MSM) (Hartmans S. et al. 1989), solidified when needed with 1.5 % agar (w/v), containing different amount of C source as listed in Table 2 unless stated otherwise.
Table 1. Strains used in this work with listed genotype and references. iAMB internal No. refers to the strain collection of the Institute of Applied Microbiology at the RWTH Aachen, Aachen Germany. Detailed plasmid descriptions are listed in Table S 2. iAMB No strain resis- genotype/ plasmid reference inter . tance nal No. 3045 Acinetobacter DSM No. 24193 baylyi Pseudomonas putida 2058 1 KT2440 - cured, restriction-deficient derivative of P. putida mt-2 Bagdasarian et al. 1981 3566 B10.1 - KT2440 ALE in 1,4-butanediol, single strain A6 this work 3567 B10.2 - KT2440 ALE in 1,4-butanediol, single strain C2 this work 3565 JM37 - Mückschel et al. 2012 3704 E6.1 - KT2440 ALE in ethylene glycol, single strain A1.1 Li et al. 2019 3705 E6.2 - KT2440 ALE in ethylene glycol, single strain B2.6 Li et al. 2019 3611 GO16 - Isolate growing on terephthalate and ethylene glycol Kenny et al. 2008b 3713 KT2440 - ΔPP_0411-13 = polyamine ABC transporter this work ΔPP_0411-13 3706 E6.1 ΔPP_0411- - ΔPP_0411-13 = polyamine ABC transporter this work 13 3714 E6.2 ΔPP_0411- - ΔPP_0411-13 = polyamine ABC transporter this work 13 3715 B10.1 ΔPP_0411- - ΔPP_0411-13 = polyamine ABC transporter this work 13 3707 B10.2 ΔPP_0411- - ΔPP_0411-13 = polyamine ABC transporter this work 13 3754 E1.1 - KT2440 ALE in ethylene glycol, single strain JKP106 Li et al. 2019 from Stuttgart, Janosch Klebensberger 3755 E1.2 - KT2440 ALE in ethylene glycol, single strain JKP123 Li et al. 2019 from Stuttgart, Janosch Klebensberger 3756 E1.3 - KT2440 ALE in ethylene glycol, single strain JKP124 Li et al. 2019 from Stuttgart, Janosch Klebensberger 5894 12 KT2440 ΔpedE-I - ΔpedE-I Daun 2017 3976 10 KT2440 - ΔPP_2046 this work ΔPP_2046
19 Chapter 2 iAMB No strain resis- genotype/ plasmid reference inter . tance nal No. 4013 B10.1 ΔPP_2046 - ΔPP_2046 this work
4015 B10.2 ΔPP_2046 - ΔPP_2046 this work
5891 E6.1 ΔpedE-I - ΔpedE-I Daun 2017 5892 E6.2 ΔpedE-I - ΔpedE-I 5893 13 KT2440 ΔpedE - ΔpedE Daun 2017 4910 A6.1p kan50 KT2440 ALE in adipic acid, single strain cpi1, bearing Ballerstett pBNT(mcs)_dcaAKIJPcpi (unpublished) 5885 KT2440 ΔpedH - ΔpedH Daun 2017 5886 14 KT2440 ΔpedI - ΔpedI Daun 2017 5887 E1 ΔpedH - ΔpedH Daun 2017 5888 E2 ΔpedH - ΔpedH Daun 2017 5889 E2 ΔpedI - ΔpedI Daun 2017 5890 E1 ΔpedI - ΔpedI Daun 2017 4176 2 KT2440 Δgcl - Δgcl this work 4180 E6.2 Δgcl - Δgcl this work 4178 E6.1 Δgcl - Δgcl this work 4619 E6.1 ΔgclR - ΔgclR this work 4612 E6.2 ΔgclR - ΔgclR this work 4617 3 KT2440 ΔgclR - ΔgclR ΔPP_2046 this work ΔPP_2046 4618 E6.1 ΔgclR - ΔgclR ΔPP_2046 this work ΔPP_2046 4619 E6.2 ΔgclR - ΔgclR ΔPP_2046 this work ΔPP_2046 4621 17 KT2440 - ΔPP_2051 this work ΔPP_2051 4622 B10.1 ΔPP_2051 - ΔPP_2051 this work 4623 B102 ΔPP_2051 - ΔPP_2051 this work 4631 KT2440 A12.1p kan50 KT2440 ALE in adipic acid, single strain 70, bearing Niehoff 2017 pBNT(mcs)_dcaAKIJPcpi 4637 KT2440 - ΔPP_2662 this work ΔPP_2662 4638 KT2440 - ΔPP_2662::14d this work ΔPP_2662::14d 4639 11 KT2440 - ΔPP_2046::14g this work ΔPP_2046::14g 4640 E6.1 ΔPP_2662 - ΔPP_2662 this work 4641 E6.1 - ΔPP_2662::14d this work ΔPP_2662::14d 4642 E6.1 - ΔPP_2046::14g this work ΔPP_2046::14g 4543 E6.2 ΔPP_2662 - ΔPP_2662 this work 4544 E6.2 - ΔPP_2662::14d this work ΔPP_2662::14d 4545 E6.2 - ΔPP_2046::14g this work ΔPP_2046::14g 4548 6 KT2440 ΔΔΔ::14g - ΔgclR ΔPP_2046::14g ΔPP_2662 this work
4649 E6.1 ΔΔΔ - ΔgclR ΔPP_2046 ΔPP_2662 this work 4650 E6.1 ΔΔΔ::14d - ΔgclR ΔPP_2046 ΔPP_2662::14d this work 4651 E6.1 ΔΔΔ::14g - ΔgclR ΔPP_2046::14g ΔPP_2662 this work 4652 E6.2 ΔΔΔ - ΔgclR ΔPP_2046 ΔPP_2662 this work
20 Material and Methods iAMB No strain resis- genotype/ plasmid reference inter . tance nal No. 4653 E6.2 ΔΔΔ::14d - ΔgclR ΔPP_2046 ΔPP_2662::14d this work 4654 E6.2 ΔΔΔ::14g - ΔgclR ΔPP_2046::14g ΔPP_2662 this work 4655 B10.1 - ΔPP_2046::14g this work ΔPP_2046::14g 4656 B10.2 - ΔPP_2046::14g this work ΔPP_2046::14g 4657 KT2440 ΔgclR - ΔgclR this work 4658 5 KT2440 ΔΔΔ - ΔgclR ΔPP_2046 ΔPP_2662 this work 4647 8 KT2440 ΔΔΔ::14d - ΔgclR ΔPP_2046 ΔPP_2662::14d this work
4660 9 KT2440 - ΔgclR ΔPP_2046::14g ΔPP_2662::14d this work ΔΔ::14gΔ::14d 4889 16 KT2440 - ΔPP_2049 this work ΔPP_2049 4890 B10.2 ΔPP_2049 - ΔPP_2049 this work 4891 KT2440 - ΔPP_2144 this work ΔPP_2144 4892 4 KT2440 ΔgclR - ΔgclR ΔPP_2662 this work ΔPP_2662 4893 7 KT2440 ΔgclR - ΔgclR ΔPP_2662::14d this work ΔPP_2662::14d 4894 A6.1p ΔPP_2144 kan50 ΔPP_2144, bearing pBNT(mcs)_dcaAKIJPcpi Bockwoldt 2018
4895 A6.1p ΔgclR kan50 ΔgclR, bearing pBNT(mcs)_dcaAKIJPcpi Bockwoldt 2018 4896 B10.1ΔPP_2049 - ΔPP_2049 Niehoff 2017 4897 KTΔPP_2046::14 kan/g Tn7-PP_2046 this work cKT9394 m 4898 KTΔPP_2046::14 kan/g Tn7-PP_2046E (B10.1--> Stop) this work c-B10.193/94 m 4899 KTΔPP_2046::14 kan/g Tn7-PP_2046E (B10.2 --> missense) this work c-B10.293/94 m 4900 B10.1ΔPP_2046:: kan/g Tn7-PP_2046 this work 14cKT9394 m 4901 B10.1ΔPP_2046:: kan/g Tn7-PP_2046E (B10.1--> Stop) this work 14c-B10.193/94 m 4902 B10.1ΔPP_2046:: kan/g Tn7-PP_2046E (B10.2 --> missense) this work 14c-B10.293/94 m 4903 B10.2ΔPP_2046:: kan/g Tn7-PP_2046 this work 14cKT9394 m 4904 B10.2ΔPP_2046:: kan/g Tn7-PP_2046E (B10.1--> Stop) this work 14c-B10.193/94 m 4905 B10.2ΔPP_2046:: kan/g Tn7-PP_2046E (B10.2 --> missense) this work 14c-B10.293/94 m 4906 P. putida_pTrans - knockin Promotor Transposon (medium size:128 bp) Bockwoldt 2018 poson_s glmS 4907 P. putida_pTrans - knockin Promotor Transposon (medium size:164 bp) Bockwoldt 2018 poson_m glmS 4908 KT2440 - ΔPpaaYX::14d Bockwoldt 2018 ΔPpaaYX::14d 4910 A6.1 - KT2440 ALE in adipic acid, cured Bockwoldt 2018 4911 A12.1 - KT2440 ALE in adipic acid, cured Bockwoldt 2018 4919 KTΔPP_2046::14 - ΔPP_2046::14g ΔPP_2662 this work g ΔPP_2662 4920 KTΔPP_2046::14 - ΔPP_2046::14g ΔPP_2662::14d this work g ΔPP_2662::14d
5641 KT2440 MM17 - ΔmmgF ΔscpC ΔsucCD ΔaceA ΔglcB Δicd Δidh ΔphaZ Provided by M.T. Δocd ΔPP_3533 PP_4431 ΔhutF Manoli (2018, CSIC) 5642 KT2440 - knock-out putative promoter exchange paaF Knock-in Plaster 2019 ΔPpaaF::14g 14g in KT2440
21 Chapter 2 iAMB No strain resis- genotype/ plasmid reference inter . tance nal No. 5644 KT2440 MM16 - ΔmmgF ΔscpC ΔsucCD ΔaceA ΔglcB Δicd Δidh ΔphaZ Provided by M.T. Δocd ΔPP_3533 PP_4431 ΔhutF growth optimized Manoli (2018, CSIC) Strain for PET degradation KT2440 E1.1 - E1.1 after stability test on LB (>120 generations) this work CONSORTIA KT2440 E6.1 - E6.1 after stability test on LB (>120 generations) this work CONSORTIA KT2440 ∆∆∆::14d - ΔgclR ΔPP_2046 ΔPP_2662::14d after stability test on this work LB (>120 generations) CONSORTIA KT2440 MM16 - MM16 ALE on ethylene glycol (after 15d) this work (ALE2) 5645 15 KT2440 - knockout PP_2047-51 in KT2440 this work ∆PP_2047-2051 5646 B10.A - knockout PP_2047-51 in B10.A this work ∆PP_2047-2051 5647 B10.B - knockout PP_2047-51 in B10.B this work ∆PP_2047-2051
5648 KT2440 ΔgclR - ΔgclR ΔPP_2046::14g ΔPP_2662::14d ΔPpaaF::14g Plaster 2019 ΔPP_2046::14g ΔPP_2662::14d ΔPpaaF::14g 5649 E6.1 ΔPpaaF::14g - ∆PpaaF::14g Plaster 2019 5650 A6.1 PP_2144E - PP_2144 E = PP_2144_E80X Plaster 2019
5651 KT2440 - ΔPpaaF::14g PP_2144E Plaster 2019 ΔPpaaF::14g PP_2144E 5652 KT2440 Tn7 tph o gm20 Tn7 Integration of the tph operon (plasmid this work pTn7tphOperon) 5653 E6.1 Tn7 tph o gm20 Tn7 Integration of the tph operon (plasmid this work pTn7tphOperon) 5654 KT2440 ΔΔΔ::14d gm20 Tn7 Integration of the tph operon (plasmid this work Tn7 tph o pTn7tphOperon) 5655 KT2440 - cured, restriction-deficient derivative of P. putida mt-2 Provided by M.T. from CSIC Manoli (2018, CSIC) 5656 MM19 - KT2440 ΔmmgF ΔscpC ΔsucC ΔsucD ΔaceA ΔglcB Δicd Provided by M.T. ΔphaZ ΔPP_3190 Δocd ΔhutF ΔPP_3533 ΔphaD Manoli (2018, CSIC) 5657 MM20 - KT2440 ΔmmgF ΔscpC ΔsucC ΔsucD ΔaceA ΔglcB Δicd Provided by M.T. ΔphaZ ΔPP_3190 Δocd ΔhutF ΔPP_3533 Δpha ΔgclR Manoli (2018, CSIC) 5658 MM21 - ΔgclR Provided by M.T. Manoli (2018, CSIC) 5659 KT2440 - ΔPpaaY::14d PP_2144E Plaster 2019 ΔPpaaY::14d PP_2144E 5660 MM20 Tn7 tph o gm20 mit Tn7 tph operon this work
Escherichia coli
- - - 2047 HB101 kan50 F mcrB mrr hsdS20(rB mB ) recA13 leuB6 ara-14 proA2 Nick Wierckx, TU lacY1 galK2 xyl-5 mtl-1 rpsL20(SmR) glnV44 λ- ; host for Delft, NL pRK2013 - - + - 2382 DH5α - F endAI hsdR17 (rk , mk ) supE44 thi-I λ recAlgyrA96 Grant et al. (1990) relAIdeoR∆(lacZYA-argF)-U169 ϕ80dlacZ∆M15 3815 DH5α kan50 pSEVA234_agmR this work 3816 DH5α kan50 pSEVA234_dcaIJ-o this work 3817 DH5α kan50 pSEVA234_dcaAo this work 3818 DH5α kan50 pSEVA234_gcl this work 3819 DH5α kan50 pSEVA234_glcB this work 3820 DH5α kan50 pSEVA234_pduCDE this work
- - + - 2077 DH5α λpir - F endAI hsdR17 (rk , mk ) supE44 thi-I λ recAlgyrA96 Centro Nacional de relAIdeoR∆(lacZYA-argF)-U169 ϕ80dlacZ∆M15 λpir Biotecnologia-CSIC, Madrid Spain 3821 DH5α λpir kan50 pEMG_Δgcl this work
22 Material and Methods iAMB No strain resis- genotype/ plasmid reference inter . tance nal No. 3822 DH5α λpir kan50 pSEVA234_gcl_glxR this work 3823 DH5α λpir kan50 pEMG_ΔPP_0411-0413 this work 3824 DH5α λpir kan50 pBNT(mcs)_dcaAKIJP this work 4614 DH5α λpir kan50 pEMG_PP_2051 this work 4620 DH5α λpir kan50 pSEVA234_dcaIJo_dcaAo this work 4634 DH5α λpir kan50 pEMGdPP_2662 this work 4635 DH5α λpir kan50 pEMGdPP_2662+14d this work 4636 DH5α λpir kan50 pEMGdPP2046+14g this work 4661 DH5α λpir kan50 pEMG_dPP_2144 this work 4662 DH5α λpir kan50 pEMG_dPP_2049 this work 4921 DH5α λpir tet20 pSEVA512S_dPP_2144 this work 4922 DH5α λpir tet20 pSEVA512S_dPP_4283 this work
4924 DH5α λpir kan50 pBG14c-KT93/94 this work 4925 DH5α λpir kan50 pBG14c-B10.1_93/94 this work 4926 DH5α λpir kan50 pBG14c-B10.2_93/94 this work 4927 DH5α λpir kan50 pEMG_dPpaaY +14d this work 4928 DH5α λpir kan50 pBG_pTransposon_s this work 4929 DH5α λpir kan50 pBG_pTransposon_m this work 5661 DH5α λpir gen25 pJNN_PP_2046E this work 5662 DH5α λpir gen25 pJNN_PP_2144 this work 5663 DH5α λpir gen25 pJNN_PP_2144EA6.1 this work 5664 DH5α λpir gen25 pJNN_PP_2144EA12.1 this work 5665 DH5α λpir kan50 pEMG_14g paaF this work 5667 DH5α λpir kan50 pEMGdPP_2047-2051 this work 5668 DH5α λpir kan50 pEMG_∆PP_2144 + PP_2144_E this work 5669 DH5α λpir kan50 pEMGΔPpaaF::14gΔPpaaY::14g this work 5670 DH5α λpir kan50 pBG14g FRT kan paaYX this work 5870 DH5α λpir strep5 pSEVA424_glxR this work 0 5871 DH5α λpir kan50 pEMGΔgntR this work 5872 DH5α λpir kan50 pEMGΔPP2046 this work 5873 DH5α λpir kan50 pEMGΔpedE-I this work 5874 DH5α λpir gen25 pJNN_gntR this work 5875 DH5α λpir gen25 pJNN_gntRE? this work 5876 DH5α λpir kan50 pBNT_PP2046 this work 5877 DH5α λpir kan50 pBNT_PP2046E this work 5878 DH5α λpir kan50 pEMGΔpedE this work 5879 DH5α λpir kan50 pEMGΔpedI this work 5880 DH5α λpir kan50 pEMG-delta pedH this work 5881 DH5α λpir kan50 pEMG_Δgcl (7) this work 5883 DH5α λpir kan50 pEMG_ΔgntR this work 5884 DH5α λpir kan50 pBNT_mcs dcaAKIJPcpi this work
23 Chapter 2
Table 2 Concentrations of C-sources used in MSM
medium: MSM (1-2x Puffer) with preculture 20 mM glucose or 20 mM acetate or 20 mM glycerin, 5 mM glucose studies with ethylene glycol 15-120 mM ethylene glycol studies with 1,4-butanediol 13.3-20 mM 1,4-butanediol studies with adipic acid 20-30 mM adipic acid
For the cultivations with allantoin, 20 mM allantoin was dissolved in MSM and sterilized using filtration.
For plasmid maintenance, E. coli strains and P. putida KT2440 strains were cultivated in media supplemented with antibiotics. The compositions of antibiotic stock solutions are listed in Table 3. These solutions were sterilized by using a 0.2 μm syringe filter (Carl Roth GmbH + Co. KG, Karlsruhe, Germany)
Table 3. Antibiotics used in this work antibiotic dissolved in stock working working concentration concentration in concentration in E. coli P. putida ampicillin deionized water 100 g L-1 100 mg L-1 500 mg L-1 gentamycin deionized water 50 g L-1 20 mg L-1 20 mg L-1 kanamycin deionized water 50 g L-1 50 mg L-1 50 mg L-1
Liquid cultivations were incubated at 30 °C for Pseudomonas and A. baylyi, and 37 °C for E. coli, 200 rpm shaking speed with an amplitude of 50 mm in a Multitron shaker (INFORS, Bottmingen, Switzerland) using 100 mL non-baffled Erlenmeyer flasks with metal caps, containing 10 mL culture volume for a pre-culture and 500 mL non-baffled Erlenmeyer flasks with metal caps, containing 50 mL culture volume for a main culture.
For online growth detection, 96-well plates with 200 μL or in 24-well plates with 4 – 3 mL culture volume were inoculated with a pre-culture containing 4 - 3 mL MSM with 20 mM glucose in 24-well System Duetz plates (Enzyscreen, Heemstede, The Netherlands), cultivated in a Multitron shaker (INFORS, Bottmingen, Switzerland) with a 300 rpm shaking speed with an amplitude of 50 mm. Inoculated Growth Profiler® plates were incubated at 30 °C, 225 rpm shaking speed with an amplitude of 50 mm in the Growth Profiler® 960 (Enzyscreen, Heemstede, The Netherlands).
Chemostat experiments were carried out in DasBox mini reactors (Eppendorf, Hamburg, Germany) with a working volume of 100 mL and a dilution rate of 0.2 1/h at 30 °C. The pH was kept at 7.0 by
24 Material and Methods the automatic addition of NaOH and HCl, and partial oxygen pressure was kept at 30 % air saturation by automatic adjustment of the stirrer speed between 400 and 800 rpm. The three conditions (MSM with 30 mM sodium acetate, 30 mM sodium acetate and 30 mM ethylene glycol, and 30 mM sodium acetate and 30 mM glyoxylate) were tested subsequently in one experiment, waiting at least five volume changes to achieve a new steady state.
Adaptive laboratory evolution was performed as follows: a pre-culture of P. putida KT2440, cultivated in MSM with 20 mM glucose, was used to inoculate 250 mL clear glass Boston bottles with Mininert valves (Thermo Fisher Scientific, Waltham, MA, USA) containing 10 mL MSM with 15 mM ethylene glycol for the adaptation on ethylene glycol, 20 mM 1,4-butanediol for the adaptation on 1,4-butanediol or different concentrations of adipic acid and alternative C sources as listed in Table 4 for the adaption on adipic acid (final OD600 of 0.01). Serial transfers were reinoculated several times after the cultures reached an OD600 of at least 0.5, with a starting OD600 of 0.1. After growth was detected (usually overnight), single colonies were isolated from ALE cultures by streaking samples on LB agar plates.
Table 4 Media composition for ALE of P. putida KT2440 on adipic acid
Order Medium: MSM (2x Puffer) containing Preculture 20 mM glucose 1 5 mM glucose, 5 mM adipic acid, 15 mM 4-hydroxybenzoate 2 10 mM adipic acid, 20 mM 4- hydroxybenzoate 3 20 mM adipic acid, 1 mM 4-hydroxybenzoate 4 20 mM adipic acid, 0,5 mM 4-hydroxybenzoate 5 30 mM adipic acid
For the adaption of P. putida KT2440 on ethylene glycol, two (E6.1 and E6.2) out of 36 colonies were chosen according to their growth behavior in MSM with 20 mM ethylene glycol determined using the Growth Profiler® 960 (Enzyscreen, Heemstede, The Netherlands).
After ALE on 1,4-butanediol, two strains (B10.1 and B10.2) out of 72 strains were selected according to their growth behavior in MSM with 20 mM 1,4-butanediol determined using the Growth Profiler® 960 (Enzyscreen, Heemstede, The Netherlands).
Two strains out of 96 strains, adapted on adipic acid were picked for their growth behavior in MSM with 30 mM adipic acid determined using the Growth Profiler® 960.
25 Chapter 2
2.2 Molecular work
DNA procedures The construction of plasmids was performed either by standard restriction-ligation or Gibson assembly (Gibson et al. 2009) using the NEBuilder HiFi DNA Assembly (New England Biolabs, Ipswich, MA, USA). DNA modifying enzymes were purchased from New England Biolabs, for dephosphorylation Fast AP Thermo Sensitive Alkaline Phosphatase (ThermoScientific, Langenselbold, Germany) was used. Primers were purchased as unmodified DNA oligonucleotides from Eurofins Genomics (Ebersberg, Germany) and are listed in Figure S1. Clonal DNA sequences were amplified using the Q5 High-Fidelity Polymerase (New England Biolabs, Ipswich, MA, USA). DNA- Ligations were performed by using T4 ligase from Fermentas (ThermoScientific, Langenselbold, Germany) according to the protocol. Arbitrary-primed PCR was performed as described by Martínez-García et al. (2014a). For the transformation of DNA assemblies and purified plasmids (Table S 2) into competent E. coli a heat shock protocol was performed (Hanahan 1983). For P. putida transformations either conjugational transfer or electroporation were performed as described by Wynands et al. (2018). Knockout strains were obtained using the pEMG system described by Martínez-García and Lorenzo (2011) with a modified protocol described by Wynands et al. (2018). Plasmid inserts and gene deletions were confirmed by Sanger sequencing performed by Eurofins Genomics (Ebersberg, Germany).
In order to perform PCR directly from bacteria the alkaline polyethylene glycerol-based method was used (Chomczynski & Rymaszewski, 2004). Therefore, cell material was picked and dissolved in 50 μL of the reagent, containing 60 g PEG 200 with 0.93 mL 2 M KOH and 39 mL water, with a pH of 13.4. After incubation for 3-15 min, 2 μL of the sample was used as template in a 25 μL PCR reaction.
For the separation and staining of DNA via electrophoresis 1 % (w/v) agarose was dissolved in 1 x TAE-buffer (40 mM Tris, 20 mM glacial acetic acid, 1 mM EDTA, pH 8) using microwave heating. After cooling down the agarose 5 μL Roti-GelStrain (Carl Roth GmbH + Co. KG, Karlsruhe, Germany) per 100 mL agarose were added. Using the Power PacTM Basis 300 (Bio-Rad Laboratories, Hercules, USA) samples were separated at 85 V and 400 mA for 45 min.
2.3 Analytical methods
Growth monitoring methods
Bacterial growth was monitored as optical density at a wavelength of λ = 600 nm (OD600) with an Ultrospec 10 Cell Density Meter (GE Healthcare, Little Chalfont, Buckinghamshire, UK).
The online analysis of growth using the Growth Profiler® was analyzed using the Growth Profiler® Control software V2_0_0. Cell densities are expressed as G-value, which is derived from imaging analysis of microtiter plates with transparent bottoms.
26 Material and Methods
Extracellular metabolites For measuring extracellular metabolites, samples taken from liquid cultivation were centrifuged for 3 min at 17,000×g to obtain supernatant for High-Performance Liquid Chromatography (HLPC) analysis using a Beckman System Gold 126 Solvent Module equipped with a Smartline 2300 refractive index detector (Knauer, Berlin, Germany). Analytes were eluted using a 300 x 8 mm organic acid resin column together with a 40 x 8 mm organic acid resin precolumn (both from CS Chromatographie,
-1 Langerwehe, Germany) with 5 mM H2SO4 as mobile phase at a flow rate of 0.7 ml min at 70 °C. (Mückschel et al. 2012)
Genome sequencing Genomic DNA for resequencing was isolated through a High Pure PCR Template Preparation Kit (ROCHE life science, Basel, Switzerland). Sequencing and SNP/InDel (single nucleotide polymorphism/ insertion and deletion polymorphism) calling was done by GATC (Konstanz, Germany) using Illumina technology as paired-end reads of 125 base pairs. To map the reference sequence against the database, BWA with default parameters was used (Li und Durbin 2009). SNPs and InDels, analyzed by GATK´s UnifiedGenotyper (DePristo et al. 2011; McKenna et al. 2010), were listed and visualized with the Integrative Genomics Viewer (IGV) (Thorvaldsdóttir et al. 2013).
The sequences have been deposited in the Sequence Read Archive (SRA) with the accession number SRP148839 for ethylene glycol ALE strains.
Proteomics The evolved strains B10.1 and B10.2 were cultivated along with the wild type P. putida KT2440 in 50 ml MSM medium supplemented with 20 mM 1,4-butanediol or 13 mM glucose. The cultures were harvested by centrifugation and prepared for proteomic analysis as previously described (Narancic et al. 2016). Samples were sent to T. Narancic at University of Dublin to perform the following protocol. For total protein concentrations, peptide fragments obtained by trypsin digestion were analyzed on the Q-Exactive Hybrid Quadrupole Orbitrap Mass Spectrometer (MS; Thermo Scientific) connected to a Dionex Ultimate 3000 (RSLCnano; Thermo Scientific) chromatography system (Buffer A: 97 % water, 2.5 % acetonitrile, 0.5 % acetic acid; buffer B: 97 % acetonitrile, 2.5 % water, 0.5 % acetic acid; all solvents were LC-MS grade). The mass spectrometer was operated in positive ion mode with a capillary temperature of 320 °C and a potential of 2300 V applied to the frit. All data were acquired with the MS operating in automatic data-dependent switching mode. A high-resolution (70,000) MS scan (300–1600 m/z) was performed using the Q Exactive to select the 12 most intense ions prior to MS/MS analysis using HCD. The identification and quantification were performed using the Andromeda peptide identification algorithm integrated into MaxQuant (Cox und Mann 2008; Cox et al. 2011). P. putida KT2440 protein sequence database downloaded from UniProt (www.uniprot.org)
27 Chapter 2 in April 2016 was used as a reference (The UniProt Consortium 2019). Label-free quantification (LFQ) was used to compare the expression level of proteins across samples and growth conditions (Wang et al. 2003). Proteins with a 2-fold change or higher and a significant change in t-test (FDR 0.01) were automatically accepted, while spectra with no specific change were manually checked for quality.
Each sample had three biological replicates, and each biological replicate was then prepared for the proteomic analysis as a technical replicate. Statistical analysis was performed using Perseus and built-in Welche’s t-test with FDR set at 0.01 (Tyanova et al. 2016). The proteins with at least 2-fold change were functionally annotated using David bioinformatics (Huang et al. 2009b, 2009a) and clustered into orthologous groups using EggNOG (Huerta-Cepas et al. 2016).
Detection of dehydrogenase and CoA activity To perform the enzyme assay, cells from a pre-culture were used to inoculate the main-culture containing 20 mM glucose and 5 mM 1,4-butanediol. After 16 h of cultivation, crude extract was isolated using BugBuster (Merck, Darmstadt, Germany) and was desalted using PD-desalting columns (GE Healthcare, Buckinghamshire, UK) and eluted in 100 mM glycinglycin buffer. Protein concentrations were estimated by standard Bradford test at 595 nm. A CoA-synthetase assay was performed according to a modified protocol from Koopmann et al (2010) on a basis of an coupled reaction with pyruvate kinase and lactate dehydrogenase and with addition of ATP and CoA. The substrate used was 5 mM 4-hydroxybutyrate. For the dehydrogenase assay, a modified protocol from Kagi und Vallee B. H. (1960) was followed, in which 5 mM 4-hydroxybutyrate and 4 % ethanol as control were used as substrate. Crude cell extracts were obtained as described for the CoA-enzyme assay.
For all assays, measurements were performed in a 96-well-plate at 30 °C in a well plate reader from Synergy Mx from Biotek (Bad Friedrichshall, Germany). To obtain a homogeneous mixture, after the addition of either NAD+, NADH, or 4-hydroxybutyrate, the well-plate was shaken for three seconds at highest speed available. The measurement of NADH consumption or formation was detected at 340 nm.
Statistics Statistical probability values were, if not stated otherwise, calculated using a paired Student's t- distribution test with homogeneity of variance (n = 3, significance level of 0.05). In case of duplicates, errors are expressed as deviation from the mean (n = 2).
28
Chapter 3 Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440
Contributions: This chapter was written by Wing-Jin Li and was reviewed by Nick Wierckx and Lars M. Blank and partly by Lahiru N. Jayakody, Mary Ann Franden, Gregg T. Beckham, Janosch Klebensberger. Wing-Jin Li performed most experiments. Janosch Klebensberger, Matthias Wehrmann as well as Stefan Schmidt and Tristan Daun constructed strains and plasmids as specified in Table 1 and Table S 2. Stefan Schmidt and Tristan Daun contributed to growth experiments. qRT-PCR were conducted by Mary Ann Franden. A modified version of this work was published in 5th June 2019 as original research article in Environmental Microbiology with the title “Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440” with the contribution of Jayakody, Lahiru N.; Franden, Mary Ann; Wehrmann, Matthias; Daun, Tristan; Hauer, Bernhard; Blank, Lars M.; Beckham, Gregg T.; Klebensberger, Janosch; Wierckx, Nick (DOI:10.1111/1462-2920.14703). Chapter 3
3 Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440
3.1 Introduction Environmental pollution with plastics is a global problem with far-reaching implications (Geyer et al. 2017; Garcia und Robertson 2017; PlasticsEurope 2018). In 2016, approximately 335 million tonnes of plastic waste was produced, a large proportion of which is mismanaged leading to the dissemination of plastic particles into mainly aquatic ecosystems (Jambeck et al. 2015; Ogunola et al. 2018; Narancic und O'Connor 2017; PlasticsEurope 2018). Despite the fact that these plastics represent non-natural chemicals, several organisms capable of metabolizing these structures have been identified in recent years. These include bacteria in the gut of the wax worm Plodia interpunctella capable of degrading polyethylene (PE) (Yang et al. 2014; Bombelli et al. 2017) and the bacterium Ideonella sakaiensis, which can depolymerize poly(ethylene terephthalate) (PET) and grow on the resulting terephthalate component (Yoshida et al. 2016a). The identification and engineering of plastic-degrading organisms and enzymes provides a compelling opportunity to increase plastic recycling and thereby reduce plastic pollution through the utilization of plastic waste as carbon source for microbial biotechnology (Wierckx et al. 2015; Cho et al. 2015; Narancic und O'Connor 2017; Wei und Zimmermann 2017a, 2017b; Austin et al. 2018).
Pseudomonas putida has been implicated as a promising host for a broad variety of biotechnological approaches including the metabolic use of plastics (Wierckx et al. 2015; Wilkes und Aristilde 2017). It is a model organism in bioremediation and also a workhorse in biotechnology and synthetic biology (Nikel et al. 2014; Loh und Cao 2008) due to its metabolic versatility (Nikel et al. 2015), genetic tractability (Belda et al. 2016), and tolerance towards chemical and oxidative stresses (Martínez- García et al. 2014b). A proof of principle for biotechnological conversion of polystyrene, PE, and PET through pyrolysis and subsequent conversion to polyhydroxyalkanoate using different Pseudomonads has been demonstrated (Guzik et al. 2014; Ward et al. 2006; Kenny et al. 2008) the case of PET, pyrolysis resulted in solid terephthalate, which was used as feedstock for Pseudomonas putida GO16 (Kenny et al. 2012).
The microbial metabolism of ethylene glycol, the second component of PET besides terephthalate, is at least equally important. The global production of ethylene glycol was about 20 million tonnes in 2010, with applications in a wide range of polyester resins and fibers (Yue et al. 2012). Ethylene glycol is also used as a coolant or antifreeze agent, and as solvent or humectant (Dobson 2000). Its oxidation products glycolaldehyde, glyoxal, glycolate, and in particular glyoxylate, also represent
32 Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440 chemicals of industrial relevance, due to their use as reactive building blocks in the production of agro-, aroma-, and polymer chemicals, or pharmaceuticals (Mattioda G. 2000; Sajtos A. 1991; Yue et al. 2012). Glycolaldehyde is also a significant component of aqueous thermochemical wastewater streams and lignocellulosic hydrolysates, which renders those substrates highly toxic, but also a potentially attractive feedstock for microbes if toxicity tolerance improvements can be achieved (Black et al. 2016; Czernik und Bridgwater 2004; Jayakody et al. 2017; Kumar und Gupta 2008; Lu et al. 2009; Vispute et al. 2010; Yu et al. 2008; Jayakody et al. 2018). In nature, glycolate is a significant overflow metabolite of phytoplankton during autotrophic photorespiration, making up 10-50 % of excreted dry organic matter in marine environments (Lau und Armbrust 2006).
Pseudomonas putida possesses the genetic inventory for several pathways potentially enabling ethylene glycol metabolism. Initially, the diol is converted into glyoxylate in a series of oxidation reactions catalyzed by a set of redundant dehydrogenases, with PP_0545, PedI, PedE, and PedH as predominant enzymes (Figure 7A) (Wehrmann et al. 2017a; Mückschel et al. 2012). Further oxidation to oxalate also occurs in whole-cell biotransformations, but generally, only relatively small traces of this dead-end product are observed (Mückschel et al. 2012). The complete conversion of ethylene glycol to glyoxylate yields three reducing equivalents, either in the form of NADH, PQQH2 or in a direct coupling to the electron transport chain. Glyoxylate can be further metabolized by the AceA or GlcB enzymes involved in the glyoxylate shunt (Blank et al. 2008b). Paradoxically, although this shunt is usually a carbon conservation pathway for growth on C2 substrates that enter primary metabolism at the level of acetyl-CoA, the overall stoichiometry of either of the two pathways starting with these enzymes can only yield two molecules of CO2 and two reducing equivalents (Figure 7), making it unsuitable for the utilization of glyoxylate as a sole carbon source. As an alternative to this energy yielding pathway, P. putida KT2440 also has the genetic inventory (PP_4297-PP_4301) for a route to metabolize glyoxylate through the glyoxylate carboligase (Gcl) enzyme, which converts two glyoxylate molecules into tartronate semialdehyde and CO2. The former is converted to glycerate, either directly or via hydroxypyruvate, and subsequently to 2-phosphoglycerate (Figure 7B, hence, termed the ‘Gcl pathway’) (Franden et al. 2018). Theoretically, this pathway could enable the utilization of ethylene glycol as carbon source, however, it is not induced in P. putida KT2440 under these conditions (Mückschel et al. 2012).
In this work, we aimed to identify the underlying cause of the existing growth deficiency and to characterize the metabolism of ethylene glycol as an energy-yielding secondary substrate for redox biocatalytic processes. With adaptive laboratory evolution, we isolated strains that use ethylene glycol as a sole source of carbon. The subsequent identification of the corresponding mutations
33 Chapter 3 combined with a reverse engineering approach finally unraveled the metabolic and regulatory systems that underlie efficient ethylene glycol catabolism.
