Tumor and Stem Cell Biology Research

Published OnlineFirst September 26, 2011; DOI: 10.1158/0008-5472.CAN-11-1367

Cancer Tumor and Stem Cell Biology Research

AGR2 Is a Novel Surface Antigen That Promotes the Dissemination of Pancreatic Cancer Cells through Regulation of Cathepsins B and D

Laurent Dumartin1, Hannah J. Whiteman1, Mark E. Weeks5, Deepak Hariharan1, Branko Dmitrovic6, Christine A. Iacobuzio-Donahue7, Teresa A. Brentnall8, Mary P. Bronner9, Roger M. Feakins3, John F. Timms4, Caroline Brennan2, Nicholas R. Lemoine1, and Tatjana Crnogorac-Jurcevic1

Abstract Pancreatic ductal adenocarcinoma (PDAC) remains one of the most lethal cancers largely due to disseminated disease at the time of presentation. Here, we investigated the role and mechanism of action of the metastasis- associated protein anterior gradient 2 (AGR2) in the pathogenesis of pancreatic cancer. AGR2 was induced in all sporadic and familial pancreatic intraepithelial precursor lesions (PanIN), PDACs, circulating tumor cells, and metastases studied. Confocal microscopy and ﬂow cytometric analyses indicated that AGR2 localized to the endoplasmic reticulum (ER) and the external surface of tumor cells. Furthermore, induction of AGR2 in tumor cells regulated the expression of several ER chaperones (PDI, CALU, RCN1), proteins of the ubiquitin-proteasome degradation pathway (HIP2, PSMB2, PSMA3, PSMC3, and PSMB4), and lysosomal proteases [cathepsin B (CTSB) and cathepsin D (CTSD)], in addition to promoting the secretion of the precursor form pro-CTSD. Importantly, the invasiveness of pancreatic cancer cells was proportional to the level of AGR2 expression. Functional downstream targets of the proinvasive activity of AGR2 included CTSB and CTSD in vitro, and AGR2, CTSB, and CTSD were essential for the dissemination of pancreatic cancer cells in vivo. Taken together, the results suggest that AGR2 promotes dissemination of pancreatic cancer and that its cell surface targeting may permit new strategies for early detection as well as therapeutic management. Cancer Res; 71(22); 1–12. 2011 AACR.

Introduction the vast majority of patients relapse due to undetected disseminated tumor cells (DTC) that have spread prior to primary Pancreatic ductal adenocarcinoma (PDAC) is almost invari- tumor diagnosis. A better understanding of the molecular ably lethal and remains one of the most devastating cancers in mechanisms that promote dissemination of cancer cells is, man (1). Most deaths from pancreatic cancer are due to the therefore, essential for the development of novel detection and silent and aggressive nature of this malignant disease. At therapeutic strategies for this, at present, largely incurable presentation, the disease has, in most cases, already spread malignant disease. locally and to distant organs, and patients usually succumb Anterior gradient 2 (AGR2) protein is upregulated in mul- within 3 to 6 months. Moreover, even after curative resection, tiple cancers, including breast (2, 3), lung (4), ovarian (5), esophageal (6), and prostate cancers (7), and is associated Authors' Affiliations: 1Centre for Molecular Oncology, Barts Cancer Insti- tute, 2School of Biological and Chemical Sciences, Queen Mary University with a metastatic phenotype and poor prognosis (2). It has of London; 3Department of Histopathology, Royal London Hospital; 4Can- been identified previously by gene profiling as a marker for cer Proteomics Laboratory, EGA Institute for Women's Health, University DTC detection (8). In sporadic pancreatic cancer, AGR2 pro- College London, London, United Kingdom; 5Proteomics, Metabolomics and Bioimaging, AHVLA-Weybridge, Addlestone, United Kingdom; tein is present from the earliest precursor lesions [pancreatic 6Department of Pathology and Forensic Medicine, KBC Osijek, Osijek, intraepithelial precursor lesions (PanIN1)] to PDACs but is not 7 Croatia; Department of Pathology, The Sol Goldman Pancreatic Cancer expressed in normal pancreas (9). Recent data also suggested Research Center, Johns Hopkins Medical Institutions, Baltimore, Mary- land; 8Division of Gastroenterology, Department of Medicine, University of that silencing of AGR2 in the pancreatic cancer cell line MPanc- Washington, Seattle, Washington; and 9Department of Anatomic Pathol- 96 results in fewer metastases in an orthotopic pancreas tumor ogy, University of Utah, Salt Lake City, Utah model (10). Note: Supplementary data for this article are available at Cancer Research AGR2 has been shown to have structural characteristics of Online (http://cancerres.aacrjournals.org/). the protein disulfide isomerase (PDI) family, including a car- Correspond Author: Tatjana Crnogorac-Jurcevic, Barts Cancer Institute, boxy-terminal endoplasmic reticulum (ER) retention signal Centre for Molecular Oncology, Queen Mary University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ, United KTEL and a single thioredoxin-like domain with a CXXS motif Kingdom. Phone: 44-0-20-7882-3554; Fax: 44-0-20-7882-3884; (11). PDI proteins catalyze formation, reduction, and isomer- E-mail: [email protected] ization of disulfide bonds, thereby facilitating the maturation doi: 10.1158/0008-5472.CAN-11-1367 of proteins in the ER and ensure correct folding and multi- 2011 American Association for Cancer Research. merization of proteins targeted for the secretory pathway (11).

www.aacrjournals.org OF1

Dumartin et al.

