Epstein-Barr Virus Nuclear Antigen 3C Stabilizes Gemin3 to Block p53-mediated Apoptosis

Qiliang Cai1., Yi Guo1,2., Bingyi Xiao1, Shuvomoy Banerjee1, Abhik Saha1, Jie Lu1, Tina Glisovic3, Erle S. Robertson1* 1 Department of Microbiology and the Tumor Virology Program, Abramson Comprehensive Cancer Center, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania, United States of America, 2 Key Laboratory of AIDS Immunology, Ministry of Health, The First Affiliated Hospital, China Medical University, Shenyang, Liaoning, People’s Republic of China, 3 Howard Hughes Medical Institute and Department of Biochemistry and Biophysics, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania, United States of America

Abstract The Epstein-Barr nuclear antigen 3C (EBNA3C), one of the essential latent antigens for Epstein-Barr virus (EBV)-induced immortalization of primary human B lymphocytes in vitro, has been implicated in regulating cell proliferation and anti- apoptosis via interaction with several cellular and viral factors. Gemin3 (also named DDX20 or DP103) is a member of DEAD RNA helicase family which exhibits diverse cellular functions including DNA transcription, recombination and repair, and RNA metabolism. Gemin3 was initially identified as a binding partner to EBNA2 and EBNA3C. However, the mechanism by which EBNA3C regulates Gemin3 function remains unclear. Here, we report that EBNA3C directly interacts with Gemin3 through its C-terminal domains. This interaction results in increased stability of Gemin3 and its accumulation in both B lymphoma cells and EBV transformed lymphoblastoid cell lines (LCLs). Moreover, EBNA3C promotes formation of a complex with p53 and Gemin3 which blocks the DNA-binding affinity of p53. Small hairpin RNA based knockdown of Gemin3 in B lymphoma or LCL cells remarkably attenuates the ability of EBNA3C to inhibit the transcription activity of p53 on its downstream genes p21 and Bax, as well as apoptosis. These findings provide the first evidence that Gemin3 may be a common target of oncogenic viruses for driving cell proliferation and anti-apoptotic activities.

Citation: Cai Q, Guo Y, Xiao B, Banerjee S, Saha A, et al. (2011) Epstein-Barr Virus Nuclear Antigen 3C Stabilizes Gemin3 to Block p53-mediated Apoptosis. PLoS Pathog 7(12): e1002418. doi:10.1371/journal.ppat.1002418 Editor: Nancy Raab-Traub, University of North Carolina at Chapel Hill, United States of America Received July 22, 2011; Accepted October 20, 2011; Published December 8, 2011 Copyright: ß 2011 Cai et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This study was supported by public health service grants: National Cancer Institute 5R01CA091792-08, 5R01CA108461-05, 1R01CA137894-01 and 1R01CA138434-01A209; National Institute of Allergy and Infectious Diseases 5R01AI067037-04 and National Institute of Dental and Craniofacial Research 5R01DE017338-03 (to ESR). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] . These authors contributed equally to this work.

Introduction oped in immunocompromised individuals and EBV-transformed lymphoblastoid cell lines [3] . In this group all six EBNAs, three Epstein-Barr virus (EBV) is the first identified human tumor LMPs and the two EBERs are expressed [7],[9]. Type IV latency virus which causes infectious mononucleosis [1],[2], and is linked is less strictly defined and is associated with infectious mononu- several lymphoproliferative diseases [3], including Burkitt’s cleosis patients [8],[9]. Some infected individuals is associated with lymphoma [4], nasopharyngeal carcinoma [5], and Hodgkin’s the tightly latent program (latency 0), in which latent gene disease [6]. EBV, a ubiquitous human c-herpesvirus, infects more expression is almost undetectable [9]. The essential mediators for than 90% of the worldwide adult population. Moreover, AIDS EBV transformation of B lymphocytes and establishment of patients or post-transplant patients whose immune system is latency in vitro include EBNA2, EBNA3A, 3C and LMP1 suppressed have a high probability of developing EBV-associated proteins. Importantly, EBNA3C plays a complex regulatory role lymphomas. In vitro, EBV can transform normal resting human in the transcription of several viral and cellular genes. For B-cells to continuous proliferation of latently infected B cells example, EBNA3C targets the cellular transcription factor RBP-Jk resulting in lymphoblastoid cell lines (LCLs). Like other herpes- to antagonize EBNA2 mediated transactivation [10],[11], and virus, the EBV life cycle exhibits both latent (non-productive) and cooperates with EBNA2 to activate the major viral LMP1 lytic (productive) phases. Four types of latency programs are promoter via interaction with the cellular transcription factor, classified: Type I latency is mainly represented by Burkitt Spi-1/Spi-B [12]. EBNA3C also regulates chromatin remodeling lymphoma (BL) cells; there are two EBER genes expressed, the by recruiting both histone acetylase and deacetylase activities [13– BART transcripts, and EBNA1 (EBV nuclear antigen 1) [7]. Type 15]. Furthermore, EBNA3C modulates the transcription of II latency is most frequently seen in Hodgkin’s lymphoma and cellular genes involved in cell migration and invasion by targeting nasopharyngeal carcinoma with three additional latent-membrane the metastasis suppressor Nm23-H1 [16]. In addition to its proteins, LMP-1, LMP-2A and LMP-2B expressed [8]. Latency transcriptional functions, it has been reported that EBNA3C has III is seen predominantly in lymphoproliferative diseases devel- cell-cycle regulatory functions, presumably mediated by direct

PLoS Pathogens | www.plospathogens.org 1 December 2011 | Volume 7 | Issue 12 | e1002418 EBNA3C Stabilizes Gemin3

Author Summary initially identified as a binding protein of EBNA2 and EBNA3C, we wanted to determine if the EBNA3C complex with Gemin3 Gemin3 (DDX20 or DP103) is a member of the DEAD-box was independent of EBNA2 and performed similar coimmuno- family of RNA helicases involved in various cellular precipitation assays again by using the EBV negative B lymphoma processes including DNA transcription and RNA process- BJAB derived cell lines BJAB7 and BJAB10 with EBNA3C stable ing. The Epstein-Barr virus (EBV) encoded nuclear antigen expression alone. The results showed that EBNA3C alone was 3C (EBNA3C) is essential for EBV-induced immortalization sufficient to form a complex with Gemin3 in vivo (Figure 1C). of primary human B-lymphocytes in vitro. In this study, we To determine if the association of EBNA3C and Gemin3 occurs discovered that Gemin3 directly binds to the tumor in the same cellular compartments in this scenario, we performed suppressor p53, and acts as a negative regulator blocking immunofluorescence assays by ectopically expressing FLAG- p53 functions. Importantly, EBNA3C induces Gemin3 accumulation and enhances the formation of the complex tagged EBNA3C and GFP-tagged Gemin3 in U2OS cells. The of Gemin3 and p53 in EBV- transformed primary human B immunofluorescence results showed that although EBNA3C lymphocytes. Remarkably, inhibition of Gemin3 production signals are shown as stippled, punctate dots with the exclusion of leads to cell death of B lymphoma cells, particularly nuclei, and Gemin3 signal was displayed as intense staining of EBNA3C positive cells. This is the first evidence which prominent but discrete foci in both nucleus and cytoplasm, and shows that Gemin3 directly impairs p53 function in EBV there were a number of positions where co-localization staining of positive cells, and that Gemin3 could be a potential target EBNA3C with Gemin3 was evident (Figure 2A). To further for EBV-associated cancer therapy. visualize the interaction of these two proteins under physiological conditions, an EBV transformed cell line LCL1 was used. Endogenous EBNA3C and Gemin3 signals were evident with protein–protein interactions [13],[17–19]. EBNA3C also stabilizes the co-localization pattern (Figure 2B), supporting the above data c-Myc and interacts with Mdm2 in modulating p53 transcription that these two proteins can associate in the same complex. and apoptotic activities [20–22]. Gemin3 was discovered as a binding partner with EBV latent antigens (EBNA2 and EBNA3C), and the survival motor neuron (SMN) protein [23],[24]. It consists of 825 amino acids with 9 conserved motifs including the ASP-Glu-Ala-Asp motifs (or DEAD box motif), and belongs to DExD/H RNA helicase family, which plays many roles in RNA metabolism including pre-mRNA splicing, ribosome biogenesis, RNA transport, translation initia- tion, and RNA decay [24–28]. Both EBNA2 and EBNA3C combine with Gemin3 and SMN,while EBNA2 cooperate with SMN in transactivation of the viral LMP1 promoter [24–26]. It has been shown that Gemin3 also interacts with and modulates a variety of cellular transcription factors including steroidogenic factor 1(SF-1) [29],[30], early growth response protein 2 (Egr2) [31], forkhead transcription factor FOXL2 [32] , and mitogen Ets repressor METS [33]. Although Gemin3 was shown to play a role in gene transcription regulation, the function of Gemin3 in cell proliferation remains largely unclear. Here we show that Gemin3 is stabilized by EBNA3C via protein-protein interaction and can play a role in cell proliferation through formation of a complex with p53 which results in blocking p53-mediated transcriptional activity and apoptosis pathway. Knockdown of Gemin3 by RNA interference dramatically increases apoptosis of EBV-infected LCLs.