A B ethylene glycol glyoxylate NAD+ Gcl NADH CO2 PQQ oxalate PedE PQQH2 tartronate PedH Hyi semialdehyde PedI glycolaldehyde PP_0545 GlxR PP_2049 hydroxypyruvate + NAD(P)H NAD ? NAD(P)+ NADH GlxR glycerate glycolate glyoxal + NAD(P)H NAD(P) TtuD
2-phosphoglycerate Cytox ? GlcDEF PykF Cytred glyoxylate pyruvate
+ CO2 NAD CO2 GlcB NADH acetyl-CoA NAD(P)H AceA NAD(P)+
malate isocitrate
2 NAD+ 2 NADH succinate 2 CO2
Figure 7 Reaction scheme of the ethylene glycol metabolism in P. putida KT2440. A: Oxidation steps of ethylene glycol to glyoxylate. B: Possible routes of glyoxylate metabolism. The pathway which enables the utilization of glyoxylate as a carbon source is shown in black. Routes which only generate redox equivalents and CO2 are shown in grey. Redox equivalents are indicated in red. The forked arrow indicates that two glyoxylate are used by the glyoxylate carboligase. Enzymes investigated in are underlined.
3.2 Results and Discussion
Redox equivalent homeostasis in the utilization of ethylene glycol as co-substrate Although wildtype P. putida KT2440 is unable to use ethylene glycol as a sole carbon source, non- growing cells can consume it as studies in detail by (Mückschel et al. 2012). The catabolism of ethylene glycol involves three oxidation steps towards glyoxylate, which is subsequently converted to two molecules of CO2 through reactions of the glyoxylate shunt (Figure 7). This overall conversion of ethylene glycol to CO2 can supply 2.5 reducing equivalents per C-mole of substrate, making it a promising energy-yielding co-substrate. Such co-substrates can be useful in the application of
34 Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440 Pseudomonas for redox biocatalysis, for example, the NADH-dependent epoxidation of styrene to (S)- styrene epoxide (Park et al. 2007), or for maintaining energy-demanding solvent-tolerance mechanisms (Blank et al. 2008b). In comparison, typical redox energy co-substrates in Pseudomonas such as formate can only yield one reducing equivalent per C-mole of substrate (Zobel et al. 2017). Even the complete oxidation of glucose through primary metabolism only yields approximately 1.66 reducing equivalents per C-mole of substrate (Blank et al. 2008a). In addition, co-consumption is likely to occur in an environmental context, making it relevant for the degradation of ethylene glycol as pollutant through co-metabolic bioremediation (Hazen 2018).
To investigate the applicability of ethylene glycol as a co-substrate, P. putida KT2440 was cultured in carbon-limited chemostats with acetate as a carbon source and either ethylene glycol or glyoxylate as the energy source. This setup was chosen as acetate is known to induce enzymes of the glyoxylate shunt (Ahn et al. 2016; Blank et al. 2008a) and because previous experiments showed diauxic utilization of acetate and ethylene glycol in batch cultivations, with acetate being metabolized first (Figure S1). Compared to the control with only acetate, a co-feed with ethylene glycol or glyoxylate significantly increased the biomass yield on acetate by 29.6 ± 1.1 % (p = 0.03) or 22.2 ± 8.2 % (p = 0.05), respectively (Figure 2A). However, at steady state, ethylene glycol was not completely metabolized to CO2 and could be detected in the culture medium together with its corresponding oxidation products (Figure 2B). The increase in biomass can likely be attributed to the additional reducing equivalents generated through co-substrate metabolism. Assuming that all glyoxylate is
-1 -1 metabolized through the glyoxylate shunt, 27.3 ± 2.6 mmol g CDW h of reducing equivalents were generated through the co-metabolism of ethylene glycol (Figure 2C). In contrast, under similar conditions Zobel et al. (2017) reached the maximal achievable biomass yield on glucose already with
-1 -1 an NADH regeneration rate of 7.6 ± 0.9 mmol g CDW h using a co-feed of formate. Notably, a limitation in the initial oxidation reactions can be excluded as the primary cause for this observation, since glyoxylate was also not completely metabolized under these conditions, yielding only 14.4 ± 0.5
-1 -1 mmol g CDW h of reducing equivalents while enabling almost the same biomass yield increase as the ethylene glycol co-feed. In all, this experiment demonstrates the potential of ethylene glycol as an energy-yielding co-metabolite but also indicates limitations regarding the full consumption which should be addressed in further studies.
35 Chapter 3
AB C ethylene glycolex Redox equivalents -7.5 ± 0.4 accox Æ accred - 27.3 ± 2.6 0.8 20 14.4 ± 0.5 ethylene glycol ) 0.6 7.5 ± 0.4 -1 15 2.7 ± 0.2 - - glycolate glycolate 0.4 10 ex 4.8 ± 0.5 - 1.1 ± 0.1 CDW (g L 0.2 5 -7.2 ± 0.2 glyoxylate glyoxylate
[metabolites] (mM) ex 0.0 0 3.7 ± 0.4 e e 7.2 ± 0.2 te e te col t ate ta a l la 0.09 ± 0.02 e y 0.13 ± 0.05 acetat ac ox oxa CO2 CO2 lyoxylat glycol gly oxalate oxalateex +g hylene gly et + ethylene glycol
Figure 8 Co-feeding of P. putida KT2440 in C-limited chemostats on MSM with 30 mM acetate supplemented with 30 mM ethylene glycol (black), 30 mM glyoxylate (green), or no co-feed (grey) at a dilution rate of 0.2. A: Comparison of biomass at steady state. B: Extracellular metabolites at steady state. For the acetate control no metabolites were detected. C: In vivo flux during growth on ethylene glycol (upper value) or glyoxylate -1 -1 (lower value) in mmol gCDW h obtained from the substrate utilization and metabolites secretion rates on the respective substrate with a growth rate of 0.2 h-1. The flux analysis allowed the estimation of redox cofactor regeneration rates according to the stoichiometry of Figure 7. (acc = electron acceptor oxidized or reduced) Error bars indicate the deviation from the mean (n = 2).
Metabolic engineering approach for ethylene glycol utilization However, as shown in Figure 7 and based on its genome, P. putida KT2440, should be able to grow on ethylene glycol. Assuming the upper part of the pathway, which involves the ped genes, is the limiting factor, a regulator for those genes shall be overexpressed. As in P. aeruginosa, one of the regulators for this pyrroloquinoline quinone (PQQ)-dependent ethanol oxidation system is AgmR, a response regulator. This regulator, although governed by ErcS and ErcS´, controls, either directly or indirectly, transcription of exaABC, which are homolog to pedE, pedH and pedI in P. putida KT2440. (Mern et al. 2010) Though, when agmR was overexpressed in KT2440, no growth or and only slight of ethylene glycol was observed.
In parallel, the ‘Gcl pathway’ was investigated. Several combinations of overexpression constructs with genes of the gcl operon were tested (Table 5).
Table 5 Overview of tested constructs in P. putida KT2440 for growth on MSM containing 30 mM ethylene glycol and antibiotics for plasmid maintenance (*= Schmidt (2017)) backbone gene to overexpress growth (h to stationary phase) pSEVA234 agmR No pSEVA234 gcl No* pSEVA234 glcB No* pSEVA234 gcl_glcB No* pSEVA234/ pSEVA424 gcl/ glxR Yes, (t > 100 h) pSEVA234 gcl_glxR Yes, (t = 30 h) pSEVA234 gcl operon Yes, (t = 100 h)
36 Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440
The publication “Engineering Pseudomonas putida KT2440 for efficient ethylene glycol utilization” (Franden et al. 2018) is based on the tested construct. Best growth could be achieved by overexpressing the gcl operon (gcl, hyi, glxR, ttuD and pykF) and the glycolate oxygenase operon (glcDEFG_PP_3749). With this combination, the accumulation of toxic intermediates like glycolaldehyde during ethylene glycol metabolism will be avoided. (Franden et al. 2018)
Isolation of mutants able to utilize ethylene glycol as sole carbon source by adaptive laboratory evolution Adaptive laboratory evolution (ALE) is a common method to adapt strains to specific environments (Dragosits und Mattanovich 2013). Given the inefficient utilization of ethylene glycol as co-substrate with acetate and the fact that P. putida KT2440 possesses the genetic inventory allowing growth on ethylene glycol as C-source, we speculated that ALE might select for ethylene glycol utilizing mutants. Therefore, we performed two independent ALE experiments, in different laboratories in Stuttgart and Aachen, each using their own laboratory wildtype strain of P. putida KT2440 and different MSM (mineral salt medium) supplemented with ethylene glycol as sole carbon source (see Experimental procedures for details). Adaptive mutants reproducibly emerged, leading to visible growth after a lag phase of 4-6 days (Figure S2). In Stuttgart, clones from three independently evolved cultures were isolated after initial growth and subcultured three times on LB-agar plates to obtain strains E1.1, E1.2 and E1.3. In Aachen, a series of three parallel ALE cultivations were performed, where batches were sequentially re-inoculated into fresh MSM with ethylene glycol after growth became apparent by visual inspection (OD600 > 0.5) (
Figure 9A). After six serial transfers into fresh growth medium, 36 individual strains were isolated on LB-agar plates and assessed in liquid cultures in a Growth Profiler® to select the best growing strains, finally obtaining strains E6.1 and E6.2 from two parallel ALE lines.
All five resulting strains showed a stable phenotype of growth on ethylene glycol. No major differences in growth and substrate oxidation and uptake could be observed within the E1 and E6 groups. Nevertheless, when comparing all strains collectively, E1 and E6 behaved differently when growing on higher ethylene glycol concentrations. With 120 mM ethylene glycol as sole carbon source, E6 strains showed 1.4 times faster growth than the E1 strains (E1: 0.083 ± 0.004 h-1; E6: 0.118 ± 0.004 h-1; p= 0.005) and reached a higher final biomass concentration (Figure 9B, Figure S3). When grown in MSM with 26.7 ± 0.4 mM ethylene glycol as the sole carbon source, all strains grew at approximately the same initial rate (0.19 ± 0.02 h-1). However, the maximum biomass concentration
37 Chapter 3
-1 (CDW = cell dry weight) of the E6 cultures (0.63 ± 0.02 gcdw L ) was significantly higher (p = 0.011)
-1 than that of the E1 cultures (0.49 ± 0.07 gcdw L ) (Figure 9C, Figure S4). The difference between E1 and E6 groups was also reflected in the metabolism of ethylene glycol and the formation of intermediate oxidation products. Illustrated in Figure 9D, the ethylene glycol degradation rate of E6.1 was 1.8-fold higher than that of E1.1, and E6.1 transiently produced up to 7.9-fold more glycolate than E1.1 (p = 0.011). In general, these experiments show the strength of ALE for the selection of new and/or improved phenotypes. This approach may also be extended in order to select strains with even more efficient utilization of ethylene glycol, i.e. with higher growth rates, lower accumulation of intermediates, or better growth in high substrate concentrations. However, we chose a relatively short evolutionary selection to facilitate the downstream genomic identification of causal mutations, as long ALE experiments can easily lead to the accumulation of additional background mutations.
38 Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440
AB KT2440 E1 E6 0.8 180
150 0.6
120 600 0.4
OD 90
0.2 Gvalue(a.u.) 60
0.0 30 0 5 10 15 20 25 30 0 5 10 15 20 25 tim e (d) tim e (h)
KT2440 E1.1 E6.1
CD[glycolate] 0.8 30 1.5
0.6 ) (m M ) , [glyoxylate] -1 20 1.0 mM) M (m 0.4
CDW (g L 10 0.5
0.2 , [oxalate] [ethylene glycol] 0.0 0 0.0 010203040 0 10203040 tim e (h) tim e (h)
Figure 9 Adaptive laboratory evolution of P. putida KT2440 on ethylene glycol and characterization of adapted strains. A: Sequential batch cultivation on MSM with 15 mM ethylene glycol. Arrows indicate the time points where strains were isolated. B: Growth comparison of P. putida KT2440 and the adapted strains E1.1 and E6.1 in MSM containing 120 mM ethylene glycol. Growth was detected via a Growth Profiler® in 96-square-well plates. C and D: Biomass growth of the isolated ALE strains E1.1 (empty square) and E6.1 (filled triangels) in comparison with KT2440, and extracellular metabolic products (ethylene glycol in red, glycolate in purple, glyoxylate in green, oxalate in brown) of the isolated ALE strains E1.1 and E6.1 growing on 26.7 ± 0.4 mM ethylene glycol in a shake flask cultivation on MSM. Error bars indicate the deviation from the mean (n = 2).
Genomic and metabolic context of adaptive mutations To identify mutations underlying the stable phenotypic switch in the ALE strains, whole genome resequencing was performed on the E1 and E6 strains, as well as the two respective wildtypes from the different laboratories. With this approach, we uncovered 80-83 Single Nucleotide Polymorphisms (SNP) and Insertion-Deletion polymorphisms (InDel) (Table S3, Supplemental data 1), compared to the updated genome sequence of P. putida KT2440 (AE015451.2, (Belda et al. 2016)). However, the vast majority of these differences were also present in the two parental strains, and consist mainly of mutations in non-coding regions, silent mutations, or errors due to low coverage and read quality. Notably, the two parental strains were very similar to each other, even though they share no known immediate common history. After subtracting the parental, silent, and intergenic mutations, three mutated regions remained. One was mutated in all evolved strains, while the other two were only mutated in the E6 strains (Figure 10).
39 Chapter 3
In the first region, 4 out of 5 strains contained mutations in the gene with locus tag PP_4283, encoding a putative GntR-type transcriptional regulator with DNA binding function, hence called gclR (Donald et al. 2001). These mutations include a missense mutation in E1.1, two identical 15 bp deletions in E1.2 and E1.3 and one nonsense mutation in E6.1 giving rise to a stop codon in the 4th triplet (Figure 10A). All of these mutations are located in the first third of the gene. The latter mutation makes it likely that the gene function is disrupted. Strain E6.2 did not contain a mutation in gclR, instead of bearing a SNP approximately 12.5 kb downstream of this locus, in the promotor region of the gcl gene, which is the first gene in the PP_4297-PP_4301 cluster that encodes the enzymes of the Gcl pathway (Franden et al. 2018). According to RegPrecise (Novichkov et al. 2013), GclR is predicted to be a regulator of xanthine metabolism with, among others, two predicted binding sites upstream of gcl (Figure 10A). The mutation in strain E6.2 may disrupt one of these binding sites, while also leading to the emergence of a putative promoter (Supporting Information 1- 3 and Table S4). Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of P. putida KT2440 and evolved strains cultured on 20 mM ethylene glycol and 40 mM acetate indicated that transcript levels of all five genes in the gcl cluster were very low in cells of the wildtype, while being significantly upregulated in cells of strains E1.1, E6.1 and E6.2 (Figure 10B, 71- fold to 842-fold upregulated compared to wildtype cells, p < 0.01). A similar effect can be assumed for strains E1.2 and E1.3. In contrast, the distantly located hprA gene (PP_0762), which encodes a second possible glyoxylate/hydroxypyruvate reductase (Cartwright und Hullin 1966), was not expressed under these conditions, independent of the strain used. From these data, we conclude that GclR is likely a repressor of the PP_4297-PP_4301 gene cluster. The disruption of gclR, or the disruption of the putative GclR binding site in the case of strain E6.2, alleviates this repression, enabling growth on ethylene glycol.
40 Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440
A gcl hyi allA ttuD yedI glxR pucL pykF gclR uacT xdhA xdhB xdhC puuE sbp-I aqpZ guaD pucM PP_4289 PP_4291 PP_4293 PP_4295 PP_4296 PP_4284 PP_4302 PP_4303 PP_4304 PP_4306 PP_4307 PP_4308 PP_4309 PP_4310
E1.1: cTgÆcAg, L69Q E1.3: 15 bp deletion E6.2: GÆA intergenic E1.2: 15 bp deletion E6.1: CagÆTag, Q4* STOP
B C D fadA PP_2045 PP_2046 PP_2047 PP_2048 PP_2049 PP_2050 4 guanine 2 wt
2 E1.1 2 xanthine E6.1 2 0 E6.2 E6.1: E34G; gAg/gGg Æ missense 2 -2 E6.2: E34G; gAg/gGg Æ missense Ct ' -4 allantoin 2 2 E 2 -6 2 urea
2 -8 glyoxylate PP_2662 PP_2661 PP_2663 pedS1 agmR
2 -10 Æped cluster
gcl hyi glxR ttuD pykF hprA pyruvate IR IR Tn4652
Figure 10 Schematic representation of genomic regions mutated after adaptive laboratory evolution on ethylene glycol. A: Gene organization from xdhA to PP_4310 (coordinates: 4866804-4902814, 36010 bp in total). Small dotted arrows indicate putative gclR binding sites. B: Box-and-whisker plot of relative expression levels of genes implicated in ethylene glycol metabolism in cells of P. putida KT2440 wildtype (wt) and cells of evolved mutants growing on 20 mM ethylene glycol and 40 mM acetate determined by qRT-PCR. The 2ΔCt values were normalized to rpoD. Individual data points are plotted onto the graph, whiskers indicate minimum to maximum values. C: Simplified pathway scheme from guanine to pyruvate. D: Gene organization from PP_2045 to fadA (coordinates: 2325342-2334253, 8911 bp in total). PP_2045, coding for a metallo-β-lactamase family protein is shown in a yellow arrow. Brown arrows show genes related to β- oxidation. The mutated regulator PP_2046 is indicated in black. E: Gene organization and direction of transcription from PP_2667 to agmR (coordinates: 3047946-3053910, 5964 bp in total). The transposon Tn4652, flanked by inverted repeats (IR in red), is shown in grey arrows, with an angled black arrow indicating the direction of a putative promotor. The annotated sites of SNP and InDels found in the adapted strains are indicated with capital letters below the relevant genes. Colored arrows indicate putative gene functions related to the conversion of guanine to xanthine (orange), from xanthine to allantoin (blue), from allantoin to glyoxylate (green) and from glyoxylate to pyruvate (red). Purple arrows indicate genes coding for transporters or porins. Genes coding for regulators are shown in black. White arrows show genes which are predicted as hypothetical proteins.
These results raise the question: why are ethylene glycol or glyoxylate not the effectors that bind GclR to relieve repression of the downstream metabolic genes? Clues to the answer can be found in the genomic context of the gclR gene in P. putida KT2440, which, similarly to other organisms such as Escherichia coli, Streptomyces coelicolor, and Bacillus subtilis (Hasegawa et al. 2008; Cusa et al. 1999; Rintoul et al. 2002; Navone et al. 2015; Schultz et al. 2001), encodes multiple genes known or predicted to be involved in the metabolism of purines via the intermediates allantoin and glyoxylate (Figure 10AC). In aerobically growing cells of E. coli, the genes encoding the Gcl pathway are repressed in the presence of allantoin through the action of the AllR regulator. This repression is alleviated by glyoxylate, which concomitantly induces an alternative allantoin metabolic pathway,
41 Chapter 3
ultimately yielding NH3 , CO2, and ATP, predominantly active under anaerobic conditions (Hasegawa et al. 2008; Cusa et al. 1999; Rintoul et al. 2002). This alternative pathway seems to be absent in P. putida KT2440, befitting its obligate aerobic lifestyle. Although the situation in P. putida KT2440 is different from that in E. coli, we hypothesize that the genomic context of gclR suggests that the failure of P. putida KT2440 to activate the Gcl pathway in the presence of ethylene glycol or glyoxylate may be because it is part of a larger metabolic context, governed by effectors that lie upstream of their metabolism. Indeed, both the parental strain P. putida KT2440 and strain E6.1 are able to grow on allantoin as a sole carbon and nitrogen source (Figure 11), indicating that allantoin, and not glyoxylate, serves as inducer of the genes encoding the Gcl pathway. A co-feed of allantoin and ethylene glycol resulted in a higher biomass concentration compared to allantoin alone, likely through the activation of the Gcl pathway, since this is the only pathway known to enable growth on these substrates as sole C-source. Similar results were obtained with xanthine, which also enabled growth on ethylene glycol (Figure S5). Notably, E6.2 was not able to utilize allantoin as a sole nitrogen source, although it retained the ability to utilize it as a carbon source, either with or without the addition of ethylene glycol. This indicates that a regulatory cross-talk between allantoin and ethylene glycol metabolism exists. One could speculate that this cross-talk involves the PP_4296 gene (Göhler et al. 2011) whose expression might be affected by the mutation in E6.2.
1.5 KT2440 E6.1
E6.2 )
-1 1.0
0.5 CDW (g L
0.0 + + in G 4 4 EG E
lanto n+ al +EG-NH n allantoi allantoin -NH antoi all
Figure 11 Biomass concentration of P. putida KT2440 and ALE strains E6.1 and E6.2 after 25 h in MSM containing 20 mM allantoin and/or 20 mM ethylene glycol (EG). + The label ‘-NH4 ’ indicates that ammonium was omitted from the medium, leaving allantoin as a sole nitrogen source. Error bars indicate the deviation from the mean (n = 2).
In addition to the above mentioned mutations involving GclR, two additional mutations were found in the E6 strains (Figure 10DE). Both strains, E6.1 and E6.2, contain the same missense mutation (E34G) in the gene with locus tag PP_2046, encoding a LysR-type transcriptional regulator. This
42 Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440 regulator likely controls the adjacent operon, which encodes enzymes involved in a β-oxidation pathway including a 3-hydroxyacyl-CoA dehydrogenase (PP_2047), an acyl-CoA dehydrogenase (PP_2048), an alcohol dehydrogenase (PP_2049), a hypothetical protein (PP_2050), and a acetyl-CoA acetyltransferase (PP_2051- fadA) (Liu et al. 2011) (Figure 10D). Indeed, qRT-PCR shows a significantly higher expression of PP_2049 in E6.1 compared to E1.1 (Figure 12), indicating that the missense mutation in PP_2046 leads to an upregulation of this operon. Although the C2 compound ethylene glycol cannot be metabolized through β- oxidation, the dehydrogenases may still affect its oxidation.
6 2 KT ' gclR 2 4 E1.1 2 2 E6.1 2 0 KT ' gclR ' PP_2046 Ct -2 ' 2
2 KT ' gclR ' PP _2046::14g 2 -4 ' PP_2662 2 -6 KT ' gclR ' PP_2662 2 -8 KT ' gclR ' PP _2662::14d 2 -10
PP_2049 pedS1 pedE pedI
Figure 12 Box-and-whisker plot of relative expression levels of genes implicated in ethylene glycol metabolism in cells of P. putida KT2440 with several knockout background and cells of evolved mutants growing on 20 mM ethylene glycol and 40 mM acetate determined by qRT-PCR. (Experiment performed by MaryAnn Franden) The 2 ΔCt values were normalized to rpoD. Individual data points are plotted onto the graph, whiskers indicate minimum to maximum values.
Both E6 strains further contain an insertion in PP_2662, which was identified as a 17 kbp Tn4652 transposon by read coverage analysis (Supporting information 4) and arbitrary-primed PCR (Martínez-García et al. 2014a). The PP_2662 gene encodes a putative porin and is located upstream of an operon encoding a putative two-component sensory system consisting of a hypothetical protein with a sensory domain (PP_2663) and a sensor histidine kinase PP_2664 (from now on referred to as PedS1 according to the gene nomenclature from Arias et al. (2008) (Figure 10E). These genes are co-regulated with a cluster of genes including the aldehyde and alcohol dehydrogenases pedI, pedE, and pedH in P. putida KT2440 in the presence of n-butanol (Vallon et al. 2015) and ethylene glycol (Mückschel et al. 2012). In P. aeruginosa the expression of a similar gene cluster is involved in the utilization of ethanol and is regulated by a complex hierarchy of sensory histidine kinases and transcriptional regulators, including erbR (previously agmR; PP_2665) and ErcS`, a
43 Chapter 3 homolog of PedS1 (Mern et al. 2010; Hempel et al. 2013; Promden et al. 2009). The Tn4652 transposon (PP_2964 – PP_5546) is known to be activated under stress conditions such as starvation (Ilves et al. 2001). It contains a predicted promoter at its 3’-end, facing the two-component regulator operon (Supporting information 5-6), and also is known for generating novel fusion promoters upon insertion into a new locus (Nurk et al. 1993). Thus, this transposon insertion into PP_2662 could affect ethylene glycol metabolism by disruption of the porin, and/or by upregulation of the ped cluster through overexpression of the sensor histidine kinase PedS1. The latter hypothesis is disproven by qRT-PCR analysis, which shows no significant difference between the expression of pedS1, pedE, and pedI in E1.1 and E6.1 (Figure 12). This indicates that it is mainly the disruption of the PP_2662 porin that led to the enhanced growth on ethylene glycol in E6.1. The exact role of this porin is unclear, but its disruption likely affects the exchange of ethylene glycol or its oxidation products across the outer membrane. The fact that E6.1 transiently accumulates much more glycolate than E1.1 (Figure 9D) suggests that the rate of ethylene glycol uptake or glycolate export from the periplasm is not affected, thus pointing to a possible transport effect on the aldehyde intermediates. That said, pedE and pedI are very highly expressed in both strains, and it is known that they are involved in the oxidation of a variety of alcohols and aldehydes including ethylene glycol (Mückschel et al. 2012; Arias et al. 2008). The essentiality of the Ped cluster was confirmed by the deletion of the pedE-pedI cluster (PP_2673-PP_2780) in the E6 strains, which eliminated their ability to grow on ethylene glycol (Figure S6).
Reverse engineering of ethylene glycol metabolism Genomic analysis implicates mutations in the gclR gene as foundational to the growth of P. putida KT2440 on ethylene glycol as a sole carbon source, while the secondary mutations in PP_2046 and PP_2662 likely affect the rates of the initial oxidation reactions. To determine how these mutations assert their effect, we sought to replicate their phenotype in a reverse engineering approach. To this end, gclR was deleted in the wildtype of P. putida KT2440. The resulting ΔgclR strain grew readily on MSM with ethylene glycol as the sole carbon source (Figure 13A), confirming that the gclR mutations in the ALE strains were disruptive in nature, and supporting the hypothesis that GclR is a repressor of the genes encoding the Gcl pathway.
In order to assess the effect of the secondary mutations, a set of combinatorial strains was constructed, in which PP_2046 and PP_2662 were deleted in the ΔgclR background (Figure 13). In addition, both genes were replaced by synthetic constitutive promoters. In the case of PP_2662, the 14d promoter of average strength (Zobel et al. 2015) was inserted facing PP_2663-pedS1 to test the effect of overexpression of these downstream genes encoding a two-component regulator system. This was done to test the effect of the presence of an upstream promoter similar to the promoter-
44 Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440 carrying transposon insertion in the E6 strains. In the case of PP_2046, the strong 14g promoter was inserted facing the downstream β-oxidation operon which is upregulated in E6.1. Subsequently, the transcript levels of relevant genes were determined by qRT-PCR (Figure 12) and growth of all strains was compared in MSM with 120 mM ethylene glycol (Figure 13).
ABC KT2440 ' gclR KT2440 ' gclR ' PP_2662 KT2440 ' gclR ' PP_2662::14d
120 120 [5] 120 [8] [E6.1] [E6.1] [E6.1] 100 [2] 100 [4] 100 [7] 80 [3] 80 [6] 80 [9]
60 60 60 Gvalue(a.u.) G value (a.u.) G value (a.u.) 40 40 40
0 102030 0 102030 0 102030 tim e (h) tim e (h) tim e (h) E6.1 wt PP_2046 ' PP_2046 ' PP_2046::14g
Figure 13 Growth comparison between E6.1 and reverse engineered P. putida KT2440 strains in MSM containing 120 mM ethylene glycol. Different colors indicate strains harboring the native PP_2046 (green, circle), the knockout of PP_2046 (red, squares), and the substitution of PP_2046 with the promotor 14g (purple, diamonds) in the background of KT2440 ∆gclR (A), KT2440 ∆gclR ∆PP_2662 (B) and KT2440 ∆gclR ∆PP_2662::14d (C). As a positive control, and for visual reference, growth of the evolved strain E6.1 is represented by grey triangles in each graph. Strain numbers next to the graphs refer to full strain names listed in Table 1. Growth was detected via a Growth Profiler® in 24-square-well plates. Error bars depict the standard error of the mean (n ≥ 3).
Disruption of gclR indeed is essential for growth on ethylene glycol, as without this mutation no growth was observed. Deletion of only PP_2046 in the ΔgclR background did not have any observable effect on the growth, nor did it change the transcript level of PP_2049. This indicates that PP_2046 is not a transcriptional repressor and suggests that the point mutations in the E6 strains were not disruptive in nature, rather causing constitutive activation. The disruption of PP_2662 in P. putida KT2440 ΔgclR, either with or without insertion of the 14d promoter, led to an improvement of the final biomass concentration compared to the ΔgclR progenitor, at the expense of the growth rate. Although the qRT-PCR analysis confirmed that the 14d promoter insertion increased the transcript level of the downstream pedS1, this overexpression didn’t significantly affect transcript levels of pedE or pedI, nor did the promoter insertion affect the growth of the reverse-engineered strain. This further confirms that the enhanced growth of the E6 strains was not caused by altered expression of the ped genes. Upon combining PP_2046 and PP_2662 mutations in different genetic backgrounds, two trends became apparent. Strains with ΔPP_2046::14g grew worse than strains with the wildtype PP_2046 locus, which in turn were out-performed by strains harboring a ΔPP_2046 deletion without an additional promoter insertion. This is unexpected considering that in E6.1 the expression of PP_2049 was increased. The qRT-PCR analysis indicates that perhaps the heterologous overexpression with the 14g promoter was too strong, with transcript levels that were several orders of magnitude above that in strain E6.1 (Figure 12).
45 Chapter 3
Of the reverse-engineered strains, P. putida KT2440 ΔgclR ΔPP_2046 ΔPP_2662 showed the fastest growth and highest final biomass (Figure 13C). Although the difference between reverse engineered strains with different modifications in the PP_2046 and PP_2662 loci are generally small, they mostly out-perform strain P. putida KT2440 ΔgclR, indicating the added benefit of these secondary mutations. Although the molecular basis underlying the genetic events that lead to the superior ethylene glycol metabolism of strain E6.1 and the engineered strains is still not completely understood, the results indicate a complex interplay between the two secondary mutations, likely affecting the balance between substrate transport across the outer membrane and alcohol and aldehyde oxidation. This hypothesis is in line with the results from a companion study, where we undertook an ab initio metabolic engineering approach to obtain a highly efficient ethylene glycol- utilizing strain of P. putida KT2440 (Franden et al. 2018). In that study, we could demonstrate that glycolaldehyde and glyoxal are indeed toxic to cells of P. putida KT2440 in concentrations above 4 mM, and that preventing the accumulation of these intermediates during ethylene glycol metabolism is crucial for efficient growth.
In all, we generated strains, using ALE and reverse engineering, that efficiently grow on ethylene glycol. These strains can be applied for the biotechnological conversion of pretreated waste streams that contain ethylene glycol or its derivatives. In this setting, strain stability is a key performance indicator. Indeed, the engineered strain KT2440 ΔgclR Δ PP_2046 Δ PP_2662 and the evolved strains E1.1 and E6.1 retained their ethylene glycol-metabolizing phenotype after more than 110 generations without selective pressure (Figure S7). This indicates that the implemented mutations pose no significant negative selection pressure under the conditions tested.
46 Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440 3.3 Conclusions The metabolism of ethylene glycol and its derivatives plays a pivotal role in the biotechnological utilization of plastic waste and lignocellulose-derived streams, and its oxidation products glycolate and glyoxylate have a variety of value-added applications. The quantitative physiological characterization of ethylene glycol co-metabolism by P. putida KT2440 provides valuable insights for the production of value-added chemicals and identifies opportunities and bottlenecks for the use of ethylene glycol as a redox energy-yielding co-substrate. ALE enabled P. putida KT2440 to utilize ethylene glycol as a sole carbon source. The characterization of evolved strains provided insights into the genetic and regulatory basis of their adapted metabolism. Based on those insights, the growth characteristics of evolved strains could be successfully reverse-engineered in P. putida KT2440. Extensive transcriptional and biochemical analysis will be necessary to fully determine the combinatorial effect of the enzymes affected by these mutations. This manuscript along with the companion study (Franden et al. 2018), provides a foundation for such analyses and enables the further development of P. putida as an applied synthetic biology workhorse in the aforementioned fields of application.
47
Chapter 4 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440
Contributions: This chapter was written by Wing-Jin Li and was reviewed by Nick Wierckx and Lars M. Blank. Proteomic data was provided by Tanja Narancic from University of Dublin (Ireland). Tristan Daun and Paul Niehoff constructed strains as specified in Table 1 and contributed to growth experiments. A modified version of this work was published in 17th March 2020 as original research article in Frontiers Microbiology with the title “Pseudomonas putida KT2440” with the contribution of Tanja Narancic, Shane T. Kenny, Paul-Joachim Niehoff, Kevin O´Connor, Lars M. Blank, and Nick Wierckx; “Unraveling 1,4-Butanediol Metabolism in Pseudomonas putida KT2440” (DOI:10.3389/fmicb.2020.00382).
Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440
4 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440
4.1 Introduction Plastics, in all forms, are ubiquitous and are used by people in their everyday life. Nevertheless, the material properties of these polymers are both a blessing and a curse. Whereas people worldwide are benefitting from the versatility and durability of plastics, these characteristics also make them a huge burden for the environment. To reduce this impact, strategies beyond incineration, landfill and inefficient recycling are needed. One of these approaches involves bio-upcycling, the microbial degradation of plastics and its conversion into value-added material (Narancic und O'Connor 2017; Wierckx et al. 2015).
In general, plastics are divided into the categories, thermoplastics, which can be melted, molded and reshaped, and thermosets, which change their chemical characteristics during production and therefore cannot be reformed. Proofs of principle for the microbial conversion of selected plastics are already available. For instance, the thermoplastic material polyethyleneterephthalate (PET) was described to be converted to value-added material like polyhydroxyalkanoates (PHA) (Kenny et al. 2012). PET was first pyrolyzed to its monomers ethylene glycol and terephthalate, which then was metabolized by P. putida GO16 to produce PHA (Kenny et al. 2008). Furthermore, first investigations with polyurethane were performed, showing Impranil, a dispersion of polyurethane, can be degraded by different fungi like Alternaria, Penicillium, and Aspergillus, and also by bacteria like P. protegens Pf-5 (Hung et al. 2016; Magnin et al. 2019a).
Polyurethanes are produced by reacting aliphatic or aromatic diisocyanates with polyols and α-ω- diols as chain extenders. Depending on the monomer composition and chain lengths, polymer properties are diverse and are key for polyurethane´s versatility. Applications can be found in painting and coating material, in building insulation and as sealants, as well as in flexible foams and absorbents for many end-user products like pillows and mattresses (CIEC promoting Science at the University of York 2017). In the context of the bio-upcycling strategy, PU can be first hydrolyzed by polyester hydrolases like LC cutinase, Tfcut2, Tcur1278, Tcur0390 from various microorganisms (Schmidt et al. 2017) or by recently discovered aminases which break the urethane bond (Magnin et al. 2019b). Typical monomers like adipic acid, 1,4-butanediol, and ethylene glycol are released during the process of depolymerization. Degradation pathways for adipic acid and ethylene glycol are described (chapter three and five, Li et al. 2019; Franden et al. 2018; Parke et al. 2001). Yet, for the non-natural compound 1,4-butanediol, no described natural degradation pathway is known.
51 Chapter 4
The chemical 1,4-butanediol is one of the major chain extenders used in the production of polyurethanes, and it is also a common co-monomer in many polyesters. This commodity chemical for the production of polymers is used to manufacture 2.5 million tons of plastics and polyesters (Yim et al. 2011). Additionally, 1,4- butanediol is used as a platform chemical to produce tetrahydrofuran and γ-butyrolactone (Grand View Research 2017). According to grand view research, the market size was valued at USD 6.19 billion in 2015 and is still growing.
So far, research was mainly focused on the sustainable production of 1,4-butanediol (Burgard et al. 2016). Its de novo microbial production was achieved in E. coli by identifying and implementing artificial routes for 1,4-butanediol biosynthesis (Yim et al. 2011). The verified and tested pathway starts with the TCA cycle intermediate succinyl-CoA. The heterologous CoA-dependent succinate semialdehyde dehydrogenase (SucD) from Clostridium kluyveri and either a native or heterologous 4- hydroxybutyrate dehydrogenase from C. kluyveri, Porphyromonas gingivalis or Ralstonia eutropha catalyze the reaction from succinyl-CoA to 4-hydroxybutyrate. After CoA activation, 4- hydroxybutyryl-CoA will be further oxidized via alcohol and aldehyde dehydrogenases to the final product 1,4-butanediol. In addition to the commonly used pathway starting with succinyl-CoA, alternate potential routes via α-ketoglutarate, glutamate or acetyl-CoA were described (Yim et al. 2011). To use an alternative carbon source to produce 1,4-butanediol, xylose, a sugar being released from lignocellulosic biomass, was also investigated in. Via oxidation and hydratation steps, xylose can be used to produce the desired product. (Liu und Lu 2015).
Pseudomonas has an established track record in bioremediation and biodegradation processes (Spini et al. 2018; Samanta et al. 2002; Tahseen et al. 2019), and different strains of this genus are also suitable candidates to perform bio-upcycling (Kenny et al. 2008; Ramos et al. 2002). One of the widely used biotechnological hosts is P. putida KT2440, which possesses extensive metabolic abilities (Nikel und Lorenzo 2018; Nikel et al. 2014; Nelson et al. 2002). Being a soil bacterium and therefore exposed to different environmental surroundings, it is equipped with tolerances and metabolic capabilities towards a broad spectrum of substances. The 6.18 Mb genome of P. putida KT2440 reveals a broad spectrum of oxygenases, oxidoreductases as well as hydrolases, transferases, and dehydrogenases (Belda et al. 2016). This wide range of enzymes enables P. putida KT2440 to modify an abundance of alcohols to intermediates of central pathways.