Park and colleagues have recently shown that AGR2 loca- RNA extraction and semiquantitative real-time PCR lizes in the ER of normal intestinal epithelial cells and is Total RNA was extracted using RNAqueous RNA extraction essential for in vivo production of protective mucus. They kit (Ambion). First-strand cDNA was prepared from 1 mgof showed that AGR2 mediates processing of the intestinal mucin total RNA with Quantitect Reverse Transcription Kit (Qiagen). MUC2 through formation of mixed disulfide bonds and that the Real-time PCR was carried out on a 7500 Real-Time PCR absence of AGR2 resulted in a dramatic reduction of mucus system (Applied Biosystems) using SYBR Green dye (Thermo production and secretion and an increased sensitivity to colitis Fisher Scientific). The primers used were S16, forward 50 in Agr2 / mice (12). The precise molecular effects of AGR2 in GTCACGTGGCCCAGATTTAT 30 and reverse 50 TCTCCTTCT- cancers, however, remain largely unknown. TGGAAGCCTCA 30; CTSB, forward 50 CACTGACTGGGGTGA- Here, we report that AGR2 is almost universally expressed in CAATG 30 and reverse 50 GCCACCACTTCTGATTCGAT 30; and tumor cells of patients with pancreatic cancer in both sporadic CTSD, forward 50 GCGAGTACATGATCCCCTGT 30 and reverse and familial settings and that it localizes both in the ER and at 50 CTCTGGGGACAGCTTGTAGC 30. All samples were tested in the external surface of the plasma membrane. We reveal 3 independent experiments. Relative changes of expression proteomic changes resulting from the induction of AGR2 were expressed after normalization to the human ribosomal expression and show that AGR2 promotes in vitro and in vivo S16 gene. dissemination of cancer cells through posttranscriptional induction of 2 proteases, cathepsin B (CTSB) and cathepsin Western blotting D (CTSD). Cell lysis was done using NP40 buffer (1% NP40, 50 mmol/L Tris, pH 7.4, 150 mmol/L NaCl) with protease inhibitors (Roche Materials and Methods Diagnostics). For secretome analyses, cells were serum starved for 16 hours and culture supernatants centrifuged at 5,000 rpm Tissues and cell lines for 15 minutes at 4C. Secretome samples were concentrated Three tissue arrays comprising 42 normal, 48 PanIN, and using Amicon Ultra Centrifugal filters Ultracel 3 kDa (Milli- 84 PDAC cores from both familial and sporadic PDAC cases pore). Twenty-five micrograms of protein lysate or 5 mgof (University of Washington, Seattle, Washington); 8 primary secretome proteins were analyzed by SDS-PAGE as previously PDACs and matched infiltrated lymph nodes (Department of described (14). Primary antibodies were rabbit anti-AGR2 Pathology, KBC Osijek); and 10 cases of primary PDAC and 9 (1:250; Abcam), goat anti-actin (1:2,000; Santa Cruz Biotech- matched liver and 1 lung metastases (GICRMDP, John nology), mouse anti-CTSD (1:5,000) and rabbit anti-CTSB Hopkins University) were analyzed. Thirty cases of peri- (1:1,000; Abcam). neural invasion found within the PDAC tissues were also examined. All specimens were obtained with full ethical Immunofluorescence approval from the host institutions. Cells were seeded on coverslips (5 104 per well in 24-well The human pancreatic ductal epithelial (HPDE) cell line was plate) and cultured for 48 hours. After fixing in 4% parafor- obtained from Dr. Ming-Sound Tsao, University of Toronto, maldehyde, permeabilization with 0.1% Triton X, and blocking Toronto, ON, Canada, and grown as described previously (13). in 2% bovine serum albumin (BSA), cells were incubated with Other cell lines, verified by short tandem repeat profiling mouse anti-AGR2 (1:500; Santa Cruz Biotechnology), rabbit (February 2010) were obtained from Cancer Research UK Cell anti-giantin (1:1,000), rabbit anti-calreticulin (1:200), and rab- Services (Clare Hall, Middlesex, UK) and cultured in Dulbecco's bit anti-LAMP1 (1:100; Abcam). Secondary antibodies were Modified Eagle Medium (DMEM; Invitrogen) supplemented Alexa Fluor 568/488-conjugated anti-mouse or anti-rabbit IgG with 10% heat-inactivated fetal calf serum (Autogen Bioclear). (1:2,000; Invitrogen). DNA was stained with 50 mg/mL 40,6- diamidino-2-phenylindole (DAPI; Invitrogen), and imaging Establishment of stable cell lines done with LSM 710 confocal microscope (Zeiss). The pCEP4 AGR2 vector was constructed by excising AGR2 from pCMV-SPORT6-AGR2 (MRC Geneservice) using KpnI and Immunohistochemistry NotI. AGR2 cDNA was cloned into the KpnI/NotI site of pCEP4 Staining was done on 4-mmthickparaffin sections using (Invitrogen). MiaPaCa2 cells (2 106 cells per 10-cm plate) rabbit anti-AGR2 antibody (Abcam) diluted 1:30 with DABMap were transfected with FuGENE6 (Roche Diagnostics) in a 3:1 kit, following protocols for the Ventana Discovery System. ratio with pCEP4 AGR2 or pCEP4. Stable cell lines were Counterstaining was done with hematoxylin. The intensity of established following selection with 300 mg/mL hygromycin immunoreactivity was graded on a scale from 0 to 3 and the B (Merck) and single-cell clones isolated. extent according to the percentage of stained cells (0 points for no staining, 1 point, <20%; 2 points, 20%–50%; and 3 points, Gene silencing >50%). The total score was the product of intensity and extent of Cells were seeded at 2 105 cells per well in a 6-well plate staining. Negative or weakly positive cases scored 0 to 3, mod- and transfected with 1, 5, 10, or 50 nmol/L of siGENOME ON- erately positive as 4 to 6, and strongly positive as more than 6. TARGETplus SMARTpool siRNA specific for human AGR2, CTSB,orCTSD gene or siGENOME Non-Targeting siRNA pool Flow cytometry #2 (Dharmacon) using INTERFERin (PeqLab) according to Subconfluent cells were harvested by trypsin/EDTA (0.25% manufacturer's instructions. w:v, 5 mmol/L) and resuspended in DMEM, 0.1% BSA, and 0.1%

OF2 Cancer Res; 71(22) November 15, 2011 Cancer Research

AGR2 in Pancreatic Cancer Invasion

sodium azide. AGR2 was detected with rabbit antibody (Santa dance, matching across all images, and having values of P < 0.05 Cruz Biotechnology; 1:10) on ice for 45 minutes. Bound anti- (Student t test) were selected. Spot picking, tryptic digestion, bodies were detected with Alexa Fluor 488–conjugated sec- and protein identification using liquid chromatography/tan- ondary antibody (Invitrogen). Labeled cells were scanned on a dem mass spectrometry (LC/MS-MS) were done as described BD FACSAria II Cell sorter (BD Biosciences) and analyzed previously (15). Nano-HPLC-electrospray ionization-collision- using CellQuest Pro software. induced dissociation MS/MS was done on an Ultimate HPLC with a PepMap C18 75 mm inner diameter column (both Functional assays Dionex) at a flow rate of 300 nL/min, coupled to a Q-TOF1 MTT, invasion, and wound-healing assays were conducted mass spectrometer (Micromass). Spectra were processed using as described previously (14). For migration assays, Biocoat Cell MassLynx (Micromass) software and submitted to Mascot Culture Inserts with 8-mm pores (BD Biosciences) were used. database search routines against the Human IPI database. Seven hundred and fifty microliters of DMEM media supple- Positive identifications were made when at least 3 peptide mented with 10% fetal calf serum was added to the lower sequences matched an entry and MOWSE scores were above chamber and 2.5 104 cells in 500 mL serum-free medium to the significance threshold value (P ¼ 0.05). the upper chamber. The assays were set up 48 hours after transfection and cells were incubated for 24 hours. Cells that Zebrafish embryo xenograft model moved through the pores were fixed in 100% methanol and Zebrafish (Danio rerio) were handled in compliance with stained with 1% Giemsa Blue (Sigma-Aldrich) before counting. local animal care regulations and standard protocols. Fish All functional assays were carried out in triplicate in at least 3 were kept at 28C in aquaria with day/night light cycles individual experiments. (10-hour dark/14-hour light periods). The developing embryos were kept in an incubator at constant temperature. Protein expression profiling by 2D-DIGE/MS Cancer cells in suspension were stained with 10 mmol/L MiaPaCa2-pCEP4 and pCEP4 AGR2 were lysed and labeled CMTMR or CMFDA (Invitrogen) and resuspended in serum- in triplicate with either NHS-Cy3 or NHS-Cy5 dyes and run in free medium before injecting into 48-hour-old zebrafish first and second dimension as described previously (14). In embryos. Injections were done using a manual injector (Picos- total, 6 gels were run generating 18 images that were exported pritzer III, Parker Hannifin Instruments). Embryos were into DeCyder software v5.0 (GE Healthcare). Spots displaying a dechorionated and anesthetized with tricaine (Sigma-Aldrich) greater than 1.4 average-fold increase or decrease in abun- prior to injection. After injections, embryos were incubated at

A B C

Figure 1. AGR2 protein expression in pancreatic tissues. D E F Immunohistochemical analysis of AGR2 expression in normal pancreas (A), familial PanIN1, PanIN2, PanIN3, and PDAC (B–E, respectively); perineural invasion, circulating tumor cells, lymph node, and liver metastasis from sporadic pancreatic cancer samples (F–I, respectively). Scale bars, 50 mm. G H I

www.aacrjournals.org Cancer Res; 71(22) November 15, 2011 OF3

Dumartin et al.