Results EBNA3C forms a complex and co-localizes with Gemin3 in vivo Similar to a screen by Grundoff, et al [24], a previous yeast two- hybrid study showed that C-terminal domain of EBNA3C interacts with Gemin3. To confirm that these two molecules do Figure 1. EBNA3C forms a complex with Gemin3 in EBV associate in vivo, we performed co-immunoprecipitation assays to transformed cells. (A) and (B) Endogenous Gemin3 associates with EBNA3C. Twenty million of Ramos, LCL1, and LCL2 cells were determine if EBNA3C forms a complex with Gemin3 in EBV individually lysed and subjected to immunoprecipitation (IP) with transformed B lymphoma cell lines (LCL1 and LCL2). The B EBNA3C (A10) or Gemin3 (12H12) specific antibody. 5% of whole cell lymphoma cell line Ramos which lacks EBNA3C expression lysates (WCL) were loaded as input. Normal serum IgG was used for because it is EBV negative was used as a control. The results preclear (PC). Lysates and IP complexes were resolved by SDS-PAGE and showed that endogenous Gemin3 was dramatically immunopre- subjected to western blotting (WB) with the indicated antibodies. (C) cipitated by anti-EBNA3C antibody, but not by control mouse Exogenous EBNA3C associates with Gemin3. The EBNA3C stable expressing cells (BJAB7 and BJAB10) and parental BJAB cells were serum (Figure 1A). The reverse immunoprecipitation with anti- individually lysed and subjected to immunoprecipitation (IP) and Gemin3 antibody further confirmed that EBNA3C does form a western blotting as indicated. complex with Gemin3 in vivo (Figure 1B). Since Gemin3 is doi:10.1371/journal.ppat.1002418.g001

PLoS Pathogens | www.plospathogens.org 2 December 2011 | Volume 7 | Issue 12 | e1002418 EBNA3C Stabilizes Gemin3

Figure 2. EBNA3C colocalizes with Gemin3. (A) Colocalization of exogenous E3C and Gemin3 in U2OS cells. Cells transfected with E3C-FLAG and GFP-Gemin3 were stained by using M2 antibody, followed by goat anti-mouse antibody conjugated to Alexa Fluor 594 (red). (B) Endogenous Gemin3 colocalizes with E3C in the EBV-transformed cell line LCL1. Endogenous Gemin3 and E3C were individually detected by using mouse anti-Gemin3 (12H12) and rabbit anti-E3C antibodies, followed by Goat anti-mouse antibody conjugated to Alexa Fluor 594 (red) and goat anti-rabbit antibody conjugated to Alexa Fluor 488 (green). Nuclei were counterstained by using DAPI (blue). The images were sequentially captured using an Olympus confocal microscope. All panels are representative pictures from similar repeat experiments. Enlarged sections are shown at the bottom. Arrows show the colocalization of E3C and Gemin3. doi:10.1371/journal.ppat.1002418.g002

EBNA3C interacts with Gemin3 through its C-terminal the previously identified data by yeast two-hybrid analysis [24], and domains further narrows the interacting domain. To define which domain of EBNA3C interacts with Gemin3, we co-transfected HEK293 cells with expression constructs for EBNA3C enhances the protein stability and production of GFP-tagged Gemin3 and FLAG-tagged full-length (residues 1 to Gemin3 992) or a series of truncated mutant of EBNA3C (1–365, 366–620, To determine if EBNA3C plays a role on the production of or 621–992), and performed coimmunoprecipitation assays with Gemin3, we tested endogenous Gemin3 protein levels in EBNA3C GFP or FLAG antibodies. Consistently, the results showed that stable expressing cell lines (BJAB7 and BJAB10) and parental coimmunoprecipitation targeting Gemin3 or EBNA3C, always BJAB cells, as well as EBV negative Ramos cells. Interestingly, the results in Gemin3 co-immunoprecipitating with both the full-length results showed that EBNA3C greatly induced the production of and C-terminal domain of EBNA3C with relatively high affinity Gemin3 in BJAB cells (Figure 4A). To verify if whole EBV latent (Figure 3A and B). To further determine if the C-terminal domain of infection with EBNA3C expression also has the same effect on EBNA3C alone is sufficient to bind with Gemin3, we performed Gemin3 production, we did a western blot to detect Gemin3 GST pulldown assays by in vitro-translating the full length and protein levels in both PBMC and two EBV-infected derived LCL truncated mutants of EBNA3C followed by co-incubation with cell lines. Consistent with EBNA3C expression alone, the results bacterially expressed GST-Gemin3 protein. The results showed showed that Gemin3 protein levels were significantly increased by that the C-terminal domain (621–992) of EBNA3C directly EBV infection (Figure 4B). The results of Gemin3 protein levels in interacted with Gemin3 (Figure 3C). Similarly, using in vitro- EBNA3C-knockdown BJAB10 and LCL cells were consistently translated Gemin3 coincubated with different bacterially expressed much lower than in the control cells (Figure 4C), further suggesting GST-EBNA3C (1–365, 366–581, 582–792, and 900–992), we that EBNA3C is required for maintenance of Gemin3 levels. To further found that the C-terminal amino acids 621 to 792, a smaller determine if the increased production of Gemin3 is due to post- region than previously identified by yeast two-hybrid analysis (534– translational regulation by EBNA3C, we co-expressed exogenous 778aa, [24]) of EBNA3C was critical for binding to Gemin3 in vitro EBNA3C-FLAG with GFP-Gemin3 or GFP control vector into (Figure 3D and F). To determine the domain of Gemin3 responsible Saos-2 cells and determined the protein levels of GFP-Gemin3 and for interacting with EBNA3C, we generated three truncated GFP. The results showed that the production of GFP-Gemin3 but mutants of GST-Gemin3 (residues 1–272, 307–547 and 546–825) not GFP was enhanced by EBNA3C in a dose-dependent manner and performed GST pulldown assays with in vitro-translated full- (Figure 4D, left and middle panels), indicating that the interaction length EBNA3C. The result showed that Gemin3 bound with of EBNA3C with Gemin3 is important for Gemin3 accumulation. EBNA3C via its C-terminal domain (Figure 3E and F), supporting To this end, we carried out similar experiments by using an

PLoS Pathogens | www.plospathogens.org 3 December 2011 | Volume 7 | Issue 12 | e1002418 EBNA3C Stabilizes Gemin3

Figure 3. EBNA3C and Gemin3 interact through their C-terminal domains. (A) and (B) Gemin3 associates with the C-terminal domain of EBNA3C. Twenty million of HEK 293 cells were cotransfected with plasmids expressing GFP-tagged Gemin3 and Flag-tagged either full-length or the truncated mutants of EBNA3C. At 36 h post-transfection, cells were harvested and subjected to immunoprecipitation using anti-FLAG (M2) or GFP antibodies followed by western blotting with GFP or M2 antibody. 5% of whole cell lysates (WCL) were used as input. The membrane was stripped and reblotted with M2 or GFP antibody. (C) Gemin3 binds to C-terminal domain of E3C in vitro. The 35S-radiolabeled in vitro-translated proteins of E3C truncated mutants were precleared with GST bead, followed by incubation with GST or GST-Gemin3 beads. The bound protein mixtures were resolved by appropriate SDS-PAGE, and autography. 5% of in vitro translated protein is used as input. The quantification of relative amount of bound protein (RBU) was shown at the bottom. (D) The 35S-radiolabeled in vitro-translated protein full-length Gemin3 was pulled down by truncated mutants of EBNA3C fusion with GST (GST-E3C 1–365, 366–581,582–792, and 900–992). Coomassie blue staining of purified GST-EBNA3C truncated proteins is shown at the bottom panel. (E) E3C binds to C-terminal domain of Gemin3 in vitro. The 35S-radiolabeled in vitro-translated protein full- length EBNA3C was pulled down by truncated mutants of Gemin3 fusion with GST (GST-Gemin3 1–272, 307–547, and 546–825). Coomassie blue staining of purified GST-Gemin3 truncated proteins is shown at the bottom. (F) Schematics illustrate different structural domains of E3C and Gemin3. The respective binding domain(s) of two proteins are indicated by bold. doi:10.1371/journal.ppat.1002418.g003