Butanol, for instance, is a substrate with structural similarities to 1,4-butanediol. Usually, butanol concentrations above 1-2 % are toxic or at least growth-inhibiting for most of Pseudomonas species, including BIRD-1, DOT-T1E, and KT2440 (Cuenca et al. 2016). Nevertheless, Pseudomonas exhibits promising traits on tolerating, assimilating or at least surviving butanol. To cope with butanol, classic solvent defense mechanisms like efflux pumps, membrane modifications or rebalancing of the redox
52 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440 state are activated (Ramos et al. 2002). Further, P. putida KT2440 is capable of rapid butanol degradation. In this strain, butanol is oxidized to butyrate via alcohol dehydrogenases by enzymes assigned to the AgmR regulon (PP_2662-PP_2680), also known as the ped cluster (PP_2674-2680) (Vallon et al. 2015). It is to be noted, that the alcohol and aldehyde dehydrogenases PedE and PedH have a high relaxed substrate specificity, and are capable of oxidizing, among others, ethanol, phenylethanol, and butanal (butyraldehyde) (Wehrmann et al. 2017a). After CoA activating butyrate via acetyl-CoA synthetases like AcsA1 (PP_4487), butyryl-CoA undergoes β-oxidation which yields acetyl-CoA as central metabolic intermediate.
In this chapter, a P. putida KT2440 strain with an enhanced growth rate on 1,4-butanediol is obtained by a combination of adaptive laboratory evolution (ALE) and reverse engineering. Strains adapted on 1,4-butanediol by ALE were analyzed by proteomics and genome resequencing in order to determine possible degradation routes. The improved growth phenotype was subsequently reverse-engineered into the wildtype, thereby generating a deeper understanding of 1,4-butanediol metabolism and enabling the consolidation of multiple monomer utilization pathways into P. putida KT2440 for upcycling of depolymerized polyurethanes.
4.2 Results
Isolation of strain with enhanced growth on 1,4-butanediol by ALE To study the growth of P. putida KT2440 and possible intermediate production when metabolizing 1,4-butanediol, growth experiments in shake flasks were performed. The wildtype showed poor growth (0.082± 0.004 h-1) on MSM with 20.2 ± 0.9 mM 1,4-butanediol, requiring more than 50 h to consume all substrate (t = 49; 1.3 ± 0.1 mM), while also secreting the oxidation product 4- hydroxybutyrate (t = 49 h; 16.8 ± 0.3 mM). (Figure 14).
To enhance its ability to grow on 1,4-butanediol, wildtype P. putida KT2440 was subjected to adaptive laboratory evolution (ALE). This method is known to enable the selection of mutated strains with enhanced properties towards selected specific environments (Dragosits und Mattanovich 2013; Lennen et al. 2019; Li et al. 2019). Cultures of P. putida KT2440 were serially reinoculated to fresh media containing 20 mM 1,4-butanediol ten times, as soon as growth was observed in form of optical densities above 0.8 (Figure 14). All three parallel batches grew with the same trend. While the first three reinoculations were performed when the previous culture reached OD600 of 0.8 - 2, after 3-4 days, the last seven transfers achieved OD600 of 2.5 - 3.5 after two days or less. At last, samples were taken after growth on 1,4-butanediol attained OD600 of 2.5 overnight. Single colonies were isolated by streaking the three ALE cultures on LB plates. From each of the three batches, 24 single colonies
53 Chapter 4 were tested for growth on 1,4-butanediol in a 96- well plate using a Growth Profiler® (Figure 14). Two strains were selected, from different evolutionary lines, according to their growth in MSM with 20 mM 1,4-butanediol and are named B10.1 and B10.2, indicating that they underwent ten serial transfers (Figure 14).
AB
5 160 1
4 2
3 120 3 600
OD 2 80 G value (a.u.) 1 B10.1 B10.2 0 40 0 5 10 15 20 25 30 35 0 5 10 15 20 tim e (d) tim e (h) CD
1.2 25
) 20 ] (mM) -1 0.8 15
10 0.4 CDW (g L
[1,4- butanediol; 5
0.0 4-hydroxybutyrate 0 0 1020304050 0 1020304050 tim e (h) tim e (h) KT2440 B10.1 B10.2
Figure 14 Adaptive laboratory evolution of P. putida KT2440 on 1,4-butanediol. A): Sequential batch cultivation on MSM with 20 mM 1,4-butanediol. B) Growth of single strains isolated from each ALE batch on MSM with 20 mM 1,4-butanediol. The strains B10.1 (purple triangle up) and B10.2 (purple triangle down) were selected for further investigation. Growth was detected via a Growth Profiler® using a 96- well plate. C) Biomass growth and D) extracellular metabolites of the wildtype and evolved strains B10.1 and B10.2 during growth on MSM with 20 mM 1,4-butanediol. Error bars indicate the deviation of the mean (n = 2).
The two evolved strains grow faster on 1,4-butanediol, even after being cultivated several generations in complex media or MSM containing glucose. In comparison with the parental wildtype strain which grew at a rate of 0.082 ± 0.004 h-1, B10.1 and B10.2 reach higher growth rates with 0.326 ± 0.054 h-1 and 0.308 ± 0.001 h-1, respectively. Interestingly, after 12 h of exponential growth, both evolved strains showed slower growth compared to the early phase of cultivation, finally
-1 -1 reaching maximum biomass concentration of 1.05 ± 0.0 gcdw L and 0.96 ± 0.02 gcdw L after 33 h (P.
-1 putida KT2440: t = 33, 0.11 ± 0.01 gcdw L ). Furthermore, in contrast to the wildtype, the evolved
54 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440 strains only transiently accumulate low concentrations of 4-hydroxybutyrate, which are rapidly metabolized within four hours (Figure 14).
Evolution successfully yielded strains with a 4- or 3.7 -fold improved growth rate on 1,4-butanediol compared to the wildtype. The fact that the wildtype accumulates much more 4-hydroxybutyrate than the evolved strains indicates that this is the likely metabolic bottleneck in the wildtype.
Developing leads for 1,4-butanediol degradation pathways To investigate the molecular basis of their growth on 1,4-butanediol, genome resequencing was performed for the evolved strains B10.1 and B10.2. The sequences were compared to our laboratory wildtype and a reference database genome of P. putida KT2440. In addition, proteomic analysis of the evolved strains and the wildtype P. putida KT2440 during growth on glucose and 1,4-butanediol was also conducted.
As described in chapter 3.2.4, when comparing the genome of our laboratory wildtype strain to the reference sequence (AE015451.2), 83 mutations were uncovered (Table 6). Most of the identified mutations were located either in the 26049 bp long PP_0168 gene, encoding for a surface adhesion protein, or they are positioned in non-coding regions or are silent mutations (Li et al. 2019). All these mutations were also found in the evolved strains and are therefore considered trivial to the adaption to 1,4-butanediol during evolution.
Table 6 List of all mutations found for wildtype P. putida KT2440 and both evolved strains B10.1 and B10.2. Numbers of found Single Nucleotide Polymorphisms (SNP) and Insertion-Deletion polymorphisms (InDel) and their functional class, divided by the cause of mutation, are shown. reference vs: laboratory P. putida laboratory P. putida KT2440 vs: KT2440 B10.1 B10.2 sum of all mutations 83 7 8 type of mutation SNP 55 6 8 InDel 28 1 0 functional class intergenic 46/28 0/0 2/0 (SNP/InDel) silent 7/0 5/0 4/0 missense 2/0 1/1 2/0 nonsense 0/0 0/0 0/0
In the evolved strains, seven, respectively, eight, mutations were identified in addition to the mutations already present in the laboratory wildtype strain. Most of these mutations were either silent or intergenic. Additionally, in the genome of B10.1, a deletion of 69 bp was found within the gene PP_2139, encoding for the DNA topoisomerase I, and, in B10.2, a single nucleotide polymorphism (SNP) was identified in PP_2889, encoding for a transmembrane anti-sigma factor. (Table 7)
55 Chapter 4
One gene in particular stood out for being mutated in both analyzed evolved strains, with each strain carrying a different mutation. Analysis revealed two SNPs in PP_2046 encoding for a LysR-type transcriptional regulator. Whereas PP_2046 in B10.1 contain a missense mutation leading to loss of the start codon (atG/atA), the gene in B10.2 carries a missense mutation leading to an amino acid exchange (E34G, gAg/ gGg) in the helix-turn-helix-DNA-binding domain of the regulator (Table 7, Figure 27).
Table 7 List of mutations (Single Nucleotide Polymorphisms (SNP) and Insertion-Deletion polymorphisms (InDel)) found in the genome of the evolved strains B10.1 (not underlined) or B10.2 (underlined) but not in our laboratory P. putida KT2440. The mutated gene found in both evolved strains, but not in the wildtype, is highlighted in red. muta position PP_XXXX codon effect functional impact annotation tion change class type 196495 PP_0168 acG/acC synonymous silent low surface adhesion coding protein 197524 PP_0168 gtA/gtG synonymous silent low coding 197551 PP_0168 acC/acG synonymous silent low coding 197551 PP_0168 acC/acG synonymous silent low coding 197572 PP_0168 aaG/aaA synonymous silent low coding 197572 PP_0168 aaG/aaA synonymous silent low coding 197590 PP_0168 gaT/gaC synonymous silent low coding 197590 PP_0168 gaT/gaC synonymous silent low SNP coding 698939 PP_16SD NA down stream none moderate rRNA 2328228 PP_2046 gAg/gGg non missense moderate lysR family synonymous transcript tional coding regulator 2328326 PP_2046 atG/atA Start lost missense high lysR family transcript tional regulator 3287225 PP_2889 gCg/gGg non missense moderate trans membrane synonymous anti-sigma factor coding 4345003 PP_3818 gaA/gaG synonymous silent low OmpA/ MotB coding domain- containing protein 4348955 intergenic NA downstream none moderate
56 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440 muta position PP_XXXX codon effect functional impact annotation tion change class type InDel 2443249 PP_2139 GTGCGCC codon deletion none moderate DNA GCTGGTGC topoisomerase I - TGGAGATT topA GTGCCGCA CAAGCATG AGATCGAC CCGAAGTA CCACTTCC TGTGCGA - -> G
In addition to the analysis of the changes on the genome level, the proteomes of the evolved strains were investigated to understand the effect of the mutations on the expression of proteins in the evolved strains by the Q-Exactive Hybrid Quadrupole Orbitrap Mass Spectrometer (MS; Thermo Scientific) connected to a Dionex Ultimate 3000 (RSLCnano; Thermo Scientific) chromatography system (chapter 2.3.4). Three biological samples from each strain and culture condition, either grown on glucose or 1,4-butanediol in MSM, were harvested at mid-log phase (Figure 15). The samples were normalized using total protein concentration to give the same starting protein concentration for all replicates.
AB 1.5 1.5 ) ) -1
-1 1.0 1.0
0.5 0.5 CDW (g L CDW (g L
0.0 0.0 0 5 10 15 20 25 30 0 1020304050607080 tim e (h) tim e (h)
KT2440 B10.1 B10.2
Figure 15 Biomass growth of P. putida KT2440 and the evolved strains B10.1 and B10.2 cultivated in MSM with 13.3 mM glucose (A) or 20 mM 1,4-butanediol (B). Arrows indicate the time when samples were taken for proteome analysis, in the estimated mid log phase. Error bars indicate the standard deviation (n = 3).
In total, 2122 proteins were identified across all samples and growth conditions, representing 40% of the P. putida KT2440 proteome. The identified proteins exhibited a wide range of annotated biophysical (molecular mass, isoelectric point), biochemical (functional annotations) and structural (domains) properties, suggesting that the analysis was not biased in favour of, or against, any protein class.
57 Chapter 4
The evolved strain B10.1 expressed 19 proteins which were not present in the wildtype cultivated with 1,4-butanediol, while 313 proteins were up- or downregulated at least two-fold compared to the wildtype. When evolved strain B10.2 was compared to the wildtype, 138 proteins showed at least two-fold difference in expression. The two evolved strains differed in their expression of 126 proteins. The likely reason for this large number of proteins with different expression levels is the presence of seven and eight mutations in the two evolved strains compared to the wildtype, some of them affecting regulatory elements, which in turn might affect the expression of other proteins, as well as differences in the growth rate. A large fraction of the differentially expressed proteins have no known function (Figure 16). The second-largest group of differentially expressed proteins can be categorized in amino acid metabolism and transport according to the clusters of orthologous groups (COG) classification (Tatusov et al. 1997). This is possibly related to the differences in growth rate for the strains and the turnover of proteins during growth.
58 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440
A Replication, recombination, repair Unknown Nucleotide transport, metabolism Coenzyme transport, metabolism Secondary metabolites biosynthesis, transport, catabolism Cell cycle control, cell division, chromosome partitioning Inorganic ion transport, metabolism Signal transduction mechanism Post-tra nslational modif ication, protein turnover, cha perones Transcription Cell wall/membrane/envelope biogenesis Cell motility, intracellular trafficking, secretion, vesicular transport Carbohydrate transport, metabolism Lipid transport, metabolism Translation, ribosomal structure, biogenesis Energy production, conversion Amino acid transport ,metabolism -40 -30 -20 -10 0 10 20 30 40 Downregulated Upregulated B Replication, recombination, repair Unknown Nucleotide transport, metabolism Coenzyme transport, metabolism Secondary metabolites biosynthesis, transport, catabolism Cell cycle control, cell division, chromosome partitioning Inorganic ion transport, metabolism Signal transduction mechanism Post-tra nslational modif ication, protein turnover, cha perones Transcription Cell wall/membrane/envelope biogenesis Cell motility, intracellular trafficking, secretion, vesicular transport Carbohydrate transport, metabolism Lipid transport, metabolism Translation, ribosomal structure, biogenesis Energy production, conversion Amino acid transport ,metabolism -40 -30 -20 -10 0 10 20 30 40 Downregulated Upregulated C Replication, recombination, repair Unknown Nucleotide transport, metabolism Coenzyme transport, metabolism Secondary metabolites biosynthesis, transport, catabolism Cell cycle control, cell division, chromosome partitioning Inorganic ion transport, metabolism Signal transduction mechanism Post-tra nslational modif ication, protein turnover, cha perones Transcription Cell wall/membrane/envelope biogenesis Cell motility, intracellular trafficking, secretion, vesicular… Carbohydrate transport, metabolism Lipid transport, metabolism Translation, ribosomal structure, biogenesis Energy production, conversion Amino acid transport ,metabolism -40-30-20-100 10203040 Downregulated in B10.1 Upregulated in B10.1 D Replication, recombination, repair Unknown Nucleotide transport, metabolism Coenzyme transport, metabolism Secondary metabolites biosynthesis, transport, catabolism Cell cycle control, cell division, chromosome partitioning Inorganic ion transport, metabolism Signal transduction mechanism Post-tra nslational modif ication, protein turnover, cha perones Transcription Cell wall/membrane/envelope biogenesis Cell motility, intracellular trafficking, secretion, vesicular… Carbohydrate transport, metabolism Lipid transport, metabolism Translation, ribosomal structure, biogenesis Energy production, conversion Amino acid transport ,metabolism -40 -30 -20 -10 0 10 20 30 40 Downregulated Upregulated
Figure 16 Proteins with significantly different levels of expression between the evolved strain B10.1 and wild type P. putida KT2440 (A), the evolved strain B10.2 and wild type P. putida KT2440 (B), between the two
59 Chapter 4 evolved strains (C), and the proteins showing the same trend of upregulation or downregulation in the evolved strains compared to the wild type (D). The proteins showing ≥2-fold change in expression are given as clusters of orthologous groups (COG).
The top three highest expressed proteins during growth on glucose as well as with 1,4-butanediol were PedE (ethanol dehydrogenase - PP_2674) and PedI (aldehyde dehydrogenase - PP_2680) and PP_0452, an elongation factor, Tu-B, which is involved in the regulation of protein synthesis. The former two proteins are encoded within the ped-cluster (PP_2663-80). To focus on 1,4-butanediol degradation, specific proteins based on putative activities in the posed pathways (Figure 17) and associated transport steps were focused on. Furthermore, genomic resequencing data and proteomic data were compared to uncover probable connections linked to the ALE on 1,4-butanediol.
Since genome sequencing uncovered mutations in PP_2046, expression levels of its downstream operon, PP_2047-51, was of interest. Indeed, high expression of this β-oxidation-related operon in P. putida KT2440 during growth on 1,4-butanediol was discovered. The expression of the iron- containing alcohol dehydrogenase (PP_2049) was 52.0-fold higher in the wildtype growing on 1,4- butanediol compared to glucose. Similarly, the 3-hydroxyacyl-CoA dehydrogenase (PP_2047), the acyl-CoA dehydrogenase (PP_2048) and the acetyl-CoA acetyltransferase (PP_2051) were also highly expressed during growth on 1,4-butanediol (22.1, 16.1 and 25.2-fold higher, respectively, compared to the wildtype on glucose). On top of this strong induction by 1,4-butanediol in the wildtype, the genes in this operon were even further induced by 2.4- to 3-fold in evolved strain compared to the wildtype (Figure 17B, Table S 5).
Also interesting was the relatively high expression of PP_0411-PP_0414, which constitute a polyamine ABC transporter for spermidine and putrescine. These proteins were highly expressed in P. putida KT2440, but not in the evolved strains, during the growth on 1,4-butanediol (Table S 5). In contrast, other transporters were also found to be highly expressed during growth on 1,4-butanediol. Among others is PP_0057, a major facilitator family transporter, which is genomically located downstream of the also highly expressed choline dehydrogenase (PP_0056, BetA-I).
The genome and proteome data indicate three possible pathways, all branching off at the point of 4- hydroxybutyrate. Since 4-hydroxybutyrate was already found as an intermediate during the cultivation of P. putida KT2440 on 1,4-butanediol, the hypotheses start with the oxidation of 1,4- butanediol to 4-hydroxybutyrate via the abundant alcohol and aldehyde dehydrogenases P. putida KT2440 possess. The high expression levels of PedE and PedI, as well as the dehydrogenases encoded by PP_0056 and PP_2049 suggest, that these three enzymes are major players in these oxidation steps. Thereafter, 4-hydroxybutyrate can be further oxidized by the same enzymes, or other upregulated dehydrogenases, like PP_2049, 3-hydroxyisobutyrate dehydrogenase (PP_4666, MmsB)
60 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440 and methylmalonate semialdehyde dehydrogenase (PP_4667 MmsA-II) (Steele et al. 1992; Zhou et al. 2013) to succinate semialdehyde. Furthermore, succinate semialdehyde can be oxidized to succinate via enzmes like SadI (PP_3151). The resulting oxidation product succinate can be then further metabolized in the TCA cycle. Another possibility is, that 4-hydroxybutyrate can be CoA activated via acyl-CoA ligases or transferases. After CoA activation, 4-hydroxybutyryl-CoA can be further oxidized by alcohol and aldehyde dehydrogenases to generate succinyl-CoA, or it undergoes β-oxidation through the enzymes encoded by the PP_2047-51 operon downstream of PP_2046, which would result in glycolyl-CoA and acetyl-CoA. (Figure 17)
61 Chapter 4
Figure 17 Hypothetic pathways for 1,4-butanediol metabolism (A) and selected protein concentrations detected from by proteomic analysis (B). Proteins which are strongly upregulated in response to growth on MSM with 1,4-butanediol compared to growth with glucose, or which are constitutively expressed at a high level, are indicated. Proteins which are investigated in this thesis are shown in bold. Protein expression levels of selected proteins for P. putida KT2440 and the evolved strains B10.1 and B10.2 growing in MSM with glucose compared to growth with 1,4-butanediol are listed as oxidoreductases (blue triangle), CoA-ligases (orange star), acyl-CoA dehydrogenases (yellow diamond), 3-hydroxyacyl-CoA dehydrogenase (green circle), enoyl-CoA hydratases (purple rectangle) and acetyl-CoA C-actyltransferase (red cross). n/d= not detected
Pathway validation The abovementioned genomic and proteomic analysis indicates several possible genes and enzymes that are either natively upregulated in the presence of 1,4-butanediol or activated by ALE. To test the relevance of these genes for 1,4-butanediol metabolism, several knockout strains were generated.
62 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440
Some of the most differentially expressed genes during growth on 1,4-butanediol include an operon encoding a polyamine ABC transporter for spermidine and putrescine (PP_0411-14). This operon was strongly induced in the wildtype on 1,4-butanediol compared to glucose, but it is hardly expressed in the evolved strains growing on 1,4-butanediol. To test whether this downregulation facilitated growth on 1,4- butanediol, the corresponding genes were deleted in the wildtype. However, this deletion had no effect on the growth rate on 1,4-butanediol compared to the wildtype (Figure 18).
60
KT2440
50 B10.1 B10.2
40 KT2440 ' PP_0411-14
Gvalue(a.u.) 30
20 0 102030 tim e (h)
Figure 18 Biomass growth of P. putida KT2440 and the evolved strains B10.1 and B10.2 compared with P. putida KT2440 ΔPP_0411-14 on MSM containing 20 mM 1,4-butanediol. Growth was detected via a Growth Profiler® in 24-square-well plates. Error bars indicate the deviation from the mean (n = 2).
In cultures on 1,4-butanediol, oxidation to its intermediate 4-hydroxybutyrate is usually observed. Since the dehydrogenases encoded in the ped- cluster from PP_2673-2680 were highly expressed, during growth on glucose as well as on 1,4-butanediol, and because it is known, that those dehydrogenases are likely to be involved in the degradation of 1,4-butanediol (Figure 17), this cluster was further investigated in. For this, P. putida KT2440 knockout strains of the whole cluster and individual pedH and pedI knockouts were constructed and tested.
When P. putida KT2440 ΔpedE-I was cultivated in MSM with 1,4-butanediol no substrate uptake or growth could be observed (Figure 19). Therefore, this cluster appears to be essential for the uptake and metabolism of 1,4-butanediol.
63 Chapter 4
AB
4 25
20 3
(-) 15 2 600 10 OD 1 5 1,4- butanediol (mM) 0 0 0 102030405060 0 102030405060 tim e (h) tim e (h)
KT2440 B10.1 B10.2 KT2440 ' pedE-I
Figure 19 Biomass growth (A) and 1,4-butanediol concentration (B) of P. putida KT2440 (black circle) and ΔpedE-I (crossed circle) in comparison with B10.1 (purple triangle up) and B10.2 (purple triangle down). Strains were cultivated in MSM with 20.09 ± 0.15 mM 1,4-butanediol. Error bars indicate the deviation of the mean (n = 2). (adapted from Daun (2017))
Further, to narrow down which genes within the ped cluster are essential for 1,4-butanediol metabolism, P. putida KT2440 single knockouts of both pedE and pedI were streaked on MSM plates containing 20 mM 1,4-butanediol as sole carbon source. Of these knockouts, P. putida KT2440 ΔpedE did not grow, while the ΔpedI strain displayed slow growth similar to the wildtype after 48 h (Figure 20). Thus, the PQQ-dependent alcohol dehydrogenase PedE is likely responsible for the oxidation of 1,4-butanediol, while, surprisingly, the aldehyde dehydrogenase PedI does not seem to play a significant role in the further oxidation steps.
[1 ] A [1 ] [6 ] B10.1 [3 ] B10.1
No. Strain name [2 ] B10.2 1 KT2440 [5 ] [9 ] t = 24h B10.1 Isolate from ALE on BDO [2 ] B10.2 Isolate from ALE on BDO [3 ] 2 KT2440 ΔPP_2046 [4 ] [8 ] [7 ] 3 KT2440 ΔPP_2046::14g B 4 KT2440 Δped [1 ] [1 ] 5 KT2440 ΔpedE
[6 ] B10.1 [3 ] B10.1 6 KT2440 ΔpedI 7 KT2440 ΔPP_2047-51 t = 48h [2 ] B10.2 8 KT2440 ΔPP_2049
[5 ] [9 ] 9 KT2440 ΔPP_2051
[2 ]
[3 ] [4 ] [8 ] [7 ]
Figure 20 Strains on MSM plates with 20 mM 1,4-butanediol after A) 24 h and B) 48 h.
64 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440
Strain numbers next to each strike out refer to full strain names listed in Table 1.
As suggested in Figure 17, 4-hydroxybutyrate can be further degraded through three putative pathways. One of these hypotheses involves β-oxidation. Since PP_2046 and the operon PP_2047-51 are both, related to β-oxidation and were found to be mutated or highly expressed, the importance of the regulator PP_2046, as well as the adjacent operon PP_2047-51 and, PP_2049 and PP_2051, individually, were investigated. Deletion strains were constructed and tested for growth on MSM with 1,4-butanediol and 4-hydroxybutyrate.
No growth on either substrate was detected when the regulator PP_2046 was deleted (Figure 20; Figure 23). Given that the deletion of PP_2046 completely disables growth on 1,4-butanediol, a phenotypic rescue experiment was performed. P. putida KT2440 ΔPP_2046 was transformed an overexpression vector with either the native regulator or the evolved version from B10.2 (E34G, gAg/ gGg, denoted as PP_2046E). As expected, only the mutated version could rescue the 1,4-butanediol- metabolizing phenotype, while expression of the native PP_2046 did not restore growth (Figure 21).
KT ' PP_2046
1.0 B10.1
0.8 pBNT_mcs )
-1 pBNT_PP_2046 0.6 pBNT_PP_2046E
0.4 CDW (g L 0.2
0.0 0 10203040 tim e (h)
Figure 21 Biomass growth of P. putida KT2440 ΔPP_2046 transformants harboring an overexpressing construct for PP_2046 or PP_2046E and the empty vector cultivated in MSM with 20 mM 1,4-butanediol. Error bars indicate the deviation of the mean (n = 2).
In chapter three and Li et al. 2019, we could show that the E34G mutation in PP_2046 leads to the overexpression of PP_2049, encoding an alcohol dehydrogenase within the PP_2047-51 operon. Therefore, PP_2046 was replaced by a constitutive promotor 14g facing the operon PP_2047-51, resulting in the strain P. putida KT2440 ΔPP_2046::14g. Indeed, the growth on 1,4-butanediol was enhanced (Figure 23, Figure 22). It should be noted that no gene encoding a CoA-ligase is present within the operon, which would be important for the β-oxidation-related 1,4-butanediol degradation strategy.
65 Chapter 4
AB 1.2 25
1.0 20 )
-1 0.8 15 0.6 10 0.4 CDW (g L 5 0.2 1, 4- butanediol (mM) 0.0 0 0 102030405060 0 102030405060 tim e (h) tim e (h)
KT2440 B10.1 B10.2 KT2440 ' PP_2046::14g
Figure 22 Biomass growth (A) and 1,4-butanediol concentrations (B) during the cultivation of P. putida KT2440 (black, circles), B10.1, B10.2 (purple, triangles) and P. putida KT2440 ΔPP_2046::14g (black, circled cross) in MSM medium with 20.1 ± 0.5 mM 1,4-butanediol. Error bars indicate the deviation of the mean (n = 2).
In comparison with the evolved strains, the strain P. putida KT2440 ΔPP_2046::14g showed lower growth rates (B10.1= 0.359 ± 0.003 h-1; B10.2= 0.75 ± 0.001 h-1; ΔPP_2046::14g= 0.249 ± 0.004 h-1), indicating additional changes within the evolved strains. Nevertheless, with one modification, the growth rate of the engineered P. putida KT2440 was increased by 3.43-fold (P. putida KT2440= 0.071 ± 0.123 h-1; p= 0.005) compared to the wildtype. (Figure 22)
The importance of PP_2047-51 was also tested for growth on MSM with 1,4-butanediol and 4- hydroxybutyrate. When the alcohol dehydrogenase PP_2049 or the operon PP_2047-51 in P. putida KT2440 were deleted no growth on 1,4-butanediol was observed (Figure 20; Figure 23). However, strain ΔPP_2051, in which fadA, encoding for a 3-ketoacyl-CoA thiolase is deleted, grew on 1,4- butanediol and 4-hydroxybutyrate comparable to the wildtype (Figure 20, Figure 23).
The relevance of the PP_2046 regulator and its adjacent operon PP_2047-51, excluding PP_2051, for growth on 1,4-butanediol, more specifically on 4-hydroxybutyrate, could thus be demonstrated.
66 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440
0.8
KT2440
0.6 B10.1 )
-1 B10.2
0.4 KT2440 ' PP_2046 KT2440 ' PP_2049
CDW (g L 0.2 KT2440 ' PP_2051 KT2440 ' PP_2046::14g
0.0 0 1020304050 tim e (h)
Figure 23 Biomass growth of P. putida KT2440 (black, circles), both evolved strains B10.1 (purple, triangles up) and B10.2 (purple, triangle down), and P. putida KT2440 knockout strains (circles) ΔPP_2046 (grey), ΔPP_2049 (green), ΔPP_2051 (orange) and ΔPP_2046::14g (crossed) on 20 mM 4-hydroxybutyrate. Error bars indicate the deviation of the mean (n = 2).
The deletion of genes in the ped cluster, as well as the PP_2047-51 operon and its upstream regulator, demonstrated their necessity for P. putida KT2440 to grow on 1,4-butanediol. Additionally, with P. putida KT2440 ΔPP_2046::14g and thus the overexpression the operon of PP_2047-51, 1,4- butanediol degradation was enhanced in P. putida KT2440. This overexpression makes it likely, that β-oxidation is involved in 1,4-butanediol degradation. However, these results do not give conclusive evidence as to which of the putative pathways is used. (Figure 17)
In order to distinguish which of the downstream pathways is used, two additional experiments were carried out. Enzyme assays with whole cell extracts were performed to test for dehydrogenase, respectively, acyl-CoA dehydrogenase activities. For this, crude extracts from strains grown on MSM supplemented with 20 mM glucose and 5 mM 1,4-butanediol were collected and rebuffered in 100 mM glycylglycine buffer for the enzyme assays. The alcohol dehydrogenase activity was evaluated via the oxidation reaction (Kagi und Vallee B. H. 1960) by monitoring the increase of NADH spectroscopically. The acyl-CoA dehydrogenase activity was assayed in a coupled reaction with pyruvate kinase and lactate dehydrogenase, with addition of CoA and MgCl2, basically as described in (Koopman et al. 2010). This assay relies on the presence of an unknown native CoA ligase, measuring the subsequent acyl-CoA dehydrogenase activity by monitoring the increase of NADH spectroscopically.
However, for both assays, no activity was detected under the performed setup with 4- hydroxybutyrate as substrate, whereas a high activity was detected with ethanol as positive control (Figure 24).
67 Chapter 4
ABC GHB EtOH GHB
2.5 2.5 2.5
2.0 2.0 2.0
1.5 1.5 1.5
1.0 1.0 1.0 eeto unit detection unit detection detection unit 0.5 0.5 0.5
-5 0 5 10 15 -5 0 5 10 15 -5 0 5 10 15 tim e (m in) tim e (m in) tim e (m in)
KT2440 B10.1 KT2440 ' PP_2046
Figure 24 Dehydrogenase activity assay with 4-hydroxybutyrate (GHB) (A) or ethanol (EtOH) (B) as substrate and coupled CoA-ligase/ acyl-CoA dehydrogenase assay with 4GHB as substrate (C). Crude cell extracts obtained from P. putida KT2440 (black, circles), B10.1, B10.2 (purple, triangles) and P. putida KT2440 ΔPP_2046 (grey, circles) Error bars depict the standard error of the mean (n = 2-3).
The importance of the PP_2047-51 operon was demonstrated, strongly suggesting that 1,4- butanediol is metabolized through β-oxidation. To test whether the upregulation of this operon enables enhanced β-oxidation, growth of the wildtype and strains B10.1 and ΔPP_2046 was analyzed on longer-chain α, ω-diols and butanol. The evolved strain, as well as the wildtype, grew on 1,4- butanediol and 1,8-octanediol, with the evolved strains growing at a significantly higher rate. Surprisingly, none of the strains grew on 1,6-hexanediol or 1,7-heptanediol. The knockout strain ΔPP_2046 was not able to grow on any of the tested diols (Figure 25). As shown in Figure 26, the evolved strains B10.1 and B10.2 grew on butanol with rates of 0.2641 h-1 and 0.3441 h-1 respectively, whereas P. putida KT2440 showed short initial growth followed by a long lag phase, ultimately reaching significantly less maximum biomass concentrations (P. putida KT2440 = 0.406 ± 0.034
-1 -1 -1 gcdw L ; B10.1 = 0.659 ± 0.017 gcdw L ; B10.2 = 0.575 ± 0.000 gcdw L ; p = 0.008). Also on this substrate, the knockout strain ΔPP_2046 did not grow.
Since these alternate substrates can only be metabolized through beta-oxidation, these results further indicate the relevance of this pathway, proving that PP_2046 is an essential regulator for the metabolism of these short- to medium-chain alcohols.
68 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440
Figure 25 Growth of P. putida KT2440 (black, circles), B10.1, B10.2 (purple, triangles) and ΔPP_2046 (grey, circles) on 1,4-butanediol (A), 1,6-hexanediol (B), 1,7-heptanediol (C) and 1,8-octanediol (D). Growth was detected via a Growth Profiler® in 24-square well plates. Error bars depict the standard error of the mean (n = 2).
0.8 KT2440 B10.1
) 0.6
-1 B10.2
0.4
CDW (g L 0.2
0.0 0 204060 tim e (h)
Figure 26 Biomass growth of P. putida KT2440 (black, circles) and the evolved strains (purple) B10.1 (triangle up) and B10.2 (triangle down) in MSM with 20 mM butanol. Error bars indicate the deviation of the mean (n = 2). 4.3 Discussion The fact that wildtype P. putida KT2440 is able to slowly grow on 1,4-butanediol implies that in principle the metabolic routes are present but are not working optimally. Therefore, we sought a top-down strategy. Like in other studies, adaptive laboratory evolution lead to improved growth on
69 Chapter 4
1,4-butanediol, likely affecting transcriptional regulatory systems (Li et al. 2019; Lennen et al. 2019). Subsequent genome resequencing and proteomic analysis uncovered underlying molecular changes, which occurred as part of native responses or were developed during the evolution process. Via genome analysis, additional mutations, compared to our laboratory P. putida KT2440, were identified. Among others there is the deletion of 69 bp within PP_2139, encoding for the DNA topoisomerase I (topA). Since this enzyme is related to DNA replication and repair (Wang 2002), this alteration is unlikely to affect 1,4-butanediol metabolism specifically although its mutation might still be favorable in a general sense by affecting growth rate through DNA replication. Also, the SNP in PP_2889 encoding for a transmembrane regulator PrtR seems to have no influence for 1,4- butanediol degradation, considering that this regulator is involved in temperature-related protease production (Burger et al. 2000). Furthermore, proteomic analysis revealed the overexpression of the polyamine ABC transporter (PP_0411-PP_0414), in the wildtype but not in the evolved strains during growth on 1,4-butanediol (Table S 5). This transporter is annotated for the transfer of spermidine and putrescine, which are structurally and chemically similar to 1,4-butanediol. In spite of this large difference, no genomic mutations were found in the evolved strains surrounding the operon, and the knockout of PP_0411-14 in P. putida KT2440 did not influence growth on 1,4-butanediol. The metabolism of putrescine and spermidine shares some metabolic intermediates with the putative 1,4-butanediol pathways (Bandounas et al. 2011). Possibly, the high accumulation of 4- hydroxybutyrate in the wildtype induced the expression of this transporter, leading to a mis regulation during growth on 1,4-butanediol. Alternatively, the diamine transporter may also facilitate uptake of the 1,4-butanediol or its oxidation products. Furthermore, among the most upregulated proteins in P. putida KT2440 wildtype during growth on 1,4-butanediol there were also other putrescine or anime related protein upregulated. These include the ornithine carbamoyl transferase, ArcB (PP_1000) and the arginine deiminase, ArcA (PP_1001) as well as the ethanolamine operon (PP_0542-44). To further investigate functions and relations with amines, experiments with the evolved strains with the operon PP_0411-PP_0414 deleted and additional growth experiments with amines are of interest.
Proteomic analysis shows changes in expression of wildtype enzymes compared to the evolved strains during the cultivation on glucose and 1,4-butanediol. Among others, PP_0452, encoding for the elongation factor Tu-B, which is involved in the regulation of protein synthesis by mediating aminoacyl tRNA into a free site of ribosomes was highly expressed (Noel und Whitford 2016). This is not surprising since the growth rate of the evolved strains is higher and as a consequence protein synthesis is upregulated as well (Klumpp et al. 2009).