35C. Three separate experiments were carried out for each metastatic samples, namely, lymph node, liver (Fig. 1H and I), protein of interest. In total, 103 embryos were injected for and lung metastases (Supplementary Fig. S1, AII). The data are AGR2 experiments, 109 for CTSB, and 107 for CTSD. summarized in Table 1. The immunochemistry therefore Counting of disseminated cells was done 24 hours after revealed that AGR2 is expressed in almost all in situ or injections; embryos were assessed using a Zeiss Axioplan disseminated cancer cells, suggesting that it may be implicated epifluorescence microscope and disseminated cells counted in all steps of PDAC development and spreading. As expected, under high magnification. due to the almost invariable expression of AGR2 across the cases tested, there was no correlation with any of the clinico- Statistical analysis pathologic data. Furthermore, using a multiorgan tissue array, The statistical analysis was done with the Student t test we have seen that AGR2 is expressed in a limited number of using Prism software; a value of P < 0.05 was statistically normal human tissues (Supplementary Fig. S1 B and Supple- significant. mentary Table S1). Of note, most adenocarcinomas of various organs show AGR2 expression, in contrast to squamous cell Results carcinomas.

AGR2 expression is induced from the earliest lesions of AGR2 is an endoplasmic reticulum and a cell surface pancreatic neoplasia and is retained in all DTCs antigen Immunohistochemistry confirmed that AGR2 is not Both cytoplasmic and membranous immunoreactivity for expressed in normal pancreas (Fig. 1A) but is induced in all AGR2 were noted in PDAC cells (Fig. 2A). The precise subcel- sporadic PanIN lesions. Here, we additionally show that AGR2 lular localization of AGR2 was further explored in vitro using is similarly expressed in familial cases; representative images of confocal microscopy. Immunofluorescent staining in permea- familial PanIN1–3 lesions are shown on Fig. 1B–D. High levels bilized PaTu 8988s pancreatic cancer cells, which express high of AGR2 expression were seen in almost all PDAC specimens levels of AGR2 (Fig. 2B), showed that AGR2 is predominantly (73 of 84, 87%; Fig. 1E) except the rare cases with squamoid localized in a fine reticular network around the nucleus (Fig. differentiation, which were negative (Supplementary Fig. S1, 2C). The extensive colocalization with calreticulin confirmed AI), and undifferentiated PDACs, which showed low expression that AGR2 is localized in the ER in PDAC cells. However, AGR2 (data not shown). AGR2 expression was retained in perineural was not seen in the Golgi apparatus and lysosomes (Supple- invasion (Fig. 1F), in circulating tumor cells (Fig. 1G) and all mentary Fig. S2A). Immunostaining of 3 nonpermeabilized

Table 1. Summary of immunohistochemical ﬁndings in human pancreatic tissues and pancreatic cancer metastases

Specimens AGR2-positive Expression level Positive cores/total analyzed cases, % 01–34–67–9

Normal 0/42 42 0 0 0 0 PanIN1 All cases 17/17 0 4 8 5 100 Sporadic 7/7 0 2 4 1 Familial 10/10 0 2 4 4 PanIN2 All cases 23/23 0 0 13 10 100 Sporadic 14/14 0 0 7 7 Familial 9/9 0 0 6 3 PanIN3 All cases 8/8 0 0 1 7 100 Sporadic 4/4 0 0 1 3 Familial 4/4 0 0 0 4 PDAC All cases 73/84 11 15 26 32 87 Sporadic 70/81 11 15 23 32 Familial 3/3 0 0 3 0 Perineural invasion 30/30 0 0 0 30 100 Lymph node metastasis 8/8 0 0 0 8 100 Liver metastasis 9/9 0 0 0 9 100 Lung metastasis 1/1 0 0 0 1 100

OF4 Cancer Res; 71(22) November 15, 2011 Cancer Research

AGR2 in Pancreatic Cancer Invasion

A C AGR2 Merge

Actin B

kDa HPDE BxPc3 Capan2 MIMPC2 Mia PaCa2 PaCa3 Panc1 Patu2 PT45 FA6 T3M4 CFPAC1 8988s PaTu 8988t PaTu SUIT2 A818.4 AsPc1 24 AGR2 52 Actin Careticulin

DE Phase contrast AGR2 Merge iii

250200150100 250200150100 95.7%

P4 P4 50 50 PaTu 8988s PaTu 102 103 104 105 102 103 104 105

250200150100 250200150100 95.7%

P4 P4 FA6 50 50

102 103 104 105 102 103 104 105

250200150100 250200150100 97.3%

P4 P4 CFPAC1 50 50

102 103 104 105 102 103 104 105 250200

P4 150 100 MiaPaCa2 50

102 103 104 105 Side scatter AGR2

Figure 2. Localization of AGR2 in pancreatic cancer cells. A, immunohistochemical analysis of AGR2 in a representative human PDAC sample showing both cytoplasmic and membranous (arrows) immunoreactivity. B, Western blot analysis showing AGR2 expression in a panel of pancreatic cancer and normal HPDE cells. C, coimmunostaining of AGR2 (green) and actin or calreticulin (red) in permeabilized PaTu 8988s cells showing that AGR2 is situated in the endoplasmic reticulum. D, cell surface immunostaining for AGR2 (green) on nonpermeabilized PaTu 8988s cells. Scale bars, 10 mm. E, i, ﬂow cytometric analysis of AGR2 cell surface expression on intact pancreatic cells in the same order (as in D) and (ii) sorting of AGR2-positive–gated cells. MiaPaCa2 cells that do not endogenously express AGR2 were used as a negative control.

www.aacrjournals.org Cancer Res; 71(22) November 15, 2011 OF5

Dumartin et al.

loss of AGR2 protein expression was seen in FA6 cells (which A express high endogenous levels of AGR2) 48 hours after trans- i ii fection with 50 nmol/L of AGR2-specific siRNA [Fig. 3A (ii)]. No morphologic change was observed after alteration of AGR2 siAGR2 siNT expression in these cells (Supplementary Fig. S4A). Moreover, kDa pCEP4 pCEP4 AGR2 510 5010 50 nmol/L no difference was observed in cell proliferation, wound healing, 24 AGR2 AGR2 or migration (Supplementary Fig. S4B–S4D, respectively), following overexpression or knockdown of AGR2. However, in 52 Actin Actin invasion assays, a significant increase (P < 0.05) in the number of invading cells was observed in AGR2-expressing MiaPaCa2 B cells, compared with vector-only controls [Fig. 3B (i)], and a i ii significant decrease (P < 0.05) in the number of invading cells P < 0.05 P < 0.05 was seen following siRNA-mediated knockdown of AGR2 in 500 * 2,000 * 400 FA6 cells [Fig. 3B (ii)]. The invasive capabilities of pancreatic 1,500 300 cancer cells are therefore proportional to levels of AGR2 1,000 200 expression. 500 100