EBNA3C mutant lacking Gemin3-interacting domain, and found Gemin3 interacts with p53 and contributes to EBNA3C- that deletion of the Gemin3-interacting domain efficiently mediated inhibition of p53 transcriptional activity abolished the effect of EBNA3C on Gemin3 production Our previous studies showed that EBNA3C blocks p53- (Figure 4D, left and right panels). To further confirm that mediated transcriptional as well as apoptotic activity [22],[34]. EBNA3C-induced Gemin3 levels were due to enhanced Gemin3 Gemin3 plays an essential role in cell survival and can function as protein stability, we performed the protein stability assays for a transcriptional repressor through interaction with a number of Gemin3 by treating BJAB (EBNA3C negative) and BJAB10 transcriptional factors [35],[36]. Therefore, we hypothesized that (EBNA3C positive) cells with cycloheximide (a protein translation EBNA3C enhanced Gemin3 levels may be due to its interaction inhibitor). The results showed that the stability of Gemin3 was with p53 and in turn repress the transcriptional activity of p53. To dramatically enhanced in the presence of EBNA3C compared to this end, we first asked if Gemin3 can directly bind to p53 in vitro. cells without EBNA3C (Figure 4E). Using in vitro-translated Gemin3, we incubated it with bacterially

PLoS Pathogens | www.plospathogens.org 4 December 2011 | Volume 7 | Issue 12 | e1002418 EBNA3C Stabilizes Gemin3

Figure 4. EBNA3C enhances the protein stability of Gemin3. (A) and (B) E3C increases the protein production of endogenous Gemin3. Ten million of EBV negative cells (Ramos, BJAB and PBMC), EBNA3C- expressing cells (BJAB7 and BJAB10), and EBV-transformed cells (LCL1 and LCL2) were lysed and subjected to western blot with indicated antibodies. The data show that the protein level of Gemin3 in the EBNA3C or EBV positive cells was significantly upregulated. (C) The protein level of Gemin3 is decreased in BJAB10 and LCL1 cells with EBNA3C stable knockdown. BJAB10 and LCL1 cells with Lentivirus-delivered GFP labeled shRNA against EBNA3C (shE3C) or scramble control (shCtrl) were showed on the left panel. The protein levels of E3C and Gemin3 are detected by western blotting with indicated antibodies. GAPDH immunoblotting was used as the loading control. The relative quantitation of Gemin3 and E3C protein levels are normalized by GAPDH. (D) E3C increases the protein level of exogenous Gemin3. Saos-2 cells were transfected GFP-Gemin3 or GFP with increasing amounts of full length (FL) EBNA3C-FLAG or its C-terminal deleted mutant (DC). The transiently transfected cells were harvested at 36 h post-transfection, the protein levels of exogenous GFP-Gemin3 and GFP were detected by western blotting with GFP antibody. The relative quantitation of GFP-Gemin3 or GFP is shown in the middle panel. (E) EBNA3C enhances the protein stability of Gemin3. The cell lysates of BJAB or BJAB10 cells treated with cycloheximide (CHX, 100 mg/ml) for 0, 2, 4 and 6 hours were subjected to immunoblotting as indicated. GAPDH immunoblotting was used as the loading control. The relative quantitation of Gemin3 is shown in the middle panel. doi:10.1371/journal.ppat.1002418.g004 expressed GST or GST-p53 protein. We found that Gemin3 interact with p53. To test if endogenous p53 interacts with strongly bound to p53 but not the GST control (Figure 5A, lane 2 Gemin3 in cells and whether this interaction is impaired by and 3). Using different truncation mutants of p53 fusion with EBNA3C, we performed immunoprecipitation assays with anti- GST, we found that the DNA-binding domain (amino acids 100– p53 antibody followed by western blotting with Gemin3 antibody 300) of p53 is critical for interaction with Gemin3 (Figure 5A, lane individually from cell lysates of BJAB, BJAB10 and LCL1 cells. 4 to 6). To define the binding site of Gemin3 with p53, we utilized The results showed that Gemin3 and p53 do form a complex in full length and truncated mutants of Gemin3 fusion with GST to EBV negative BJAB cells, and that the association of p53 with incubate with in vitro-translated p53. The results showed that the Gemin3 was greatly enhanced by 2.2 fold in EBNA3C-expressing C-terminal domain (amino acids 546–825) alone of Gemin3 BJAB10 cells and 5.2 fold in LCL1 cells when compared to that in presents similar strong binding with p53 as full length Gemin3 the EBV negative BJAB cells (Figure 5C, bottom panel). Since (Figure 5B). This further confirms that Gemin3 can directly Gemin3 bound to the DNA-binding domain of p53, we wanted to

PLoS Pathogens | www.plospathogens.org 5 December 2011 | Volume 7 | Issue 12 | e1002418 EBNA3C Stabilizes Gemin3

Figure 5. Gemin3 interacts with p53 and contributes to EBNA3C-mediated inhibition of p53 transcriptional activity. (A) Gemin3 binds with DNA-binding domain of p53 in vitro. 35S-radiolabeled Gemin3 was in-vitro translated and incubated with bacterially purified GST, GST fusion with full length (1–393) or truncated mutants of p53 (1–83, 100–300, and 300–393). The pull-down complexes were resolved by appropriate SDS- PAGE and autography. The amount of bound protein was quantified with ImageQuant software. Coomassie blue staining of purified GST protein is shown in the middle panel. Schematic illustrates the binding domains of p53 with Gemin3 and EBNA3C. (B) C-terminal domain of Gemin3 binds with p53 in vitro. 35S-radiolabeled p53 was in vitro translated and incubated with bacterially purified GST control, full length GST-Gemin3 (1–825) or its truncations (1–272, 307–547, and 546–825). The GST pull down assay was analyzed as the described above. (C) EBNA3C increases the interaction of p53 with Gemin3. Twenty million of BJAB, BJAB10 and LCL1 cells were individually harvested, lysed and subjected to immunoprecipitation (IP) with p53 specific antibody and subsequently western blotted with Gemin3 or p53 antibody. The relative quantitation of Gemin3 complex with p53 was calculated by IP compared with input and shown in bottom panel. (D) Gemin3 reduces DNA-binding affinity of p53. Saos-2 cells were co-transfected HA-p53 with or without GFP-Gemin3 in the presence of p53-RE-Luc containing 13 copies of p53-binding sties or pGL3-basic vector alone. Chromatin immunoprecipitation assays were performed with anti-HA or normal lgG antibodies control. The DNA binding ability of p53 was detected by standard (upper) and quantitative real-time (lower) PCR with primers targeting ampicilin gene of pGL3 plasmid. (E) Gemin3 inhibits the transcriptional activity of p53 in the luciferase reporter assay. Saos-2 cells were co-transfected with 3 mg of the pGL3-p53-RE-Luc, 10 mg HA-p53 in the presence of either vector control or increasing amounts of GFP-Gemin3 (5 mg and 10 mg). Each transfection was performed in triplicate. Error bars indicated standard variations. Bottoms panels show the protein levels detected by western blotting analysis with the indicated antibodies. GAPDH was used as a control for equal loading. The relative luciferase unit (RLU) is showed by normalization with vector alone. (F) Gemin3 knockdown reduces E3C- mediated inhibition of p53 transcriptional activity in the luciferase reporter assays. Saos-2 cells with stable Gemin3 knockdown (shG3) or control (shCtrl) were individually co-transfected p53-RE-Luc with HA-p53, HA-p53 and E3C-FLAG or vector alone. The western blotting data of each protein is shown at the bottom panel. The relative luciferase unit (RLU) is showed by normalization with vector alone. Plasmid expressing RFP was used for normalized transfection efficiency. doi:10.1371/journal.ppat.1002418.g005 know if Gemin3 blocks sequence specific DNA-binding ability of consequence of Gemin3 blocking DNA-binding ability of p53 and p53, and so performed chromatin immunoprecipitation assays argue the possibility that Gemin3 can directly bind to DNA probe, with exogenous p53 alone or p53 and Gemin3 in the presence and we also performed reporter assays by co-expressing exogenous absence of p53-responsive DNA element (p53-RE). As shown in HA-p53 with increasing doses of GFP-tagged Gemin3 in the the Figure 5D, Gemin3 dramatically reduced the ability of p53 to presence of 13 copies of p53-binding sites driven luciferase bind to the p53-responsive DNA element. To further confirm the reporter into p53-null Saos-2 cells. The results showed that

PLoS Pathogens | www.plospathogens.org 6 December 2011 | Volume 7 | Issue 12 | e1002418 EBNA3C Stabilizes Gemin3