70 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440
As for the remaining observations, we show indications fitting our hypothesis for the degradation of 1,4-butanediol. Shown in Figure 17, 1,4-butanediol metabolism starts with its oxidation to 4- hydroxybutyrate (upper pathway). The detection of the oxidation product 4-hydroxybutyrate supports this hypothesis and suggests the involvement of dehydrogenases or oxidoreductases. P. putida KT2440 has a large inventory of oxidoreductases, including various dehydrogenases, which could carry out the first steps of oxidizing 1,4-butanediol to 4-hydroxybutyrate (Belda et al. 2016). One of the major players, we determined, is encoded within the ped cluster PP_2674-80, with pedE as an essential gene, since its knockout disabled growth on 1,4-butanediol. Its corresponding enzyme was also found to be the highest expressed protein during growth on glucose and 1,4-butanediol in the wildtype as well as in the evolved strains. PedE, a homolog to ExaA from P. aeruginosa, is an extensively investigated pyrroloquinoline quinone alcohol dehydrogenase with a broad substrate activity, including 1-butanol and 1,4-butanediol (Takeda et al. 2013). Furthermore, Wehrman et al. (2017b) showed activities of PedE towards structural similar alcohols and aldehydes of 1,4- butanediol, like 1- butanol and butyraldehyde. Additionally, the first steps of 1- butanol assimilation in P. putida BIRD-1 also involves homologs of the ped cluster (Cuenca et al. 2016). By confirming, that the evolved strains are growing better on butanol than the wildtype, we show a relation of butanol and 1,4-butanediol degradation.
The other dehydrogenases encoded within the ped cluster, PedH and also PedI, seem to be of minor relevance. PedE and PedH are both ethanol dehydrogenases but are inversely regulated by lanthanides. In the absent of those rare earth elements, pedE expression is induced and pedH is repressed (Wehrmann et al. 2017b). Both, PedE and PedH are highly expressed, but considering the absents of lanthanides, it is likely that PedH is not active. Notably, PedE was highly expressed in both tested conditions, and 4-hydroxybutyrate was accumulating more in the wildtype than in the evolved strains during growth on 1,4-butanediol. It is likely that the upper pathway oxidation steps of 1,4- butanediol are not the bottleneck for the degradation in P. putida KT2440. Furthermore, the knockout strain ΔpedI grew similar to the wildtype, which indicates the involvement of other aldehyde dehydrogenases oxidizing the aldehydes to acids.
Complementary to PedE, PP_2049 was also found to be an essential alcohol dehydrogenase for growth on 1,4-butanediol. Since both individual knockout strains of PP_2049 and pedE were unable to grow on 1,4-butanediol, it is unlikely that they oxidize the same substrate. More likely, the PP_2049 dehydrogenase is essential for the lower pathway, the metabolism of 4-hydroxybutyrate to intermediates of the central carbon metabolism. PP_2049 may be responsible for the further oxidation of 4-hydroxybutyrate to succinate, although the lack of dehydrogenase activity found in cell extracts with 4-hydroxybutyrate contradict this hypothesis. In literature, this dehydrogenase is
71 Chapter 4 placed in a context of beta-oxidation, mainly due to its association with the other genes in the PP_2047-51 operon. However, sequence-based predictions (Interpro) describe PP_2049 to be an iron-containing alcohol dehydrogenase, which belongs to type III non-homologous NAD(P)+- dependent alcohol dehydrogenases (Gaona-López et al. 2016). This family is known to have ethanol dehydrogenase activities, as well as activities with towards methanol, propanol and butanol (Hiu et al. 1987; Gaona-López et al. 2016). It is highly likely that, PP_2049 oxidizes one or more of the 1,4- butanediol metabolic intermediates. Which exact role this gene may play in beta-oxidation is unclear.
Besides PP_2049, other dehydrogenases were also upregulated like the 3-hydroxyisobutyrate dehydrogenase, MmsB (PP_4666), which could conduct the oxidation of 4-hydroxybutyrate to succinate semialdehyde (Steele et al. 1992; Zhou et al. 2013). Moreover, the methylmalonate semialdehyde dehydrogenase, MmsA-II (PP_4667) and NAD+-dependent succinate semialdehyde dehydrogenase, Sad-II (PP_3151) were further upregulated in wildtype P. putida KT2440 compared to the evolved strains (Figure 17). This higher expression might be an indicator, that in wildtype P. putida KT2440 4-hydroxybutyrate is rather degraded through direct oxidation than via β-oxidation (Figure 17). But since wildtype P. putida KT2440 grows poorly on 1,4-butanediol (Figure 14), this pathway is rather inefficient for growth.
Taken together, no definite answer can be given on which of the three putative lower pathways is or is not active on 1,4-butanediol. That said, most circumstantial evidence points to strong involvement of β-oxidation, given the essential nature of the PP_2047-51 beta-oxidation operon and the fact that the evolved strains grow better on alternative substrates like butanol and 1,8-octanediol, which can only be metabolized through this pathway.
The regulator PP_2046 groups in the LysR-type family, which mainly contains transcriptional activators, repressors, and even dual function activators/repressors with a helix-turn-helix (HTH) DNA-binding domain at the N-terminus (Pérez-Rueda und Collado-Vides 2000; Maddocks und Oyston 2008). Both mutations found in the B10.1 and B10.2 evolved strains are located in the first third of the gene. Whereas B10.1 version of PP_2046 lost its native start codon, alternatives start codons are present which truncate the native HTH DNA binding domain (Figure 27). Also, the SNP (E34G, gAg/ gGg) in PP_2046 of B10.2 was found to alter the HTH DNA binding site. The fact, that only the mutated version of PP_2046 can enable growth on 1,4-butanediol, while its deletion abolishes growth, strongly suggests that this gene encodes an activator of the downstream operon, with an unknown inducer outside of the 1,4-butanediol context. It seems that a modification of the HTH domain is key to creating a constitutive activator. Strains with the same mutation in PP_2046 as in B10.2 were obtained from a previous study with strains isolated from ALE on ethylene glycol (chapter three, Li et al. 2019). This version of PP_2046 led to the upregulation of PP_2049, and therefore,
72 Unraveling 1,4-butanediol metabolism in Pseudomonas putida KT2440 most likely the whole operon. High enzyme levels for the enzymes downstream of PP_2046 of B10 strains support this hypothesis. The overexpression of the downstream operon PP_2047-51 via a synthetic promotor resulted in comparable phenotype and underlines the hypothesis of PP_2046E being a constitutive activator. Interestingly, both isolated strains from ALE on ethylene glycol, namely E6.1 and E6.2, are able to grow on 1,4-butanediol, comparable to B10.1 (Figure 28). These data imply, that PP_2046 regulates part of the 1,4-butanediol degradation pathway and is also supportive for the growth on ethylene glycol.
PP_2046 – LysR transcriptional regulator with 307 aa: Start of PP_2046 ATa Æ Start loss TTTTTGAAATTTCCATTTCGTATGCCATATATTTTCAGCATGAATATTTCGAACTTCGACCTGAACCT GGG Æ E34G GCTGCGCGTCTTCGACATGTTGCTGCGTGAACAGAATGTATCCCGGGCAGCCGCGCGTCTGGCCCTGA CCCAGCCGACCGTGAGCAATGCCCTGGCGCGCCTGCGTGACCAGCTGGGTGACCCGCTGCTGGTCCGC GTGGGCCGGCGCATGCGCCCGACGCCACGGGCCTTGGCACTGGAGGGGCCGATACGTGCGGCGTTACA GCAGATCGAGCAGACGCTGGGCACCGGCGATGGTTTCGAGCCTCAGCGCAGCCATCGCCAGCTGCGCA TCGCCCTCACCGATTTCGTCGAACAGCTGTGCATGCCGCCACTCCTGGCGCGGCTGGAGCTACTGGCA CCCAACGTGCGCATCGACGTGGTGCACCTGGCCCCCAACCTGCCGGCCGAGGCGCTGGACCGGGGCGA CCTCGACCTGGTACTGGGCCGTTTCGACGAGGTGCCGGCGCGCTTCACCCGCCACCCCTGGCGCCGTG AAACCCTGCAGATCGCGCTGCGCCAGCAGCACCCGCACCTGGCGCCGGGCCAGGCACTGGACCTCGAC GCATTCCTGGGCTTGCGGCACATCTGGGTGCACGGCGGCCAGACCCGGGGCATGGTCGACCAGTGGCT GGCCGAGCAAGGCCTGACCCGGCAAATCGCCTATACCACGCCCAACTACCTGCAGGCCGCCCATCTGG CCGCAGCCACCGACATGTGTGTGGTGCTGCCGCGGCAACTGGCGCAGCAGTTTGCGCACCTGCTGCCA TTGGCGGTGCACGAACTGCCATTTGCCCTGGAGCCTTTCGAATTGGAAGTGGTGCACCTGAGCCACCG TCAGCACGACCCCGCCCTGGCCTGGCTGGTCGAACAGATCCTCACGCTCCCCCCCGCCTGAAGCCATC AGGAAACGCGATA
ATG, GTG: alternative start codons (in frame) 15Æ72 aa: DNA HTH binding site lysR family 106Æ301 aa: substrate binding domain - type 2 periplasmic binding fold protein superfamily
Figure 27 P. putida KT2440 sequence of PP_2046 encoding for a LysR-transcriptional regulator. Native (red) and alternative start codons (orange), as well as the mutations of B10.1 (ATG – ATa: start loss, in light blue) and B10.2 (GCG – GgG: E34G, in dark blue) are shown. Conserved DNA helix-turn-helix (HTH) (bold) and substrate binding domain (underlined) are indicated.
73 Chapter 4
100
80 KT2440 E6.1 60 E6.2 B10.1 40 B10.2 Gvalue(a.u.) 20
0 0 102030 tim e (h)
Figure 28 Growth comparison of wildtype P. putida KT2440, the evolved strains on ethylene glycol, E6.1 and E6.2, and the evolved strains on 1,4-butanediol, B10.1 and B10.2, cultivated in MSM with 20 mM 1,4- butanediol. Growth was detected via the Growth Profiler® in a 24-well plate. Error bars indicate the standard deviation (n=3).
For the bio-upcycling approach, in this work, we identified major contributors and present possible pathways for 1,4-butanediol degradation.
4.4 Conclusion Strains isolated from ALE were used to enlighten possible degradation pathways for 1,4-butanediol. Via genome resequencing and proteomic analysis, targets were identified and tested. These include PedE, the alcohol dehydrogenase, the LysR-transcriptional regulator PP_2046, and the putative alcohol dehydrogenase PP_2049. Further results indicate the relevance of β-oxidation for the degradation of 1,4-butanediol, yet, the pathway is not clearly understood. Nevertheless, by replacing the LysR-transcriptional regulator PP_2046 with a synthetic promotor 14g (Zobel et al. 2015) and thereby overexpressing the operon of PP_2047-51, a reverse-engineered strain was constructed. This strain shows enhanced growth on 1,4-butanendiol compared to P. putida KT2440. With this rational target, a consolidation route for P. putida KT2440 to grow on multiple plastic monomers is enabled.
74
Chapter 5 Consolidation for strains utilizing PU monomers
Contributions: This chapter was written by Wing-Jin Li and was reviewed by Nick Wierckx and Lars M. Blank. Hendrick Ballerstedt isolated strain A6.1p. Paul Niehoff, Julia Bockwoldt and Jaqueline Plaster constructed strains as specified in Table 1 and contributed to growth experiments as indicated in figure legends.
Consolidation for strains utilizing PU monomers
5 Consolidation for strains utilizing PU monomers
5.1 Introduction The strategies for dealing with plastic pollution are plenty (chapter 1.3). One of those approaches aims at the bio upcycling plastics like PU to value-added materials using enzymatic and microbial biotechnology (Wierckx et al. 2015). PU is a versatile material consisting of aliphatic diisocyanates with polyols and α-ω-diols as chain extenders. Since different monomers can be used, we focus on aliphatic polyester polyols. To degrade these polymers, esterases like lipases, cutinases or other PUases can be used to enzymatically depolymerize the plastic to monomers like ethylene glycol, 1,4- butanediol, adipic acid, and a diamine like for instance 4,4´-Methylenedianiline MDA (Sharmin und Zafar 2012; Magnin et al. 2019b; Schmidt et al. 2017). The metabolism of the first two monomers, ethylene glycol, and 1,4-butanediol, are addressed in chapter three and chapter four.
Adipic acid is a dicarboxylic acid, which is mainly used in the production of nylon 6,6 (hexamethylene diamine adipic acid) and polyurethanes. For the industrial production, fossil benzene is used to chemically synthesize adipic acid (Sato 1998). Since the concerns of fossil oil shortage, pollution, and climate change became apparent, sustainable production alternatives were investigated.
Several methods for the microbial production of adipic acid or its intermediate precursors were developed. For this, lipid and lignin or cellulose and hemicellulose derived feedstocks can be utilized to produce the precursors, muconic acid and glucaric acid or adipic acid, directly. To convert muconic acid and glucaric acid to adipic acid, those compounds undergo catalytic hydrogenation (Kruyer und Peralta-Yahya 2017; Vardon et al. 2015; Cheong et al. 2016). Further, Yu et al (2014) developed an E. coli strain, which is able to produce adipic acid directly from glucose. The metabolic pathway used for production was adapted from degradation routes, similar to the one from Acinetobacter baylyi.
A. baylyi is a Gram-negative soil bacterium with robust physiological properties known to degrade various components like aromatics and other organic substrates (Barbe et al. 2004). Simple genetic manipulations and the high competence for natural transformation make this organism more and more of interest (Vaneechoutte et al. 2006; Metzgar et al. 2004; Young et al. 2005). Its single, circular chromosome of 3.6 mbp consists of an average GC content of 40.3 %. Interestingly, although the GC content of Pseudomonas species is with 60 %, distinct from Acinetobacter, sequence comparisons of their 16S RNA revealed their close relation (Barbe et al. 2004).
The degradation pathway of adipic acid in A. baylyi was reported by Parke et al (2001). They propose adipic acid first to be activated to adipyl-CoA, after which it is further converted via β-oxidation to 3-
79 Chapter 5 oxoadipyl-CoA which is then degraded to succinyl-CoA and acetyl-CoA, intermediates of the TCA cycle. The responsible genes are clustered in two operons, in which in one, enzymes for the transport (DcaK and DcaP), CoA transferase subunits (DcaIJ) and an acyl-CoA dehydrogenase (DcaA) are encoded. The other operon consists of enzymes related to β-oxidation (enoyl-CoA hydratase, ketoacyl-CoA reductase, hydroxyl-CoA dehydrogenase and a thiolase within dcaECHF)
For the bio upcycling approach, P. putida KT2440 convinces with its benefits, which were reviewed in chapter one. Being a soil bacterium, it possesses a great inventory of routes to survive in all kinds of environments, including high solvent tolerance and metabolic versatility. To fulfill the task of achieving a strain growing on PU monomers, P. putida KT2440 strains was enabled to grow on adipic acid. Further, preliminary experiments were conducted, in which ethylene glycol and 1,4-butanediol growth-enabling factors from chapters three and four were combined to generate a strain for PU monomer utilization. These features include the deletion of the gclR encoding transcriptional regulator for growth on ethylene glycol and the exchange of PP_2046 with a synthetic promotor 14g for growth on 1,4-butanediol.
5.2 Results
Enabling growth on adipic acid To investigate whether P. putida KT2440 can metabolize adipic acid, growth experiments were performed. These showed no growth on MSM containing 20 mM adipic acid as sole carbon source. Further analysis also revealed no uptake of this substrate (data not shown). Therefore, the adipic acid metabolic pathway from A. baylyi was heterologously expressed in P. putida KT2440. The degradation starts with CoA activation of adipic acid, which then subsequently undergoes β-oxidation and, finally, 3-oxoadipyl-CoA is cleaved to succinyl-CoA and acetyl-CoA. The latter two can be then further degraded within the TCA cycle. (Parke et al. 2001, Figure 29)
80 Consolidation for strains utilizing PU monomers
A
4-hydroxybenzoate PcaK, adipate DcaK, DcaP phenylacetate PaaK, PcaT (A. baylyi) PaaJ
4-hydroxybenzoate adipate phenylacetate CoA CoA DcaIJ (A. baylyi) PaaK PobA adipyl-CoA phenylacetyl-CoA PaaABCD, DcaA(A. baylyi) PaaG, PP_3726, PaaZ
PaaG, 2,3-didehydro- PP_3726 3-oxo-5,6- 3,4-dihydroxybenzoate adipyl-CoA dehydrosuberyl-CoA DcaE(A. baylyi), PaaG, FadB, PP_3726 PcaGH PaaF, PcaB PaaG PcaC PcaD 3-hydroxyadipate-CoA acetyl-CoA DcaH (A. baylyi), FadB, PaaH
PcaIJ 3-oxoadipate 3-oxoadipyl-CoA oxidoreductase ligase DcaF (A. baylyi), CoA transferase PcaFI, transporter PcaF-II, hydrolase regulator PaaJ lyase non relevant genes succinyl-CoA; acetyl-CoA isomerase hypothetical proteins
B
IRR IR Tn4652
C
pBNT_dcaAKIJP (10.48 kbp)
A12.6p: Gac Æ Tac, E80*
Figure 29 Overview of genes and enzymes involved in adipic acid metabolism
81 Chapter 5
A) Suggested adipic acid degradation pathway for P. putida KT2440 in comparison with its native 4- hydroxybenzoate and phenylacetate metabolism. Heterologous proteins from A. baylyi are underlined. Corresponding enzymes are indicated and shown as arrows with following color coding: oxidoreductases in green, transferases in orange, hydrolase in black, lyases in dark blue, isomerases in light purple, ligases in dark purple, transporter in light blue. B) Organization of 4-hydroxybenzoate and phenylacetate degradation relevant genes in P. putida KT2440. The color coding corresponds to the coded enzymes in A) with the addition of regulators in red, not relevant genes in grey and genes encoding for hypothetical proteins in white. The 17kbp transposon Tn4652, flanked by inverted repeats (IR), is shown in grey arrows. The annotated site of SNP in only A12.1p is indicated below the relevant genes. C) Plasmid organization of pBNT_dcaAKIJP. (Adipate degradation pathway adapted from Parke et al. (2001))
In order to determine potential connecting points of dcaAIJP and dcaECHF to the native P. putida KT2440 metabolism, proteins which could conduct the same reactions were searched for by in silico analysis. As depicted in Figure 29 2,3-dihydro-adipyl-CoA (5-carboxy-2-pentenoyl-CoA), can be metabolized via a part of the phenylacetate degradation pathway. For the activation with CoA and the first oxidation step, the responsible enzymes DcaIJ and DcaA from A. baylyi were compared to the existing repertoire in P. putida KT2440 (Table 8).
Table 8 Protein sequence comparison of A. baylyi and P. putida KT2440
Protein sequence from Alignment to P. putida KT2440 Identities A. baylyi
DcaA acyl-CoA dehydrogenase (PP_3492) 40 %
DcaK major- facilitator superfamily transporter (PP_4578) 30 %
DcaIJ 3-oxoadipyl-CoA transferase subunit A/B (PcaIJ (PP_3951-52)) 66/62 %
DcaP no significant similarity found -
The protein sequences of the acyl-CoA dehydrogenase (PP_3492) and PcaIJ from P. putida KT2440 revealed the highest match compared with DcaA and DcaIJ from A. baylyi. Nevertheless, the similarities are quite low and are likely not active in the present of adipic acid. Therefore, these enzymes were targeted to be heterologously expressed in P. putida KT2440. Since the GC-content and the codon usage of both organisms are very different (Barbe et al. 2004), codon optimization was carried out to optimize transcription and translation of those genes in P. putida. This method is known to improve the expression of heterologous genes by changing the original codons to frequently used codons for the expression host (Elena et al. 2014). For this, the online tool, OPTIMIZER, was used, in which the codon was optimized for P. putida KT2440 with the ´guided random´ method with the eubacterial genetic code. Furthermore, undesired restriction sites, which interfere with the cloning strategy into the pSEVA234-backbone and rare codons with usage of less than 10 % were manually removed. The genes dcaIJ and dcaA from A. baylyi were hence codon- optimized for P. putida KT2440 and are named dcaIJo and dcaAo. These genes were cloned into
82 Consolidation for strains utilizing PU monomers standard European vector architecture (SEVA) plasmid (pSEVA234_dcaIJo, pSEVA234_dcaAo, pSEVA234 dcaIJAo) (Puigbò et al. 2007; Martínez-García et al. 2015). Although P. putida KT2440 was transformed with the codon-optimized sequence to express the missing enzymes for adipic acid degradation, no growth on MSM with 20 mM adipic acid was obtained (data not shown). To address potential transport limitations, the dcaAKIJP operon from A. baylyi was cloned into a compatible vector, yielding pBNT_dcaAKIJP. Transformed P. putida KT2440 harboring pBNT_dcaAKIJP was tested for growth in MSM containing adipic acid, but no growth could be detected (data not shown).
Since the introduction of a heterologous pathway alone could not enable P. putida KT2440 to grow on adipic acid, another extended approach was pursued. Assuming the operon dcaAKIJP from the vector is expressed, but the native genes from the downstream pathway are not active, a modified adaptive laboratory evolution (ALE) strategy was performed. For this, a co-feeding scheme of adipic acid and alternative carbon sources like glucose and 4-hydroxybenzoate was followed (Table 9). 4- hydroxybenzoate was used to induce genes like pcaF-II (PP_2137), pcaI (PP_1377), paaJ (PP_3280) (Figure 29). These genes are involved in the degradation of the intermediate 3-oxoadiply-CoA, which is the shared compound between the adipic acid and 4-hydroxybenzoate metabolism (Figure 29). Furthermore, genes for phenylalanine, or rather phenylacetate degradation were assumed to be already active, since the turnover of proteins results in the recycling of e.g. phenylalanine and its degradation.
Table 9 Carbon source composition in two-fold buffered MSM for adaptive laboratory evolution of P. putida KT2440 to enable growth on adipic acid
Order MSM (2x buffered) with Preculture 20 mM glucose
1 5 mM glucose, 5 mM adipic acid, 15 mM 4-hydroxybenzoate
2 10 mM adipic acid, 20 mM 4-hydroxybenzoate
3 20 mM adipic acid, 1 mM 4-hydroxybenzoate
4 20 mM adipic acid, 0,5 mM 4-hydroxybenzoate
5 30 mM adipic acid
The stepwise increase in adipic acid and decrease of alternative C-source was used to adapt P. putida KT2440 with pBNT_dcaAKIJP in two individual batches without adding the kanamycin to maintain the plasmid. Furthermore, no salicylate was added as inducer of the NagR/PnagAa regulator which controls the dcaAKIJP operon, relying instead on leaky expression of the promoter.. The first batch, shown in
83 Chapter 5
Figure 30 A, was performed as proof on principle, was repeated extensively (Figure 30 B) and is described below.
When glucose was supplemented to the medium (medium 1, Table 9), the strain grew overnight. The second overnight culture reaching OD600 4.5 was washed in MSM Buffer and used to inoculate medium 2 with 4-hydroxybenzoate and adipic acid as carbon sources (OD600 0.1). Growth phases increased to two days reaching OD600 2.6- 3.5 and could be shorted after three transfers to one day. When only 1 mM 4- hydroxybenzoate was supplemented (medium 3), only optical densities of 0.16 were reached. Four transfers were performed by harvesting the cells and transferring them to fresh medium 3. Growth in medium 3 was detected after the ninth transfer. Since these densities
(OD600 = 3.6) could only be reached when adipic acid is utilized, the addition of 4-hydroxybenzoate was further discontinued. A consortium of P. putida KT2440 strains harboring pBNT_dcaAKIJP growing on adipic acid was obtained through five different media compositions after 12 transfer steps (A12p) (Niehoff 2017).
ABC 1234 12 3 45 150 6 6 A12.1p A6.1p
4 4 100 600 600 OD OD 2 2 Gvalue(a.u.)
50
0 0
0 5 10 15 20 25 30 35 0 5 10 15 20 25 30 35 0 5 10 15 20 25 tim e (d) tim e (d) tim e (h) P. putida KT2440 transfers pBNT_dcaAKIJP
Figure 30 Adaptive laboratory evolution of P. putida KT2440 harboring pBNT_dcaAKIJP on adipic acid. Sequential batch cultivation to obtain the consortia A6p (A) and A12p (B) on medium according to Table 9. Medium numbers are indicated above. Each transfer is indicated with a green star. The greyed symbol is an estimated value after longtime cultivation. Adapted from Ballerstedt (unpublished data) and Niehoff (2017)) C) Growth of 96 single strains (94 strains in grey) isolated from each ALE batch on two-fold buffered MSM with 30 mM adipic acid with kanamycin. The strains A12.1p (green triangle up) and A6.1p (green triangle down) were selected for further investigation. Growth was detected via a Growth Profiler® using a 96-well plate.
20 and 96 single strains from each evolved culture were isolated from LB agar plates and tested for growth on adipic acid (Figure 30 C). From each batch, one strain was isolated according to the fastest growth on adipic acid and hence called A6.1p and A12.1p (first strain from 6th or 12th transfer harboring plasmid). Both strains are still harboring the plasmid pBNT_dcaAKIJP, as they are growing on MSM with adipic acid and kanamycin. When adipic acid was supplied as sole carbon source in MSM, both evolved strains grew, while the wildtype didn´t (Figure 31). Strain A12.1p, which was generated from a more extended ALE approach, grew 2.9-fold faster than A6.1p (A6.1p: 0.057± 0.0013 h-1; A12.1p: 0.167± 0.001 h-1; p= 0.0002). 84 Consolidation for strains utilizing PU monomers
AB 5 25 KT2440
4 A6.1p 20 A12.1p 3 15 600
OD 2 10
1 adipic acid5 (m M )
0 0 020406080 0 20406080 tim e (h) tim e (h)
Figure 31 Growth of biomass and adipic acid detection of the isolated ALE strains A6.1p and A12.1p growing on adipic acid in a shake flask cultivation in salicylate and kanamycin supplemented MSM with 18.8 ± 0.8 mM adipic acid. Error bars indicate the deviation of the mean (n = 2). (adapted from Plaster (2019))
To identify whether changes favoring the growth on adipic acid occurred within the genome or the plasmid of the evolved strains, both strains were cured from their plasmid. Both strains had stably maintained their plasmid during the evolution since they were kanamycin resistant. Wildtype P. putida KT2440 was transformed with the evolved plasmid of A6.1p (pBNT_dcaAKIJPcpi). Additionally, the evolved strains were transformed with the original plasmid (pBNT_dcaAKIJP). Furthermore, to investigate the dependency of plasmid-based expression to its inducer salicylate, growth experiments of the mentioned transformants were performed in kanamycin supplemented MSM containing 20 mM adipic acid with and without salicylate (Figure 32). Independent of the addition of salicylate, the overall growth pattern of the strains is comparable, but the uninduced cultures grew slower, having a 15 h prolonged growth phase.
Growth experiments showed no growth of the wildtype or the evolved strains without any plasmid. When harboring either the original or the evolved plasmid, growth was detected for the evolved strains. Hence, the operon dcaAKIJP is essential for the growth on adipic acid. Furthermore, wildtype P. putida KT2440 bearing the evolved plasmid was also able to grow on adipic acid, in contrast to the wildtype with the original plasmid (Figure 32). This was regardless of the addition of salicylate, indicating that the laboratory evolution affected the plasmid-based expression of the adipic acid metabolic genes.
85 Chapter 5
AB
200 200 P. putida KT2440 +
pBNT_mcs
150 150 pBNT_dcaAKIJP pBNT_dcaAKIJPcpi
P. putida A6.1 + 100 100 Gvalue(a.u.) Gvalue(a.u.) pBNT_mcs
pBNT_dcaAKIJP
pBNT_dcaAKIJPcpi 50 50
0 10203040506070 0 10203040506070 tim e (h) tim e (h)
Figure 32 Growth of the P. putida KT2440 wildtype (black circle) and the evolved strain A6.1 (green triangle) harboring the empty vector (pBNT_mcs, light-colored) or expressing the native (pBNT_dcaAKIJP, medium colored) or evolved version (pBNT_dcaAKIJPcpi, dark-colored) of dcaAKIJP in kanamycin supplemented MSM containing 20 mM adipic acid (n = 1) with (A) and without (B) the addition of salicylate as inducer. (adapted from Niehoff (2017))
Since the wildtype with the evolved plasmid grew on adipic acid, mutations within the plasmid were assumed. Additionally, in contrast to the wildtype with the original plasmid, the evolved strains with the original plasmid grew on adipic acid. This indicates that the evolution affected both the plasmid and the genome within the evolved strains. Moreover, with the omission of the inducer, growth was not inhibited but slowed, indicating a promotor leakage in pBNT_dcaAKIJP and pBNT_dcaAKIJPcpi.
The molecular basis for growth on adipic acid To understand the molecular basis of the phenotype of the two evolved strains and their plasmids, genome resequencing was conducted. As described in chapter three, the genome of our laboratory P. putida KT2440 was compared to the reference genome from the database and 83 mutations were uncovered. The genes identified are mostly located either in the 26049 bp long PP_0168 gene, encoding for a surface adhesion protein, or they are positioned in non-coding regions or are silent mutations (Li et al. 2019). Table 10 shows the summary of the genome analysis of A12.1 and A6.1 and their corresponding plasmid in comparison with our wildtype P. putida KT2440 and the native plasmid, pBNT_dcaAKIJP.
86 Consolidation for strains utilizing PU monomers
Table 10 Summary of identified mutations in strain A6.1p and A12.1p. Single nucleotide polymorphism (SNP) and insertions and deletions (InDel) are shown for the strain and its harboring plasmid.
Laboratory P. putida KT2440 vs: pBNT_dcaAKIJP vs:
A6.1p A12.1p pBNT_dcaAKIJP pBNT_dcaAKIJP cpi from A6.1 cpi2 from A12.1 sum of all mutations 51 53 7 6 type of mutation SNP 30 31 3 2
InDel 21 22 4 4 functional class intergenic 27/21 27/21 3/0 3/0
(SNP/InDel) silent 0/0 0/0 0/3 0/3
missense 2/1 2/2 1/0 0/0
nonsense 0/0 1/0 0/0 0/0
Most of the mutations which occurred within the genome were found in both evolved strains or in strain A12.1p only (Table 11). One prominent alteration stood out in both evolved strains. Via sequence reads analysis, the coverage for Tn4652, a transposon element, was found to be as twice as high as the average genomic coverage. Arbitrary-primed PCR revealed that this transposon had replicated into a second locus, between paaFGHIJ and paaYX. The paa cluster encodes enzymes responsible for the degradation of phenylacetate, which shows parallel activities to adipic acid degradation (Figure 29). Initial CoA activation and several steps involving β-oxidation lead to the shared intermediate, 2,3 didehydro-adiply-CoA, which is further converted to the TCA intermediates succinyl-CoA and acetyl-CoA (Nogales et al. 2017). The characteristics of Tn4256 were already described in chapter three. This transposon element is known to be active during starvation (Ilves et al. 2001). Also, it is reported that this transposon can introduce fusion promotors (Nurk et al. 1993; Teras et al. 2000).
87 Chapter 5
Table 11 List of main affected genes found after genome resequencing analysis of both A6.1p and A12.1p. (aa= amino acid)
Found affected putative found mutation putative effect of Literature in gene function (position in mutation strain genome) A6.1p PP_0278 hypothetical insertion_-_T inserted stop Nelson et al. 2002; and protein (336124^336125) codon (last 10 aa Belda et al. 2016 A12.1p missing) A12.1p PP_2144 tetR family E80* disrupted 236 aa Fonseca et al. transcriptional (2445964) long regulator 2014; Cuthbertson regulator und Nodwell 2013 A6.1p PP_2589 aldehyde A428V mutation in PuuC- Kurihara et al. and dehydrogenase (2958523) like dehydrogenase 2005 A12.1p family protein domain A12.1p PP_3988 hypothetical Deletion_T_- mutation in Nelson et al. 2002; protein (4498312) Histidine kinase- Belda et al. 2016 like ATPase domain A6.1p PP_5037 lipocalin family S175N mutation in Flower et al. 2000; and lipoprotein (5740555) lipocalin-like Bishop 2000 A12.1p domain A6.1p Tn4652 transposon doubled replicated 17 kbp Ilves et al. 2001; and PP_2964– coverage, transposon Teras et al. 2000 A12.1p PP_5546 replicate located element between paaFGHIJ and paaYX
Additionally, only identified in A12.1p, the TetR family transcriptional regulator PP_2144 (GAC Æ TAC; E80*, *= stop codon) was mutated (Table 11). In P. aeruginosa, this regulator (PsrA) functions as a repressor for fadBA and is therefore related to β-oxidation (Kang et al. 2008). The approximate location of PP_2144, pcaF-II, and fadB in P. putida KT2440 makes it likely that they are regulated by this transcriptional repressor, and that its mutation activates the expression of these genes (Figure 29).
Furthermore, mutations were identified within the evolved plasmid. Two SNPs were found in the nagR gene causing missense mutations (I119L; W120R) in both evolved plasmids. The NagR/pnag promoter on the plasmid used during evolution, pBNT_mcs, regulates the expression of the operon of interest by induction with salicylate (Verhoef et al. 2010). The response protein NagR activates the promotor pnag to induce the downstream operon when salicylate is sensed (Mitchell und Gu 2005).
88 Consolidation for strains utilizing PU monomers
Additionally, in only pBNT_dcaAKIJPcpi, one SNP was found within rep, which encodes the replication initiator protein and is involved in the replication of the plasmid (Funnell und Phillips 2004).
After the evolution process, the original high copy number plasmid was mutated in regulatory elements for copy number and protein expression level. The plasmid number, influenced by the Rep protein, can severely influence growth in P. putida, and mutations in the rep gene of a plasmid with the same backbone as pBNT have been shown to greatly improve growth (Mi et al. 2016). Thus, this mutation may be a more aspecific effect of the evolutionary selection resulting in a more stable plasmid that is less frequently lost without antibiotic selection. Furthermore, since both the copy number effect of the rep mutation, as well as the mutations in nagR will likely influence gene expression, these combined mutations may also serve to balance the expression of the dca genes in the absence of salicylate as inducer during ALE. The mutation within the NagR/pnag system might have changed the regulation to a constitutive expression of dcaAKIJP, but this remains to be tested (Figure 32).
Investigation in genes responsible for adipic acid degradation In order to investigate which genomic mutations are responsible for the growth of the evolved strains on adipic acid with the original plasmid and, which genes are responsible for the enhanced growth of A12.1p compared to A6.1p, targets from genome resequencing were further analyzed.
Fernandez et al (2014) investigated the regulation of paa operons in E. coli and showed, that PaaX is a repressor of paaZ and paaABCDEFGHIJK, operons involved in the degradation of phenylacetate or rather 2,3-dihydro-adipyl-CoA (Figure 29). The genomic organization of the paa operons in P. putida KT2440 is divided into paaZ, paaABCDE, and paaFGHIJK regulated by paaXY. At first, phenylacetate is Coa-activated to activated to phenylacetatyl-CoA, which inactivates PaaX and thereby releasing the repression of paaZ and paaABCDEFGHIJK by disassociating from the promoter binding site of PZ and
PA (Ferrández et al. 2000). Phenylacetyl-CoA can then further be degraded to intermediates of the TCA-cycle. To avoid accumulation of intermediates that prevent this further degradation to succinyl- CoA and acetyl-CoA, PaaY thiolase can act as putative detoxifier and can hydrolyze accumulated intermediates. Since the parallels of adipic acid and phenylacetate start with 2,3-dihydro-adipyl-CoA, the focus lies on the operon paaFGHIJK, its regulation and the influence of the transposon Tn4256 insertion between paaFGHIJK and paaXY. This 17 kb transposon is located 104 bp downstream of paaF and thereby disrupts a putative promotor binding site, whereas the putative promotor binding site for paaYX remains intact (Supporting information 7-9)
To test, whether paaFGHJI or paaYX are affected by the transposon Tn4256 and resulting overexpression through possible fusion promotors, which favor growth on adipic acid, each native
89 Chapter 5 promotor was exchanged for a synthetic constitutive promoter in wildtype P. putida KT2440. For the promotor exchange upstream of paaYX a synthetic promotor with moderate strength was used (14d, (Zobel et al. 2015). Since the paaF operon consists of five genes, paaFGHIJ, the exchanged was performed with a strong promotor (14g) (Zobel et al. 2015). After the strains were obtained, they were transformed with the evolved plasmid pBNT_dcaAKIJPcpi, to enable growth on adipic acid.
The initial growth rate of the transformed wildtype strain with pBNT_dcaAKIJPcpi (0.047± 0.00045
-1 g h ) does not differ significantly from P. putida KT2440 ΔPpaaF::14g bearing the same evolved plasmid (0,048± 0,00115 g h-1). But higher biomass concentrations were reached with P. putida
KT2440 ΔPpaaF::14. Also, these strains do not grow as fast as the evolved strains A6.1p (0.057± 0.002 g h-1) and A12.1p (0.176± 0.001 g h-1) on adipic acid, as well as not reaching the same biomass concentrations (Figure 33). Furthermore, strain ΔPpaaYX::14d is not able to grow on adipic acid, with or without pBNT_dcaAKIJPcpi.