0 0 AGR2 induces changes in cancer cell proteome Number of invading cells Number of invading cells siNT siAGR2 pCEP4 pCEP4 AGR2 To assess the molecular mechanisms underlying the proinvasive activity of AGR2, proteomic analysis of AGR2-expressing Figure 3. Functional roles of AGR2. A, Western blot analysis of AGR2 MiaPaCa2 versus vector control–transfected cells was done expression in (i) MiaPaCa2 cells stably transfected with empty vector using 2-dimensional difference in gel electrophoresis (2D- control (pCEP) or pCEP-AGR2 vector and (ii) in FA6 cells 48 hours after DIGE). A representative gel is shown in Fig. 4. We identified transfection with specific AGR2 siRNA or nontargeting (NT) control siRNA. Actin was used as a loading control. B, invasion assays using (i) 15 upregulated and 24 downregulated proteins (represented by stably transfected MiaPaCa2 cells and (ii) siRNA-transfected FA6 cells. 15 and 36 spots, respectively) with a cutoff of 1.4-fold at P < 0.05 Mean values of triplicate experiments are shown. , P < 0.05. (Table 2). Two ER chaperones, CALU and RCN1, were identified as the AGR2-expressing cell lines, PaTu 8988s, FA6, and CFPAC1 (Fig. highest upregulated proteins (both 2-fold), in addition to AGR2 2D), indicated that AGR2 also localized at the external surface (8.5-fold upregulated). The archetypal cellular ER PDI, PDI/ of the plasma membrane. This finding was further confirmed P4HB, was also upregulated, in addition to deregulation of on nonpermeabilized cells by flow cytometry [Fig. 2E (i)], several proteins of the ubiquitin-proteasome degradation which also permitted the physical isolation of cell surface pathway (HIP2, PSMB2, PSMA3, PSMC3, and PSMB4) that AGR2-expressing cells [Fig. 2E (ii)]. This was not observed in play a role in ER-associated degradation of improperly pro- the MiaPaCa2 cell line that does not express AGR2 endoge- cessed proteins. The expression levels of a number of structural nously and thus served as a negative control. Of note, similar proteins (LMNA, VIM, KRT1, KRT8, KRT18, and KRT19) were surface expression was also seen on breast cancer cells (Sup- also altered. The functional interactions among the majority of plementary Fig. S2B), indicating that AGR2 also might be a cell these differentially expressed proteins mapped in a network surface antigen in other tumor types. Furthermore, Western are shown on Supplementary Fig. S5. blotting (Supplementary Fig. S2C) showed the presence of AGR2 in culture supernatants of PaTu 8988s and CFPAC1 but AGR2 is a posttranscriptional regulator of CTSB and not in FA6 or BxPC3 that also expresses AGR2 (Fig. 2B, D, and CTSD E), suggesting that AGR2 might be shed from the cell surface Interestingly, the proteases CTSB and CTSD were both rather than being actively secreted. upregulated (1.79- and 1.52-fold, respectively) in AGR2-expres- Taken together, our data indicate that in pancreatic tumor sing cells. As CTSB and CTSD are known to be frequently cells, the PDI protein AGR2 not only has a conserved ER overexpressed and hypersecreted in several cancers, including localization but also is a cell surface marker. pancreatic (16, 17) cancer, they were selected for further analyses. AGR2 regulates the invasiveness of PDAC cancer cells CTSB/D overexpression was confirmed by Western blotting To assess the functional roles of AGR2 in pancreatic cells, [Fig. 5A (i); Fig. 5A (ii) shows densitometry quantification], long-term stable expression of AGR2 was achieved in Mia- whereas no change was detected at the mRNA level using real- PaCa2 cells, an undifferentiated pancreatic cancer cell line. time PCR [Fig. 5A (iii)]. A large increase in the expression of the AGR2 expression was confirmed by Western blot in MiaPaCa2- precursor isoforms, pro-CTSB and CTSD, in AGR2-expressing pCEP4 AGR2 cells compared with cells transfected with empty cells was also observed. This was further confirmed in addi- control vector [pCEP4; Fig. 3A (i)]. The recombinant AGR2 tional pancreatic cells, in AGR2-expressing FA6 cells when protein had the same subcellular localization as endogenous compared with normal HPDE cells [Fig. 5B (i) and (iii)] and in AGR2, as it was detected in the ER, at the cell surface, and in the PaTu 8988s compared with PaTu 8988t cells, which originate culture supernatant of pCEP4 AGR2–transfected cells (Sup- from liver metastases of the same patient (18). Metastatic PaTu plementary Fig. S3A–S3C, respectively). In parallel, a complete 8988s cells express AGR2 and higher levels of CTSB/CTSD

OF6 Cancer Res; 71(22) November 15, 2011 Cancer Research

AGR2 in Pancreatic Cancer Invasion

pH3 pH 10 210 360 kDa 592 590 569 581

878 753 875 985 1009 969 1033 1108 1123 753 1146 1095 1216 1105 1135 11 1281 1285 1182 124522 1293 1262 1318 1302 1410 1413 1455 1562 ﬁ 1631 1654 Figure 4. Proteomic pro ling of 1753 MiaPaCa2 AGR2-expressing cells. P4HB

A, Representative gel image 1966 1969 2045 2099 2144 displaying protein spots with 2119 2160 2176 2241 2186 AGR2-dependent changes in 2295 2310 expression is shown. Magniﬁed 2394 regions showing several 1410 2428 differentially expressed proteins. 2473 pCEP4 CALU, calumenin; RCN1, 2459 pCEP4 AGR2 reticulocalbin 1. 1455 10 kDa