Gemin3 diminished p53-mediated transcriptional activity in a EBNA3C and this was identified with high frequency in positive dose-dependent manner (Figure 5E). The expression levels of yeast clones when the C-terminal domain of EBNA3C was used as Gemin3, p53, and GAPDH as a loading control, were also bait (data not shown). We now confirm that Gemin3 directly binds analyzed by western blotting (Figure 5E, bottom panels). To to EBNA3C in vitro and in vivo, and this interaction led to answer if EBNA3C-mediated inhibition of p53 transcriptional increased Gemin3 protein stability and its accumulation in B activity is dependent on Gemin3 accumulation, we performed lymphoma cells and EBV-transformed lymphoblastoid cell lines. similar reporter assays by co-expressing p53 with or without Furthermore, EBNA3C promoted the formation of a complex EBNA3C in the presence of specific Gemin3 shRNA (shG3) or with p53 and Gemin3 in vivo which was important for blocking non-specific control shRNA (shCtrl). Strikingly, the results showed p53-mediated transcriptional activity and apoptosis. Inhibition of that EBNA3C-mediated inhibition of p53 transcriptional activity is Gemin3 expression dramatically abolished EBNA3C-mediated dramatically reversed once Gemin3 is knocked down (Figure 5F, inhibition of p53-induced apoptosis (Figure 7). The emerging compare lane 3 with 6). This suggests that Gemin3 is important for evidence showing Gemin3 as a DEAD-box RNA helicase that EBNA3C-mediated inhibition of p53 function. plays a role in carcinogenesis, will inspire us to develop efficient helicase inhibitors as a potential target for anti-cancer in the Gemin3 knockdown attenuates EBNA3C-mediated future. inhibition of p53-induced apoptosis Gemin3 is also an integral component of the SMN complex, Studies in our lab have shown that EBNA3C is able to inhibit which plays an essential role in the production of spliceosomal p53-induced apoptosis in p53-null Saos2 cells [22],[34]. To further small nuclear ribonucleoproteins (snRNPs) [38], regulation of confirm the significance of Gemin3 on EBNA3C-mediated DNA transcription [30], pre-mRNA splicing [37], and axonal inhibition of p53 function, we verified whether or not Gemin3 RNA transport [39]. In addition to interaction with Gemin3, knockdown affects EBNA3C-mediated inhibition of p53-induced EBNA3C also has been shown to associate with SMN [25]. This apoptosis by using colony formation assays. The results showed further supports the notion that EBNA3C targets the SMN that coexpression of EBNA3C with p53 markedly increased the complex and can impair the function of each component including colony formation of Saos-2 cell compared to that produced by p53 Gemin3 in the SMN complex. Here, we demonstrate a novel alone (Figure 6A, left panel). In contrast, although less colony function of Gemin3 as a regulator that suppresses p53-mediated formation was produced in the vector alone with the Gemin3 transcriptional activity and apoptosis. Interestingly, SMN was also knockdown (shG3) compared to that with the control knockdown shown to interact with p53 [40]. Therefore, our results showing (shCtrl) (Figure 6A, top panel), the colony formation of p53 co- that knockdown of Gemin3 sufficiently rescues p53, suggest that expressed with EBNA3C was significantly inhibited in Gemin3 Gemin3 could be a critical member of the SMN complex to knockdown cells (Figure 6A). Thus, these data revealed a role for suppress p53 function. This provides an explanation as to why EBNA3C in upregulation of Gemin3 for anti-apoptosis and EBNA3C promotes complex formation of p53 and Gemin3 promotes cell proliferation. through enhancing Gemin3 protein stability. To further prove that Gemin3 plays an important role in cell The N-terminal domain of Gemin3 contains the conserved proliferation, we performed apoptosis assays using B lymphoma helicase motifs, while the non-conserved C-terminal domain can cells or LCLs with or without lentivirus-mediated Gemin3 interact with a variety of cellular and viral factors. In this study, we knockdown. Gemin3 expression was significantly knocked down found that Gemin3 binds with both EBNA3C and p53 through in the EBV negative B lymphoma cell lines Ramos and BJAB, EBV the same region (amino acid 548 to 825) of its C-terminal domain. transformed B cell line LCL1 as well as EBNA3C stably expressing Considering that EBNA3C individually binds to p53 and Gemin3 BJAB cell lines BJAB7 and BJAB10 (Figure 6B). The results of through its N-terminal and C-terminal domains. There is a strong apoptotic assays showed that Gemin3 knockdown cells had a possibility for EBNA3C to act as an adaptor to promote Gemin3 dramatic increase in apoptosis compared to the control knockdown interaction with p53. This also may provide an explanation as to cells (Figure 6C). Furthermore, Gemin3 knockdown in EBV or why the levels of p53 in complex with Gemin3 are dramatically EBNA3C positive cells showed significantly higher levels of enhanced in the presence of EBNA3C. apoptosis than that in EBV or EBNA3C negative cells (Figure 6C, Although it has been shown that Gemin3 plays a diverse roles bottom panel). Consistently, the quantitative PCR analysis showed on repressing gene transcription [30], the mechanism of Gemin3- that the transcriptional levels of p53 downstream genes including mediated transcriptional repression is not fully clear. One of the p21, Bax and p53 were enhanced when Gemin3 was knocked down potential mechanisms could be through recruitment of specific in EBNA3C positive cells and were remarkably higher than that in transcription co-repressors. For examples, Gemin3 interacts with EBNA3C negative cells (Figure 6D). Therefore, Gemin3 plays a METS to repress Ets by assembling a complex of N-CoR, Sin3A, critical role in cell proliferation in EBNA3C positive cells. HDAC-2, and HDAC-5 [30],[33],[41]. Gemin3 was also found to form a complex with METS (mitogenic Ets transcriptional Discussion suppressor)/PE1 or ERF (Ets2 repressor factor) controlling cellular proliferation and differentiation through recruitment of HDAC2 and Emerging evidence have indicated that Gemin3 is an essential HDAC5 [42]. It also interacts with and represses the transcriptional gene for embryonic development and survival from mammal to activity of Egr2/Krox-20 which is dependent in part on HDAC Drosophila [23],[37]. Gemin3 (DP103/DDX20) was originally recruitment [31]. Gemin3 also interacts with the transcriptional discovered in a screen for cellular factors that bind to EBNA2 and factor FOXL2 important for inducing apoptosis [32]. However, our EBNA3C using the yeast two-hybrid system [24]. Gemin3 was study showed that Gemin3 reduces p53 transcriptional activity and shown to be involved in EBNA2-mediated transactivation and now provides another potential mechanism through which Gemin3 transformation, and a deletion mutant of EBNA2 lacking the can sequester a transactivation cofactor or may disrupt a transcrip- Gemin3-binding site severely impeded LMP1 transactivation and tionally active nucleic acid-protein complex. viral transformation [26]. However, there was no previous report Previous studies in our lab indicated that EBNA3C targets on the functional effect of EBNA3C on Gemin3. Our yeast two- multiple factors to deregulate the p53 pathway and so drive cell hybrid screen showed that Gemin3 strongly interacted with proliferation. For example, EBNA3C has a unique activity of

PLoS Pathogens | www.plospathogens.org 7 December 2011 | Volume 7 | Issue 12 | e1002418 EBNA3C Stabilizes Gemin3

Figure 6. Gemin3 knockdown attenuates EBNA3C-mediated inhibition of p53-induced apoptosis. (A) Saos-2 (p532/2) cells were electroporated with different combinations of expression plasmids for HA-p53, EBNA3C-FLAG or vector alone in the presence of small hairpin RNA against Gemin3 (shG3) or control (shCtrl) as indicated. 26103 transfected cells were cultured in the selection medium (DMEM supplemented with 100 mg/ml G418). After a 2-week selection, cells were fixed on the plates with 4% formaldehyde and stained with 0.1% crystal violet. The area of colonies (pixels) in each dish was calculated by LiCor Odyssey. The number represents the averages of data from two independent experiments. Plasmid expressing RFP was used for normalized transfection efficiency. (B) Western blots showing the protein level of Gemin3 in the lentivirus- mediated Gemin3 or control knockdown cell lines. GAPDH was used as the loading control. (C) Gemin3 knockdown increases apoptosis of EBV negative cells (Ramos and BJAB), EBNA3C positive cells (BJAB7 and BJAB10), and EBV transformed cells (LCL1). Cells were harvested after a 12-h serum starvation and fixed. Levels of cells undergoing apoptosis (sub-G1 phase) in individual PI-stained samples were detected by flow cytometry, and the data were analyzed by FlowJo software. The bar diagram shown at the bottom panel represents the mean of three independent experiments and the results of comparing with each control knockdown sample. (D) Quantitative real-time PCR analysis showed that p53, p21 and Bax genes were upregulated in the Gemin3 knockdown cells. Total RNA was individually isolated from the Gemin3 (shG3) or control (shCtrl) knockdown cells with 12- h serum starvation treatment. A 2 mg total RNA was used to synthesis cDNA. Error bars show standard deviations. doi:10.1371/journal.ppat.1002418.g006 ubiquitylation and de-ubiquitylation [17],[18],[21], and also directly interact with p53 through its DNA-binding domain and in suppresses p53 function through formation of a complex with turn inhibits its activities. This pathway is essentially targeted by Mdm2 [21]. More recently, our lab also showed that EBNA3C EBNA3C in EBV-transformed lymphoblastoid cells. directly competes with two p53-associated growth inhibitors ING4 and ING5 for attenuating p53 function [34]. Despite current Materials and Methods studies which convincingly showed that EBNA3C inhibit p53 function, it is still unknown as to why the protein level of p53 is not DNA constructs and antibodies affected in EBV-transformed LCLs or in B lymphoma expressing pA3F-EBNA3C constructs expressing either full-length EB- EBNA3C [43–46]. Here, our study further addresses a potential NA3C or different truncated versions of EBNA3C 1–365, 366– mechanism that EBNA3C can block p53 function through 620, and 621–992 with a Flag tag at the carboxy-terminal end and upregulating Gemin3 protein levels and so promoting the Glutathione S-transferase (GST)-EBNA3C truncation mutation formation of a complex of p53 with Gemin3. This is distinctly were described previously [20]. Constructs expressing green different from the strategy used by KSHV encoded LANA where fluorescent protein (GFP)-tagged Gemin3 was prepared by cloning p53 ubiquitylation is induced and results in its degradation [47]. In PCR-amplified fragments into pEGFP-C1 vector (BD Biosciences summary, this study provides initial evidence that Gemin3 can Clontech) at EcoRI and SalI restriction sites. The plasmid pGL3-