P. putida KT2440: 1.6 A6.1p A12.1p
) 1.2
-1 pBNT_mcs
0.8 pBNT_dcaAKIJPcpi
' P paaF::14g pB N T_m cs
CDW (g L 0.4 ' P paaF::14g pBNT_dcaAKIJPcpi
' P paaYX::14d 0.0 ' P ::14d pBNT_dcaAKIJPcpi 0 25 50 75 100 125 150 paaYX tim e (h)
Figure 33 Biomass growth of strains growing in salicylate and kanamycin supplemented MSM with 20 mM adipic acid. The evolved strains A6.1p (triangle up in green), and A12.1p (triangle down in blue) are shown along with the wildtype strain (circle), ΔPpaaF::14g (diamond) and ΔPpaaYX::14d (square) transformed with the empty vector (grey) and the evolved plasmid pBNT_dcaAKIJPcpi (black). Error bars indicate the deviation of the mean (n = 2). (adapted from Bockwoldt (2018) and Plaster (2019))
When overexpressing the regulator paaX, growth on adipic acid is abolished. PaaX represses the expression of the paaFGHIJK and thereby prevents adipic acid degradation throught the phenylacetate pathway (Figure 29). The overexpression of paaFGHIJK, resulted in similar growth compared to the wildtype control. Although this overexpression did result a higher final biomass concentration, the growth rate was still much lower than that of the evolved strains. More investigation is needed to determine the influence of paaFGHIJK on adipic acid degradation. Possibly,
90 Consolidation for strains utilizing PU monomers the transposon insertion disrupts the PaaX binding site upstream of the paaFGHIJK operon, thereby activating its expression. The much smaller synthetic promoter inserted into the heterologous strain may have left this binding site intact, thereby repressing transcription even in the presence of this strong pomoter.
The other mutated target, only found in A.12.1p, is PP_2144, which encodes for a TetR family transcriptional regulator. As described previously, this regulator is a homolog to PsrA (protein identity of 85.15 %), the repressor for fadAB and related to β-oxidation in P. aeruginosa (Kang et al. 2008). Since pcaF-II and fadB are located close to PP_2144, it is likely, that this transcriptional regulator represses those two genes. As indicated in Figure 29 FadB as well as PcaF-II can conduct the same reactions as necessary for the degradation of phenylacetate or rather 2,3-didehydroadipyl- CoA, the common intermediate between adipic acid and phenylacetate. The found mutation resulted in a stop codon, thereby likely disrupting PP_2144.
To investigate PP_2144 and its influence, deletion strains, as well as overexpression plasmids, were constructed. Preliminary results show that there is an influence on growth of strains with PP_2144 deleted or overexpressed (Bockwoldt 2018; Plaster 2019). Nevertheless, further characterization will be needed.
With the characterization of the targets, indications for enzymes involved in the degradation pathway of adipic acid were identified. Regulatory effects on plasmid expression for heterologous genes from A. baylyi as well as native regulatory elements for benzoate and protocatechuate degradation or rather β-oxidation related pathways are involved for the utilization of adipic acid in P. putida KT2440.
The genetic factors enabling efficient metabolism of adipic acid in the evolved strains are not fully understood yet. Nevertheless, the pathway seems to be a hybrid metabolism involving dcaAKIJP from A. baylyi, and possibly redundant downstream β-oxidation pathways encoded by paaFGHIJK and fadAB (Figure 29).
Consolidation of the metabolism of adipic acid, 1,4-butanediol, ethylene glycol To obtain a strain which is able to utilize the PU monomers ethylene glycol, 1,4-butanediol, and adipic acid, traits enabling the metabolism of each monomer were combined in two parallel approaches. On the one hand, strains with the ability to grow on adipic acid were engineered to enable growth on ethylene glycol. On the other hand, a strain growing on ethylene glycol and 1,4- butanediol was engineered to also grow on adipic acid.
91 Chapter 5
As described in chapter three, the deletion of gclR in P. putida KT2440 enabled growth on ethylene glycol. Hence, gclR was deleted in A12.1p and A6.1p and a growth experiment in MSM with a mixture of ethylene glycol and adipic acid was performed. As expected, the P. putida KT2440 ΔgclR control strain only took up ethylene glycol, whereas A12.1p ΔgclR and A6.1p ΔgclR consumed both substrates and achieved higher biomass concentrations (Figure 34). When P. putida KT2440 ΔgclR
-1 grew on ethylene glycol alone, biomass yields were at 0.224 gcdw gEG (chapter 3). Growing on adipic
-1 acid and ethylene glycol, yields were only at 0.0644 gcdw gAA+EG . Since only ethylene glycol was taken
-1 up, biomass yields calculated with just using ethylene glycol as carbon source were at 0.214 gcdw ge , showing only ethylene glycol was utilized for biomass formation. When comparing the evolved
-1 strains growing only on adipic acid (biomass yields of A6.1p= 0.487 gcdw gAA and A12.1p=
-1 0.536 gcdw gAA (chapter 6.X)), Co-feed with adipic acid and ethylene glycol resulted in less biomass
-1 -1 yields (A6.1p ΔgclR= 0.268 gcdw gAA+EG and A12.1p ΔgclR= 0.312 gcdw gAA+EG , respectively). This slight decrease might be due to the influence of the short term toxic intermediate accumulation during the degradation of ethylene glycol (chapter 3). Yields were calculated for the whole substrates, in which the carbon to oxygen ratio are different. Nevertheless, those yields do not change the overall outcome.
Furthermore, the best-evolved strain on adipic acid, A12.1p, consumes adipic acid faster than A6.1ΔgclR, consistent with the abovementioned phenotypes on adipic acid alone. This demonstrates, that the two pathways are generally not preventing each other from functioning. Nevertheless, possible accumulation of toxic intermediates during cultivation with ethylene glycol might influence the growth performance, resulting in lower biomass yields on mixed substrates.
92 Consolidation for strains utilizing PU monomers
AB
6 35
30
25 4 20 600
(m M) 15 ; ethylene glycol] OD 2 10
5
0 0 adipic acid 0153045 60 75 [ 0 1530456075 tim e (h) tim e (h) KT2440 ' g clR A6.1p ' gclR A12 .1p ' gclR
Figure 34 Biomass growth (A) and extracellular metabolites (B) of ΔgclR deletion in P. putida KT2440 (circle), the evolved strains A6.1p (triangle up) and A12.1p (triangle down). Cultures were grown in MSM with 24.4± 0.9 mM ethylene glycol and 29.9± 0.9 mM adipic acid. For the evolved strains, salicylate and kanamycin were added to the medium. Errors are shown by the error of the means (n = 2). (adapted from Bockwoldt (2018))
Characterization of the strains E6.1 and E6.2 revealed their ability to grow on 1,4-butanediol. Additionally, all reverse-engineered strains for ethylene glycol in which the tetR transcriptional regulator gclR is deleted and the transcriptional regulator PP_2046 was replaced by a synthetic promotor (ΔPP_2046::14g) (described in chapter three) are able to grow on both ethylene glycol and 1,4-butanediol (Figure 35). Although B10.1 is also consuming ethylene glycol, P. putida KT2440 ΔgclR ΔPP_2046::14g ΔPP_2662::14d (0.678± 0.002 g L-1) and E6.1 (0.744± 0.071 g L-1) achieve more biomass compared to B10.1 (0.541± 0.035 g L-1). This indicates, that B10.1 is not able to generate biomass from ethylene glycol, likely only oxidizing it to CO2 or intermediates such as glycolate or glyoxylate (chapter 3.2, Li et al. 2019) in contrast to P. putida KT2440 ΔgclR ΔPP_2046::14g ΔPP_2662::14d and E6.1.
93 Chapter 5
AB ;
0.8 16
0.6 12 ) -1
0.4 1,4- butanediol 8 CDW (g L 0.2 4 ethylene (mM) glycol] 0.0 0 0 102030 0 102030 ocnrto [ concentration tim e (h) tim e (h) KT2440 ' g clR ' PP_2046::14g B10.1 E6.1 ' PP_2662::14d
Figure 35 Biomass growth (A) and extracellular metabolites (B) of P. putida B10.1 (rectangle), KT2440 ΔgclR ΔPP_2046::14g ΔPP_2662::14d (circle), and E6.1 (triangle) cultivated in MSM with 6.4± 0.5 mM ethylene glycol and 13.8± 0.4 mM 1,4-butanediol. Errors are shown by the error of the means (n = 2).
To enable growth on adipic acid, the PpaaF promoter was exchanged for the constitutive 14g promoter in P. putida KT2440 ΔgclR ΔPP_2046::14g ΔPP_2662::14d and E6.1 to obtain P. putida KT2440 ΔgclR
ΔPP_2046::14g ΔPP_2662::14d ΔPpaaF::14g (reverse-engineered strain) and E6.1 ΔPpaaF::14g (ALE+). These strains were additionally transformed with plasmid pBNT_dcaAKIJPcpi which enables growth on adipic acid. These strains were tested in a cultivation experiment with MSM containing each substrate and a mixture of both, respectively. (Figure 36)
These results confirmed the relatively insignificant effect of the ΔPpaaF::14g modification, as described above. However, there are differences between strains harboring an empty plasmid or the pBNT_dcaAKIJPcpi overexpression construct in either the reversed engineered strain or ALE+ strain. In both strains, growth is comparable on 1,4-butanediol or ethylene glycol, except or a slightly longer lag phase (>10 h) and a lower biomass concentration of the ALE+ strain with empty plasmid growing on 1,4-butanediol. Additionally, the ALE+ strain with the empty plasmid exhibits decreased growth rates. Also, with 1,4-butanediol as substrate, less biomass was detected for strains harboring the empty plasmid, compared to the strain with the overexpression construct pBNT_dcaAKIJPcpi (Figure 36 AB). It seems that the overexpression of additional CoA transferases and dehydrogenases, or the transport proteins has a positive effect for E6.1 during growth on 1,4-butanediol and ethylene glycol.
Only strains carrying the construct pBNT_dcaAKIJPcpi were able to utilize adipic acid for growth, confirming that dcaAKIJP is essential for this phenotype. Further, strains growing on adipic acid require 72 h to reach stationary phase, whereas on the other substrates it may take only 16 h for 1,4- butanediol and 20 h for ethylene glycol, respectively (Figure 36). This is to be expected, given that introduction of this plasmid alone yielded suboptimal growth on adipic acid (Figure 33)
94 Consolidation for strains utilizing PU monomers
A B
120 120
100 100
80 80
60 60 Gvalue(a.u.) Gvalue(a.u.) 40 40
20 20 0 1020304050 0 1020304050 tim e (h) tim e (h)
CD
120 120
100 100
80 80
60 60 Gvalue(a.u.) Gvalue(a.u.) 40 40
20 20 0 20406080100 0 1020304050 tim e (h) tim e (h)
KT2440 ' g clR ' PP_2046::14g KT2440 ' g clR ' PP_2046::14g E6.1 ' P paaF::14g E6.1 ' P paaF::14g
' PP_2662::14d ' P paaF::14g ' PP_2662::14d ' P paaF::14g pBNTmcs pBNT_dcaAKIJPcpi pBNT_mcs pBNT_dcaAKIJPcpi
Figure 36 Biomass growth of P. putida KT2440 ΔgclR ΔPP_2046::14g ΔPP_2662::14d ΔPpaaF::14g (circle) and E6.1 ΔPpaaF:.14g (square) harboring either the empty vector (black) or pBNT_dcaAKIJPcpi (green). The strains were cultivated in MSM with salicylate and kanamycin, containing 20 mM 1,4-butanediol (A), 30 mM ethylene glycol (B), 30 mM adipic acid (C) and a mixture of 10 mM adipic acid 25 mM ethylene glycol and 12.5 mM 1,4-butanediol (D). Error bars show the deviation of the mean (n = 2). (adapted from Plaster (2019))
The ability of the transformants to grow on all three substrates was tested in MSM with a mixture of adipic acid, ethylene glycol, and 1,4-butanediol. As depicted in Figure 36, all tested strains grow on this mixture, but the ALE+ strain with plasmid pBNT_mcs grew slower, requiring 38 h to reach stationary phase, compared to 18 h for the other three strains. The reverse-engineered strain with either the empty vector, pBNT_mcs, or pBNT_dcaAKIJPcpi and ALE+ harboring the overexpression construct showed similar growth rates. Furthermore, both transformants with the overexpression construct of dcaAKIJPcpi achieve higher biomass concentrations, compared to transformants with the empty vector. This is an indication that the additional carbon from adipic acid is efficiently co- metabolized, in contrast to transformants harboring the control vector.
To analyze the substrate uptake and possible catabolite repression, a shake flask experiment was performed where samples were analyzed by HPLC using the same conditions as above with a mixture of the three substrates. When carrying the plasmid pBNT_dcaAKIJPcpi, all transformants completely consume all three substrates, first consuming 1,4-butanediol and ethylene glycol simultaneously, after which adipic acid is taken up (Figure 37).
95 Chapter 5
ABC KT2440 ' g clR ' PP_2046::14g KT2440 ' gclR ' PP_2046::14g KT2440 ' gclR ' PP_2046::14g
' PP_2662::14d ' P paaF::14g ' PP_2662::14d ' P paaF::14g ' PP_2662::14d ' P paaF::14g pBNT_mcs pBNT_dcaAKIJPcpi ; 6 25 ; 25
20 20
4 adipic acid 15 adipic acid 15 600
OD 10 10 ; ethylene glycol] (m M ) 2 ; ethylene glycol] (m M )
5 5
0 0 0 ocnrto [ concentration ocnrto [ concentration 0 1020304050 0 1020304050 0 1020304050 tim e (h) tim e (h) tim e (h) 1,4- butanediol 1,4- butanediol pBNT_mcs pBNT_dcaAKIJPcpi DEF
E6.1 ' P paaF::14g E6.1 ' P paaF::14g E6.1 ' P paaF::14g pBNT_dcaAKIJPcpi pBNT_mcs ;
6 ; 25 25
20 20 4
adipic acid 15
adipic acid 15 600
OD 10
10 ; ethylene glycol] (m M )
2 ; ethylene glycol] (m M )
5 5
0 0 0 [ concentration 0 1020304050 [ concentration 0 1020304050 0 1020304050 tim e (h) tim e (h)
tim e (h) 1,4- butanediol pBNTmcs pBNT_dcaAKIJPcpi 1,4- butanediol
Figure 37 Biomass growth of P. putida KT2440 ΔgclR ΔPP_2046::14g ΔPP_2662::14d ΔPpaaF:.14g (circle) (A) and E6.1 ΔPpaaF::14g (square) (D) harboring either the empty vector (pBNT_mcs; grey, yellow) or pBNT_dcaAKIJPcpi (black, orange) and the corresponding extracellular metabolites during cultivation in MSM with salicylate and kanamycin supplemented MSM with 9.8± 0.1 mM adipic acid (green), 22.9± 0.2 mM ethylene glycol (black) and 12.8± 0.3 mM 1,4-butanediol (blue) (B, C; E, F). Errors are shown by the error of the means (n = 2).
Together, these results show that both the reverse-engineered strain P. putida KT2440 ΔgclR
ΔPP_2046::14g ΔPP_2662::14d ΔPpaaF::14g bearing the plasmid pBNT_dcaAKIJPcpi or the evolved strain E6.1 ΔPpaaF::14g harboring the same plasmid, can metabolize all three plastic monomers, adipic acid, 1,4-butanediol, and ethylene glycol.
96
Chapter 6 General discussion and outlook
Contributions: This chapter was written by Wing-Jin Li and was reviewed by Lars M. Blank. The plasmid pBT_tph and PHA production data was kindly provided by Marta Saccomanno from University of Dublin (Ireland).
General discussion and outlook
6 General discussion and outlook For the bio-upcycling approach, strategies to utilize plastics need to be developed. By enabling P. putida KT2440 to grow on ethylene glycol, 1,4-butanediol, and adipic acid, the groundwork for the approach of achieving a strain growing on plastics is set. Via several independent ALE experiments and in-depth analysis by genome resequencing and proteomics, and testing of the potential targets by reverse engineering, a rational design of a strain able to grow on PET and PU monomers is presented.
6.1 Plastic monomer degrading P. putida To enable ethylene glycol utilization in P. putida KT2440, the deletion of the regulator gclR is sufficient, but the utilization was further optimized by introducing additional secondary traits (deletion or replacement via a synthetic promotor of PP_2046 and PP_2662) (chapter 3.2.5, Li et al. 2019). As described by Franden et al. (2018), the overexpression of the glycolate oxidase, glcDEF, lead to enhanced glycolaldehyde tolerance and improved ethylene glycol utilization in engineered strains. Degradation of toxic ethylene glycol intermediates enhanced ethylene glycol utilizing strains generated in this work.
Degradation of 1,4-butanediol was achieved by replacing the regulator PP_2046 with a synthetic promotor in P. putida KT2440 and thereby deregulating parts of β-oxidation (chapter 4.2.4). Results from proteomic and genomic analyses of the wildtype and evolved strains indicated possible pathways, which involve oxidation, CoA activation, and β-oxidation (chapter 4.2.3). To additionally analyze the pathway usage, labeling experiments with C13-labeled 1,4-butanediol or other intermediates like 4-hydroxybutyrate could elucidate possible pathways (Feng et al. 2012; Shimizu 2002). By tracing the labeled carbon, metabolic flux analysis might reveal the actual underlying pathways of 1,4-butanediol and support my three pathway hypothesis described in chapter 4.2.1. With the gained knowledge, further optimization steps can be designed.
For adipic acid, the optimized overexpression vector for heterologous genes from A. baylyi, namely dcaAKIJP, enabled growth of P. putida KT2440 (chapter 5.2.1). Analysis of genome resequenced evolved strains baring the evolved plasmid (pBNT_dcaAKIJPcpi) indicate a hybrid utilization pathway of adipic acid with the heterologous enzymes from A. baylyi (dcaAKIJP) and, native phenylacetate (paa genes) and benzoate degradation proteins (pca genes) (chapter 0). Adipic acid is thereby CoA activated and undergoes β-oxidation steps. Since first reverse engineering attempts could not fully resolve the underlying pathway, further investigations are necessary. These include the consolidation of mutated targets, which were identified after genome resequencing of the evolved strains. Also,
101 Chapter 6 genomic integration of dcaAKIJP could reduce the burden of replicating and maintaining a plasmid, thereby enhancing the degradation of adipic acid.
First attempts were performed to combine all found targets to generate a strain able to metabolize the three compounds, ethylene glycol, 1,4-butanediol, and adipic acid from PU depolymerization
(chapter 0). Two strains (P. putida KT2440 ΔgclR ΔPP_2046::14g ΔPP_2662::14d ΔPpaaF::14g baring the plasmid pBNT_dcaAKIJPcpi and the evolved strain E6.1 ΔPpaaF::14g harboring pBNT_dcaAKIJPcpi) were constructed to utilize these three PU monomers.
Nevertheless, the remaining challenge is to utilize MDI, a toxic compound being released during the depolymerization process for PU. This substance is known to react with DNA in vivo and in vitro, therefore genotoxic (Bolognesi et al. 2001). However, a putative P. putida B1 is able to metabolize and survive amounts of MDI (Eberlein, unpublished data) and is a promising candidate to further investigate. Another approach to overcome the utilization of MDI in bacteria would be the extraction from the depolymerized broth. For example, solid-phase extraction and liquid-liquid extraction methods were already used to extract antibiotics in water (Faleye et al. 2017).
For the utilization of PET monomers, preliminary results show promising results for growth on ethylene glycol and terephthalate, using strain KT2440 ΔgclR ΔPP_2046 ΔPP_2662 and E6.1, which were transformed with an overexpression vector (pBT_tph) harboring the terephthalate degradation operon from Comamonas testosteroni YZW-D (provided by Marta Saccomanno from University College Dublin). This operon, controlled by the regulator TphR, consists of genes encoding for a transporter for terephthalic acid (tphR) and is followed by genes encoding for two subunits of a dioxygenase (tphA2A3), a dehydrogenase (tphB), and a reductase (tphA1) (Wang et al. 1995). Growth of transformed strains in MSM is depicted in Figure 38. P. putida KT2440, the evolved strain E6.1 and KT2440 ΔgclR ΔPP_2046 ΔPP_2662::14d baring pBT_tph are growing on terephthalate, whereas the transformed strain KT2440 ΔgclR ΔPP_2046 ΔPP_2662::14d show diauxic behavior. Compared to KT2440 baring pBT_tph, when cultivated in MSM with terephthalate and ethylene glycol, strains, which were enabled to grow on ethylene glycol (E6.1 and KT2440 ΔgclR ΔPP_2046 ΔPP_2662::14d) and harbor the plasmid pBT_tph, generated more biomass (Figure 38). This indicates the utilization of both carbon sources. The construction of strains able to utilize PET monomers is also achieved.
102 General discussion and outlook
A B 30 mM ethlylene glycol 20 mM terephthalate 20 m M terephthalate
100 100
80 80
60 60 Gvalue(a.u.) Gvalue(a.u.) 40 40
20 20 0 10203040 0 10203040 tim e (h) tim e (h) KT2440 ' gclR ' PP_2046 KT2440 pBT_tph E6.1 pBT_tph ' PP_2662::14d pBT_tph
Figure 38 First consolidated strains for PET monomer utilization. Growth of P. putida KT2440, the evolved strain E6.1 and KT2440 ΔgclR ΔPP_2046 ΔPP_2662::14d baring pBT_tph cultivated in kanamycin supplemented MSM containing 20 mM terephthalate (A) and 30 mM ethylene glycol and 20 mM terephthalate (B). Growth was detected in a 96-well plate using the Growth Profiler®. Error bars depict the standard error of the mean (n = 2). (The plasmid pBT_tph was kindly provided by Marta Saccomanno, UCD)
6.2 Challenges to overcome Nevertheless, challenges remain to be solved. Those challenges include diauxic growth during cultivation on mixed substrates, yield, and titer on hydrolysis products, and the application beyond lab scale. Since bio upcycling is not just the utilization of plastic monomers, but the production of value-added materials, investigations, whether the targets of plastic monomer utilization prevents production need to be exploited.
Plastic monomer co-utilization In natural environments, microorganisms are often exposed to a broad range of different carbon and energy sources. To save its own resources, microorganisms are activating utilization pathways for favorable compounds, which for example can be metabolized more rapidly (Görke und Stülke 2008; Deutscher 2008). As soon as the preferred source is depleted, other metabolic routes will be initiated. This process is reflected in diauxic growth and is controlled via catabolite repression. To optimize metabolism, catabolite repression in P. putida is regulated by a system, in which the availability of free Crc proteins is involved. Free Crc proteins are translational repressors, which can bind to specific mRNAs and thereby hindering protein production. Two sRNAs, CrcZ and CrcY, act as antagonists towards the Crc protein (Moreno et al. 2012). The expression of those two sRNAs is regulated by a two-component system, CbrA and CbrB, which is sensing surrounding compounds. When no catabolite repression is necessary, CbrAB activates the expression of the sRNAs CrcZ and
103 Chapter 6
CrcY. When CrcZ and CrcY are binding to free Crc, less Crc is available to hinder the translation of specific target mRNAs and translation can begin (Moreno et al. 2015). In contrary, when a favorable carbon source like succinate is available, levels of CrcZ and CrcY decrease, the Crc protein remains free, is able to bind to the Crc specific binding sequence on mRNAs, thereby hindering translation (Valentini et al. 2014).
As described in chapter 0, diauxic growth occurred, when enabled strains grow on three different substrates. Ethylene glycol and 1,4-butanediol were assimilated before adipic acid was utilized (figure 35). This work shows that paa genes are likely to be involved in adipic acid metabolism. Since Fernandez et al (2014) demonstrated a relation of catabolism of phenylacetate via paa genes and its regulation through global regulation of carbon catabolite repression in E. coli, probably, the same is occurring in P. putida strains, which are enabled to grow on three plastic monomers. Ethylene glycol and 1,4-butanediol represent more favorable carbon sources compared to adipic acid, thus, the adipic acid metabolism seems to be repressed. Whereas proteomic data from chapter 4.2.2 showed no high levels of Crc and thereby indicating no carbon catabolite repression during growth on glucose nor on 1,4-butanediol, the addition of adipic acid seems trigger its regulation. Furthermore, investigation of PU degrading P. protegens Pf-5 showed catabolite repression during growth on several carbon sources including glucose (Hung et al. 2016). This supports the hypothesis of active carbon catabolite repression during growth on plastic monomers.
To overcome the phenotype of diauxic growth, CrcZ and CrcY can be overexpressed and thereby avoiding overall carbon catabolite repression (Moreno et al. 2012). When applied to the generated strains of this work, it is likely, that all three substrates will be metabolized parallel, resulting in a higher growth rate, which is industrially relevant. Also, this strategy is likely to be applicable for other carbon catabolite repressed pathways as shown for the production of muconate a carbon catabolite repression deregulated Δcrc P. putida KT2440 strain (Johnson et al. 2017).
Developing plastic monomer utilizing strains for industrial production Strains utilizing plastic monomers were generated, though, further optimization of biomass yield and degradation rate need to be investigated.
As described previously (chapter 6.1), several optimization approaches are possible. Nevertheless, one could also seek further ALE to force strains, which are already able to grow on three plastic monomers, to even utilize those in a more efficient way and thereby also selecting for strains without catabolite repression and higher biomass yield. So far, the generated strains were cultivated and tested on purified substrates. To be as close to application as possible and to gain a strain
104 General discussion and outlook consisting of all features described, plastic hydrolysate can be used as carbon supply for the advanced ALE, thereby also adapting strains to possible plasticizers or additives.
One should keep in mind the overall goal of bio-upcycling, which describes not only the utilization of plastic but the production of value-added material. For starters, the natural product polyhydroxyalkanoates (PHA) was investigated (Madison und Huisman 1999). As described in chapter 1.3, this polymer represents one of the bioplastics used in industry and is naturally produced by P. putida KT2440 during nitrogen limitation and carbon excess (Lee et al. 2000; Prieto et al. 2016). Depending of the carbon source, different lengths of PHA can be formed (Huijberts et al. 1992). Linked to fatty acid biosynthesis, PHAs can be formed directly from (R)-3-hydroxyacyl-ACP to (R)-3- hydroxyacyl-CoA via PhaG and will be further converted to PHA by PhaC. Another way is the production from glucose, through acetyl-CoA and further undergoing fatty acid de novo synthesis, yielding medium-chain-length PHAs (Borrero-de Acuña et al. 2014).
Indeed, preliminary data indicate PHA production in all evolved strains (Figure 39). Depending on the substrate, the titers achieved by the evolved strains (PHA content in relation to CDW: 25 % for E6.1 on ethylene glycol, 19 % for B10.1 on 1,4-butanediol and 28 % for A12.1p on adipic acid) are in the same range compared to the wildtype KT2440 growing on non-fatty acid carbon sources (La Rosa et al. 2014; Fonseca et al. 2014; Huijberts et al. 1992). With the above-described overexpression of crcZY, additional to the benefit of overcoming catabolite repression (chapter 6.2.1), PHA production might be even increased (La Rosa et al. 2014).
1.0 )
-1 0.8
0.6
0.4
0.2 CDW, PHA (g L 25 % 19 % 28 % 0.0
E6.1 B10.1 A12.1
CDW PHA
Figure 39 PHA production in relation to biomass formation in evolved strains grown in MSM with 80mM EG for E6.1 and 40mM BDO for B10.1 and B10.2 after 48 hours at 30°C. Data generated by Megg Walsh from Bioplastech.
Whether the rational strain, which features growth on ethylene glycol, 1,4-butanediol, and adipic acid, is able to produce PHA will be subject of future work. Nevertheless, one should keep in mind the alterations made within those rational strains. In particular two mutations, which are involved in
105 Chapter 6
β-oxidation are of relevance for PHA production. The mutation target PP_2046 found in ethylene glycol and 1,4-butanediol evolved strains is regulating the β-oxidation genes PP_2047-2051 (chapter 3.2.4 and 4.2.2). These genes and corresponding proteins are highly expressed during nitrogen limiting conditions, which happen to be the production conditions for PHA (Poblete-Castro et al. 2012). Also, PP_2144, a mutated regulator found only in A12.1p, a strain developed for adipic acid growth is related to β-oxidation (chapter 0, Fonseca et al. 2014). After engineering those two targets the chain length of produced PHA might be influenced.
Another promising product from plastic waste utilizing strains are rhamnolipids, which are biosurfactants being produced in P. aeruginosa (Abdel-Mawgoud et al. 2010). This biosurfactant consists of either one or two rhamnose units, the hydrophilic moiety, and 3-(3- hydroxyalkanoyloxy)alkanoic acid (HAA), serving as hydrophobic part. These amphiphilic compounds can be applied as bio-remediating agent or detergent. For the production in P. putida KT2440, dTDP- L- rhamnose from glucose-1-phosphate and HAAs from acetyl-CoA and fatty acid de novo synthesis serve as precursors. When rhlA and rhlB from P. aeruginosa are expressed, mono-rhamnolipids can be formed; with the addition of rhlC, the second rhamnose can be attached to a mono rhamnolipid (Tiso et al. 2017; Wittgens et al. 2011). Since acetyl-CoA is formed after the degradation of ethylene glycol, 1,4-butanediol, and adipic acid, either directly or via pyruvate, strains generated in this work might serve as promising production host producing PHA as well as rhamnolipids (or also HAA) from plastic.
By enabling P. putida KT2440 to grow on three plastic monomers, this presented work serves as groundwork for upcoming bio-upcycling processes. The gained knowledge contributes to our challenge dealing with potential environmental detrimental plastics.