CALU and RCN1 2099 2459

2119 CTSB and CTSD AGR2

isoforms than nonmetastatic PaTu 8988t cells that do not 48-hour-old zebrafish embryos (Fig. 6A). After 24 hours, both express AGR2 [Fig. 5B (ii) and (iv)]. These results indicate that red and green tumor cells were equally observed as dissem- AGR2 may be an important posttranscriptional regulator of inated into the tail of the embryo [Fig. 6B (i) and (iii)] or CTSB and CTSD in PDAC cells. localized in the vicinity of the injection site in the yolk sack As overexpression of CTSB and CTSD is often associated [Fig. 6B (ii) and (iv)]. Silencing of AGR2 in PaTu 8988s cells with an increase in their secretion, the culture supernatants of significantly lowered the number of DTC than siRNA-control– PDAC cells were analyzed: higher levels of pro-CTSD were transfected cells (P < 0.001; Fig. 6C and D). A similar decrease of detected in the supernatants of AGR2-expressing MiaPaCa2 DTC was observed after silencing of CTSB (P < 0.001) or CTSD than in vector-only transfected cells, and inversely, silencing of (P < 0.001; Fig. 6E and F, respectively). These results show that AGR2 in FA6 cells strongly inhibited pro-CTSD secretion (Fig. all 3 proteins are major regulators of the in vivo ability of PDAC 5C). AGR2 is thus an important regulator of pro-CTSD secre- cells to disseminate. tion. We were not able to detect pro CTSB or CTSB/CTSD in the supernatants, which might be due to their binding to the Discussion plasma membrane rather than being secreted (19). AGR2 expression has previously been shown to be induced CTSB and CTSD are involved in AGR2-mediated from the earliest precursor lesions of pancreatic cancer, PanINs, dissemination of pancreatic cancer cells as well as in PDACs (9, 10, 20). Here, we provide a comprehensive To examine whether cathepsins are involved in the AGR2- analysis of AGR2 expression in both pancreas and extrapan- induced increase in cell invasion, CTSB and CTSD were creatic tissues, showing that it is widely expressed in both silenced in AGR2-expressing MiaPaCa2 cells [Fig. 5D (i)]. About sporadic and familial PanINs, PDACs, and metastatic lesions. 50% (P < 0.005) and 80% (P < 0.001) reduction in the number of In contrast, AGR2 is not widely expressed in normal organs, in invading cells was observed after silencing of CTSB and CTSD, which it is mostly confined to mucin-secreting cells (21). respectively [Fig. 5D (ii)], thus reducing the invasiveness of We show that in PDAC cells, AGR2 localizes to the ER, as MiaPaCa2-pCEP4 AGR2 cells close to the level observed in observed in normal intestinal epithelial cells (12), suggesting control MiaPaCa2-pCEP4. The same dramatic effect was that AGR2 could exert a PDI activity on presecretory proteins observed in FA6 cells after silencing of CTSB (P < 0.05) and also in transformed cells. Furthermore, we provide the first CTSD [P < 0.001; Fig. 5D (iii) and (iv)]. AGR2 thus regulates the evidence that AGR2 also localizes to the external surface of expression, and potentially secretion, of CTSB and CTSD, AGR2-expressing pancreatic cancer cells; accumulation at the which in turn mediate the AGR2-induced invasiveness of cell surface has previously been shown for several ER proteins pancreatic cancer cells. (22, 23). Therefore, AGR2 may be used for the detection of To analyze whether AGR2, CTSB, and CTSD are important circulating tumor cells in the peripheral blood of patients with regulators of the dissemination of pancreatic cancer cells pancreatic cancer and could also be a novel tumor cell surface in vivo, a zebrafish embryo xenotransplant model was used. antigen for the development of antibody-targeting strategies PaTu 8988s cells were stained in vitro with red or green (24). An increasing number of recent studies report that PDI fluorescent dyes and were coinjected into the yolk sack of proteins have important roles on the cell surface, as majority of

www.aacrjournals.org Cancer Res; 71(22) November 15, 2011 OF7

Dumartin et al.

Table 2. Deregulated proteins identiﬁed by 2D-DIGE analysis comparing MiaPaCa2-pCEP AGR2 with MiaPaCa2-pCEP cells

Spot ID Name Symbol Fold change

2459 IPI00007427 Anterior gradient 2 AGR2 8.55 1410 IPI00789155 Calumenin CALU 2.07 1455 IPI00015842 Reticulocalbin 1 RCN1 2.03 2144 IPI00176455 Synovial sarcoma, X breakpoint 9 SSX9 1.83 2119 IPI00011229 Cathepsin D CTSD 1.79 1285 IPI00009634 Sulﬁde quinone reductase-like SQRDL 1.71 1135 IPI00418471 Vimentin VIM 1.69 2428 IPI00375676 Ferritin, light polypeptide FTL 1.68 1562 IPI00220685 Heterogeneous nuclear ribonucleoprotein D HNRPD 1.66 1293 IPI00784347 Keratin 18 KRT18 1.55 2310 IPI00021370 Huntingtin interacting protein 2 HIP2 1.55 2099 IPI00295741 Cathepsin B CTSB 1.52 753 IPI00010796 Proline 4-hydroxylase, b polypeptide PDI/P4HB 1.50 2473 IPI00175923 Synovial sarcoma, X breakpoint 6 SSX6 1.50 878 IPI00219049 Trans-golgi network protein 2 TGOLN2 1.47 1302 IPI00550488 Transaldolase 1 TALDO1 1.47 1033 IPI00298423 Pyruvate dehydrogenase complex, component X PDHX 1.49 1108 IPI00019376 Septin 11 SEPT11 1.49 2176 IPI00216318 Tyrosine 3-/tryptophan5-monooxygenase activation protein b YWHAB 1.49 2394 IPI00028006 Proteasome subunit b type 2 PSMB2 1.50 985 IPI00337370 Pre-B-cell colony enhancing factor 1 PBEF1 1.51 1631 IPI00014873 Cyclin-dependent kinase 10 CDK10 1.53 2160 IPI00171199 Proteasome subunit a type 3 PSMA3 1.53 2186 IPI00003815 Rho GDP dissociation inhibitor (GDI) a ARHGDIA 1.54 875 IPI00795040 Heat shock 70kDa protein 8 HSPA8 1.55 1216 IPI00465248 Enolase 1 ENO1 1.55 1966 IPI00021700 Proliferating cell nuclear antigen PCNA 1.56 1969 IPI00329801 Annexin A5 ANXA5 1.56 1123 IPI00018398 Proteasome 26S subunit, ATPase, 3 PSMC3 1.57 1413 IPI00479145 Keratin 19 KRT19 1.58 1654 IPI00220327 Keratin 1 KRT1 1.61 2241 IPI00220301 Peroxiredoxin 6 PRDX6 1.61 1753 IPI00455315 Annexin A2 ANXA2 1.66 1095 IPI00554648 Keratin 8 KRT8 1.67 1281 IPI00337494 Solute carrier family 25, member 24 SLC25A24 1.70 590 IPI00514204 Lamin A/C LMNA 1.71 2045 IPI00296913 Nucleoside diphosphate linked moiety X-type motif 5 NUDT5 1.75 2295 IPI00555956 Proteasome subunit b type 4 PSMB4 1.79 1182 IPI00418471 Vimentin VIM 1.93

surface proteins contain disulfide bonds (reviewed in RCN1), suggesting activation of the ER stress response. This refs. 23, 25) in which they can modulate the activity of mem- correlates with a previous report on Agr2 / mice that showed brane receptors (and thus activate and regulate signaling that Agr2 is involved in the ER stress response as well as being pathways; ref. 26), adhesion molecules integrins (27), or even itself induced by ER stress (31). Stressful conditions such as proteases such as ADAM17 (28). We and others show that hypoxia, nutrient deprivation, and pH changes encountered by AGR2 can also be found in cell culture supernatants (10) and tumor cells are known to induce ER stress (32), characterized pancreatic juice (29). It remains to be established whether by the upregulation of ER chaperones. This enables cells to AGR2 functions also at the cell surface or when secreted and adapt to an unfavorable microenvironment and avoid ER whether it is immunogenic as shown for PDI proteins in renal stress–induced apoptosis. The main cellular PDI, PDI/P4HB, cell carcinoma (30). in which upregulation was seen here, is a well-established Protein profiling of AGR2-expressing MiaPaCa2 cells iden- executor of the ER stress response and has been shown to tified upregulation of several ER chaperones (PDI, CALU, and protect melanoma cancer cells against ER stress–induced