PLoS Pathogens | www.plospathogens.org 8 December 2011 | Volume 7 | Issue 12 | e1002418 EBNA3C Stabilizes Gemin3

Cell culture and transfection Human embryonic kidney cells transformed with sheared adenovirus type 5 DNA HEK293 cell line and p53-null cell line SaoS-2 were obtained from Jon Aster (Brigham and Woman’s Hospital, Boston, MA) [48]. U2OS is also a human osteosarcoma cell line [49]. EBV negative Burkitt’s lymphoma cell lines BJAB and Ramos were provided by Elliott Kieff (Brigham and Woman’s Hospital, Boston, MA) [50]. LCL1 and LCL2 are in vitro- transformed EBV positive cell lines. BJAB cells expressing EBNA3C (BJAB7 and BJAB10) were generated previously by transfecting with pZipneo eukaryotic expression vector with EBNA3C cDNA followed by neomycin selection [51]. HEK 293, U2OS and Saos-2 cells were grown in Dulbecco’s modified Eagle’s medium (purchased from HyClone, Logan, UT) supple- mented with 10% fetal bovine serum, 50 U/ml penicillin, 50 mg/ ml streptomycin, and 2 mM L-glutamine. BJAB, Ramos and the EBV-positive cell lines were maintained in RPMI 1640 medium (HyClone, Logan, UT) supplemented as described for Dulbecco’s Figure 7. A schematic model depicting the Gemin3-mediated modified Eagle’s medium above. All cultures were incubated at transcriptional regulation of p53 by EBNA3C in the EBV 37uC in a humidified environment supplemented with 5% CO2. latently infected cells. Left panel, in response to genotoxic stress, Cells were transfected by electroporation with a Bio-Rad Gene p53 achieves its anti-proliferative properties through its function as a Pulser II electroporator. Briefly, 156106 cells harvested in DNA-binding transcriptional activator, and induce expression of exponential phase were collected, washed in phosphate-buffered downstream target genes (including p21 and BAX) for cell-cycle arrest and apoptosis. Right panel, in the EBV latency III cells, EBNA3C not only saline (PBS), and resuspended in 400 ml of the appropriate stabilizes Gemin3 through the interaction of their C-terminal domains medium containing DNA for transfection [52]. Resuspended cells and but also enhances a stable complex of Gemin3 with p53 for were transferred to a 0.4-cm-gap cuvette, and electroporation was blocking p53-mediated transcriptional activity and cell apoptosis. performed at 975 mF, 210 V for HEK293 and Saos-2 cells. Gemin3 knockdown (siRNA) increases the sensitivity of the EBNA3C- Transfected cells were transferred to a 100-mm petri dish expressing cells to stress-induced apoptosis. p53-RE, p53 responsive containing 10 ml of complete medium and incubated at 37uC. element. doi:10.1371/journal.ppat.1002418.g007 Immunoprecipitation and Western blotting p53-RE contains 13 copies of p53-binding site at the upstream of Transfected cells were harvested, washed with ice-cold PBS, and lysed in 0.5 ml ice-cold radioimmunoprecipitation (RIPA) buffer firefly luciferase gene was constructed by EcoRV insertion of p53- (1% Nonidet P-40 [NP-40], 10 mM Tris [pH 7.5], 2 mM EDTA, binding sequences into the pGL-3 luciferase reporter plasmid 150 mM NaCl), supplemented with protease inhibitors (1 mM (Kindly provided by Wafik S. EI-Deiry at University of Pennsylva- phenylmethylsulfonyl fluoride, 1 mg/ml aprotinin, 1 mg/ml pep- nia, Philadelphia, Pennsylvania). pGEX-p53 expresses an N- statin, and 1 mg/ml leupeptin). Cell debris was removed by terminal glutathione S-transferase (GST)-p53 fusion protein was centrifugation at 21,0006g (10 min and 4uC), and the supernatant derived from pGEX-2T (Amersham Pharmacia, Inc, Piscataway, was transferred to a fresh microcentrifuge tube. Lysates were then NJ) by insertion of human p53 cDNA (A gift from Gary J Nabel, precleared by end-over-end rotation with normal mouse serum National Institutes of Health, Bethesda, MD) at the BamH1 and and 30 ml of a 1:1 mixture of Protein A-Protein G-conjugated EcoR1 sites. pcDNA-HA-p53 was generated by cloning PCR- Sepharose beads (1 h, 4uC). Beads were spun out, and supernatant amplified p53 cDNA using pGEX-p53 as a template into the was transferred to a fresh microcentrifuge tube and approximately pcDNA3-HA vector at EcoR1 and Not1 sites. GST-p53 truncation 5% of the lysate was saved for input control. The protein of mutants were constructed by insertion of PCR fragments into the interest was captured by rotating the remaining lysate with 1 mgof pGEX-5x-1 backbone (gift from Shelley L Berger, The Wistar appropriate antibody overnight at 4uC. Immune complexes were Institute, Philadelphia, PA). Plasmid expressing GST-Gemin3 was captured with 30 ml of a 1:1 mixture of Protein A and Protein G kindly provided by Dr. Gideon Dreyfuss (Howard Hughes Medical Sepharose beads, pelleted, and washed five times with ice-cold Institute Investigator at University of Pennsylvania Perelman RIPA buffer. For Western blot assays, input lysates and School of Medicine) and described previously [23]. GST-Gemin3 immunoprecipitated (IP) complexes were boiled in Laemmli buffer truncation mutants GST-Gemin3 1–272 was constructed by [53], fractionated by SDS-PAGE, and transferred to a 0.45 mm insertion of PCR fragments into pGEX-2TK derivative vector at nitrocellulose membrane. The membranes were then probed with Kpn1andEcoR1 sites, GST-Gemin3 307–547 and GST-Gemin3 appropriate antibodies followed by incubation with appropriate 546–825 into pGEX-2TK vector BamH1 and EcoR1 sites. All infrared-tagged secondary antibodies and viewed on an Odyssey constructs and mutations were verified by DNA sequencing. imager (LiCor Inc., Lincoln, NE). Mouse monoclonal anti-Gemin3 (12H12) was kindly provided by Dr. Gideon Dreyfuss (Howard Hughes Medical Institute Investiga- Purification of GST fusion proteins tor at University of Pennsylvania School of Medicine). The Escherichia coli BL21 (DE3) cells were transformed with the monoclonal antibodies mouse anti-myc (9E10) and anti-EBNA3C plasmid constructs for each GST fusion protein. Single colonies (A10) were prepared from the respective hybridoma cultures. Mouse were picked and grown overnight in 3 ml of Luria broth monoclonal antibody anti-FLAG epitope (M2) was purchased from supplemented with 100 mg/ml ampicillin. One milliliter of the Sigma-Aldrich Corp. (St. Louis, MO). Mouse monoclonal antibody overnight culture was used to inoculate a 500 ml culture. The reactive to p53 (DO-1) and GFP (F56-BA1) were purchased from larger culture was incubated until the optical density at 600 nm Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). was approximately 0.6, at which point it was induced with 1 mM