106 General discussion and outlook
107
Appendix
Appendix
o _dcaA o _dcaA
o o o o
dcaA agmR agmR dcaIJ dcaIJ dcaIJ dcaIJ gcl gcl glcB glcB pduCDE dcaECHF dcaECHF dcaAKIJP dcaAKIJP glxR pduCDE
gcl gcl gcl gcl gcl gcl gcl purpose purpose pSEVA234_ pSEVA234_ pSEVA234_ pSEVA234_ MCS sequencing pSEVA234 MCS sequencing pSEVA234 Sequencing pSEVA234_ pSEVA234_ pSEVA234_ pSEVA234_ pSEVA424_ pSEVA424_ pSEVA234_ pSEVA234_ pSEVA424_ pSEVA424_ pSEVA234_ pSEVA234_ pEMG_Δ pEMG_Δ pEMG_Δ pEMG_Δ pEMG_Δ pEMG_Δ pEMG_Δ pSEVA424_ fw fw fw fw fw fw fw fw fw fw fw fw fw fw rev rev rev rev rev rev rev rev rev rev rev rev rev rev direction direction
KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 template template P. putida P. putida A. baylyi A. baylyi pSEVA234 pSEVA234 dcaIJo dcaAo dcaAo P. putida P. putida P. putida P. putida pUCDD11 pUCDD11 A. baylyi A. baylyi A. baylyi A. baylyi P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida TGGCAGCAGATGCTGCTTAC sequence sequence CCGAATTCAAGGCCATGTACAAAATTCTG TTCCCGGGGCCGGAACAGCTCAAC TTGAATTCGGAATGAATGCTTATG TTGGTACCTTTATCTAAGCTGAATC CATCCGGCTCGTATAATG CCGAGCGTTCTGAACAAATC CTGAATGCCCGCTGATTGAC TGCGCTAATCCCGGGGATCCTAGGAGGTACGACGTATGATC CACGACGCGGCCGCAAGCTTTTACGAGGTGACCTCCTTG TTGTGAGCTCGCTAGGAGGTCAAACCATGAGCAAAATGAG ACGTCGTACCTCCTACTCTAGACGTCAGGCGATCAGTCCAG TTGTTCTAGATAGGAGGTCGGCAAGCAATGACTGGATAC CACGACGCGGCCGCAAGCTTCCC TATGAATTCGTAGGAGGTACCAGCTGAGGCTGATTCATGAGATCG TATGGATCCGAAGTTAATCGTCGCCTTTGAG TTGTGAATTCGCGATATGAGGAATATAGTTTTGTTATG TTGTGGATCCAGAGCTCGGACGCGGATG TTGTCTGCAGGCGTGAAATCTTGCAGTCTGGCTAT TTGTAAGCTTTTCGTATCAATCTCCTTTTTAAAAC TTCCGAATTCCATCTCGAAGGGCCATTCGC TTCCGGTACCTGGTTTGTGCCTCATCGATTTTG TTCCTCTAGATGTGCCTCATCGATTTTGTAATTG TTCCGGTACCGATCGCCTGACGCCCCCAGG TTCCTCTAGACCCGCTTCGGTGGTGGTCAG TGGCAGATTTCTGCGGTGAC ACAGGGTCCCGAGTTGTTCC TTCCGGATCCTAGGAGGTACCAGCTATGGCTAAAATCGGTTTCAT C List of used oligonucleotides name name WJ20 WJ21 WJ22 WJ23 BW062 BW063 WJ24 WJ25 WJ26 WJ27.2 WJ28 WJ29.2 WJ30 WJ31 WJ32 WJ33 WJ34 WJ35 WJ36 WJ37.2 WJ38 WJ38.2 WJ39 WJ40 WJ41 WJ42 WJ43 Table S 1
111 Appendix
1
glxR _
glxR gcl gcl gcl pduCDE pduCDE
gcl PP_0411 pedE pedE pedE pedE pedH pedH pedH pedH pedI purpose purpose pSEVA424_ sequencing sequencing sequencing sequencing pEMG_Δ pJNN/pBNT pJNN pBNT pEMG_Δ pEMG_ΔPP_0411 pEMG_ΔPP_0411 pEMG_ΔPP_041 pSEVA234_ pEMG_ΔPP_0411 pEMG_ΔPP_0411 pEMG pEMG pEMG_Δ pEMG_Δ pEMG_Δ pEMG_Δ pEMG_Δ pEMG_Δ pEMG_Δ pEMG_Δ pEMG_Δ fw fw fw fw fw fw fw fw fw fw fw fw fw fw rev rev rev rev rev rev rev rev rev rev rev rev rev direction direction
KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 template template P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida pEMG pEMG P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida sequence sequence TTCCGCATGCTTATTTGTCGTCGCGGATCG TGTCGTCGATCAGTACCAGTAG ACCTGGCTGAAGCCGTTGAG ATGCGCTTTACCTCCGGCTC TGGCGCTCTTGATCCCAACG CTCTGAATTCGCCAGAACAGGCAATAGAG CAGCCATTCGGAGACAACTG GCGCTCGACTAACCCAGATG ACTATAGGGCGAATTGGAGC GCTCGGTACCCGGGGATCCTCTAGAGAATTCAGTACTGGTGGCC GAAGA GCAAGGATCCCCTAGGGGGGGTACTGAGAGAATG CAGTACCCCCCCTAGGGGATCCTTGCCTGTACCGGCCTCTTC TGCATGCCTGCAGGTCGACTCTAGAGTCGACCAGCGTCCCCGGG AACAG TTCCTCTAGAATAGGAGGTCACCAGCTATGGCTAAAATCGGTTTCA TC AGATTGAGCTGGTACGTGAG GCATAAGCGTCCATGAACAG AGGGTTTTCCCAGTCACGACGTT GAGCGGATAACAATTTCACACAGG TCTCGGTACCCGCTGGCCCTTAACATTCCC CCGCTCTAGAAATTTCCACCCGCTATTCAC TACATCTAGACACCTCAATTGGCCCTTCGC ATTCGTCGACTTGTACACCGCCACCTTGAG TCTCGAGCTCCTCACCGACAAGCCGGTAG TCTCGGATCCTCTTGGTCCCGACCCGATTG TCTCGGATCCCGGCCCTACTACCAAATGAC TCTCGTCGACTCTTGGCAATGCGCTTGCTG TCTCGGTACCACGTGCTCGACCGCACCAAC name name WJ44 WJ45 WJ46 WJ47 WJ48 WJ37.x MO15 MO16 MO48 WJ49 WJ50 WJ51 WJ52 WJ53 WJ54 WJ55 M13uni (-43) M13rev (-49) WJ56 WJ57 WJ58 WJ59 WJ60 WJ61 WJ62 WJ63 WJ64
112 Appendix
dcaAKIJP dcaAKIJP dcaAKIJP dcaAKIJP dcaAKIJP dcaAKIJP dcaAKIJP dcaAKIJP dcaAKIJP dcaAKIJP dcaAKIJP
glxR pedE pedI gclR gclR pedI pedI pedI gclR gclR gclR gclR MG_Δ MG_ΔPP_2046 purpose purpose pEMG_Δ pEMG_Δ pEMG_Δ sequencing sequencing pEMG_Δ pEMG_Δ pEMG_Δ pE pEMG_ΔPP_2046 pEMG_ΔPP_2046 pE pEMG_ΔPP_2046 sequencing sequencing PP_2046 sequencing PP_2046 sequencing pBNT_ sequencing pBNT_ sequencing pBNT_ sequencing pBNT_ sequencing pBNT_ sequencing pBNT_ sequencing pBNT_ sequencing pBNT_ sequencing pBNT_ sequencing pBNT_ sequencing pBNT_ sequencing pSEVA424_ fw fw fw fw fw fw fw fw fw fw fw fw fw fw fw fw fw fw fw fw rev rev rev rev rev rev rev rev rev rev direction direction
KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 template template KT2440 P. putida P. putida P. putida P. putida KT2440 P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida pBNTdcaAKIJP pBNTdcaAKIJP pBNTdcaAKIJP pBNTdcaAKIJP pBNTdcaAKIJP pBNTdcaAKIJP pBNTdcaAKIJP pBNTdcaAKIJP pBNTdcaAKIJP pBNTdcaAKIJP pBNTdcaAKIJP P. putida AGCTATGGCTAAAATCGGTTTC sequence sequence ATCGTCTAGATTTGGTAGTAGGGCCGCTTG ATCGTCTAGAGCCCGCTCCCACAGGTTCAC ATCGGTCGACGGCACCAAAGATGATTTCAG GGGCTTGCGCCTGTTCATTC GCTGTGTACAGGCAGTAGTC TCTCGAATTCCCGATAGCAGCACCGATCAG TCTCGGTACCATCGTTTGCCTGCGTGATCG TCTCGGTACCTCTCGAGGCACGAAGAGAAAG TCTCGTCGACCGATGATGCCTGCAGTCTTC TCTCGAATTCTCCGGCATCCACCTGGCCTC TCTCGGTACCAGCCATCAGGAAACGCGATAG TCTCGGTACCTACCTTCGGCCTGCTTAGGG TTCCTCTAGATCCAGGTCGATGCCCACCAC CTGCGTGCACCAGCGTTAAG TGGCGATCAGCAGGAAGCAC TGAGGCTGACAGTGGCATTG AGCGCATTATCGACCTGCAC GCTGGATAAAGGCCGTCTAC TGCGGGTCTTTGGTTCGATG TGGTTATGGCTGCTGCTTAC TGGTCCGATTATGGCCAAAG TGGCTGTGGCTTGTGCTACG GCAGATCATATGCAGCTCTC GGCAGCGTGACCCGTGTCGG CAATGAGCTGTTGCGTACCC TCAAGCACGCCTACCGCGAG GCACGGTCGCGATGAGGTCG TTCCTGCGCCGGTTGCATTC TTCCGGATCCATAGGAGGTCACC ATC name WJ65 WJ66 WJ67 WJ68 WJ69 WJ70 WJ71 WJ72 WJ73 WJ74 WJ75 WJ76 WJ77 WJ78 WJ79 WJ80 WJ81 WJ82 WJ83 WJ84 WJ85 WJ86 WJ87 WJ88 WJ89 WJ90 WJ91 WJ92 WJ43.2
113 Appendix
o o
o_ dcaA o_ dcaA
pedE
pcaR pcaR dcaIJ dcaIJ gclR gclR _ΔPP_2662::14d purpose purpose pBNT_PP_2046E pBNT_PP_2046E PP_2046 sequencing sequencing gclR Sequencing pJNN_ pJNN_ pBNT_ pBNT_ pEMG_ΔPP_2051 pEMG_ΔPP_2051 pEMG_ΔPP_2051 pEMG_ΔPP_2051 PP_2051 mapping PP_2051 mapping pBNT_ pBNT_ PP_2662 sequencing PP_2662 sequencing 2 PCR round prime arbitrary pEMG_ΔPP_2662 pEMG_ΔPP_2662 pEMG_ΔPP_2662 pEMG_ΔPP_2662 pEMG_ΔPP_2662::14d pEMG fw fw fw fw fw fw fw fw fw fw fw fw fw rev rev rev rev rev rev rev rev rev rev rev rev rev rev direction direction
KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 template template P. putida E6.1/2 B10.1 P. putida E6.1/2 B10.1 P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida dcaIJo pSeva234dcaao dcaIJo pSeva234dcaao P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida ACATTCGCGACTGTATAATAAGTT sequence sequence AGGTACCGAATTCCTCGAGTTAGGAGGTATTTCGTATGCCATATAT TTTCAGCATGAATATTTCGAACTTCGACCTGAACCTG GCCCGACGTCGCATGCTCCTTCTA GATCAGGCGGGGGGGAGCGT ACGCTCCTGCTTTCTTGTAG GAATAGCGGGTGGAAATTGG GCGCAATGTGTCATACAACG CGGTACCGAATTCCTCGAGTCTAGACCCGGGTAGGAGGTGAGCC CATGAACGAACAGCTGCAAC GCCCGACGTCGCATGCTCCTCTAGAGTCGACTCAACCCTTGACGG AAAC AGGTACCGAATTCCTCGAGTGAATTCAGGGGGTGTGCGATGAGTG ACGAAACCCTG GCCCGACGTCGCATGCTCCTCTGCAGTCAACCAAACAACTGGTG TTCCGAATTCTGCATGCCCTGGCCTATCCG TTCCAGGTACCCTTTCATGATGGCTGTTCC TTCCGGTACCCAAGGCCAGCCCATGGCGCTGAC TTCCTCTAGACAGCAGCGCCATGAGCCAGC GCTGCTGGCGGATAACCTTG GCACACGCAAATCTTCAACG AGGTACCGAATTCCTCGAGTAGGAGGTACCAGCTATGATC GCCCGACGTCGCATGCTCCTTTACGAGGTGACCTCCTTG GCAGCAACCGCACCGTTATG AGGCGTATGCCGCCAAAGTC TTCGCAGGCACTGGCTTC AGCTCGGTACCCGGGGATCCTCCCTGTTCGCACGAGGGCG CCTAGCGGCCCCGGCCGCTTTGGCGTGGGGTGGCGA TCGCCACCCCACGCCAAAGCGGCCGGGGCCGCTAGG TGCATGCCTGCAGGTCGACTTCGGCACCGGTTACCACCAGCTTTT CC CCTAGGTCAACTTATTATACAGTCGCGAATGTCGGATGTCAAGTAG ATTAATTAATTTGGCGTGGGGTGGCGA TTAATTAATCTACTTGACATCCG GACCTAGGGCGGCCGGGGCCGCTAGG name name WJ93 WJ94 WJ95 WJ96 WJ97 WJ98 WJ99 WJ100 WJ101 WJ102 WJ103 WJ104 WJ105 WJ106 WJ107 WJ108 WJ109 WJ110 WJ111 WJ112 WJ113 WJ114 WJ115 WJ116 WJ117 WJ118
114 Appendix
dcaAKIJP paaYX paaYX PP_2049 PP_2049 PP_2049 purpose purpose pEMG_ΔPP_2046::14g pEMG_ΔPP_2046::14g pEMG_ΔPP_2046::14g pEMG_ΔPP_2046::14g 1 PCR round prime arbitrary 2 PCR round prime arbitrary verification transposon verification transposon verification transposon verification transposon pEMG_Δ pEMG_Δ pEMG_ΔPP_2049 pEMG_ΔPP_2049 primer sequencing pBG pEMG_ΔPP_2047 pEMG_ΔPP_2047 FRT pBG14g FRT pBG14f FRT pBG14f mapping MCS pEMG mapping MCS pEMG fw fw fw fw fw fw fw fw fw fw fw rev rev rev rev rev rev rev rev rev rev rev rev direction direction
KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 template template P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida P. putida pBG P. putida P. putida A. baylyi P. putida P. putida pEMG pEMG sequence sequence AGCTCGGTACCCGGGGATCCTCCGGCATCCACCTGGCCTC CCTAGGTCGTGCAATTATACCTGGCCGCGAGAGCCTTGTCAATGG GCTTAATTAAAGCCATCAGGAAACGCGATAG TTAATTAAGCCCATTGACAAGGCTCTCGCGGCCAGGTATAATTGC ACGACCTAGGTACCTTCGGCCTGCTTAGGG TGCATGCCTGCAGGTCGACTTCCAGGTCGATGCCCACCAC CGCCGGCATTGTTGGTGAAG GAACGGGTTGATGCCTTTGG TCCATTCGCGGTGTAGATTC CGCGCAGATCTACAGTTGGG ACTGACTCCACGGTAGAAAC CGTCGCTTTCCCTGTGTATC GCTCGGTACCCGGGGATCCTGATCCGATCATCGTCCATC CCTCATAGATCGCACTCTCCTTGTTCGTG GGAGAGTGCGATCTATGAGGCAGCCTACTGATG TGCATGCCTGCAGGTCGACTTCCTGACCTGCGCCAATG GCTGCGTTCGGTCAAGGTTC GATCGAATTCCCAGATGTGCCGCAAGCCCAG GTATGGTACCTCCAGCCACAGCACCGACAG GGCCGAGCTCTTCATTTCGTATCAATCTCC GCGCGAATTCATGCCTTGCTATCGACTG TAATGGATCCTCAAGCCAACCCGCCAAAAC TTTGCACTGCCGGTAGAAC AATACGCAAACCGCCTCTC name name WJ119 WJ120 WJ121 WJ122 WJ123 WJ124 WJ125 WJ126 WJ127 WJ128 WJ129 WJ130 WJ131 WJ132 BW492 WJ134 WJ135 WJ136 WJ137 WJ138 BW13 BW14
115 Appendix reference reference Helinski und Figurski (1979) und Martínez-García (2011) Lorenzo Meg Walsh, (unpublished) und Martínez-García (2011) Lorenzo This work al.(2019) Li et Daun (2017) Daun (2017) Daun (2017) Daun (2017) This work al.(2019) Li et al.(2019) Li et This work (2017) Niehoff This work This work This work (2019) Plaster from from pcaK pcaK ion delivery vector vector delivery ion ion delivery vector vector delivery ion livery vector vector livery livery vector vector livery livery vector livery vector livery he synthetic promotor 14d, 14d, promotor synthetic he he synthetic promotor 14g, 14g, promotor he synthetic to Pm) to Pm) sceI deletion delivery vector vector delivery deletion deletion delivery vector vector delivery deletion deletion delivery vector vector delivery deletion deletion delivery vector vector delivery deletion deletion delivery vector vector delivery deletion , without tac RBS, with A2A3BA1 tac , without R pedE-I deletion delivery vector vector delivery deletion tac cl , pedH pedE g pedI , , and integration of the synthetic promotor 14g, replacing replacing 14g, promotor synthetic the of integration and , , gcl
R , cl -SceI sites sites -SceI gcl g pedE pedE-I pedH pedI paaF of PP_0411-13, PP_0411-13 delet PP_0411-13 of PP_0411-13, of t integration and of PP_2046 delet PP_2047-51 of PP_2047-51, of t integration and of PP_2662
+ , tra + -sceI (transcriptional fusion of I- fusion (transcriptional -sceI GO16 listed genotype and references. listed genotype with 14g delivery vector vector delivery 14g with , oriR6K, lacZ α wth two flanking I flanking α wth two lacZ , oriR6K, , oriRK2, xylS, Pm→I xylS, , oriRK2, r , oriV(RK2/ColE1), mob , oriV(RK2/ColE1), P constitutive with the vector , expression r r r genotype genotype Km Gm Km P. putida Kan of sequences flanking bearing pEMG of sequences flanking bearing pEMG of sequences flanking bearing pEMG of sequences flanking bearing pEMG of sequences flanking bearing pEMG of sequences flanking bearing pEMG sequences flanking bearing pEMG de deletion PP_2046 of PP_2046, sequences flanking bearing pEMG sequences flanking bearing pEMG sequences flanking bearing pEMG de deletion PP_2049 of PP_2049, sequences flanking bearing pEMG de deletion PP_2051 of PP_2051, sequences flanking bearing pEMG de deletion PP_2662 of PP_2662, sequences flanking bearing pEMG sequences flanking bearing pEMG vector delivery 14d with PP_2662 replacing of sequences flanking bearing pEMG paaF replacing PP_2046 with 14g delivery vector vector delivery 14g with PP_2046 replacing
pcaK
14g
Plasmids usedwork with in this
gcl gclR pedE pedH PP_0411-0413 PP_2046 PP_2046::14g PP_2047-51 PP_2049 PP_2051 PP_2662 PP_2662::14d pedE-I pedI Δ Δ Δ Δ Δ Δ Δ Δ Δ Δ Δ Δ Δ Δ paaF::
Table S 2 plasmid pRK2013 pSW-2 pBT´T A2A3BA1 and pEMG derivatives pEMG pEMG_ pEMG_ pEMG_ pEMG_ pEMG_ pEMG_ pEMG_ pEMG_ pEMG_ pEMG_ pEMG_ pEMG_ pEMG_ pEMG_ pEMG_
116 Appendix reference reference (2019) Plaster (2019) Plaster (2019) Plaster (2019) Plaster lab de Lorenzo Victor collection (2018) Bockwoldt (2018) Bockwoldt (2015) et al. Zobel This work This work This work Zobel et al. (2015) Zobel et al. (2015) (2019) Plaster Köbbing Sebastian (unpublished) al. et Silva-Rocha (2013) This work This work This work This work This work GO16 P. putida P. putida on delivery vector vector delivery on on delivery vector delivery on livery vector vector livery livery vector livery vector livery B10.1 B10.1 B10.2 KT2440 KT2440 KT2440 KT2440 KT2440 KT2440 codon optimized optimized codon and integration of the synthetic promotor 14g, 14g, promotor synthetic the of integration and -BCD-msfgfp-fusion -BCD-msfgfp-fusion -BCD-msfgfp-fusion -BCD-msfgfp-fusion -BCD-msfgfp-fusion P. putida P. putida P. putida P. paaY 14c 14d 14g P. putida P. putida A.baylyi codon optimized optimized codon codon optimized optimized codon and and KT2440 KT2440 from from from from paaF , the terephthalic acid degradation operon of operon degradation acid terephthalic the , A. baylyi A. baylyi dcaIJ paaYX P. putida - PP_2665 from from - PP_2665 from
from and r from from gcl agmR dcaIJ dcaA with two 14g delivery vector vector delivery 14g two with A2A3BA1pcaK paaY and P and
paaF , Ori(R6K), Tn7 and Tn7R extremes, P Tn7R extremes, and Tn7 , Ori(R6K), , Ori(R6K), Tn7 and Tn7R extremes, P , Ori(R6K), Tn7 and Tn7R extremes, P r r r , Gm , Gm , Gm oriV(pBBR1), lacIQPtrc, expression vector vector expression lacIQPtrc, oriV(pBBR1), r r r , replacing P replacing genotype genotype of sequences flanking bearing pEMG de deletion PP_2144 of PP_2144, sequences flanking bearing pEMG de deletion PP_2144 of PP_2144, sequences flanking bearing pEMG de deletion PP_2144 of PP_2144, sequences flanking bearing pEMG with Tet but equivalent pEMG deleti PP_2144 of PP_2144, sequences flanking pSEVA512S bearing deleti PP_4283 of PP_4283, sequences flanking pSEVA512S bearing Km from of PP_2046 intrgration Tn7 the for pBG14c from of PP_2046E intrgration Tn7 the for pBG14c from of PP_2046E intrgration Tn7 the for pBG14c Km Km of intrgration Tn7 the for pBG14g of integration For Tn7 Km with pSEVA234 plasmid dcaA with pSEVA234 plasmid with pSEVA234 plasmid with pSEVA234 plasmid with pSEVA234 plasmid
o
dcaA
o o_ o
::14g_ ::14g_
agmR dcaA dcaIJ dcaIJ gcl
paaF
paaYX
::14g paaY plasmid plasmid pEMG_ΔP pEMG_ΔPP_2144 pEMG_PP_2144E pEMG_∆PP_2144+ PP_2144E pSEVA512S pSEVA512S_ΔPP_2144 pSEVA512S_ΔPP_4283 deriviatives pBG14c and pBG14c pBG14c-KT2440_93/94 pBG14c-B10.1_93/94 pBG14c-B10.2_93/94 pBG14d pBG14g pBG14g- pTn7tphOperon vectors Expression deriviatives pSEVA234 and pSEVA234 pSEVA234_ pSEVA234_ pSEVA234_ pSEVA234_ pSEVA234_ ΔP
117 Appendix reference reference This work This work This work This work al. et Silva-Rocha (2013) This work (2005) et al. Wierckx This work This work This work (2019) Plaster (2019) Plaster (2019) Plaster et (2010) al. Verhoef This work This work This work This work Meg Walsh (unpublished) GO16 P. putida P. putida KT2440, E6.1 KT2440,
KT2440 KT2440
KT2440 KT2440 P. putida KT2440 KT2440 from A6.1 A6.1 from KT2440 KT2440 KT2440 KT2440 A. baylyi P. putida from E6.1 E6.1 from P. putida P. putida Klebsiella oxytoka Klebsiella KT2440 KT2440 gclR from from from from , the terephthalic acid degradation operon of operon degradation acid terephthalic the , PP_2046 from from PP_2046 P. putida dcaAKIJP
P. putida from glxR P. putida from from from from operon from from operon and and PP_2046 from from PP_2046 evolved dcaAKIJP gcl gcl glcB pduCDE glxR gcl from from plasmid with plasmid
A2A3BA1pcaK
trc gclR plasmid with plasmid with plasmid with plasmid
: nag promoter without RBS, salicylate-inducible RBS, salicylate-inducible without promoter nag : : nag promoter without RBS, salicylate-inducible RBS, salicylate-inducible without promoter : nag nagAa nagAa , P , oriRK2, lacIq-p , oriRK2, , P r r r genotype genotype with pSEVA234 plasmid with pSEVA234 plasmid with pSEVA234 plasmid with pSEVA234 plasmid Sm with pSEVA424 plasmid Gm B10.1 from of PP_2046 version evolved with plasmid pJNN with pJNN plasmid of version evolved with plasmid pJNN putida KT2440 P. from PP_2144 with plasmid pJNN A6.1 from of PP_2144 version evolved with plasmid pJNN A12.1 from of PP_2144 version evolved with plasmid pJNN Km pBNT_(MCS) pBNT_(MCS) evolved pBNT_(MCS) pBNT_(MCS) for vector Expression
cpi
glxR
_ o
gcl gcl glcB pduCDE glxR
dcaAKIJP dcaAKIJP gclR gclRE
plasmid pSEVA234_ pSEVA234_ pSEVA234_ pSEVA234_ derivate pSEVA424 and pSEVA424 pSEVA424_ pJNN and derivatives pJNN pJNN_PP_2046E pJNN_ pJNN_ pJNN_PP_2144 pJNN_PP_2144E_A6.1 pJNN_PP_2144E_A12.1 pBNT and derivatives pBNT pBNT_ pBNT_ pBNT_PP_2046 pBNT_PP_2046E pBT´T A2A3BA1pcaK
118 Appendix , [glycolate] [acetate] 0.6 40 sm] [sum )
30 [glyoxylate] , -1 0.4 glycol] [ethylene
20 M) (m
0.2 CDW (g L 10 , [oxalate],
0.0 0 , 0 5 10 15 20 25 tim e (h)
Figure S1 Growth of P. putida KT2440 in MSM medium containing 28.6 mM acetate and 29.8 mM ethylene glycol in duplicates. Compounds from ethylene glycol metabolism (ethylene glycol, glycolate, glyoxylate and oxalate) are shown individually and in sum. The culture was incubated at 30 °C and 200 rpm. Error bars indicate the deviation from the mean (n = 2) and according to error propagation.
1.5 KT2440
1.0 600 OD 0.5
0.0 0 50 100 150 tim e (h)
Figure S2 Growth of P. putida KT2440 in 50 mL (250 mL Erlenmeyer flask) of modified M9 medium (Wehrmann et al. 2017) containing 20 mM ethylene glycol. The culture was incubated at 30°C and 180 rpm and growth was determined by measuring OD600 in a photometer (Eppendorf Biophotometer). One exemplary culture is shown.
119 Appendix
AB
180 0.8
150 0.6 ) -1 120 0.4 90 CDW (g L Gvalue(a.u.) 0.2 60
30 0.0 0 5 10 15 20 25 010203040 tim e (h) tim e (h)
KT2440 E1.1 E1.2 E1.3 E6.1 E6.2
Figure S3 A: Growth comparison of P. putida KT2440 and all adapted strains in MSM containing 30 mM ethylene glycol (in light colors) and 120 mM ethylene glycol (in darker colors). Growth was detected via a Growth Profiler in 96-square-well plates. B: Biomass growth of the isolated ALE strains E1.1 and E6.1 growing on 30 mM ethylene glycol in a shake flask cultivation on MSM with 30 mM ethylene glycol. Error bars indicate the deviation from the mean (n = 2).
0.8 0.8 ims (g biomass )
-1 0.6 0.6
0.4 0.4 cdw L
0.2 0.2 -1 grow th rate (h )
0.0 0.0
.1 2 3 6.1 6.2 1 1. E E E E1. E
Figure S4 Comparison of growth rate and maximum biomass concentrations of P. putida KT2440 strains E6.1, E6.. E1.1, E1.2 and E1.3 from the two evolution lines grown in a shake flask cultivation on MSM with 26.7 ± 0.4 mM ethylene glycol. Growth rate shown in filled pattern, maximum biomass concentrations are depicted in checked pattern. Error bars indicate the deviation from the mean (n = 2).
120 Appendix
Table S3 List of all mutations found for all sequenced strains. Numbers of found Single Nucleotide Polymorphisms (SNP) and Insertion-Deletion polymorphisms (InDel) and their functional class, divided by the cause of mutation, are shown. KT[A] represents the P. putida KT2440 from Aachen. KT[S] describes P. putida KT2440 from Stuttgart.
reference vs: KT[A] vs: KT[S] vs:
KT[A] KT[S] E6.1 E6.2 E1.1 E1.2 E1.3 sum of all mutations 83 80 13 6 4 4 4 type of mutation SNP 55 54 13 5 4 3 3 InDel 28 26 0 1 0 1 1 functional class intergenic 46/28 43/26 2/0 2/1 1/0 1/1 1/1 (SNP/InDel) silent 7/0 8/0 8/0 2/0 2/0 1/0 2/0 missense 2/0 3/0 2/0 1/0 1/0 1/0 0/0 nonsense 0/0 0/0 1/0 0/0 0/0 0/0 0/0
Supporting information 1: GclR binding sites (BS) mutation in P. putida E6.2 glcGЋ GTTCATGGAAAGGTCCTCTTCTTGTTGTGAGAAGCCCTAAGGGCAGTTGAAAACCGATCGAAAAAATA
GAACACAACGAGCGATATTTTTGTATACAATATTTTGAAACGATCGTATGCGATGGCGCAAACCTCCT GclR BS1 TTTCACGGGCGCTCTGACGAAAGCCAGCTTAGCCGATGAAAACCCATTGACCTAAGCCGTCAGGCGTG A AATACACTCTGTCGCAAAGCAAGTTGTATACAATTACAAAATCGATGAGGCACAAACCATGAGCAAAA GclR BS2 Ѝgcl -35 Emergent promoter -10__
Supporting information 2: Bprom analysis of mutated sequence in P. putida E6.2: (http://www.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb)
>test sequence: TTGACCTAAGCCGTCAGGCGTGAATACACTCTGTCGCAAAGCAAGTTATATACAATTACAAAATCGATGAGGCAC AAACC Length of sequence- 80 Threshold for promoters - 0.20 Number of predicted promoters - 1 Promoter Pos: 61 LDF- 0.82 -10 box at pos. 48 ATATACAAT Score 54 -35 box at pos. 25 TACACT Score 4
Oligonucleotides from known TF binding sites:
For promoter at 61: lexA: TATATACA at position 47 Score - 13
121 Appendix
Supporting information 3: Regprecise (http://regprecise.lbl.gov/RegPrecise) analysis of gclR:
Profile of regulator PA1520 in Pseudomonadaceae
Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Xanthine utilization; Allantoin utilization
Effector:
Regulog: PA1520 - Pseudomonadaceae
Member of regulog collections x By taxonomy - Pseudomonadaceae x By TF family - GntR/Others x By pathway - Xanthine utilization x By pathway - Allantoin utilization
Table S4 List of GntR binding sites PP_xxxx name position score binding site location
PP_4297 gcl -35 4.7 TTGTATACAA Upstream of gcl cluster
PP_4297 gcl -175 4.7 TTGTATACAA Upstream of gcl cluster
PP_4309 PA0476 -427 4.8 TTGTACACAA Upstream of putative purine/allantoin permease and hydrantoin racemase
PP_4309 PA0476 -166 4.7 TTGTATACAA Upstream of putative purine/allantoin permease and hydrantoin racemase
PP_4643 PA2938 -181 4.3 TTGTACACAC Upstream of putative xanthine/uracil permease
PP_4643 PA2938 -78 4.7 TTGTATACAA Upstream of putative xanthine/uracil permease
PP_4284 PA1519 -146 4.8 TTGTACACAA Upstream of putative ureate permease
PP_4284 PA1519 -245 4.6 TTGTACACAG Upstream of putative ureate permease
122 Appendix
PP_xxxx name position score binding site location
PP_4283 PA1520 -45 4.6 CTGTGTACAA Upstream of glcR (Duplicate, reverse hit of PP_4284)
PP_4283 PA1520 -144 4.8 TTGTGTACAA Upstream of glcR (Duplicate, reverse hit of PP_4284)
PP_4296 PA1503 -232 4.7 TTGTATACAA Upstream of putative glcG (Duplicate, reverse hit of PP_4297)
PP_4296 PA1503 -92 4.7 TTGTATACAA Upstream of putative glcG (Duplicate, reverse hit of PP_4297)
PP_4286 PA1517 -86 4.7 TTGTATACAA Upstream of putative allantionase
PP_4286 PA1517 -291 4.8 TTGTACACAA Upstream of putative allantionase
PP_4285 PA1518 -323 4.7 TTGTATACAA Upstream of putative hydroxyisourate hydrolase (Duplicate, reverse hit of PP_4286)
PP_4285 PA1518 -118 4.8 TTGTGTACAA Upstream of putative hydroxyisourate hydrolase (Duplicate, reverse hit of PP_4286)
1.0
0.8
0.6 600
OD 0.4
0.2
0.0 0 50 100 150 200 tim e (h) ethylene glycol ethylene glycol xanthine + xanthine
Figure S5 Growth of P. putida KT2440 in 20 mL (125 mL Erlenmeyer flask) of M9 medium containing 20 mM ethylene glycol (black circles), 60 mg L-1 xanthine (green circles) or a mixture of 20 mM ethylene glycol and 60 mg L-1 xanthine (green circles with black fill). The cultures were incubated at 30 °C and 180 rpm.
123 Appendix
Supporting information 4: Locating Tn4652 using read coverage analysis
A) Location of PP_2662 and read coverage drop/gap in E6.1 and E6.2 indicated by blue arrow
B) Native location of Tn4652, showing twice approximately doubled read coverages in E6.1 and E6.2 in comparison to KT2440
Supporting information 5: Mapped transposon Tn4652 and the resulting putative promotor insertion
PP_2662Ћ GGTGGGTTACGGGGTGCAGGCAAAGATGGGCGGCTGATGCCGAGATAAGGCAAAAATTAG
Ћ 16.8kb Tn4652 Ѝ
CACCGATGCCATTGAACACATCCCCCAAGCGAGGCAAAAGCATCAGCATAGACGGCTAGC -35 -10 CAGACGGTGGATGACCAGCAAGCCACGGCCTCTCGAATAACCTTTTAAATCATATATTTA Ѝ PP_2662 CAGAACGAATGTCCTAATTTTTGCCTTATCTCGGCATGTCGCTGACCGGCTCGGGGTTCC
124 Appendix
Supporting information 6: Bprom analysis of 3´ transposon site of Tn4652
>test sequence CCCCCAAGCGAGGCAAAAGCATCAGCATAGACGGCTAGCCAGACGGTGGATGACCAGCAA GCCACGGCCTCTCGAATAACCTTTTAAATCATATATTTACAGAACGAATGTCCTAATTTT TGCCTTATCTCGGCAT Length of sequence- 136 Threshold for promoters - 0.20 Number of predicted promoters - 1 Promoter Pos: 104 LDF- 1.39 -10 box at pos. 89 TCATATATT Score 48 -35 box at pos. 72 TCGAAT Score 18
Oligonucleotides from known TF binding sites:
No such sites for promoter at 104
0.03 )
-1 0.02
0.01 KT2440 ' ped CDW (g L E6.1 ' ped E6.2 ' ped 0.00 0 204060 tim e (h)
Figure S6 Growth of P. putida KT2440 Δped (PP_2673-80), E6.1 Δped (PP_2673-80) and E6.2 Δped (PP_2673-80) in 50 mL (500 mL Erlenmeyer flask) of MSM medium containing 30 mM ethylene glycol in duplicates. The cultures were incubated at 30 °C and 200 rpm. Errors are shown by the error of the means (n = 2).
125 Appendix
Figure S7 Long-term phenotypic robustness of E1.1, E6.1 and KT2440 ΔgclR ΔPP_2046 ΔPP_2662::14d. 20 single colonies, picked after 134 (E1.1), 116 (E6.1) and 134 (KT2440 ΔgclR ΔPP_2046 ΔPP_2662::14d) generations of cultivation in LB medium, were cultivated in MSM containing 30 mM ethylene glycol (black bars, n = 1) and compared to their corresponding parental strain (grey bars, error bars indicate the standard deviation; n = 3). Growth was detected via OD600 measurement after 30 h of cultivation in System Duetz 24-square-well plates. All picked clones grow on ethylene glycol, indicating that >95 % of the population from the cultures in unselective medium have retained their degradative phenotype.
126 Appendix
Table S5 List Selection of found proteins. Protein concentrations and fold changes (fc) of wildtype P. putida KT2400 grown in MSM with glucose (glu) compared to cultivation with 1,4-butanediol (BDO) and the evolved strains B10 (the average of both strains) compared to wildtype P. putida KT2440 grown in MSM with 1,4- butanediol are shown. Wildtype on glucose vs B10a strains vs. PP_XXXX gene annotation BDO wildtype on BDO glu BDO fc glu BDO fc 4,12x 4,07x 98.8 2,36x 8,97x 2.0 PP_0056 choline dehydrogenase, BetA-I 1007 1009 1007 1008 1,31x 2,14x 162.9 3,82x 1,25x 0.6 PP_0057 major facilitator family transporter 1007 1009 1006 1009 two-component system sensor histidine n/d n/d n/a n/d n/d n/a PP_0409 kinase two-component system response 2,24x 6,08x 2.7 3,16x 5,79x 1.0 PP_0410 regulator, UhpA 1007 1007 1007 1007 polyamine ABC transporter ATP-binding 1,17x 5,37x 46.0 1,40x 4,90x 0.1 PP_0411 protein 1008 1009 1008 1008 polyamine ABC transporter substrate- 3,27x 1,13x 34.5 2,65x 1,06x 0.1 PP_0412 binding protein 1008 1010 1008 1009 2,53x 1,47x 58.2 9,68x 1,89x 0.0 PP_0413 polyamine ABC transporter permease 1007 1009 1006 1007 n/d 6,84x n/a n/d n/d n/a PP_0414 polyamine ABC transporter permease 1007 8,97x 5,72x 0.6 9,89x 7,34x 1.3 PP_0452 elongation factor, Tu-B 1010 1010 1010 1010 PP_2046 LysR familiy transcriptional regulator n/d n/d n/a n/d n/d n/a 4,46x 9,85x 22.1 2,68x 3,00x 3.0 PP_2047 3- hydroxyacyl- CoA dehydrogenase 1007 1008 1008 1009 1,70x 2,73x 16.1 1,26x 7,42x 2.7 PP_2048 acyl-CoA dehydrogenase 1008 1009 1009 1009 1,45x 7,57x 52.0 2,17x 1,83x 2.4 PP_2049 iron-containing alcohol dehydrogenase 1007 1008 1008 1009 PP_2050 hypothetical protein n/d n/d n/a n/d n/d n/a 9,22x 2,32x 25.2 8,17x 5,40x 2.3 PP_2051 acetyl-CoA acetyltransferase 1007 1009 1008 1009 7,11x 2,21x 3.1 4,89x 1,23x 0.6 PP_2673 pentapeptide repeat-containing protein 1009 1010 1009 1010 calcium-dependent quinoprotein ethanol 4,66x 1,35x 2.9 3,38x 8,11x 0.6 PP_2674 dehydrogenase, PedE 1010 1011 1010 1010 7,36x 1,87x 2.5 4,67x 8,81x 0.5 PP_2675 cytochrome c-type protein 1009 1010 1009 1009 6,14x 1,80x 2.9 4,08x 7,84x 0.4 PP_2676 substrate-binding protein 1008 1009 1008 1008 5,48x 1,51x 2.8 3,66x 6,42x 0.4 PP_2677 hypothetical protein 1008 1009 1008 1008 5,58x 1,47x 2.6 2,99x 6,05x 0.4 PP_2678 hydrolase 1008 1009 1008 1008 lanthanide-dependent quinoprotein 8,87x 7,97x 0.9 9,23x 1,12x 1.4 PP_2679 ethanol dehydrogenase, PedH 1009 1009 1009 1010 4,34x 8,90x 2.1 3,68x 6,55x 0.7 PP_2680 aldehyde dehydrogenase, PedI 1010 1010 1010 1010 PP_2681 coenzyme PQQ synthesis protein D n/d n/d n/a n/d n/d n/a n/d 4,67x n/a n/d 2,12x 0.5 PP_2682 Fe-containing alcohol dehydrogenase 1007 1007 two-component system sensor histidine 8,36x 4,96x 5.9 7,36x 2,31x 0.5 PP_2683 kinase/response regulator 1007 1008 1007 1008 a: average values of both evolved strains are shown. For individual values and deviations see supplement. glu= glucose; BDO = 1,4-butanediol; fc= fold changes; n/a= not available, n/d= not detected
127 Appendix
Supporting information 7 Promotor predictions for the intergentic region between paaF and paaY
paaF Å CATGTTCGGGCGCCTGCACATCGATATATCGCGGCATCTCGGGTTCCTCTGGCTGCACGC
ACGGCACATCGCTTGGCCGGCATTTTTTGGAATTGTTTGCAGGGACGTAATGCGGGATCA -10 ÆTn4256 -35 GGGGTCATGCCGAGATAAGGCAAAAATTAGGA CATTCGT -35 CGACCAGGTGTGGTCAGTATAꜜTGCTCTATGCGATACAACAATGCAAGGCGCAAAATGTTT
TCT … ~17kbp …TTTACAGAACGAATGTCCTAATTTTTGCCTTATCTCGGCATAACCCC -10 TCGCGTATCTCTTTTTTACTTTTCTATGATCACAGCTCCAGTGCAATGCTTGCTGAAGAA
TCGTTTAACCTTTGCATTTTCTAGTACTTACAGCGGGTTTTTGCCTTGCAGCATTAATTC
AACACAAGTGATACACGATTGACGACCAAACAGCATCTGATACAAGATCGACTGACATTC Æ paaY CAAATCATTTCGAGAGTGTTGCCATGCCTTGCTATCGACTGGACGGCCTGACGCCTGTGG
Predicted promotor binding sites via Bprom: yellow for paaF blue for paaY green for paaF inserted by transposon Tn4652
Transcriptional regulators: rpoD17 towards paaF rpoD17 towards paaY bold = paaF and paaY ꜜ = insertion of transposon Italic = inverted repeat right and left from transposon Tn4256
Supporting information 8 Bprom analysis of the intergenic region of paaF and paaY (5´- 3´) (http://www.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb)
> test sequence: intergenic region of paaF and paaY 5´- 3´ CTCGGGTTCCTCTGGCTGCACGCACGGCACATCGCTTGGCCGGCATTTTTTGGAATTGTTTGCAGGGACGTAATG CGGGATCACGACCAGGTGTGGTCAGTATATGCTCTATGCGATACAACAATGCAAGGCGCAAAATGTTTTCGCGTA TCTCTTTTTTACTTTTCTATGATCACAGCTCCAGTGCAATGCTTGCTGAAGAATCGTTTAACCTTTGCATTTTCT AGTACTTACAGCGGGTTTTTGCCTTGCAGCATTAATTCAACACAAGTGATACACGATTGACGACCAAACAGCATC TGATACAAGATCGACTGACATTCCAAATCATTTCGAGAGTGTTGCC Length of sequence- 346 Threshold for promoters - 0.20 Number of predicted promoters - 1 Promoter Pos: 181 LDF- 2.62 -10 box at pos. 165 TTCTATGAT Score 65 -35 box at pos. 141 TTTTCG Score 28
Oligonucleotides from known TF binding sites:
For promoter at 181: rpoD17: TTTTACTT at position 157 Score - 8
128 Appendix
Supporting information 9 Bprom analysis of the intergenic region of paaF and paaY (3´- 5´) (http://www.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb)
> test sequence: intergenic region of paaF and paaY 3´- 5´ GGCAACACTCTCGAAATGATTTGGAATGTCAGTCGATCTTGTATCAGATGCTGTTTGGTCGTCAATCGTGTATCACTTGTGT TGAATTAATGCTGCAAGGCAAAAACCCGCTGTAAGTACTAGAAAATGCAAAGGTTAAACGATTCTTCAGCAAGCATTGCACT GGAGCTGTGATCATAGAAAAGTAAAAAAGAGATACGCGAAAACATTTTGCGCCTTGCATTGTTGTATCGCATAGAGCATATA CTGACCACACCTGGTCGTGATCCCGCATTACGTCCCTGCAAACAATTCCAAAAAATGCCGGCCAAGCGATGTGCCGTGCGTG CAGCCAGAGGAACCCGAG Length of sequence- 346 Threshold for promoters - 0.20 Number of predicted promoters - 1 Promoter Pos: 255 LDF- 1.66 -10 box at pos. 240 GCATATACT Score 55 -35 box at pos. 218 TTGCAT Score 50
Oligonucleotides from known TF binding sites:
No such sites for promoter at 255
129
References
References
References
Abdel-Mawgoud, Ahmad Mohammad; Lépine, François; Déziel, Eric (2010): Rhamnolipids: diversity of
structures, microbial origins and roles. In: Appl Microbiol Biotechnol 86 (5), S. 1323–1336.