OF8 Cancer Res; 71(22) November 15, 2011 Cancer Research

AGR2 in Pancreatic Cancer Invasion

A B i ii i ii iii

pCEP4 HPDE 10 pCEP4 AGR2 22 FA6 6 12 2 2 2 pCEP4 pCEP4 AGR2 kDa 1.4 kDa HPDE FA6 8988t PaTu 8988s PaTu 2 Pre-pro CTSD 1 Pre-pro CTSD 1.4 52 1 52 (densitometry) pro CTSD pro CTSD (densitometry) 0 Relative expression Relative pro-CTSD CTSD pro CTSB CTSB expression Relative 0 34 CTSD 34 CTSD pro CTSD CTSD pro CTSB CTSB iii 42 pro CTSB 3 42 pro CTSB iv PaTu 8988t 10 PaTu 8988s 26 CTSB 2 26 CTSB 6 2 24 AGR2 24 AGR2 2 1 1.4 1 Transcript ratio Transcript 52 Actin 52 Actin (densitometry) 0 0 Relative expression Relative (pCEP4 AGR2/pCEP4) CTSB CTSD pro CTSD CTSD pro CTSB CTSB

i i ii MiaPaCa2 FA6 MiaPaCa2-pCEP4 AGR2 150 *** ** P = 0.0007 100 P = 0.0027 siNT siCTSB siNT siCTSD 50

pCEP4 pCEP4 AGR2 siNT siAGR2 26 CTSB 34 CTSD

Supernatant pro-CTSD Actin Actin cells (% ctrl) Invading 52 52 0 siNT siCTSB siCTSD

ii iii FA6 iv 150 ** P = 0.0018 10,000 8,000 * P = 0.015 8,000 100 6,000

6,000 siNT siCTSB siNT siCTSD 4,000 4,000 26 CTSB 34 CTSD 50 2,000 2,000 (densitometry) (densitometry) pro-CTSD level pro-CTSD level pro-CTSD 52 Actin 52 Actin cells (% ctrl) Invading 0 0 0 pCEP4 pCEP4 AGR2 siNT siAGR2 siNT siCTSB siCTSD

Figure 5. CTSB and CTSD are functional downstream targets of AGR2. A, Western blot analysis (i) and densitometry quantiﬁcation (ii) showing increased expression of precursor and mature CTSB and CTSD in MiaPaCa2-pCEP4 and pCEP4 AGR2 lysates. Actin was used as a loading control. III, semiquantitative real-time PCR analysis of CTSB and CTSD gene expression in MiaPaCa2-pCEP4 and pCEP4 AGR2 showing no change in their transcript levels. S16 was used as a reference gene. B, Western blot (i and ii) and densitometry (iii and iv) showing increased protein levels of precursor and mature CTSB and CTSD in FA6 pancreatic cancer cells in comparison with HPDE cells and in metastatic PaTu 8988s in comparison with nonmetastatic PaTu 8988t. C, levels of pro-CTSD in the culture supernatant of MiaPaCa2-pCEP4 and pCEP4 AGR2 and in FA6 cells 48 hours after transfection with AGR2 or nontargeting (NT) siRNA. D, after siRNA silencingofCTSBandCTSDfor48hours(iandiii), decreased invasion of MiaPaCa2- pCEP4 AGR2 cells (ii) and FA6 cells (iv) was seen. Mean values of triplicate experiments are shown. , P < 0.05; , P < 0.005; , P < 0.0001. cell death (33). CALU and RCN1 are EF-hand members of the settings suggests that activation of ER stress response could CREC protein family (34) which is associated with various be one of the earliest events in PDAC development and could þ Ca2 -dependent processes in the secretory pathway; in the ER, provide a survival advantage to premalignant cells. Although in these proteins interact with the protein translocase (35) that the present study, we report on the consequences of AGR2 guides the transport of nascent presecretory proteins into the induction in the pancreas, the nature of the initial trigger that ER lumen. The regulation of these 2 ER chaperones by AGR2 causes early AGR2 induction is not known and currently under could thus directly affect one of the very ﬁrst steps in the investigation as it could potentially lead to a better under- protein secretion process (35). standing of pancreatic cancer initiation. Interestingly, Denoyelle and colleagues (36) showed that the The expression of PDI proteins and ER chaperones has also induction of ER stress chaperones is an early event in the been correlated with cancer invasion and metastasis in several initiation of melanoma. Similarly, the universal AGR2 expres- tumor types (33, 37), and we here provide similar evidence for sion in all precursor lesions in both sporadic and familial the role of AGR2 in PDAC.

www.aacrjournals.org Cancer Res; 71(22) November 15, 2011 OF9

Dumartin et al.

A C i ii iii *** i ii 100 *** 100 P < 0.0001 P < 0.0001 80 80

kDa siNT siAGR2 60 60 24 AGR2 40 40

No. of DTC No. 20 20 Day 0 Day 52 Actin of DTC per No.

0 embryo (%)/control 0 siNT siAGR2 siNT siAGR2 PaTu 8988s - CMTMR D PaTu 8988s - CMFDA iii

B Posterior Anterior iii i ii siNT siAGR2 E i ii iii ** 50 100 *** P = 0.0026 40 P < 0.0001 80

kDa siNT siCTSB Day 1 Day 30 60 26 CTSB 20 40

No. of DTC No. 10 20 52 Actin No. of DTC per No. 0

0 embryo (%)/control siNT siCTSB siNT siCTSB

F i ii iii *** ** 40 100 iii iv P = 0.0008 P = 0.0074 30 80 kDa siNT siCTSD 60 20 34 CTSD 40

No. of DTC No. 10 52 20

Actin of DTC per No.

0 embryo (%)/control 0 siNT siCTSD siNT siCTSD

Figure 6. AGR2 and CTSB/CTSD are major regulators of pancreatic cancer cell dissemination in vivo.A,fifty to 100 PaTu 8988s cells stained with CMTMR or CMFDA dyes were injected into the yolk sack of 48-hour-old embryos and assessed by epifluorescence microscopy (i) of the whole embryo and confocal microscopy (ii) of the injection area. B, twenty-four hours after injection, disseminated cancer cells were observed in the tail of the embryo (i) or in the yolk sack (ii). Elongated cells imaged by confocal microscopy in the tail (iii) and the yolk sack (iv) of the embryo. Scale bars, 50 mm. C, labeled PaTu 8988s cells transfected with AGR2 or nontargeting (NT) siRNA (i) were assessed by epifluorescence microscopy 24 hours after injection. The number of disseminated cells was statistically significantly decreased after AGR2 silencing (ii and iii). D, representative image of decreased tumor cell dissemination in zebrafish tail after AGR2 silencing (i). The enlarged respective images of the 2 marked areas in tail are shown on ii and iii. E and F, after silencing of CTSB/CTSD (i), a significant decrease in the number of disseminated cells was also seen (ii and iii), respectively. , P < 0.005; , P < 0.0001.

AGR2 expression induced an increase in the levels of CTSB cathepsins mRNA levels upon AGR2 upregulation. Identifying and CTSD, 2 disulfide-containing thiol proteases that have the formation of mixed disulfide bonds between AGR2 and previously been reported to be upregulated in pancreatic CTSB and CTSD would confer a formal evidence of this cancer (16, 38, 39) and are known to play a role in the dis- mechanism in pancreatic cancer cells; however, the speed and semination of cancer cells (40–42). Our in vitro data indicated the transient nature of this type of interaction potentiated by that AGR2-induced invasion was mediated through the action the presence of only 6 and 4 disulfide bonds in CTSB and CTSD, of these proteases rather than by increased cell motility, as no respectively (46), rendered such experimental confirmation difference in migration and wound-healing assays was challenging. Our in vivo studies using transparent zebrafish observed. The AGR2-induced increase in CTSB and CTSD embryos, which provide an elegant short-term invasion assay levels could be the direct result of AGR2 PDI activity in the and allows quantification of the DTCs with a single-cell res- ER during the processing of pro-cathepsins, as previously olution (47), faithfully recapitulated in vitro data and further reported for the production of MUC2 in enterocytes (12), substantiated that the role of AGR2 in increased invasion of especially because we also observed an increase in the levels pancreatic cancer cells is largely mediated by the 2 cathepsins. of cathepsin precursor forms. This is also in accordance with a Finally, we observed that AGR2 expression in PDAC cells is number of other reports of PDI activity in protein folding being also involved in regulation of pro-CTSD secretion; overexpres- a limiting factor for protein synthesis and secretion (43, 44). sion of CTSD in cancer cells was reported previously to lead to The concept of a posttranslational regulation of cathepsins as the hypersecretion of its proteolytically inactive proform (48). observed previously (45), and here reported to be mediated by Furthermore, increased levels of pro-CTSD have been found in AGR2, is additionally supported by the absence of change in the plasma of patients with metastatic breast carcinoma (49)

