The Stomatin STO-6 Is a Novel Regulator of the Caenorhabditis Elegans Motor Circuit

The Stomatin STO-6 is a Novel Regulator of the Caenorhabditis elegans Motor Circuit

Louis Barbier

A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Molecular Genetics University of Toronto

The Stomatin STO-6 is a Novel Regulator of the Caenorhabditis elegans Motor Circuit

Louis Barbier

Master of Science

Department of Molecular Genetics University of Toronto

2012 Abstract

The ability to move is essential to an animal’s ability to interact with and respond to its changing environment. The nematode Caenorhabditis elegans is a commonly used organism in the study of the genetic and neural bases of behaviours, yet the mechanistic explanation for its ability to move in a smooth sinusoidal wave remains elusive. Here, I present studies of an uncharacterized gene, sto-6, encoding a stomatin protein that regulates C. elegans motor behaviour. I show that this gene plays a role in two unexplained and fundamental processes to C. elegans locomotion: wave initiation and wave propagation. Furthermore, I examine the genetic interaction between sto-6 and an innexin gene unc-7, providing support for the hypothesis that stomatins regulate gap junction proteins in C. elegans. Together, these studies push forward our understanding of the mechanistic basis of C. elegans locomotion, and open up avenues of further inquiry.

Acknowledgements

I would like to thank my supervisor Dr. Mei Zhen for her mentorship, patience, excitement, and honest approach to science. I left feeling more positive about my project and science in general after every meeting we sat down for, which I think is a clear mark of a good supervisor.

I would also like to thank my committee members for their input and character: Derek van der Kooy for bringing his enthusiasm and joy; Andrew Spence for his two cents condensed from his immense knowledge base; and Michael Salter for peppering my meetings with his presence when he was available.

I would like to make a shout out to Michelle Po for being an awesome mentor and colleague. Her patience, determination and ability to focus boggles my mind.

I greatly enjoyed hanging out with and learning from Wesley Hung in between his running around doing a million experiments every day. I also thank Ying Wang for doing her thing so steadily.

To all other members of the Zhen Lab, thank you for the good times, helpful discussion, delicious snacks, and inside jokes.

I would like to thank Peter Roy and his lab members for first inspiring me to pursue graduate research, perched over my microscope in search for a guiding force in life.

Finally, I would like to thank all of my friends and family, for keeping me sane during tough times, and allowing me to stay exposed to the world outside of science while being immersed in it.

iii

Table of Contents

ACKNOWLEDGEMENTS ...... III

TABLE OF CONTENTS...... IV

LIST OF TABLES ...... VII

LIST OF FIGURES...... VIII

LIST OF ABBREVIATIONS...... IX

1 INTRODUCTION: THE C. ELEGANS MOTOR CIRCUIT AS A MODEL FOR UNDERSTANDING GENES FUNCTIONING TO COORDINATE ACTIVITY IN THE NERVOUS SYSTEM ...... 1 1.1 STUDYING ANIMAL BEHAVIOUR AT THE GENETIC AND NEURAL CIRCUIT LEVELS ...... 1 1.1.1 Animal behaviour is driven by interactions between the nervous system and the environment...... 1 1.1.2 Behavioural genetics links molecules to behaviours...... 2 1.1.3 Model systems used to study fundamental aspects of behaviour ...... 2 1.2 C. ELEGANS LOCOMOTION AS A MODEL FOR UNDERSTANDING BEHAVIOUR GENERATION...... 4 1.2.1 The C. elegans connectome guides our functional understanding of the nervous system....4 1.2.2 The anatomy and connectivity of the C. elegans motor circuit ...... 5 1.2.3 C. elegans locomotion in the laboratory...... 8 1.2.4 C. elegans gait analysis...... 9 1.2.5 Is the undulatory wave driven by a central pattern generator?...... 10 1.3 DETAILED ANALYSES OF C. ELEGANS LOCOMOTION CAN REVEAL MECHANISMS UNDERLYING BEHAVIOUR ...... 11 1.3.1 Quantitative analysis of locomotion ...... 11 1.3.2 Ablation studies to understand motor circuit function ...... 12 1.3.3 Optogenetic approaches to understand the motor circuit ...... 13 1.3.4 An altered waveform and bending frequency phenotype resulting from defects in the DGC complex and muscle acetylcholine transport ...... 14 1.4 INNEXIN GAP JUNCTIONS AND STOMATINS REGULATE THE C. ELEGANS MOTOR CIRCUIT...... 15 1.4.1 Innexins and stomatins are implicated in regulation of C. elegans motor circuit dynamics 15 iv

1.4.2 Stomatins are conserved, lipid raft-associated, channel-modulating oligomeric proteins.18 1.4.3 Stomatin function is conserved between invertebrates and vertebrates...... 19 1.4.4 A forward genetic screen for suppressors of the unc-7 kinker phenotype identifies stomatins as potential regulators of gap junctions...... 21 1.5 OUTLINE AND RATIONALE ...... 21