PLoS Pathogens | www.plospathogens.org 9 December 2011 | Volume 7 | Issue 12 | e1002418 EBNA3C Stabilizes Gemin3 isopropyl-b-D-thiogalactopyranoside (IPTG) for 12 h at 30uC. Luciferase reporter assay The bacteria were pelleted, washed once with STE buffer Twelve million Saos-2 cells were co-transfected by using a Bio- (100 mM NaCl, 10 mM Tris, and 1 mM EDTA, pH 7.5), Rad electroporater (Bio-Rad Laboratories, Inc., Hercules, CA) resuspended in 3 ml NETN buffer (0.5% NP-40, 100 mM NaCl, with different combination of pGL3-p53-RE, pcDNA-HA-p53, 20 mM Tris, 1 mM EDTA, pH 8.0), supplemented with protease pA3F-EBNA3C and GFP-Gemin3. At 24 h post-transfection, cells inhibitors, and incubated on ice for 15 min. A volume of 150 mlof were harvested, washed in PBS, and lysed by cell lysis buffer 1 M dithiothreitol (DTT) and 1.8 ml of a 10% solution of Sarkosyl (BioVision, Inc., Mountain View, CA). Forty microliters of cell in STE buffer was added, and the suspension was sonicated (for lysate was used for the reporter assay, using an LMaxII384 3 min on ice) to solubilize the proteins. The lysates were luminometer (Molecular Devices, Inc., Sunnyvale, CA). A portion centrifuged (12,0006g, 10 min, 4uC) to separate the unsolubilized of the cell lysate was used for Western blotting. Transferred fraction. The clear supernatant was transferred to a fresh tube, to proteins were detected with Odyssey infrared scanning technology which 3 ml of 10% Triton X-100 in STE buffer and 200 mlof (LI-COR, Inc., Lincoln, NE), using Alexa Fluor 680 and Alexa Glutathione-Sepharose beads were added. The tube was rotated Fluor 800 (Molecular Probes, Carlsbad, CA, and Rockland, overnight at 4uC, after which the purified protein bound to Gilbertsville, PA, respectively). All the transfections were per- Glutathione was collected by centrifugation (2 min, 6006g, 4uC) formed multiple times, and the results shown represent the means and washed five times with NETN buffer supplemented with of the data from three independent experiments. protease inhibitors. The level of purification was determined by SDS-PAGE, and purified proteins were stored at 4uC. Lentiviral-mediated gene silencing For the lentivirus-mediated knockdown of EBNA3C or GST pull-down assays Gemin3, the EBNA3C shRNA sequence (CCAUAUACCG- For pull-down assays from cell lysates, lysates were prepared in CAAGGAAUA) or Gemin3 shRNA (ACUCCCCAGUGAGAC- RIPA buffer (0.5% NP-40, 10 mM Tris [pH 7.5], 2 mM EDTA, CAUU) was respectively inserted into pGIPZ vector according to 150 mM NaCl, supplemented with protease inhibitors). Lysates the manufacture’s instructions (Open Biosystem, Inc, Huntsville, were precleared and then rotated with either GST control or the AL), the vector expressing EBNA3C or Gemin3 small hairpin appropriate GST fusion protein bound to Glutathione-Sepharose RNA is abbreviated as shE3C or shG3, respectively. A 21-mer beads. For in vitro binding experiments, GST fusion proteins were oligonucleotide (UCUCGCUUGGGCGAGAGUAAG) that had incubated with 35S-labeled in vitro-translated protein in binding no significant homology to any known human mRNA in the buffer (16PBS, 0.1% NP-40, 0.5 mM DTT, 10% glycerol, databases was cloned in the same vector and used as control. supplemented with protease inhibitors). In vitro translation was Control shRNA is hereinafter abbreviated as shCtrl. performed with the T7-TNT Quick Coupled transcription- Lentiviruses were produced by transient transfection into HEK translation system (Promega Inc., Madison, WI) according to the 293T cells as previously described with the following modifications 6 6 manufacturer’s instructions. [54]. A total of 2 10 293T cells were seeded in 10-cm-diameter dishes in DMEM (HyClone, Logan, UT) supplemented with 10% FBS and cultured for 24 h prior to transfection. A total 20 mgof Immunofluorescence plasmid DNA was used for the transfection of each dish, including To check the co-localization of ectopically expressed GFP- 1.5 mg of envelope plasmid pCMV-VSV-G (catalog no. 8454; Gemin3 and Flag-EBNA3C in the cells, we used Lipofectamine Addgene, Inc., Cambridge, MA), 3 mg of packaging plasmid 2000 (Invitrogen, Carlsbad, CA) to transfect U2OS cells with the pRSV-REV (catalog no. 12251 Addgene, Inc., Cambridge, MA), plasmids then cultured on coverslips. At 36 h posttransfection, 5 mg of packaging plasmid pMDLg/Prre (catalog no. 12251 cells were fixed using 3% paraformaldelhyde with 0.1% Triton X- Addgene, Inc., Cambridge, MA), and 10.5 mg of lentiviral vector 100 for 20 min at room temperature. We used LCL1 cells to plasmid. The precipitation was formed by adding the plasmids to a examine the co-localization of endogenous Gemin3 with EB- final volume of 438 mlofH20 and 62 ml of 2 M CaCl2, mixing NA3C, appropriate LCL1 cells were added onto slides and fixed well, adding 500 mlof26HEPES-buffered saline, and then using the same method after culture 5 h. Fixed cells were washed incubating at room temperature for 30 min. Chloroquine was with PBS and subsequently blocked in 1% BSA for 10 min. added to the 10 ml of plated media with a final concentration of Gemin3 was detected using mouse monoclonal antibody (12H12). 25 mM at 5 minutes prior to transfection. The medium was Endogenous EBNA3C was detected using EBNA3C-reactive replaced after 12 h with DMEM supplemented with 10% FBS and rabbit polyclonal antibody (1:150 dilution); Flag-tagged EBNA3C 10 mM HEPES, and 10 mM sodium butyrate. The medium was was detected using M2 antibody (1:1,000 dilution; Santa Cruz replaced again 10 hours later using DMEM supplemented with Biotechnology, Inc., Santa Cruz, CA). Primary antibodies were 10% FBS and 10 mM HEPES. The conditioned medium was incubated with the cells for 60 min at the room temperature. Cells collected four times at 12 h interval, filtered through 0.45 mm were washed three times with PBS and exposed to secondary pore-size cellulose acetate filters, and stored on ice. The virus was antibodies. Goat anti-mouse antibody conjugated to Alexa Fluor concentrated by spinning at 70,0006g for 2.5 h. The concentrated 594 to detect Gemin3 and goat anti-rabbit antibody conjugated to virus was resuspended in RPMI then used to infect 106 cells in the Alexa Fluor 488 to detect EBNA3C were respectively used for presence of 20 mM/ml Polybrene. After 72 h, add puromycin to LCL1 cells, and Goat anti-mouse antibody conjugated to Alexa final concentration of 2 mg/ml for selection. GFP immunofluo- Fluor 594 to detect FLAG-EBNA3C was used for U2OS cells. rescence was assessed by using an Olympus IX71 microscope Secondary antibodies were diluted in blocking buffer at 1:1,000 filtered with 560-nm excitation and 645-nm emission filters. and incubated for 1 h at RT, followed by three washes with Visible colonies were grown to 80% confluence in the presence of blocking buffer. The last wash contained 49,69-diamidino-2- 2 mg/ml puromycin prior to western blot and apoptosis analysis. phenylindole (DAPI; Promega, Madison, WI) to counterstain the nuclei. The slides were examined using Olympus confocal Chromatin immunoprecipitation assay microscopy and the images were analyzed with a Fluoview The chromatin immunoprecipitation (ChIP) experiments were FV300 (Olympus, Melville, NY) software. done essentially as previously described with some modifications

PLoS Pathogens | www.plospathogens.org 10 December 2011 | Volume 7 | Issue 12 | e1002418 EBNA3C Stabilizes Gemin3