OF10 Cancer Res; 71(22) November 15, 2011 Cancer Research

AGR2 in Pancreatic Cancer Invasion

and antibodies recognizing pro-CTSD in the serum of patients Acknowledgments with ovarian cancer (50). If a similar situation is established in fl PDAC, pro-CTSD might constitute a potential target for new The authors thank Dr. Guglielmo Rosignoli for technical assistance with ow cytometric analyses. detection strategies. In summary, we provide new insights into the mechanisms Grant Support of action of AGR2 and its role in dissemination of pancreatic cancer cells through regulation of CTSB and CTSD both in vitro The work was supported by funding from CR-UK (L. Dumartin, H.J. and in vivo. In addition, we show that AGR2 can also be Whiteman, and N.R. Lemoine), EU-FW6 (M.E. Weeks and D. Hariharan), immunodetected at the surface of cancer cells, which could and HEFCE (T. Crnogorac-Jurcevic). Part of the proteomic work (2D-DIGE) was undertaken at UCLH/UCL and supported by funding to J.F. Timms from open new avenues for both the early detection and the devel- the Department of Health's NIHR Biomedical Research Centres funding opment of novel immunotherapeutic strategies in pancreatic scheme. adenocarcinoma. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Disclosure of Potential Conflicts of Interest Received May 2, 2011; revised August 31, 2011; accepted September 15, 2011; No potential conflicts of interest were disclosed. published OnlineFirst September 26, 2011.

References 1. Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J mediated through cytoskeletal changes and regulation of cathepsin D. Clin 2010;60:277–300. Cancer Res 2007;67:8633–42. 2. Barraclough DL, Platt-Higgins A, de Silva Rudland S, Barraclough R, 15. Weeks ME, Sinclair J, Butt A, Chung YL, Worthington JL, Wilkinson CR, Winstanley J, West CR, et al. The metastasis-associated anterior et al. A parallel proteomic and metabolomic analysis of the hydrogen gradient 2 protein is correlated with poor survival of breast cancer peroxide- and Sty1p-dependent stress response in Schizosacchar- patients. Am J Pathol 2009;175:1848–57. omyces pombe. Proteomics 2006;6:2772–96. 3. Liu D, Rudland PS, Sibson DR, Platt-Higgins A, Barraclough R. Human 16. Shen J, Person MD, Zhu J, Abbruzzese JL, Li D. Protein expression homologue of cement gland protein, a novel metastasis inducer profiles in pancreatic adenocarcinoma compared with normal pan- associated with breast carcinomas. Cancer Res 2005;65:3796–805. creatic tissue and tissue affected by pancreatitis as detected by 4. Fritzsche FR, Dahl E, Dankof A, Burkhardt M, Pahl S, Petersen I, et al. two-dimensional gel electrophoresis and mass spectrometry. Cancer Expression of AGR2 in non small cell lung cancer. Histol Histopathol Res 2004;64:9018–26. 2007;22:703–8. 17. Grønborg M, Kristiansen TZ, Iwahori A, Chang R, Reddy R, Sato N, 5. Park K, Chung YJ, So H, Kim K, Park J, Oh M, et al. AGR2, a mucinous et al. Biomarker discovery from pancreatic cancer secretome using ovarian cancer marker, promotes cell proliferation and migration. Exp a differential proteomic approach. Mol Cell Proteomics 2006;5: Mol Med 2011;43:91–100. 157–71. 6. Pohler E, Craig AL, Cotton J, Lawrie L, Dillon JF, Ross P, et al. The 18. Elsasser HP, Lehr U, Agricola B, Kern HF. Establishment and char- Barrett's antigen anterior gradient-2 silences the p53 transcriptional acterisation of two cell lines with different grade of differentiation response to DNA damage. Mol Cell Proteomics 2004;3:534–47. derived from one primary human pancreatic adenocarcinoma. Virch- 7. Zhang JS, Gong A, Cheville JC, Smith DI, Young CY. AGR2, an ows Arch B Cell Pathol Incl Mol Pathol 1992;61:295–306. androgen-inducible secretory protein overexpressed in prostate can- 19. Sloane BF, Rozhin J, Hatfield JS, Crissman JD, Honn KV. Plasma cer. Genes Chromosomes Cancer 2005;43:249–59. membrane-associated cysteine proteinases in human and animal 8. Smirnov DA, Zweitzig DR, Foulk BW, Miller MC, Doyle GV, Pienta KJ, tumors. Exp Cell Biol 1987;55:209–24. et al. Global gene expression profiling of circulating tumor cells. Cancer 20. Missiaglia E, Blaveri E, Terris B, Wang YH, Costello E, Neoptolemos JP, Res 2005;65:4993–97. et al. Analysis of gene expression in cancer cell lines identifies 9. Sitek B, Sipos B, Alkatout I, Poschmann G, Stephan C, Schulenborg T, candidate markers for pancreatic tumorigenesis and metastasis. Int et al. Analysis of the pancreatic tumor progression by a quantitative J Cancer 2004;112:100–12. proteomic approach and immunhistochemical validation. J Proteome 21. Thompson DA, Weigel RJ. hAG-2, the human homologue of the Res 2009;8:1647–56. Xenopus laevis cement gland gene XAG-2, is coexpressed with estro- 10. Ramachandran V, Arumugam T, Wang H, Logsdon CD. Anterior gen receptor in breast cancer cell lines. Biochem Biophys Res Com- gradient 2 is expressed and secreted during the development of mun 1998;251:111–16. pancreatic cancer and promotes cancer cell survival. Cancer Res 22. Altmeyer A, Maki RG, Feldweg AM, Heike M, Protopopov VP, Masur 2008;68:7811–18. SK, et al. Tumor-specific cell surface expression of the-KDEL contain- 11. Persson S, Rosenquist M, Knoblach B, Khosravi-Far R, Sommarin M, ing, endoplasmic reticular heat shock protein gp96. Int J Cancer Michalak M, et al. Diversity of the protein disulfide isomerase family: 1996;69:340–9. identification of breast tumor induced Hag2 and Hag3 as novel mem- 23. Jordan PA, Gibbins JM. Extracellular disulfide exchange and the bers of the protein family. Mol Phylogenet Evol 2005;36:734–40. regulation of cellular function. Antioxid Redox Signal 2006;8: 12. Park SW, Zhen G, Verhaeghe C, Nakagami Y, Nguyenvu LT, Barczak 312–24. AJ, et al. The protein disulfide isomerase AGR2 is essential for pro- 24. Carter P, Smith L, Ryan M. Identification and validation of cell surface duction of intestinal mucus. Proc Natl Acad Sci U S A 2009;106: antigens for antibody targeting in oncology. Endocr Relat Cancer 6950–5. 2004;11:659–87. 13. Liu N, Furukawa T, Kobari M, Tsao MS. Comparative phenotypic 25. Turano C, Coppari S, Altieri F, Ferraro A. Proteins of the PDI family: studies of duct epithelial cell lines derived from normal human pan- unpredicted non-ER locations and functions. J Cell Physiol 2002;193: creas and pancreatic carcinoma. Am J Pathol 1998;153:263–9. 154–63. 14. Whiteman HJ, Weeks ME, Dowen SE, Barry S, Timms JF, Lemoine NR, 26. Couet€ J, de Bernard S, Loosfelt H, Saunier B, Milgrom E, Misrahi M, et al. The role of S100P in the invasion of pancreatic cancer cells is et al. Cell surface protein disulfide-isomerase is involved in the

www.aacrjournals.org Cancer Res; 71(22) November 15, 2011 OF11

Dumartin et al.