Ahn, Sungeun; Jung, Jaejoon; Jang, In-Ae; Madsen, Eugene L.; Park, Woojun (2016): Role of glyoxylate
shunt in oxidative stress response. In: J Bio Chem 291 (22), S. 11928–11938.
Andrady, Anthony L.; Neal, Mike A. (2009): Applications and societal benefits of plastics. In: Philos
Trans R Soc Lond B Biol Sci 364 (1526), S. 1977–1984.
Arias, Sagrario; Olivera, Elías R.; Arcos, Mario; Naharro, Germán; Luengo, José M. (2008): Genetic
analyses and molecular characterization of the pathways involved in the conversion of 2-
phenylethylamine and 2-phenylethanol into phenylacetic acid in Pseudomonas putida U. In:
Environ Microbiol 10 (2), S. 413–432.
Astrup, Thomas; Møller, Jacob; Fruergaard, Thilde (2009): Incineration and co-combustion of waste:
accounting of greenhouse gases and global warming contributions. In: Waste Manag Res 27 (8), S.
789–799.
Austin, Harry P.; Allen, Mark D.; Donohoe, Bryon S.; Rorrer, Nicholas A.; Kearns, Fiona L.; Silveira,
Rodrigo L. et al. (2018): Characterization and engineering of a plastic-degrading aromatic
polyesterase. In: Proc Natl Acad Sci USA 115 (19), E4350-E4357.
Bagdasarian, M.; Lurz, R.; Ruckert, B.; Franklin, F. C.; Bagdasarian, M. M.; Frey, J.; Timmis, K. N.
(1981): Specific-purpose plasmid cloning vectors. II. Broad host range, high copy number,
RSF1010-derived vectors, and a host-vector system for gene cloning in Pseudomonas. In: Gene 16
(1-3), S. 237–247.
Balasubramanian, Deepak; Schneper, Lisa; Kumari, Hansi; Mathee, Kalai (2013): A dynamic and
intricate regulatory network determines Pseudomonas aeruginosa virulence. In: Nucleic Acids Res
41 (1), S. 1–20.
133 References
Bandounas, Luaine; Ballerstedt, Hendrik; Winde, Johannes H. de; Ruijssenaars, Harald J. (2011):
Redundancy in putrescine catabolism in solvent tolerant Pseudomonas putida S12. In: J Biotechnol
154 (1), S. 1–10.
Barbe, Valérie; Vallenet, David; Fonknechten, Nuria; Kreimeyer, Annett; Oztas, Sophie; Labarre,
Laurent et al. (2004): Unique features revealed by the genome sequence of Acinetobacter sp.
ADP1, a versatile and naturally transformation competent bacterium. In: Nucleic Acids Res 32 (19),
S. 5766–5779.
Barth, Markus; Oeser, Thorsten; Wei, Ren; Then, Johannes; Schmidt, Juliane; Zimmermann, Wolfgang
(2015): Effect of hydrolysis products on the enzymatic degradation of polyethylene terephthalate
nanoparticles by a polyester hydrolase from Thermobifida fusca. In: Biochem Eng J 93, S. 222–228.
Beaman, Joe; Bergeron, Christine; Benson, Robert; Cook, Anna-Marie; Gallagher, Kathryn; Hoff, Dale;
Laessing, Susan (2016): A Summary of Literature on the Chemical Toxicity of Plastics Pollution to
Aquatic Life and Aquatic-Dependent Wildlife. In: US EPA, OW, Office of Science and Technology
(EPA-822-R- 16-009).
Belda, Eugeni; van Heck, Ruben G. A.; José Lopez-Sanchez, Maria; Cruveiller, Stéphane; Barbe,
Valérie; Fraser, Claire et al. (2016): The revisited genome of Pseudomonas putida KT2440
enlightens its value as a robust metabolic chassis. In: Environ Microbiol 18 (10), S. 3403–3424.
DOI: 10.1111/1462-2920.13230.
Bergmann, Melanie; Gutow, Lars; Klages, Michael (Hg.) (2015): Marine Anthropogenic Litter. Cham:
Springer.
Bishop, R. E. (2000): The bacterial lipocalins. In: Biochim Biophys Acta 1482 (1-2), S. 73–83. DOI:
10.1016/s0167-4838(00)00138-2.
Black, Brenna A.; Michener, William E.; Ramirez, Kelsey J.; Biddy, Mary J.; Knott, Brandon C.; Jarvis,
Mark W. et al. (2016): Aqueous stream characterization from biomass fast pyrolysis and catalytic
fast pyrolysis. In: ACS Sustain Chem Eng 4 (12), S. 6815–6827. DOI:
10.1021/acssuschemeng.6b01766.
134 References
Blank, Lars M.; Ebert, Birgitta E.; Bühler, Bruno; Schmid, Andreas (2008a): Metabolic capacity
estimation of Escherichia coli as a platform for redox biocatalysis. Constraint-based modeling and
experimental verification. In: Biotechnol Bioeng 100 (6), S. 1050–1065. DOI: 10.1002/bit.21837.
Blank, Lars M.; Ionidis, Georgios; Ebert, Birgitta E.; Bühler, Bruno; Schmid, Andreas (2008b):
Metabolic response of Pseudomonas putida during redox biocatalysis in the presence of a second
octanol phase. In: FEBS J 275 (20), S. 5173–5190. DOI: 10.1111/j.1742-4658.2008.06648.x.
Bockwoldt, J. A. (2018): Reverse Engineering Pseudomonas putida to Enable Plastic Monomer
Degradation. (Master thesis). In: Institute for Applied Microbiology, Aachen.
Boisart, Cédric; Maille, Emmanuel; Guillamont, Frédérique (2016): A method for degrading a plastic.
Anmeldenr: US 2016/0280881 A1.
Bolognesi, C.; Baur, X.; Marczynski, B.; Norppa, H.; Sepai, O.; Sabbioni, G. (2001): Carcinogenic risk of
toluene diisocyanate and 4,4'-methylenediphenyl diisocyanate: epidemiological and experimental
evidence. In: Crit Rev Toxicol 31 (6), S. 737–772. DOI: 10.1080/20014091111974.
Bombelli, Paolo; Howe, Christopher J.; Bertocchini, Federica (2017): Polyethylene bio-degradation by
caterpillars of the wax moth Galleria mellonella. In: Curr Biol 27 (8), R292-R293. DOI:
10.1016/j.cub.2017.02.060.
Borrero-de Acuña, José Manuel; Bielecka, Agata; Häussler, Susanne; Schobert, Max; Jahn, Martina;
Wittmann, Christoph et al. (2014): Production of medium chain length polyhydroxyalkanoate in
metabolic flux optimized Pseudomonas putida. In: Microb Cell Fact 13, S. 88. DOI: 10.1186/1475-
2859-13-88.
Brandon, Anja Malawi; Criddle, Craig S. (2019): Can biotechnology turn the tide on plastics? In: Curr
Opin Biotechnol 57, S. 160–166. DOI: 10.1016/j.copbio.2019.03.020.
Burgard, Anthony; Burk, Mark J.; Osterhout, Robin; van Dien, Stephen; Yim, Harry (2016):
Development of a commercial scale process for production of 1,4-butanediol from sugar. In: Curr
Opin Biotechnol 42, S. 118–125. DOI: 10.1016/j.copbio.2016.04.016.
135 References
Burger, M.; Woods, R. G.; McCarthy, C.; Beacham, I. R. (2000): Temperature regulation of protease in
Pseudomonas fluorescens LS107d2 by an ECF sigma factor and a transmembrane activator. In:
Microbiology 146 Pt 12, S. 3149–3155. DOI: 10.1099/00221287-146-12-3149.
Cai, Zhongyu; Wan, Yong; Becker, Matthew L.; Long, Yun-Ze; Dean, David (2019): Poly(propylene
fumarate)-based materials: Synthesis, functionalization, properties, device fabrication and
biomedical applications. In: Biomaterials 208, S. 45–71. DOI: 10.1016/j.biomaterials.2019.03.038.
Carta, Daniela; Cao, Giacomo; D'Angeli, Claudio (2003): Chemical recycling of poly(ethylene
terephthalate) (PET) by hydrolysis and glycolysis. In: Environ Sci Pollut Res Int 10 (6), S. 390–394.
Cartwright, L. N.; Hullin, R. P. (1966): Purification and properties of two glyoxylate reductases from a
species of Pseudomonas. In: Biochem J 101 (3), S. 781–791. DOI: 10.1042/bj1010781.
Cheong, Seokjung; Clomburg, James M.; Gonzalez, Ramon (2016): Energy- and carbon-efficient
synthesis of functionalized small molecules in bacteria using non-decarboxylative Claisen
condensation reactions. In: Nature biotechnol 34 (5), S. 556–561. DOI: 10.1038/nbt.3505.
Cho, Changhee; Choi, So Young; Luo, Zi Wei; Lee, Sang Yup (2015): Recent advances in microbial
production of fuels and chemicals using tools and strategies of systems metabolic engineering. In:
Biotechnol Adv 33 (7), S. 1455–1466. DOI: 10.1016/j.biotechadv.2014.11.006.
Choi, Kyoung-Hee; Kumar, Ayush; Schweizer, Herbert P. (2006): A 10-min method for preparation of
highly electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer
between chromosomes and plasmid transformation. In: J Microbiol Methods 64 (3), S. 391–397.
DOI: 10.1016/j.mimet.2005.06.001.
Choi, Kyoung-Hee; Schweizer, Herbert P. (2006): mini-Tn7 insertion in bacteria with single attTn7
sites: example Pseudomonas aeruginosa. In: Nat Protoc 1 (1), S. 153–161. DOI:
10.1038/nprot.2006.24.
CIEC promoting Science at the University of York (2017): Polyuethethanes. University of York. Online
verfügbar unter http://www.essentialchemicalindustry.org/polymers/polyurethane.html, zuletzt
aktualisiert am 24.04.2017.
136 References
Cox, Jürgen; Mann, Matthias (2008): MaxQuant enables high peptide identification rates,
individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. In: Nature
biotechnol 26 (12), S. 1367–1372. DOI: 10.1038/nbt.1511.
Cox, Jürgen; Neuhauser, Nadin; Michalski, Annette; Scheltema, Richard A.; Olsen, Jesper V.; Mann,
Matthias (2011): Andromeda: a peptide search engine integrated into the MaxQuant
environment. In: J Proteome Res 10 (4), S. 1794–1805. DOI: 10.1021/Pr101065j.
Cregut, Mickael; Bedas, M.; Durand, M-J; Thouand, G. (2013): New insights into polyurethane
biodegradation and realistic prospects for the development of a sustainable waste recycling
process. In: Biotechnol Adv 31 (8), S. 1634–1647. DOI: 10.1016/j.biotechadv.2013.08.011.
Cuenca, María del Sol; Roca, Amalia; Molina-Santiago, Carlos; Duque, Estrella; Armengaud, Jean;
Gómez-Garcia, María R.; Ramos, Juan L. (2016): Understanding butanol tolerance and assimilation
in Pseudomonas putida BIRD-1: an integrated omics approach. In: Microb Biotechnol 9 (1), S. 100–
115. DOI: 10.1111/1751-7915.12328.
Cusa, Eva; Obradors, Nuria; Baldomà, Laura; Badia, Josafa; Aguilar, Juan (1999): Genetic analysis of a
chromosomal region containing genes required for assimilation of allantoin nitrogen and linked
glyoxylate metabolism in Escherichia coli. In: J Bacteriol 181 (24), 7479-7484.
Cuthbertson, Leslie; Nodwell, Justin R. (2013): The TetR family of regulators. In: Microbiol Mol Biol
Rev 77 (3), S. 440–475. DOI: 10.1128/MMBR.00018-13.
Czernik, S.; Bridgwater, A. V. (2004): Overview of applications of biomass fast pyrolysis oil. In: Energ
Fuel 18 (2), S. 590–598. DOI: 10.1021/ef034067u.
Daun, T. (2017): Untersuchung von Alkoholdehydrogenasen im 1,4- Butandiol und
Ethylenglykolmetabolismus durch Deletionen im Genbreich pedE-I von Pseudomonas putida
KT2440. (Bachelor thesis). In: Institute for Applied Microbiology, Aachen.
DePristo, Mark A.; Banks, Eric; Poplin, Ryan; Garimella, Kiran V.; Maguire, Jared R.; Hartl, Christopher
et al. (2011): A framework for variation discovery and genotyping using next-generation DNA
sequencing data. In: Nat Genet 43 (5), S. 491–498. DOI: 10.1038/ng.806.
137 References
Deutscher, Josef (2008): The mechanisms of carbon catabolite repression in bacteria. In: Curr Opin
Microbiol 11 (2), S. 87–93. DOI: 10.1016/j.mib.2008.02.007.
Dobson, S. (2000): Ethylene glycol: environmental aspects. Concise international chemical
assessment document 22. In: WHO, S. 1–24.
Donald, Lynda J.; Hosefield, David; Cuvelier, Susan L.; Ens, Werner; Standing, Kenneth G.; Duckworth,
Harry W. (2001): Mass spectrometric study of Escherichia coli repressor proteins, IclR and GclR,
and their complexes with DNA. In: Protein Sci (10), S. 1370–1380.
Dower, W. J.; Miller, J. F.; Ragsdale, C. W. (1988): High efficiency transformation of E. coli by high
voltage electroporation. In: Nucleic Acids Res 16 (13), S. 6127–6145.
Dragosits, Martin; Mattanovich, Diethard (2013): Adaptive laboratory evolution -- principles and
applications for biotechnology. In: Microb Cell Fact 12, S. 64. DOI: 10.1186/1475-2859-12-64.
Elena, Claudia; Ravasi, Pablo; Castelli, María E.; Peirú, Salvador; Menzella, Hugo G. (2014): Expression
of codon optimized genes in microbial systems: current industrial applications and perspectives.
In: Front Microbiol 5, S. 21. DOI: 10.3389/fmicb.2014.00021.
European Bioplastics (January 2016): Fact Sheet - What are bioplastics? Berlin. Online verfügbar
unter https://www.european-bioplastics.org/bioplastics/.
Faleye, A. C.; Adegoke, A. A.; Ramluckan, K.; Bux, F.; Stenström, T. A. (2017): Identification of
antibiotics in wastewater: current state of extraction protocol and future perspectives. In: J Water
Health 15 (6), S. 982–1003. DOI: 10.2166/wh.2017.097.
Federal Register (1982): Certified Host-Vector Systems 47, S. 17197.
Feng, Xueyang; Zhuang, Wei-Qin; Colletti, Peter; Tang, Yinjie J. (2012): Metabolic pathway
determination and flux analysis in nonmodel microorganisms through 13C-isotope labeling. In:
Methods Mol Biol 881, S. 309–330. DOI: 10.1007/978-1-61779-827-6_11.
Fernández, Cristina; Díaz, Eduardo; García, José Luis (2014): Insights on the regulation of the
phenylacetate degradation pathway from Escherichia coli. In: Environ Microbiol rep 6 (3), S. 239–
250. DOI: 10.1111/1758-2229.12117.
138 References
Ferrández, A.; García, J. L.; Díaz, E. (2000): Transcriptional regulation of the divergent paa catabolic
operons for phenylacetic acid degradation in Escherichia coli. In: J Biol Chem 275 (16), S. 12214–
12222. DOI: 10.1074/jbc.275.16.12214.
Ferreira, Filipe V.; Cividanes, Luciana S.; Gouveia, Rubia F.; Lona, Liliane M.F. (2019): An overview on
properties and applications of poly(butylene adipate- co -terephthalate)-PBAT based composites.
In: Polym Eng Sci 59 (s2), E7-E15. DOI: 10.1002/pen.24770.
Figurski, D. H.; Helinski, D. R. (1979): Replication of an origin-containing derivative of plasmid RK2
dependent on a plasmid function provided in trans. In: Pro Natl Acad Sci USA 76 (4), S. 1648–1652.
DOI: 10.1073/pnas.76.4.1648.
Filloux, Alain; Ramos, Juan-Luis (2014): Pseudomonas Methods and Protocols. New York, NY: Springer
New York (1149).
Flower, Darren R.; North, Anthony C.T.; Sansom, Clare E. (2000): The lipocalin protein family:
structural and sequence overview. In: Biochim Biophys Acta 1482 (1-2), S. 9–24. DOI:
10.1016/S0167-4838(00)00148-5.
Fonseca, Pilar; La Peña, Fernando de; Prieto, María Auxiliadora (2014): A role for the regulator PsrA
in the polyhydroxyalkanoate metabolism of Pseudomonas putida KT2440. In: Int J Biol Macromol
71, S. 14–20. DOI: 10.1016/j.ijbiomac.2014.04.014.
Franden, Mary Ann; Jayakody, Lahiru N.; Li, Wing-Jin; Wagner, Neil J.; Cleveland, Nicholas S.;
Michener, William E. et al. (2018): Engineering Pseudomonas putida KT2440 for efficient ethylene
glycol utilization. In: Metab Eng 48, S. 197–207. DOI: 10.1016/j.ymben.2018.06.003.
Funnell, B.; Phillips, G. (Hg.) (2004): The Biology of Plasmids. Chapter 2: Participating Elements in the
Replication of Iteron-Containing Plasmids.
Gaona-López, Carlos; Julián-Sánchez, Adriana; Riveros-Rosas, Héctor (2016): Diversity and
Evolutionary Analysis of Iron-Containing (Type-III) Alcohol Dehydrogenases in Eukaryotes. In: PloS
one 11 (11), e0166851. DOI: 10.1371/journal.pone.0166851.
139 References
Garcia, Jeannette M.; Robertson, Megan L. (2017): The future of plastics recycling. Chemical
advances are increasing the proportion of polymer waste that can be recycled. In: Science 358
(6365), S. 870–872. DOI: 10.1126/science.aao6711.
Geyer, Roland; Jambeck, Jenna R.; Law, Kara Lavender (2017): Production, use, and fate of all plastics
ever made. In: Sci Adv 3 (7), e1700782 1-5. DOI: 10.1126/sciadv.1700782.
Gibson, Daniel G.; Young, Lei; Chuang, Ray-Yuan; Venter, J. Craig; Hutchison, Clyde A.; Smith,
Hamilton O. (2009): Enzymatic assembly of DNA molecules up to several hundred kilobases. In:
Nat Methods 6 (5), S. 343–345. DOI: 10.1038/nmeth.1318.
Göhler, Anna-Katharina; Kökpinar, Öznur; Schmidt-Heck, Wolfgang; Geffers, Robert; Guthke,
Reinhard; Rinas, Ursula et al. (2011): More than just a metabolic regulator--elucidation and
validation of new targets of PdhR in Escherichia coli. In: BMC Syst Biol 5, S. 197. DOI:
10.1186/1752-0509-5-197.
Görke, Boris; Stülke, Jörg (2008): Carbon catabolite repression in bacteria: many ways to make the
most out of nutrients. In: Nat Rev Microbiol 6 (8), S. 613–624. DOI: 10.1038/nrmicro1932.
Grand View Research (2017): 1,4- butanediol (BDO) Market Report 1,4- butanediol (BDO) Market
Analysis By Application (Tetrahydrofuran (THF), Polybutylene Terephthalate (PBT), Gamma-
Butyrolactone (GBL), Polyurethane (PU)), By Region (North America, Europe, Asia Pacific, CSA,
MEA), And Segment Forecasts, 2018 - 2025. In: Grand View Research.
Grunwald, Peter (2014): Industrial Biocatalysis: Pan Stanford.
Guzik, Maciej W.; Kenny, Shane T.; Duane, Gearoid F.; Casey, Eoin; Woods, Trevor; Babu, Ramesh P.
et al. (2014): Conversion of post consumer polyethylene to the biodegradable polymer
polyhydroxyalkanoate. In: Appl Microbiol Biot 98 (9), S. 4223–4232. DOI: 10.1007/s00253-013-
5489-2.
Han, Xu; Liu, Weidong; Huang, Jian-Wen; Ma, Jiantao; Zheng, Yingying; Ko, Tzu-Ping et al. (2017):
Structural insight into catalytic mechanism of PET hydrolase. In: Nat Commun 8 (1), S. 2106. DOI:
10.1038/s41467-017-02255-z.
140 References
Hanahan, Douglas (1983): Studies on transformation of Escherichia coli with plasmids. In: J Mol Biol
166 (4), S. 557–580. DOI: 10.1016/S0022-2836(83)80284-8.
Hartmans S.; Smiths, J. P.; van der Werf, M. J.; Volkering, F.; Bont, J.A.M. de (1989): Metabolism of
styrene oxide and 2-phenylethanol in the styrene-degrading Xanthobacter strain 124X. In: Appl
Environ Microb 55 (11), S. 2850–2855.
Hasegawa, Akiko; Ogasawara, Hiroshi; Kori, Ayako; Teramoto, Jun; Ishihama, Akira (2008): The
transcription regulator AllR senses both allantoin and glyoxylate and controls a set of genes for
degradation and reutilization of purines. In: Microbiology 154, S. 3366–3378. DOI:
10.1099/mic.0.2008/020016-0.
Hazen, Terry C. (2018): Cometabolic Bioremediation. In: Robert Steffan (Hg.): Consequences of
Microbial Interactions with Hydrocarbons, Oils, and Lipids: Biodegradation and Bioremediation,
Bd. 63. Cham: Springer International Publishing, S. 1–15.
Hestin, Mathieu; Mitsios, Andreas; Said, Sarah Ait; Fouret, Felix; Berwald, Anton; Senlis, Victoire
(2018): Blueprint for plastics packaging waste: Quality sorting & recycling. In: Deloitte.
Hiu, S. F.; Zhu, C. X.; Yan, R. T.; Chen, J. S. (1987): Butanol-Ethanol Dehydrogenase and Butanol-
Ethanol-Isopropanol Dehydrogenase: Different Alcohol Dehydrogenases in Two Strains of
Clostridium beijerinckii (Clostridium butylicum). In: Appl Environ Microb 53 (4), S. 697–703.
Hosler D.; Burkett S.L.; Tarkanian M.J. (1999): Prehistoric polymers: rubber processing in ancient
mesoamerica. In: Sciences 284 (5422), 1988–1991.
Huang, Da Wei; Sherman, Brad T.; Lempicki, Richard A. (2009a): Bioinformatics enrichment tools:
paths toward the comprehensive functional analysis of large gene lists. In: Nucleic Acids Res 37
(1), S. 1–13. DOI: 10.1093/nar/gkn923.
Huang, Da Wei; Sherman, Brad T.; Lempicki, Richard A. (2009b): Systematic and integrative analysis
of large gene lists using DAVID bioinformatics resources. In: Nat Protoc 4 (1), S. 44–57. DOI:
10.1038/nprot.2008.211.
Huerta-Cepas, Jaime; Szklarczyk, Damian; Forslund, Kristoffer; Cook, Helen; Heller, Davide; Walter,
Mathias C. et al. (2016): eggNOG 4.5: a hierarchical orthology framework with improved
141 References
functional annotations for eukaryotic, prokaryotic and viral sequences. In: Nucleic Acids Res 44
(D1), D286-93. DOI: 10.1093/nar/gkv1248.
Huijberts, G. N.; Eggink, G.; Waard, P. de; Huisman, G. W.; Witholt, B. (1992): Pseudomonas putida
KT2442 cultivated on glucose accumulates poly(3-hydroxyalkanoates) consisting of saturated and
unsaturated monomers. In: Appl Environ Microb 58 (2), S. 536–544.
Hung, Chia-Suei; Zingarelli, Sandra; Nadeau, Lloyd J.; Biffinger, Justin C.; Drake, Carrie A.; Crouch,
Audra L. et al. (2016): Carbon Catabolite Repression and Impranil Polyurethane Degradation in
Pseudomonas protegens Strain Pf-5. In: Appl Environ Microb 82 (20), S. 6080–6090. DOI:
10.1128/AEM.01448-16.
Ilves, H.; Horak, R.; Kivisaar, M. (2001): Involvement of sigmaS in starvation-induced transposition of
Pseudomonas putida transposon Tn4652. In: J Bacteriol 183 (18), S. 5445–5448. DOI:
10.1128/JB.183.18.5445-5448.2001.
Jambeck, Jenna R.; Geyer, Roland; Wilcox, Chris; Siegler, Theodore R.; Law, Kara Lavender (2015):
Plastic waste inputs from land into the ocean. In: Science 347 (6223), S. 764–768. DOI:
10.1126/science.1260879.
Jayakody, Lahiru N.; Ferdouse, Jannatul; Hayashi, Nobuyuki; Kitagaki, Hiroshi (2017): Identification
and detoxification of glycolaldehyde, an unattended bioethanol fermentation inhibitor. In: Crit
Rev Biotechnol 37 (2), S. 177–189. DOI: 10.3109/07388551.2015.1128877.
Jayakody, Lahiru N.; Johnson, Christopher W.; Whitham, Jason M.; Giannone, Richard J.; Black,
Brenna A.; Cleveland, Nicholas S. et al. (2018): Thermochemical wastewater valorization via
enhanced microbial toxicity tolerance. In: Energy Environ Sci 311, S. 484. DOI:
10.1039/C8EE00460A.
Johnson, Christopher W.; Abraham, Paul E.; Linger, Jeffrey G.; Khanna, Payal; Hettich, Robert L.;
Beckham, Gregg T. (2017): Eliminating a global regulator of carbon catabolite repression enhances
the conversion of aromatic lignin monomers to muconate in Pseudomonas putida KT2440. In:
Metab Eng Commun 5, S. 19–25. DOI: 10.1016/j.meteno.2017.05.002.
142 References
Kagi, J. H.; Vallee B. H. (1960): The role of zinc in alcohol dehydrogenase. V. The effect of metal-
binding agents on the structure of the yeast alcohol dehydrogenase molecule. In: J Biol Chem 235,
S. 3188–3192.
Kampers, Linde F. C.; Volkers, Rita J. M.; Martins Dos Santos, Vitor A. P. (2019): Pseudomonas putida
KT2440 is HV1 certified, not GRAS. In: Microbial biotechnology. DOI: 10.1111/1751-7915.13443.
Kang, Yun; Nguyen, David T.; Son, Mike S.; Hoang, Tung T. (2008): The Pseudomonas aeruginosa PsrA
responds to long-chain fatty acid signals to regulate the fadBA5 β-oxidation operon. In:
Microbiology 154 (Pt 6), S. 1584–1598. DOI: 10.1099/mic.0.2008/018135-0.
Karan, Hakan; Funk, Christiane; Grabert, Martin; Oey, Melanie; Hankamer, Ben (2019): Green
Bioplastics as Part of a Circular Bioeconomy. In: Trends Plant Sci 24 (3), S. 237–249. DOI:
10.1016/j.tplants.2018.11.010.
Kawai, Fusako; Kawabata, Takeshi; Oda, Masayuki (2019): Current knowledge on enzymatic PET
degradation and its possible application to waste stream management and other fields. In: Appl
Microbiol Biot 103 (11), S. 4253–4268. DOI: 10.1007/s00253-019-09717-y.
Kenny, Shane T.; Runic, Jasmina Nikodinovic; Kaminsky, Walter; Woods, Trevor; Babu, Ramesh P.;
Keely, Chris M. et al. (2008): Up-Cycling of PET (Polyethylene Terephthalate) to the biodegradable
plastic PHA (Polyhydroxyalkanoate). In: Environ Sci Technol 42 (20), S. 7696–7701. DOI:
10.1021/es801010e.
Kenny, Shane T.; Runic, Jasmina Nikodinovic; Kaminsky, Walter; Woods, Trevor; Babu, Ramesh P.;
O'Connor, Kevin E. (2012): Development of a bioprocess to convert PET derived terephthalic acid
and biodiesel derived glycerol to medium chain length polyhydroxyalkanoate. In: Appl Microbiol
Biot 95 (3), S. 623–633. DOI: 10.1007/s00253-012-4058-4.
Klumpp, Stefan; Zhang, Zhongge; Hwa, Terence (2009): Growth rate-dependent global effects on
gene expression in bacteria. In: Cell 139 (7), S. 1366–1375. DOI: 10.1016/j.cell.2009.12.001.
Koopman, Frank; Wierckx, Nick; Winde, Johannes H. de; Ruijssenaars, Harald J. (2010): Identification
and characterization of the furfural and 5-(hydroxymethyl)furfural degradation pathways of
143 References
Cupriavidus basilensis HMF14. In: Proc Natl Acad Sci USA 107 (11), S. 4919–4924. DOI:
10.1073/pnas.0913039107.
Kruyer, Nicholas S.; Peralta-Yahya, Pamela (2017): Metabolic engineering strategies to bio-adipic acid
production. In: Curr Opin Biotechnol 45, S. 136–143. DOI: 10.1016/j.copbio.2017.03.006.
Kumar, Sandeep; Gupta, Ram B. (2008): Hydrolysis of microcrystalline cellulose in subcritical and
supercritical water in a continuous flow reactor. In: Ind Eng Chem Res 47 (23), S. 9321–9329. DOI:
10.1021/ie801102j.
Kurihara, Shin; Oda, Shinpei; Kato, Kenji; Kim, Hyeon Guk; Koyanagi, Takashi; Kumagai, Hidehiko;
Suzuki, Hideyuki (2005): A novel putrescine utilization pathway involves gamma-glutamylated
intermediates of Escherichia coli K-12. In: J Biol Chem 280 (6), S. 4602–4608. DOI:
10.1074/jbc.M411114200.
La Rosa, Ruggero; La Peña, Fernando de; Prieto, María Axiliadora; Rojo, Fernando (2014): The Crc
protein inhibits the production of polyhydroxyalkanoates in Pseudomonas putida under balanced
carbon/nitrogen growth conditions. In: Environ Microbiol 16 (1), S. 278–290. DOI: 10.1111/1462-
2920.12303.
Lambertsen, Lotte; Sternberg, Claus; Molin, Soren (2004): Mini-Tn7 transposons for site-specific
tagging of bacteria with fluorescent proteins. In: Environ Microbiol 6 (7), S. 726–732. DOI:
10.1111/j.1462-2920.2004.00605.x.
Lau, W. W. Y.; Armbrust, E. V. (2006): Detection of glycolate oxidase gene glcD diversity among
cultured and environmental marine bacteria. In: Environ Microbiol 8 (10), S. 1688–1702. DOI:
10.1111/j.1462-2920.2006.01092.x.
Lee, S. Y.; Wong, H. H.; Choi, J. i.; Lee, S. H.; Lee, S. C.; Han, C. S. (2000): Production of medium-chain-
length polyhydroxyalkanoates by high-cell-density cultivation of Pseudomonas putida under
phosphorus limitation. In: Biotechnol Bioeng 68 (4), S. 466–470.
Lenaïc, Gravis (Hg.) (2017): The New Plastics Economy. Rethinking the Future of Plastics & Catalysing
action. EllenMacArthurFoundation. Barcelona: GAM Digital.
144 References
Lennen, Rebecca M.; Jensen, Kristian; Mohammed, Elsayed T.; Malla, Sailesh; Börner, Rosa A.;
Chekina, Ksenia et al. (2019): Adaptive laboratory evolution reveals general and specific chemical
tolerance mechanisms and enhances biochemical production (24).
Li, Heng; Durbin, Richard (2009): Fast and accurate short read alignment with Burrows-Wheeler
transform. In: Bioinformatics 25 (14), S. 1754–1760. DOI: 10.1093/bioinformatics/btp324.
Li, Wing-Jin; Jayakody, Lahiru N.; Franden, Mary Ann; Wehrmann, Matthias; Daun, Tristan; Hauer,
Bernhard et al. (2019): Laboratory evolution reveals the metabolic and regulatory basis of
ethylene glycol metabolism by Pseudomonas putida KT2440. In: Environ Microbiol. DOI:
10.1111/1462-2920.14703.
Liu, Huaiwei; Lu, Ting (2015): Autonomous production of 1,4-butanediol via a de novo biosynthesis
pathway in engineered Escherichia coli. In: Metab Eng 29, S. 135–141. DOI:
10.1016/j.ymben.2015.03.009.
Liu, Qian; Luo, Ge; Zhou, Xin Rong; Chen, Guo-Qiang (2011): Biosynthesis of poly(3-
hydroxydecanoate) and 3-hydroxydodecanoate dominating polyhydroxyalkanoates by β-oxidation
pathway inhibited Pseudomonas putida. In: Metab Eng 13 (1), S. 11–17. DOI:
10.1016/j.ymben.2010.10.004.
Loh, Kai-Chee; Cao, Bin (2008): Paradigm in biodegradation using Pseudomonas putida—A review of
proteomics studies. In: Enzyme Microb Tech 43 (1), S. 1–12. DOI:
10.1016/j.enzmictec.2008.03.004.
Lu, Xin; Yamauchi, Kazuchika; Phaiboonsilpa, Natthanon; Saka, Shiro (2009): Two-step hydrolysis of
Japanese beech as treated by semi-flow hot-compressed water. In: J Wood Sci 55 (5), S. 367–375.
DOI: 10.1007/s10086-009-1040-6.
Ma, Yuan; Yao, Mingdong; Li, Bingzhi; Ding, Mingzhu; He, Bo; Chen, Si et al. (2018): Enhanced
Poly(ethylene terephthalate) Hydrolase Activity by Protein Engineering. In: Engineering 4 (6), S.
888–893.
145 References
Maddocks, Sarah E.; Oyston, Petra C. F. (2008): Structure and function of the LysR-type
transcriptional regulator (LTTR) family proteins. In: Microbiology 154 (Pt 12), S. 3609–3623. DOI:
10.1099/mic.0.2008/022772-0.
Madison, L. L.; Huisman, G. W. (1999): Metabolic engineering of poly(3-hydroxyalkanoates): from
DNA to plastic. In: Microbiol Mol Biol Rev 63 (1), S. 21–53.
Magnin, Audrey; Hoornaert, Lucie; Pollet, Eric; Laurichesse, Stéphanie; Phalip, Vincent; Avérous, Luc
(2019a): Isolation and characterization of different promising fungi for biological waste
management of polyurethanes. In: Microb Biotechnol 12 (3), S. 544–555. DOI: 10.1111/1751-
7915.13346.
Magnin, Audrey; Pollet, Eric; Perrin, Rémi; Ullmann, Christophe; Persillon, Cécile; Phalip, Vincent;
Avérous, Luc (2019b): Enzymatic recycling of thermoplastic polyurethanes: Synergistic effect of an
esterase and an amidase and recovery of building blocks. In: Waste Manag 85, S. 141–150. DOI:
10.1016/j.wasman.2018.12.024.
Mani, Thomas; Hauk, Armin; Walter, Ulrich; Burkhardt-Holm, Patricia (2015): Microplastics profile
along the Rhine River. In: Sci Rep 5, 17988 EP -. DOI: 10.1038/srep17988.
Martínez-García, Esteban; Aparicio, Tomás; Goñi-Moreno, Angel; Fraile, Sofía; Lorenzo, Víctor de
(2015): SEVA 2.0: an update of the Standard European Vector Architecture for de-/re-construction
of bacterial functionalities. In: Nucleic Acids Res 43 (Database issue), D1183-9. DOI:
10.1093/nar/gku1114.
Martínez-García, Esteban; Aparicio, Tomás; Lorenzo, Víctor de; Nikel, Pablo I. (2014a): New
transposon tools tailored for metabolic engineering of gram-negative microbial cell factories. In:
Front Bioeng Biotechnol 2 (46), S. 1–13. DOI: 10.3389/fbioe.2014.00046.
Martínez-García, Esteban; Lorenzo, Víctor de (2011): Engineering multiple genomic deletions in
Gram-negative bacteria. Analysis of the multi-resistant antibiotic profile of Pseudomonas putida
KT2440. In: Environ Microbiol 13 (10), S. 2702–2716. DOI: 10.1111/j.1462-2920.2011.02538.x.
146 References
Martínez-García, Esteban; Lorenzo, Víctor de (2017): Molecular tools and emerging strategies for
deep genetic/genomic refactoring of Pseudomonas. In: Curr Opin Biotechnol 47, S. 120–132. DOI:
10.1016/j.copbio.2017.06.013.
Martínez-García, Esteban; Nikel, Pablo I.; Aparicio, Tomás; Lorenzo, Víctor de (2014b): Pseudomonas
2.0. Genetic upgrading of P. putida KT2440 as an enhanced host for heterologous gene
expression. In: Microb Cell Fact 13, S. 159. DOI: 10.1186/s12934-014-0159-3.
Mattioda G., Christidis Y. (2000): Ullmann's Encyclopedia of Industrial Chemistry. Glyoxylic acid.