[55],[56]. Saos-2 cells (106106) transfected HA-p53 with or (Invitrogen, Inc., Carlsbad, CA). The primers for real-time PCR without GFP-Gemin3 in the presence of pGL-p53-RE or pGL3- were as followings: for p53: 59-CCT GAGGTTGGCTCTGAC- basic vector alone were cross-linked with 1.1% (v/v) formalde- TGTA-39(sense) and 59-TCCGTCCCAGTAGATTACCAC- 39 hyde, 100 mM NaCl, 0.5 mM EGTA, and 50 mM Tris-HCl (antisense), yielding a 136-bp product; for p21: 59-GAGGGCAAG- (pH 8.0) in growth medium at 37uC for 10 min, then at 4uC for TACGAGTGG CAA-39 (sense) and 59- CTGCGCATTGCTC- 50 min. Formaldehyde was quenched by adding 0.05 vol 2.5 M CGCTAACC-39 (antisense), yielding a 170-bp product; for Bax: 59- glycine. Fixed cells were washed with PBS, incubated for 15 min TGCTTCAGGGTTTCATCCAGGA-39 (sense) and 59- ACGG- in 15 ml of 10 mM Tris-HCl (pH 8.0), 10 mM EDTA, 0.5 mM CGGCAATCATCCTCTG-39 (antisense), yielding a 172-bp pro- EGTA, and 0.25% (v/v) Triton X-100, followed by 15 min in duct; and for GAPDH (glyceraldehyde-3-phosphate dehydroge- 15 ml of 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 0.5 mM nase): 59-CTCCTCTGACTTCAAC AGCG-39 (sense) and 59- EGTA, and 200 mM NaCl, and finally sonicated in 1 ml of GCCAAATTCGTTGTCATACCAG-39 (antisense), yielding a 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 0.5 mM EGTA, 1% 112-bp product. The cDNA was amplified by using 10 ml of Master (w/v) SDS plus 1 mM PMSF, 1 mg/ml aprotonin, leupettin, and Mix from the DyNAmo SYBR green quantitative real-time PCR kit pestatin to an average fragment size of 300–500 bp. 20% of (MJ Research, Inc.), 1 mM of each primer, and 2 ml of the cDNA solubilized chromatin extracts were saved for input followed with product in a 20 ml total volume. Thirty cycles of 1 min at 94uC, 30 s cross-link reverse step, and the remaining were clarified by at 55uC, and 40 s at 72uC were followed by 10 min at 72uCinan centrifugation at 12,000 g, and diluted to 6 OD260 U/ml in IP MJ Research Opticon II thermocycler (MJ Research, Inc., buffer [140 mM NaCl, 1% (w/v) Triton X-100, 0.1% (w/v) Waltham, MA). A melting curve analysis was performed to verify sodium deoxycholate, 1 mM PMSF, 100 mg/ml salmon sperm the specificities of the amplified products. The values for the relative DNA, and 100 mg/ml BSA]; preincubated for 1 h at 4uC with levels of change were calculated by the ‘‘delta delta threshold cycle’’ 10 ml/ml 50% (v/v) Protein A-agarose (Invitrogen Life Technol- (DDC ) method and each sample were tested in triplicates. ogies, Camarillo, CA) with normal mouse/rabbit sera; reconsti- T tuted in PBS, and washed several times in IP buffer. Aliquots Apoptosis assay (600 ml) were incubated with 20 mg of each specific antibody for The apoptotic cells of stable Gemin3 and control knock down overnight at 4uC. Immune complexes were separated into bound and unbound complexes with protein A-agarose and cross-links cells were analyzed by propidium iodide (PI) flow cytometric assay, were reversed by treatment at 65uC overnight. After treatment which is based on the principle that DNA fragmentation and the consequent loss of nuclear DNA content occurs at the late phase of with RNase A and proteinase K, samples were extracted once with 6 phenol/chloroform, and the DNA was precipitated with 2 volumes apoptosis. Briefly, 10 cells with serum starvation treatment of of ethanol. Precipitated DNA was pelleted, washed once with 70% 0.1% serum for 12 h were collected and fixed with 100% ethanol ethanol, dried, and resuspended in 100 ml of water. The DNA was for 2 h at 4uC, washed with 1x phosphate-buffered saline (PBS), analyzed by quantitative PCR using Ampicilin primers (forward: and stained with 50 mg/ml propidium iodide (Sigma, St. Louis, 5’-CATCTTACGGATGGCATGAC-3’, reverse: 5’-CAACGAT- MO) and 1 mg/ml RNase for 1 hour in the dark at 4uC. The CAAGGCGAGTTAC-3’). stained cells were subseqeutly analyzed using FACSCalibur cytometer (Becton Dickinson, San Jose, CA) and FlowJo Software Colony formation assay (Tree Star, Ashland, OR). Ten million of Saos-2 cells were typically transfected using electroporation with different combinations of expression plasmids Acknowledgments as shown in the text. Transfected cells were cultured in the We are grateful to Gideon Dreyfuss, Gary J Nabel, Shelley L Berger, Jon selection medium (DMEM supplemented with 100 mg/ml G418). Aster, Elliott Kieff, and Wafik S. EI-Deiry for generously providing After 14 days, cells were fixed on the plates with formaldehyde and reagents. stained with 0.1% crystal violet. The amount of the colonies in each dish was scanned by Li-Cor Odyssey and counted. The data Author Contributions are presented as the average from two independent experiments. Conceived and designed the experiments: QC YG ESR. Performed the experiments: QC YG BX SB. Analyzed the data: QC YG ESR. Quantitative real-time PCR Contributed reagents/materials/analysis tools: AS JL TG. Wrote the Total RNA from cells was extracted using Trizol reagent and paper: QC YG ESR. cDNA was made with a Superscript II reverse transcription kit

References 1. Burkitt D (1958) A sarcoma involving the jaws in African children. Br J Surg 46: 7. Kuppers R (2003) B cells under influence: transformation of B cells by Epstein- 218–223. Barr virus. Nat Rev Immunol 3: 801–812. 2. Epstein MA, Achong BG, Barr YM (1964) Virus Particles In Cultured 8. Thorley-Lawson DA (2001) Epstein-Barr virus: exploiting the immune system. Lymphoblasts From Burkitt’s Lymphoma. Lancet 1: 702–703. Nat Rev Immunol 1: 75–82. 3. Rickinson AB, Kieff E (2002) Epstein-Barr virus. In: Fields BN, Knipe DM, 9. Hochberg D, Middeldorp JM, Catalina M, Sullivan JL, Luzuriaga K, et al. Howley PM, eds. Fields virology, 4th ed. Vol 2Philadelphia: Lippincott Williams (2004) Demonstration of the Burkitt’s lymphoma Epstein-Barr virus phenotype & Wilkins. pp 2575–2627. in dividing latently infected memory cells in vivo. Proc Natl Acad Sci U S A 101: 4. Henle G, Henle W, Diehl V (1968) Relation of Burkitt’s tumor-associated 239–244. herpes-ytpe virus to infectious mononucleosis. Proc Natl Acad Sci U S A 59: 10. Johannsen E, Miller CL, Grossman SR, Kieff E (1996) EBNA-2 and EBNA-3C 94–101. extensively and mutually exclusively associate with RBPJkappa in Epstein-Barr 5. zur Hausen H, Schulte-Holthausen H, Klein G, Henle W, Henle G, et al. (1970) virus-transformed B lymphocytes. J Virol 70: 4179–4183. EBV DNA in biopsies of Burkitt tumours and anaplastic carcinomas of the 11. Robertson ES, Lin J, Kieff E (1996) The amino-terminal domains of Epstein- nasopharynx. Nature 228: 1056–1058. Barr virus nuclear proteins 3A, 3B, and 3C interact with RBPJ(kappa). J Virol 6. Johansson B, Klein G, Henle W, Henle G (1970) Epstein-Barr virus (EBV)- 70: 3068–3074. associated antibody patterns in malignant lymphoma and leukemia. I. Hodgkin’s 12. Zhao B, Sample CE (2000) Epstein-barr virus nuclear antigen 3C activates the disease. Int J Cancer 6: 450–462. latent membrane protein 1 promoter in the presence of Epstein-Barr virus

PLoS Pathogens | www.plospathogens.org 11 December 2011 | Volume 7 | Issue 12 | e1002418 EBNA3C Stabilizes Gemin3