shedding of human thyrotropin receptor ectodomain. Biochemistry 39. Iacobuzio-Donahue CA, Maitra A, Olsen M, Lowe AW, van Heek NT, 1996;35:14800–5. Rosty C, et al. Exploration of global gene expression patterns in 27. Lahav J, Gofer-Dadosh N, Luboshitz J, Hess O, Shaklai M. Protein pancreatic adenocarcinoma using cDNA microarrays. Am J Pathol disulfide isomerase mediates integrin-dependent adhesion. FEBS Lett 2003;162:1151–62. 2000;475:89–92. 40. Rao JS. Molecular mechanisms of glioma invasiveness: the role of 28. Willems SH, Tape CJ, Stanley PL, Taylor NA, Mills IG, Neal DE, et al. proteases. Nat Rev Cancer 2003;3:489–501. Thiol isomerases negatively regulate the cellular shedding activity of 41. Joyce JA, Baruch A, Chehade K, Meyer-Morse N, Giraudo E, Tsai FY, ADAM17. Biochem J 2010;428:439–50. et al. Cathepsin cysteine proteases are effectors of invasive growth 29. Chen R, Pan S, Duan X, Nelson BH, Sahota RA, de Rham S, et al. and angiogenesis during multistage tumorigenesis. Cancer Cell Elevated level of anterior gradient-2 in pancreatic juice from patients 2004;5:443–53. with pre-malignant pancreatic neoplasia. Mol Cancer 2010;9:149. 42. Tzanakakis GN, Margioris AN, Tsatsakis AM, Vezeridis MP. The 30. Fonseca C, Soiffer R, Ho V, Vanneman M, Jinushi M, Ritz J, et al. metastatic potential of human pancreatic cell lines in the liver of nude Protein disulfide isomerases are antibody targets during immune- mice correlates well with cathepsin B activity. Int J Gastrointest Cancer mediated tumor destruction. Blood 2009;113:1681–8. 2003;34:27–38. 31. Zhao F, Edwards R, Dizon D, Afrasiabi K, Mastroianni JR, Geyfman M, 43. Davis R, Schooley K, Rasmussen B, Thomas J, Reddy P. Effect of PDI et al. Disruption of Paneth and goblet cell homeostasis and increased overexpression on recombinant protein secretion in CHO cells. Bio- endoplasmic reticulum stress in Agr2-/- mice. Dev Biol 2010;338: technol Prog 2000;16:736–43. 270–9. 44. Robinson AS, Hines V, Wittrup KD. Protein disulfide isomerase over- 32. Moenner M, Pluquet O, Bouchecareilh M, Chevet E. Integrated endo- expression increases secretion of foreign proteins in Saccharomyces plasmic reticulum stress responses in cancer. Cancer Res 2007;67: cerevisiae. Biotechnology (N Y) 1994;12:381–4. 10631–4. 45. Gole B, Duran Alonso MB, Dolenc V, Lah T. Post-translational regu- 33. Lovat PE, Corazzari M, Armstrong JL, Martin S, Pagliarini V, Hill D, et al. lation of cathepsin B, but not of other cysteine cathepsins, contributes Increasing melanoma cell death using inhibitors of protein disulfide to increased glioblastoma cell invasiveness in vitro. Pathol Oncol Res isomerases to abrogate survival responses to endoplasmic reticulum 2009;15:711–23. stress. Cancer Res 2008;68:5363–9. 46. Baldwin ET, Bhat TN, Gulnik S, Hosur MV, Sowder RC, Cachau RE, 34. Honore B, Vorum H. The CREC family, a novel family of multiple EF- et al. Crystal structures of native and inhibited forms of human hand, low-affinity Ca(2þ)-binding proteins localised to the secretory cathepsin D: implications for lysosomal targeting and drug design. pathway of mammalian cells. FEBS Lett 2000;466:11–8. Proc Natl Acad Sci U S A 1993;90:6796–800. 35. Tyedmers J, Lerner M, Nastainczyk W, Zimmermann R. Calumenin and 47. Marques IJ, Weiss FU, Vlecken DH, Nitsche C, Bakkers J, Lagendijk reticulocalbin are associated with the protein translocase of the mam- AK, et al. Metastatic behaviour of primary human tumours in a zebrafish malian endoplasmic reticulum. J Biol Sci 2005;5:70–5. xenotransplantation model. BMC Cancer 2009;9:128. 36. Denoyelle C, Abou-Rjaily G, Bezrookove V, Verhaegen M, Johnson 48. Capony F, Rougeot C, Montcourrier P, Cavailles V, Salazar G, Roche- TM, Fullen DR, et al. Anti-oncogenic role of the endoplasmic reticulum fort H, et al. Increased secretion, altered processing, and glycosylation differentially activated by mutations in the MAPK pathway. Nat Cell Biol of pro-cathepsin D in human mammary cancer cells. Cancer Res 2006;8:1053–63. 1989;49:3904–9. 37. Goplen D, Wang J, Enger P, Tysnes BB, Terzis AJ, Laerum OD, et al. 49. Brouillet JP, Dufour F, Lemamy G, Garcia M, Schlup N, Grenier J, et al. Protein disulfide isomerase expression is related to the invasive prop- Increased cathepsin D level in the serum of patients with metastatic erties of malignant glioma. Cancer Res 2006;66:9895–902. breast carcinoma detected with a specific pro-cathepsin D immuno- 38. Tumminello FM, Leto G, Pizzolanti G, Candiloro V, Crescimanno M, assay. Cancer 1997;79:2132–6. Crosta L, et al. Cathepsin D, B and L circulating levels as prog- 50. Taylor DD, Gercel-Taylor C. Tumor-reactive immunoglobulins in ovar- nostic markers of malignant progression. Anticancer Res 1996;16: ian cancer: diagnostic and therapeutic significance? (review). Oncol 2315–9. Rep 1998;5:1519–24.

OF12 Cancer Res; 71(22) November 15, 2011 Cancer Research

AGR2 Is a Novel Surface Antigen That Promotes the Dissemination of Pancreatic Cancer Cells through Regulation of Cathepsins B and D

Laurent Dumartin, Hannah J. Whiteman, Mark E. Weeks, et al.

Cancer Res Published OnlineFirst September 26, 2011.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-11-1367

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2011/09/26/0008-5472.CAN-11-1367.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2011/11/04/0008-5472.CAN-11-1367. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.