Weinheim, Germany: Wiley-VCH Verlag GmbH & Co. KGaA.
McKenna, Aaron; Hanna, Matthew; Banks, Eric; Sivachenko, Andrey; Cibulskis, Kristian; Kernytsky,
Andrew et al. (2010): The genome analysis toolkit. A MapReduce framework for analyzing next-
generation DNA sequencing data. In: Genome Res 20 (9), S. 1297–1303. DOI:
10.1101/gr.107524.110.
Mern, Demissew S.; Ha, Seung-Wook; Khodaverdi, Viola; Gliese, Nicole; Görisch, Helmut (2010): A
complex regulatory network controls aerobic ethanol oxidation in Pseudomonas aeruginosa:
indication of four levels of sensor kinases and response regulators. In: Microbiology 156 (Pt 5), S.
1505–1516. DOI: 10.1099/mic.0.032847-0.
Metzgar, David; Bacher, Jamie M.; Pezo, Valérie; Reader, John; Döring, Volker; Schimmel, Paul et al.
(2004): Acinetobacter sp. ADP1: an ideal model organism for genetic analysis and genome
engineering. In: Nucleic Acids Res 32 (19), S. 5780–5790. DOI: 10.1093/nar/gkh881.
Mi, Jia; Sydow, Anne; Schempp, Florence; Becher, Daniela; Schewe, Hendrik; Schrader, Jens;
Buchhaupt, Markus (2016): Investigation of plasmid-induced growth defect in Pseudomonas
putida. In: J Biotechnol 231, S. 167–173. DOI: 10.1016/j.jbiotec.2016.06.001.
Mitchell, Robert J.; Gu, Man Bock (2005): Construction and evaluation of nagR-nagAa::lux fusion
strains in biosensing for salicylic acid derivatives. In: Appl Biochem Biotechnol 120 (3), S. 183–198.
Moreno, Renata; Fonseca, Pilar; Rojo, Fernando (2012): Two small RNAs, CrcY and CrcZ, act in concert
to sequester the Crc global regulator in Pseudomonas putida, modulating catabolite repression.
In: Mol Microbiol 83 (1), S. 24–40. DOI: 10.1111/j.1365-2958.2011.07912.x.
147 References
Moreno, Renata; Hernández-Arranz, Sofía; La Rosa, Ruggero; Yuste, Luis; Madhushani, Anjana;
Shingler, Victoria; Rojo, Fernando (2015): The Crc and Hfq proteins of Pseudomonas putida
cooperate in catabolite repression and formation of ribonucleic acid complexes with specific
target motifs. In: Environ Microbiol 17 (1), S. 105–118. DOI: 10.1111/1462-2920.12499.
Mückschel, Björn; Simon, Oliver; Klebensberger, Janosch; Graf, Nadja; Rosche, Bettina; Altenbuchner,
Josef et al. (2012): Ethylene glycol metabolism by Pseudomonas putida. In: Appl Environ Microb 78
(24), S. 8531–8539. DOI: 10.1128/AEM.02062-12.
Narancic, Tanja; O'Connor, Kevin E. (2017): Microbial biotechnology addressing the plastic waste
disaster. In: Microb Biotechnol 10 (5), S. 1232–1235. DOI: 10.1111/1751-7915.12775.
Narancic, Tanja; Scollica, Elisa; Kenny, Shane T.; Gibbons, Helena; Carr, Eibhlin; Brennan, Lorraine et
al. (2016): Understanding the physiological roles of polyhydroxybutyrate (PHB) in Rhodospirillum
rubrum S1 under aerobic chemoheterotrophic conditions. In: Appl Microbiol Biotechnol 100 (20),
S. 8901–8912. DOI: 10.1007/s00253-016-7711-5.
Navone, Laura; Macagno, Juan Pablo; Licona-Cassani, Cuauhtémoc; Marcellin, Esteban; Nielsen, Lars
K.; Gramajo, Hugo; Rodriguez, Eduardo (2015): AllR controls the expression of Streptomyces
coelicolor allantoin pathway genes. In: Appl Environ Microb 81 (19), S. 6649–6659. DOI:
10.1128/AEM.02098-15.
Nelson, K. E.; Weinel, C.; Paulsen, I. T.; Dodson, R. J.; Hilbert, H.; Martins dos Santos, V A P et al.
(2002): Complete genome sequence and comparative analysis of the metabolically versatile
Pseudomonas putida KT2440. In: Environ Microbiol 4 (12), S. 799–808.
Niehoff, P. J. (2017): Einblicke in den Adipinsäure Metabolismus von Pseuodmonas putida durch
adaptive Laborevolution. (Bachelor thesis). In: Institute for Applied Microbiology, Aachen.
Nielson (2011): The green gap between environmental concerns and the cash register. In: Nielson.
Online verfügbar unter https://www.nielsen.com/us/en/insights/news/2011/the-green-gap-
between-environmental-concerns-and-the-cash-register.html, zuletzt geprüft am 12.04.2019.
Nikel, Pablo I.; Chavarría, Max; Fuhrer, Tobias; Sauer, Uwe; Lorenzo, Víctor de (2015): Pseudomonas
putida KT2440 strain metabolizes glucose through a cycle formed by enzymes of the Entner-
148 References
Doudoroff, Embden-Meyerhof-Parnas, and pentose phosphate pathways. In: J Biol Chem 290 (43),
S. 25920–25932. DOI: 10.1074/jbc.M115.687749.
Nikel, Pablo I.; Lorenzo, Víctor de (2018): Pseudomonas putida as a functional chassis for industrial
biocatalysis: From native biochemistry to trans-metabolism. In: Metab Eng 50, S. 142–155. DOI:
10.1016/j.ymben.2018.05.005.
Nikel, Pablo I.; Martínez-García, Esteban; Lorenzo, Víctor de (2014): Biotechnological domestication
of Pseudomonads using synthetic biology. In: Nat Rev Microbiol 12 (5), S. 368–379. DOI:
10.1038/nrmicro3253.
Nikodinovic-Runic, Jasmina; Guzik, Maciej; Kenny, Shane T.; Babu, Ramesh; Werker, Alan; O Connor,
Kevin E. (2013): Carbon-rich wastes as feedstocks for biodegradable polymer
(polyhydroxyalkanoate) production using bacteria. In: Adv Appl Microbiol 84, S. 139–200. DOI:
10.1016/B978-0-12-407673-0.00004-7.
Noel, Jeffrey K.; Whitford, Paul C. (2016): How EF-Tu can contribute to efficient proofreading of aa-
tRNA by the ribosome. In: Nat Commun 7, 13314 EP. DOI: 10.1038/ncomms13314.
Nogales, J.; García, J. L.; Díaz, E. (2017): Degradation of Aromatic Compounds in Pseudomonas: A
Systems Biology View. In Rojo F. (eds) Aerobic Utilization of Hydrocarbons, Oils and Lipids.
Handbook of Hydrocarbon and Lipid Microbiology. In: Springer, Cham 171, S. 1–49. DOI:
10.1007/978-3-319-39782-5_32-1.
Novichkov, Pavel S.; Kazakov, Alexey E.; Ravcheev, Dmitry A.; Leyn, Semen A.; Kovaleva, Galina Y.;
Sutormin, Roman A. et al. (2013): RegPrecise 3.0--a resource for genome-scale exploration of
transcriptional regulation in bacteria. In: BMC genomics 14, S. 745. DOI: 10.1186/1471-2164-14-
745.
Nurk, Allan; Tamm, Anu; Hôrak, Rita; Kivisaar, Maia (1993): In-vivo-generated fusion promoters in
Pseudomonas putida. In: Gene 127 (1), S. 23–29. DOI: 10.1016/0378-1119(93)90612-7.
Ogunola, Oluniyi Solomon; Onada, Olawale Ahmed; Falaye, Augustine Eyiwunmi (2018): Mitigation
measures to avert the impacts of plastics and microplastics in the marine environment. In: Environ
Sci Pollut R, S. 1–18. DOI: 10.1007/s11356-018-1499-z.
149 References
Palleroni, N. J. (1993): Pseudomonas classification. A new case history in the taxonomy of gram-
negative bacteria. In: Antonie van Leeuwenhoek 64 (3-4), S. 231–251.
Park, Jin-Byung; Bühler, Bruno; Panke, Sven; Witholt, Bernard; Schmid, Andreas (2007): Carbon
metabolism and product inhibition determine the epoxidation efficiency of solvent-tolerant
Pseudomonas sp. strain VLB120ΔC. In: Biotechnol Bioeng 98 (6), S. 1219–1229. DOI:
10.1002/bit.21496.
Parke, D.; Garcia, M. A.; Ornston, L. N. (2001): Cloning and Genetic Characterization of dca Genes
Required for -Oxidation of Straight-Chain Dicarboxylic Acids in Acinetobacter sp. Strain ADP1. In:
Appl Environ Microb 67 (10), S. 4817–4827. DOI: 10.1128/AEM.67.10.4817-4827.2001.
Peretó, Juli (2007): The Renaissance of Synthetic Biology. In: Biol Theory 2 (2), S. 128–130.
Pérez-Rueda, E.; Collado-Vides, J. (2000): The repertoire of DNA-binding transcriptional regulators in
Escherichia coli K-12. In: Nucleic Acids Res 28 (8), S. 1838–1847. DOI: 10.1093/nar/28.8.1838. petcore Europe (14.12.2018): 2017 - Survey on European PET Recycle Industry - 58.2 % of PET bottles
collected. Online verfügbar unter https://petcore-europe.org/news-events/202-2017-survey-on-
european-pet-recycle-industry-58-2-of-pet-bottles-collected.html.
Plaster, J. (2019): Plastic monomers as sole carbon source for Pseudomonas putida KT2440. (Master
thesis). In: Institute for Applied Microbiology, Aachen.
PlasticsEurope (2018a): Plastics - the Facts 2017. An analysis of European plastics production,
demand and waste data.
PlasticsEurope 2018: Plastics - The Facts 2017. An analysis of European plastics production, demand
and waste data;
https://www.plasticseurope.org/application/files/5715/1717/4180/Plastics_the_facts_2017_FINA
L_for_website_one_page.pdf (from 31.08.2018). Online verfügbar unter
https://www.plasticseurope.org/application/files/5715/1717/4180/Plastics_the_facts_2017_FINA
L_for_website_one_page.pdf, zuletzt geprüft am 31.08.2018.
Poblete-Castro, Ignacio; Escapa, Isabel F.; Jäger, Christian; Puchalka, Jacek; Lam, Carolyn Ming Chi;
Schomburg, Dietmar et al. (2012): The metabolic response of P. putida KT2442 producing high
150 References
levels of polyhydroxyalkanoate under single- and multiple-nutrient-limited growth: highlights
from a multi-level omics approach. In: Microb Cell Fact 11, S. 34. DOI: 10.1186/1475-2859-11-34.
Polen, Tino; Spelberg, Markus; Bott, Michael (2013): Toward biotechnological production of adipic
acid and precursors from biorenewables. In: J Biotechnol 167 (2), S. 75–84. DOI:
10.1016/j.jbiotec.2012.07.008.
Prata, Joana Correia; da Costa, Joao P.; Lopes, Isabel; Duarte, Armando C.; Rocha-Santos, Teresa
(2019): Effects of microplastics on microalgae populations: A critical review. In: Sci Total Environ
665, S. 400–405. DOI: 10.1016/j.scitotenv.2019.02.132.
Prieto, Auxiliadora; Escapa, Isabel F.; Martínez, Virginia; Dinjaski, Nina; Herencias, Cristina; La Peña,
Fernando de et al. (2016): A holistic view of polyhydroxyalkanoate metabolism in Pseudomonas
putida. In: Environ Microbiol 18 (2), S. 341–357. DOI: 10.1111/1462-2920.12760.
Puigbò, Pere; Guzmán, Eduard; Romeu, Antoni; Garcia-Vallvé, Santiago (2007): OPTIMIZER: a web
server for optimizing the codon usage of DNA sequences. In: Nucleic Acids Res 35 (Web Server
issue), W126-31. DOI: 10.1093/nar/gkm219.
Ramos, Juan L.; Duque, Estrella; Gallegos, Maria-Trinidad; Godoy, Patricia; Ramos-Gonzalez, Maria
Isabel; Rojas, Antonia et al. (2002): Mechanisms of solvent tolerance in gram-negative bacteria. In:
Annu Rev Microbiol 56, S. 743–768. DOI: 10.1146/annurev.micro.56.012302.161038.
Ramos, Juan L.; Duque, Estrella; Godoy, Patricia; Segura, Ana (1998): Efflux Pumps Involved in
Toluene Tolerance in Pseudomonas putida DOT-T1E. In: J Bacteriol 180 (13), S. 3323–3329.
Regenhardt, D.; Heuer, H.; Heim, S.; Fernandez, D. U.; Strömpl, C.; Moore, E. R. B.; Timmis, K. N.
(2002): Pedigree and taxonomic credentials of Pseudomonas putida strain KT2440. In: Environ
Microbiol 4 (12), S. 912–915.
Rintoul, Maria R.; Cusa, Eva; Baldomà, Laura; Badia, Josefa; Reitzer, Larry; Aguilar, Juan (2002):
Regulation of the Escherichia coli allantoin regulon. Coordinated function of the repressor AllR
and the activator AllS. In: J Mol Biol 324 (4), S. 599–610. DOI: 10.1016/S0022-2836(02)01134-8.
Ritchie, Hannah; Roser, Max (2019): Plastic Pollution. Hg. v. OurWorldInData. Online verfügbar unter
https://ourworldindata.org/plastic-pollution.
151 References
Roth, Christian; Wei, Ren; Oeser, Thorsten; Then, Johannes; Föllner, Christina; Zimmermann,
Wolfgang; Sträter, Norbert (2014): Structural and functional studies on a thermostable
polyethylene terephthalate degrading hydrolase from Thermobifida fusca. In: Appl Microbiol
Biotechnol 98 (18), S. 7815–7823. DOI: 10.1007/s00253-014-5672-0.
Ryan, Peter G. (2015): A Brief History of Marine Litter Research. In: Melanie Bergmann, Lars Gutow
und Michael Klages (Hg.): Marine Anthropogenic Litter, Bd. 2. Cham: Springer, S. 1–25.
Saad, B.; Suter, U. W. (2001): Biodegradable Polymeric Materials. In: Encyclopedia of materials.
Amsterdam: Elsevier, S. 551–555.
Sajtos A. (1991): Process for the preparation of glyoxylic acid and glyoxylic acid derivates. US patent
5015,760; application year 1989. Veröffentlichungsnr: 5015,760.
Salvador, Manuel; Abdulmutalib, Umar; Gonzalez, Jaime; Kim, Juhyun; Smith, Alex A.; Faulon, Jean-
Loup et al. (2019): Microbial Genes for a Circular and Sustainable Bio-PET Economy. In: Genes 10
(5). DOI: 10.3390/genes10050373.
Samanta, Sudip K.; Singh, Om V.; Jain, Rakesh K. (2002): Polycyclic aromatic hydrocarbons:
environmental pollution and bioremediation. In: Trends Biotechnol 20 (6), S. 243–248. DOI:
10.1016/S0167-7799(02)01943-1.
Sato, K. (1998): A "Green" Route to Adipic Acid: Direct Oxidation of Cyclohexenes with 30 Percent
Hydrogen Peroxide. In: Science 281 (5383), S. 1646–1647. DOI: 10.1126/science.281.5383.1646.
Scheirs, John; Long, Timothy E. (Hg.) (2003): Modern Polyesters: Chemistry and Technology of
Polyesters and Copolyesters. England: Wiley Series in Polymer Science - John Wiley & Sons, Ltd.
Schmidt, Juliane; Wei, Ren; Oeser, Thorsten; Dedavid E Silva, Lukas Andre; Breite, Daniel; Schulze,
Agnes; Zimmermann, Wolfgang (2017): Degradation of Polyester Polyurethane by Bacterial
Polyester Hydrolases. In: Polymers 9 (2). DOI: 10.3390/polym9020065.
Schmidt, S. (2017): Einfluss von gcl und glcB auf den Ethyleneglycol-Metabolismus von Pseudomonas
putida KT2440. (Bachelor thesis). In: Institute for Applied Microbiology, Aachen.
Schultz, A. C.; Nygaard, P.; Saxild, H. H. (2001): Functional analysis of 14 genes that constitute the
purine catabolic pathway in Bacillus subtilis and evidence for a novel regulon controlled by the
152 References
PucR transcription activator. In: J Bacteriol 183 (11), S. 3293–3302. DOI: 10.1128/JB.183.11.3293-
3302.2001.
Sharmin, Eram; Zafar, Fahmina (2012): Polyurethane: An Introduction. In: Fahmina Zafar (Hg.):
Polyurethane: InTech.
Shimao, Masayuki (2001): Biodegradation of plastics. In: Curr Opin Biotechnol 12 (3), S. 242–247. DOI:
10.1016/S0958-1669(00)00206-8.
Shimizu, Azuyuki (2002): A review on metabolic pathway analysis with emphasis on isotope labeling
approach. In: Biotechnol Bioprocess Eng 7 (5), S. 237–251. DOI: 10.1007/BF02932832.
Silva-Rocha, Rafael; Martínez-García, Esteban; Calles, Belén; Chavarría, Max; Arce-Rodríguez,
Alejandro; Las Heras, Aitor de et al. (2013): The Standard European Vector Architecture (SEVA): a
coherent platform for the analysis and deployment of complex prokaryotic phenotypes. In:
Nucleic Acids Res 41 (Database issue), D666-75. DOI: 10.1093/nar/gks1119.
Smith, Madeleine; Love, David C.; Rochman, Chelsea M.; Neff, Roni A. (2018): Microplastics in
Seafood and the Implications for Human Health. In: Curr Environ Health Rep 5 (3), S. 375–386.
DOI: 10.1007/s40572-018-0206-z.
Spini, Giulia; Spina, Federica; Poli, Anna; Blieux, Anne-Laure; Regnier, Tiffanie; Gramellini, Carla et al.
(2018): Molecular and Microbiological Insights on the Enrichment Procedures for the Isolation of
Petroleum Degrading Bacteria and Fungi. In: Front Microbiol 9. DOI: 10.3389/fmicb.2018.02543.
Steele, M. I.; Lorenz, D.; Hatter, K.; Park, A.; Sokatch, J. R. (1992): Characterization of the mmsAB
operon of Pseudomonas aeruginosa PAO encoding methylmalonate-semialdehyde dehydrogenase
and 3-hydroxyisobutyrate dehydrogenase. In: J Biol Chem 267 (19), S. 13585–13592.
Sulaiman, Sintawee; Yamato, Saya; Kanaya, Eiko; Kim, Joong-Jae; Koga, Yuichi; Takano, Kazufumi;
Kanaya, Shigenori (2012): Isolation of a Novel Cutinase Homolog with Polyethylene Terephthalate-
Degrading Activity from Leaf-Branch Compost by Using a Metagenomic Approach. In: Appl Environ
Microb 78 (5), S. 1556–1562. DOI: 10.1128/AEM.06725-11.
153 References
Tahseen, Razia; Arslan, Muhammad; Iqbal, Samina; Khalid, Zafar M.; Afzal, Muhammad (2019):
Enhanced degradation of hydrocarbons by gamma ray induced mutant strain of Pseudomonas
putida. In: Biotechnol Lett 41 (3), S. 391–399. DOI: 10.1007/s10529-019-02644-y.
Takeda, Kouta; Matsumura, Hirotoshi; Ishida, Takuya; Samejima, Masahiro; Igarashi, Kiyohiko;
Nakamura, Nobuhumi; Ohno, Hiroyuki (2013): The two-step electrochemical oxidation of alcohols
using a novel recombinant PQQ alcohol dehydrogenase as a catalyst for a bioanode. In:
Bioelectrochemistry 94, S. 75–78. DOI: 10.1016/j.bioelechem.2013.08.001.
Tatusov, R. L.; Koonin, E. V.; Lipman, D. J. (1997): A genomic perspective on protein families. In:
Science 278 (5338), S. 631–637. DOI: 10.1126/science.278.5338.631.
Teras, R.; Hõrak, R.; Kivisaar, M. (2000): Transcription from fusion promoters generated during
transposition of transposon Tn4652 is positively affected by integration host factor in
Pseudomonas putida. In: J Bacteriol 182 (3), S. 589–598. DOI: 10.1128/JB.182.3.589-598.2000.
The UniProt Consortium (2019): UniProt: a worldwide hub of protein knowledge. In: Nucleic Acids Res
47 (D1), D506-D515. DOI: 10.1093/nar/gky1049.
Thompson, Richard C.; Moore, Charles J.; Vom Saal, Frederick S.; Swan, Shanna H. (2009): Plastics,
the environment and human health: current consensus and future trends. In: Philos Trans R Soc
Lond B Biol Sci 364 (1526), S. 2153–2166. DOI: 10.1098/rstb.2009.0053.
Thorvaldsdóttir, Helga; Robinson, James T.; Mesirov, Jill P. (2013): Integrative Genomics Viewer (IGV).
High-performance genomics data visualization and exploration. In: Brief Bioinform 14 (2), S. 178–
192. DOI: 10.1093/bib/bbs017.
Tiso, Till; Sabelhaus, Petra; Behrens, Beate; Wittgens, Andreas; Rosenau, Frank; Hayen, Heiko; Blank,
Lars Mathias (2016): Creating metabolic demand as an engineering strategy in Pseudomonas
putida - Rhamnolipid synthesis as an example. In: Metab Eng Commun 3, S. 234–244. DOI:
10.1016/j.meteno.2016.08.002.
Tiso, Till; Zauter, Rabea; Tulke, Hannah; Leuchtle, Bernd; Li, Wing-Jin; Behrens, Beate et al. (2017):
Designer rhamnolipids by reduction of congener diversity: production and characterization. In:
Microb Cell Fact 16 (1), S. 225. DOI: 10.1186/s12934-017-0838-y.
154 References
Tyanova, Stefka; Temu, Tikira; Sinitcyn, Pavel; Carlson, Arthur; Hein, Marco Y.; Geiger, Tamar et al.
(2016): The Perseus computational platform for comprehensive analysis of (prote)omics data. In:
Nat Methods 13 (9), S. 731–740. DOI: 10.1038/nmeth.3901.
Valentini, Martina; García-Mauriño, Sofía M.; Pérez-Martínez, Isabel; Santero, Eduardo; Canosa, Inés;
Lapouge, Karine (2014): Hierarchical management of carbon sources is regulated similarly by the
CbrA/B systems in Pseudomonas aeruginosa and Pseudomonas putida. In: Microbiology 160 (Pt
10), S. 2243–2252. DOI: 10.1099/mic.0.078873-0.
Vallon, Tobias; Simon, Oliver; Rendgen-Heugle, Beate; Frana, Sabine; Mückschel, Björn; Broicher,
Alexander et al. (2015): Applying systems biology tools to study n-butanol degradation in
Pseudomonas putida KT2440. In: Eng Life Sci 15 (8), S. 760–771. van Eygen, Emile; Laner, David; Fellner, Johann (2018): Circular economy of plastic packaging:
Current practice and perspectives in Austria. In: Waste Manag 72, S. 55–64. DOI:
10.1016/j.wasman.2017.11.040.
Vaneechoutte, Mario; Young, David M.; Ornston, L. Nicholas; Baere, Thierry de; Nemec, Alexandr;
van der Reijden, Tanny et al. (2006): Naturally transformable Acinetobacter sp. strain ADP1
belongs to the newly described species Acinetobacter baylyi. In: Appl Environ Microb 72 (1), S.
932–936. DOI: 10.1128/AEM.72.1.932-936.2006.
Vardon, Derek R.; Franden, Mary Ann; Johnson, Christopher W.; Karp, Eric M.; Guarnieri, Michael T.;
Linger, Jeffrey G. et al. (2015): Adipic acid production from lignin. In: Energy Environ Sci 8 (2), S.
617–628. DOI: 10.1039/c4ee03230f.
Venkatachalam, S.; G., Shilpa; V., Jayprakash; R., Prashant; Rao, Krishna; K., Anil (2012): Degradation
and Recyclability of Poly (Ethylene Terephthalate). In: Hosam El-Din M. Saleh (Hg.): Polyester.
Rijeka, Croatia: InTech.
Verhoef, Suzanne; Ballerstedt, Hendrik; Volkers, Rita J. M.; Winde, Johannes H. de; Ruijssenaars,
Harald J. (2010): Comparative transcriptomics and proteomics of p-hydroxybenzoate producing
Pseudomonas putida S12: novel responses and implications for strain improvement. In: Appl
Microbiol Biotechnol 87 (2), S. 679–690. DOI: 10.1007/s00253-010-2626-z.
155 References
Vispute, Tushar P.; Zhang, Huiyan; Sanna, Aimaro; Xiao, Rui; Huber, George W. (2010): Renewable
chemical commodity feedstocks from integrated catalytic processing of pyrolysis oils. In: Science
330 (6008), 1222-1227. DOI: 10.1126/science.1194218.
Volkers, Rita J. M.; Ballerstedt, Hendrik; Winde, Johannes H. de; Ruijssenaars, Harald J. (2010):
Isolation and genetic characterization of an improved benzene-tolerant mutant of Pseudomonas
putida S12. In: Environ Microbiol rep 2 (3), S. 456–460. DOI: 10.1111/j.1758-2229.2010.00172.x.
Wang, James C. (2002): Cellular roles of DNA topoisomerases: a molecular perspective. In: Nat Rev
Mol Cell Biol 3 (6), S. 430–440. DOI: 10.1038/nrm831.
Wang, Weixun; Zhou, Haihong; Lin, Hua; Roy, Sushmita; Shaler, Thomas A.; Hill, Lander R. et al.
(2003): Quantification of Proteins and Metabolites by Mass Spectrometry without Isotopic
Labeling or Spiked Standards. In: Anal Chem 75 (18), S. 4818–4826. DOI: 10.1021/Ac026468x.
Wang, Y. Z.; Zhou, Y.; Zylstra, G. J. (1995): Molecular analysis of isophthalate and terephthalate
degradation by Comamonas testosteroni YZW-D. In: Environ Health Perspect 103 (Suppl 5), S. 9–
12.
Ward, Patrick G.; Goff, Miriam; Donner, Matthias; Kaminsky, Walter; O'Connor, Kevin E. (2006): A
two step chemo-biotechnological conversion of polystyrene to a biodegradable thermoplastic. In:
Environ Sci Technol 40 (7), S. 2433–2437. DOI: 10.1021/es0517668.
Wehrmann, Matthias; Billard, Patrick; Martin-Meriadec, Audrey; Zegeye, Asfaw; Klebensberger,
Janosch (2017a): Functional role of lanthanides in enzymatic activity and transcriptional regulation
of pyrroloquinoline quinone-dependent alcohol dehydrogenases in Pseudomonas putida KT2440.
In: mBio 8 (3), S. 1–14. Online verfügbar unter e00570-17.
Wehrmann, Matthias; Billard, Patrick; Martin-Meriadec, Audrey; Zegeye, Asfaw; Klebensberger,
Janosch (2017b): Functional Role of Lanthanides in Enzymatic Activity and Transcriptional
Regulation of Pyrroloquinoline Quinone-Dependent Alcohol Dehydrogenases in Pseudomonas
putida KT2440. In: mBio 8 (3). DOI: 10.1128/mBio.00570-17.
156 References
Wei, Ren; Zimmermann, Wolfgang (2017a): Biocatalysis as a green route for recycling the recalcitrant
plastic polyethylene terephthalate. In: Microb Biotechnol 10 (6), S. 1302–1307. DOI:
10.1111/1751-7915.12714.
Wei, Ren; Zimmermann, Wolfgang (2017b): Microbial enzymes for the recycling of recalcitrant
petroleum-based plastics: how far are we? In: Microb Biotechnol 10 (6), S. 1308–1322. DOI:
10.1111/1751-7915.12710.
Westhues, Stefan; Idel, Jasmine; Klankermayer, Jürgen (2018): Molecular catalyst systems as key
enablers for tailored polyesters and polycarbonate recycling concepts. In: Sci Adv 4 (8), eaat9669.
DOI: 10.1126/sciadv.aat9669.
Wierckx, Nick; Prieto, M. Auxiliadora; Pomposiello, Pablo; Lorenzo, Victor de; O'Connor, Kevin; Blank,
Lars M. (2015): Plastic waste as a novel substrate for industrial biotechnology. In: Microb
Biotechnol 8 (6), S. 900–903. DOI: 10.1111/1751-7915.12312.
Wierckx, Nick J. P.; Ballerstedt, Hendrik; Bont, Jan A. M. de; Wery, Jan (2005): Engineering of solvent-
tolerant Pseudomonas putida S12 for bioproduction of phenol from glucose. In: Appl Environ
Microb 71 (12), S. 8221–8227. DOI: 10.1128/AEM.71.12.8221-8227.2005.
Wilkes, R. A.; Aristilde, L. (2017): Degradation and metabolism of synthetic plastics and associated
products by Pseudomonas sp.: capabilities and challenges. In: J Appl Microbiol 123 (3), S. 582–593.
DOI: 10.1111/jam.13472.
Wittgens, Andreas; Santiago-Schuebel, Beatrix; Henkel, Marius; Tiso, Till; Blank, Lars Mathias;
Hausmann, Rudolf et al. (2018): Heterologous production of long-chain rhamnolipids from
Burkholderia glumae in Pseudomonas putida-a step forward to tailor-made rhamnolipids. In: Appl
Microbiol Biot 102 (3), S. 1229–1239. DOI: 10.1007/s00253-017-8702-x.
Wittgens, Andreas; Tiso, Till; Arndt, Torsten T.; Wenk, Pamela; Hemmerich, Johannes; Müller,
Carsten et al. (2011): Growth independent rhamnolipid production from glucose using the non-
pathogenic Pseudomonas putida KT2440. In: Microb Cell Fact 10, S. 80. DOI: 10.1186/1475-2859-
10-80.
157 References
Wynands, Benedikt; Lenzen, Christoph; Otto, Maike; Koch, Falk; Blank, Lars M.; Wierckx, Nick (2018):
Metabolic engineering of Pseudomonas taiwanensis VLB120 with minimal genomic modifications
for high-yield phenol production. In: Metab Eng 47, S. 121–133. DOI:
10.1016/j.ymben.2018.03.011.
Yang, Jun; Yang, Yu; Wu, Wei-Min; Zhao, Jiao; Jiang, Lei (2014): Evidence of polyethylene
biodegradation by bacterial strains from the guts of plastic-eating waxworms. In: Environ Sci
Technol 48 (23), S. 13776–13784. DOI: 10.1021/es504038a.
Yim, Harry; Haselbeck, Robert; Niu, Wei; Pujol-Baxley, Catherine; Burgard, Anthony; Boldt, Jeff et al.
(2011): Metabolic engineering of Escherichia coli for direct production of 1,4-butanediol. In: Nat
Chem Biol 7 (7), S. 445–452. DOI: 10.1038/nchembio.580.
Yoshida, Shosuke; Hiraga; Kazimi; Takehara, Toshihiko; Oda, Kohei (2016a): A bacterium that
degrades and assimilates poly(ethylene terephthalate). In: Science 351 (6278), S. 1196–1199.
Yoshida, Shosuke; Hiraga, Kazumi; Takehana, Toshihiko; Taniguchi, Ikuo; Yamaji, Hironao; Maeda,
Yasuhito et al. (2016b): A bacterium that degrades and assimilates poly(ethylene terephthalate).
In: Science 351 (6278), S. 1196–1199. DOI: 10.1126/science.aad6359.
Young, David M.; Parke, Donna; Ornston, L. Nicholas (2005): Opportunities for genetic investigation
afforded by Acinetobacter baylyi, a nutritionally versatile bacterial species that is highly
competent for natural transformation. In: Annu. Rev. Microbiol 59 (1), S. 519–551. DOI:
10.1146/annurev.micro.59.051905.105823.
Yu, Jia-Le; Xia, Xiao-Xia; Zhong, Jian-Jiang; Qian, Zhi-Gang (2014): Direct biosynthesis of adipic acid
from a synthetic pathway in recombinant Escherichia coli. In: Biotechnol Bioeng 111 (12), S. 2580–
2586. DOI: 10.1002/bit.25293.
Yu, Yun; Lou, Xia; Wu, Hongwei (2008): Some recent advances in hydrolysis of biomass in hot-
compressed water and its comparisons with other hydrolysis methods. In: Energ Fuel 22 (1), S.
46–60. DOI: 10.1021/ef700292p.
Yue, Hairong; Zhao, Yujun; Ma, Xinbin; Gong, Jinlong (2012): Ethylene glycol. Properties, synthesis,
and applications. In: Chem Soc Rev 41 (11), S. 4218–4244. DOI: 10.1039/c2cs15359a.
158 References
Zhou, Shengfang; Mohan Raj, Subramanian; Ashok, Somasundar; Edwardraja, Selvakumar; Lee, Sun-
Gu; Park, Sunghoon (2013): Cloning, expression and characterization of 3-hydroxyisobutyrate
dehydrogenase from Pseudomonas denitrificans ATCC 13867. In: PloS one 8 (5), e62666.
Zobel, Sebastian; Benedetti, Ilaria; Eisenbach, Lara; Lorenzo, Victor de; Wierckx, Nick; Blank, Lars M.
(2015): Tn7-based device for calibrated heterologous gene expression in Pseudomonas putida. In:
ACS Synth Biol 4 (12), S. 1341–1351. DOI: 10.1021/acssynbio.5b00058.
Zobel, Sebastian; Kuepper, Jannis; Ebert, Birgitta; Wierckx, Nick; Blank, Lars M. (2017): Metabolic
response of Pseudomonas putida to increased NADH regeneration rates. In: Eng Life Sci 17 (1), S.
47–57. DOI: 10.1002/elsc.201600072.
159
Curriculum Vitae
Personal data:
Name: Wing-Jin Li
Born: 09. April 1990 in Wuppertal
Nationality: Dutch
Education
2015-2019 Doctoral studies at the Institute of Applied Microbiology of the REVTH Aachen University, (Aachen, Germany)
2014-2012 Master of Science at Heinrich-Heine-Universität (Düsseldorf, Germany)
2009-2012 Bachelor of Science at Heinrich-Heine-Universität (Düsseldorf, Germany)
2006-2009 Luisen Gymnasium, Düsseldorf, Germany for the acquisition of Abitur (higher education entrance qualification)
2000-2006 Werner von Siemens Realschule, Düsseldorf for the acquisition of Mittlere Reife (secondary school certificate)
Work experience
2015-2019 Scientific employee at the Institute of Applied Microbiology of the REVTH Aachen University, (Aachen, Germany)
Awards
2018 Second price in „Best oral presentation award by a graduate student” for the presentation ”Engineering Pseudomonas putida for plastic monomer utilization“ at the “7th European Bioremediation Conference (EBC-VII) and the 11th International Society for Environmental Biotechnology conference (ISEB 2018)” in Chania, Greece
Publications
2020 Wing-Jin Li, Tanja Narancic, Shane T. Kenny, Paul-Joachim Niehoff, Kevin O´Connor, Lars M. Blank, and Nick Wierckx; “Unraveling 1,4-Butanediol Metabolism in Pseudomonas putida KT2440” in Frontiers Microbiology (DOI:10.3389/fmicb.2020.00382)
161 Curriculum Vitae
Publications
2019 Wing-Jin Li, Lahiru N. Jayakody, Mary Ann Franden, Matthias Wehrmann, Tristan Daun, Bernhard Hauer, Lars M. Blank, Gregg T. Beckham, Janosch Klebensberger, and Nick Wierckx; “Laboratory evolution reveals the metabolic and regulatory basis of ethylene glycol metabolism by Pseudomonas putida KT2440” in Environmental Microbiology (DOI:10.1111/1462-2920.14703)
2018 Mary Ann Franden, Lahiru N. Jayakody, Wing-Jin Li, Neil J. Wagner, Nicholas S. Cleveland, William E. Michener, Bernhard Hauer, Lars M. Blank, Nick Wierckx, Janosch Klebensberger, and Gregg T. Beckham, “Engineering Pseudomonas putida KT2440 for efficient ethylene glycol utilization“ in Metabolic engineering (DOI:10.1016/j.ymben.2018.06.003)
2017 Till Tiso, Rabea Zauter, Hannah Tulke, Bernd Leuchtle, Wing-Jin Li, Beate Behrens, Andreas Wittgens, Frank Rosenau, Heiko Hayen, and Lars M. .Blank, “Designer rhamnolipids by reduction of congener diversity: production and characterization” in Microbial Cell Factories (DOI: 10.1186/s12934-017-0838- y)
Poster presentations
2017 Poster presentation at the “4th International Synthetic & Systems Biology Summer School“ in Cambridge, United Kingdom
2015 Poster presentation at the „Vereinigung für Allgemeine und Angewandte Mikrobiologie“ (VAAM) e.V. in Jena, Deutschland
Oral presentations
2017 Presentation at the “4th International Synthetic & Systems Biology Summer School“ in Cambridge, United Kingdom
2018 Presentation at the “7th European Bioremediation Conference (EBC-VII) and the 11th International Society for Environmental Biotechnology conference (ISEB 2018)” in Chania, Greece
162