nuclear antigen 2 through sequences encompassing an spi-1/Spi-B binding site. 34. Saha A, Bamidele A, Murakami M, Robertson ES (2010) EBNA3C attenuates J Virol 74: 5151–5160. the function of p53 through interaction with inhibitor of growth family proteins 13. Knight JS, Lan K, Subramanian C, Robertson ES (2003) Epstein-Barr virus 4 and 5. J Virol 85: 2079–2088. nuclear antigen 3C recruits histone deacetylase activity and associates with the 35. Cauchi RJ, Davies KE, Liu JL (2008) A motor function for the DEAD-box RNA corepressors mSin3A and NCoR in human B-cell lines. J Virol 77: 4261–4272. helicase, Gemin3, in Drosophila. PLoS Genet 4: e1000265. 14. Radkov SA, Touitou R, Brehm A, Rowe M, West M, et al. (1999) Epstein-Barr 36. Mouillet JF, Yan X, Ou Q, Jin L, Muglia LJ, et al. (2008) DEAD-box protein- virus nuclear antigen 3C interacts with histone deacetylase to repress 103 (DP103, Ddx20) is essential for early embryonic development and modulates transcription. J Virol 73: 5688–5697. ovarian morphology and function. Endocrinology 149: 2168–2175. 15. Subramanian C, Hasan S, Rowe M, Hottiger M, Orre R, et al. (2002) Epstein- 37. Pellizzoni L, Charroux B, Rappsilber J, Mann M, Dreyfuss G (2001) A Barr virus nuclear antigen 3C and prothymosin alpha interact with the p300 functional interaction between the survival motor neuron complex and RNA transcriptional coactivator at the CH1 and CH3/HAT domains and cooperate polymerase II. J Cell Biol 152: 75–85. in regulation of transcription and histone acetylation. J Virol 76: 4699–4708. 38. Fischer U, Liu Q, Dreyfuss G (1997) The SMN-SIP1 complex has an essential 16. Subramanian C, Cotter MA, 2nd, Robertson ES (2001) Epstein-Barr virus role in spliceosomal snRNP biogenesis. Cell 90: 1023–1029. nuclear protein EBNA-3C interacts with the human metastatic suppressor 39. Rossoll W, Jablonka S, Andreassi C, Kroning AK, Karle K, et al. (2003) Smn, Nm23-H1: a molecular link to cancer metastasis. Nat Med 7: 350–355. the spinal muscular atrophy-determining gene product, modulates axon growth 17. Knight JS, Sharma N, Robertson ES (2005) Epstein-Barr virus latent antigen 3C and localization of beta-actin mRNA in growth cones of motoneurons. J Cell can mediate the degradation of the retinoblastoma protein through an SCF Biol 163: 801–812. cellular ubiquitin ligase. Proc Natl Acad Sci U S A 102: 18562–18566. 40. Young PJ, Day PM, Zhou J, Androphy EJ, Morris GE, et al. (2002) A direct 18. Knight JS, Sharma N, Robertson ES (2005) SCFSkp2 complex targeted by interaction between the survival motor neuron protein and p53 and its Epstein-Barr virus essential nuclear antigen. Mol Cell Biol 25: 1749–1763. relationship to spinal muscular atrophy. J Biol Chem 277: 2852–2859. 19. Knight JS, Sharma N, Kalman DE, Robertson ES (2004) A cyclin-binding motif 41. Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty CD, et al. (1997) within the amino-terminal homology domain of EBNA3C binds cyclin A and A complex containing N-CoR, mSin3 and histone deacetylase mediates modulates cyclin A-dependent kinase activity in Epstein-Barr virus-infected cells. transcriptional repression. Nature 387: 43–48. J Virol 78: 12857–12867. 42. Lee MB, Lebedeva LA, Suzawa M, Wadekar SA, Desclozeaux M, et al. (2005) 20. Bajaj BG, Murakami M, Cai Q, Verma SC, Lan K, et al. (2008) Epstein-Barr The DEAD-box protein DP103 (Ddx20 or Gemin-3) represses orphan nuclear virus nuclear antigen 3C interacts with and enhances the stability of the c-Myc receptor activity via SUMO modification. Mol Cell Biol 25: 1879–1890. oncoprotein. J Virol 82: 4082–4090. 43. Renouf B, Hollville E, Pujals A, Tetaud C, Garibal J, et al. (2009) Activation of 21. Saha A, Murakami M, Kumar P, Bajaj B, Sims K, et al. (2009) Epstein-Barr p53 by MDM2 antagonists has differential apoptotic effects on Epstein-Barr virus nuclear antigen 3C augments Mdm2-mediated p53 ubiquitination and virus (EBV)-positive and EBV-negative Burkitt’s lymphoma cells. Leukemia 23: degradation by deubiquitinating Mdm2. J Virol 83: 4652–4669. 1557–1563. 44. Pujals A, Renouf B, Robert A, Chelouah S, Hollville E, et al. (2011) Treatment 22. Yi F, Saha A, Murakami M, Kumar P, Knight JS, et al. (2009) Epstein-Barr with a BH3 mimetic overcomes the resistance of latency III EBV (+) cells to p53- virus nuclear antigen 3C targets p53 and modulates its transcriptional and mediated apoptosis. Cell Death Dis 2: e184. apoptotic activities. Virology 388: 236–247. 45. Forte E, Luftig MA (2009) MDM2-dependent inhibition of p53 is required for 23. Charroux B, Pellizzoni L, Perkinson RA, Shevchenko A, Mann M, et al. (1999) Epstein-Barr virus B-cell growth transformation and infected-cell survival. J Virol Gemin3: A novel DEAD box protein that interacts with SMN, the spinal 83: 2491–2499. muscular atrophy gene product, and is a component of gems. J Cell Biol 147: 46. O’Nions J, Turner A, Craig R, Allday MJ (2006) Epstein-Barr virus selectively 1181–1194. deregulates DNA damage responses in normal B cells but has no detectable 24. Grundhoff AT, Kremmer E, Tureci O, Glieden A, Gindorf C, et al. (1999) effect on regulation of the tumor suppressor p53. J Virol 80: 12408–12413. Characterization of DP103, a novel DEAD box protein that binds to the 47. Cai QL, Knight JS, Verma SC, Zald P, Robertson ES (2006) EC5S ubiquitin Epstein-Barr virus nuclear proteins EBNA2 and EBNA3C. J Biol Chem 274: complex is recruited by KSHV latent antigen LANA for degradation of the 19136–19144. VHL and p53 tumor suppressors. PLoS Pathog 2: e116. 25. Krauer KG, Buck M, Belzer DK, Flanagan J, Chojnowski GM, et al. (2004) The 48. Aiello L, Guilfoyle R, Huebner K, Weinmann R (1979) Adenovirus 5 DNA Epstein-Barr virus nuclear antigen-6 protein co-localizes with EBNA-3 and sequences present and RNA sequences transcribed in transformed human survival of motor neurons protein. Virology 318: 280–294. embryo kidney cells (HEK-Ad-5 or 293). Virology 94: 460–469. 26. Voss MD, Hille A, Barth S, Spurk A, Hennrich F, et al. (2001) Functional 49. Ponten J, Saksela E (1967) Two established in vitro cell lines from human cooperation of Epstein-Barr virus nuclear antigen 2 and the survival motor mesenchymal tumours. Int J Cancer 2: 434–447. neuron protein in transactivation of the viral LMP1 promoter. J Virol 75: 50. Clements GB, Klein G, Povey S (1975) Production by EBV infection of an 11781–11790. EBNA-positive subline from an EBNA-negative human lymphoma cell line 27. Cordin O, Banroques J, Tanner NK, Linder P (2006) The DEAD-box protein without detectable EBV DNA. Int J Cancer 16: 125–133. family of RNA helicases. Gene 367: 17–37. 51. Robertson ES, Grossman S, Johannsen E, Miller C, Lin J, et al. (1995) Epstein- 28. Rocak S, Linder P (2004) DEAD-box proteins: the driving forces behind RNA Barr virus nuclear protein 3C modulates transcription through interaction with metabolism. Nat Rev Mol Cell Biol 5: 232–241. the sequence-specific DNA-binding protein J kappa. J Virol 69: 3108–3116. 29. Ou Q, Mouillet JF, Yan X, Dorn C, Crawford PA, et al. (2001) The DEAD box 52. Knight JS, Robertson ES (2004) Epstein-Barr virus nuclear antigen 3C regulates protein DP103 is a regulator of steroidogenic factor-1. Mol Endocrinol 15: cyclin A/p27 complexes and enhances cyclin A-dependent kinase activity. J Virol 69–79. 78: 1981–1991. 30. Yan X, Mouillet JF, Ou Q, Sadovsky Y (2003) A novel domain within the 53. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the DEAD-box protein DP103 is essential for transcriptional repression and helicase head of bacteriophage T4. Nature 227: 680–685. activity. Mol Cell Biol 23: 414–423. 54. Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, et al. (1998) A third- 31. Gillian AL, Svaren J (2004) The Ddx20/DP103 dead box protein represses generation lentivirus vector with a conditional packaging system. J Virol 72: transcriptional activation by Egr2/Krox-20. J Biol Chem 279: 9056–9063. 8463–8471. 32. Lee K, Pisarska MD, Ko JJ, Kang Y, Yoon S, et al. (2005) Transcriptional factor 55. Wei F, Zaprazna K, Wang J, Atchison ML (2009) PU.1 can recruit BCL6 to FOXL2 interacts with DP103 and induces apoptosis. Biochem Biophys Res DNA to repress gene expression in germinal center B cells. Mol Cell Biol 29: Commun 336: 876–881. 4612–4622. 33. Klappacher GW, Lunyak VV, Sykes DB, Sawka-Verhelle D, Sage J, et al. (2002) 56. Bai Y, Srinivasan L, Perkins L, Atchison ML (2005) Protein acetylation regulates An induced Ets repressor complex regulates growth arrest during terminal both PU.1 transactivation and Ig kappa 3’ enhancer activity. J Immunol 175: macrophage differentiation. Cell 109: 169–180. 5160–5169.

PLoS Pathogens | www.plospathogens.org 12 December 2011 | Volume 7 | Issue 12 | e1002418