2 CHAPTER 2: STO-6 REGULATES MOTOR BEHAVIOUR IN C. ELEGANS...... 24 2.1 SPECIFIC BACKGROUND ...... 24 2.1.1 hp395 is a semi-dominant gain of function mutation of sto-6...... 24 2.1.2 sto-6(gf) lies in a genetic pathway with other innexins and stomatins...... 26 2.1.3 sto-6(gf) does not restore the AVA-A motor neuron gap junction to suppress unc-7(lf)....26 2.2 RESULTS ...... 28 2.2.1 sto-6(gf), but not sto-6(lf), displays an overt locomotion phenotype ...... 28 2.2.2 sto-6 is expressed in motor neurons and localizes to puncta in the axonal compartment..30 2.2.3 The sto-6(gf) phenotype arises from effects in the B-class motor neurons...... 33 2.2.4 sto-6(gf) suppresses unc-7(lf) mutants in a developmental stage-specific manner ...... 37 2.2.5 sto-6 is likely required in multiple neurons, including those outside the core motor circuit, to suppress unc-7(lf) ...... 38

3 CHAPTER 3: DISCUSSION AND FUTURE DIRECTIONS...... 45 3.1 THE UNIQUE PHENOTYPIC PROFILE OF STO-6 MUTANTS CAN SHED LIGHT ON NOVEL MECHANISMS OF REGULATION OF THE MOTOR CIRCUIT ...... 45 3.1.1 Mutations in sto-6 alter the frequency of body bending through an unknown mechanism 45 3.1.2 The increased anterior wave amplitude and decay seen in sto-6(gf) may result from altered cholinergic signaling in B motor neurons ...... 48 3.2 THE STAGE-SPECIFICITY OF STO-6(GF)-MEDIATED UNC-7(LF) SUPPRESSION LIKELY ARISES FROM DEVELOPMENTAL REGULATION OF STOMATIN AND INNEXINS ...... 51 3.3 THE AS CLASS CHOLINERGIC MOTOR NEURONS CONTRIBUTE TO STO-6(GF)-MEDIATED RESCUE OF UNC-7(LF) KINKERS...... 52 3.4 CLOSING PERSPECTIVES...... 55

4 METHODS...... 57 4.1 STRAINS ...... 57 4.2 MOLECULAR BIOLOGY ...... 57 4.3 SITE-DIRECTED MUTAGENESIS...... 58

4.4 IMAGING...... 59 4.5 LOCOMOTION ANALYSIS...... 59 4.6 CURVATURE ANALYSIS ...... 60

5 REFERENCES...... 66

List of Tables

Table 1 – Complete list of strains ………………………………………………………………61

Table 2 – Complete list of plasmids ……………………………………………………………63

Table 3 – Oligonucleotides used for genotyping ……………………………………………….64

Table 4 – Oligonucleotides used for plasmid construction ……………………………………..64

vii

List of Figures

Figure 1 - The anatomy and connectivity of the C. elegans motor circuit………………………6

Figure 2 - An unc-7(lf) suppressor screen identifies two stomatins as potential gap junction regulators…………………………………………………………………………………………17

Figure 3 - Stomatins are conserved membrane bound proteins ………………………………...25

Figure 4 - Quantification of locomotion parameters reveals the phenotypes of sto-6(gf) and sto- 6(lf) mutants ……………………………………………………………………………………..29

Figure 5 - STO-6 is expressed in a subset of neurons in and out of the core motor circuit...... 32

Figure 6 - The sto-6(gf) phenotype can be reverted by overexpressing STO-6(wt) in B motor neurons and PVC interneurons…………………………………………………………………..34

Figure 7 - The sto-6(gf) phenotype can be recapitulated by expression of STO-6(gf) in B motor neurons and PVC interneurons…………………………………………………………………..36

Figure 8 - sto-6(gf) restores forward movement to unc-7(lf) kinkers in a developmental stage- specific manner…………………………………………………………………………………..39

Figure 9 - The sto-6(gf) unc-7(lf) phenotype can be partially reverted by overexpressing STO- 6(wt) in A, B, and AS motor neurons …………………………………………………………...41

Figure 10 - The sto-6(gf) unc-7(lf) phenotype is not recapitulated by expressing STO-6(gf) in any of the tested subsets of the core motor circuit neurons in sto-6(lf) unc-7(lf) animals. ……...44

Figure 11 - Model of the basis of the sto-6(gf) and sto-6(lf) phenotypes ………………………47

Figure 12 - Model of sto-6(gf) suppression of the unc-7(lf) kinker phenotype…………………53

viii

List of Abbreviations

DGC Dystrophin Glycoprotein Complex

NMJ Neuromuscular Junction

ASIC Acid-Sensing Ion Channel

STG Stomatogastric Ganglion

CPG Central Pattern Generator lf loss of function gf gain of function wt wild type

ROS Reactive Oxygen Species

PHB Prohibitin Homology Domain

YFP Yellow Fluorescent Protein

GFP Green Fluorescent Protein

DNA Deoxyribonucleic Acid

L4 Fourth Larval Stage

YA Young Adult

RNAi RNA interference mosDEL Mos transposon-mediated targeted DNA sequence deletion

PCR Polymerase Chain Reaction

1 Introduction: The C. elegans motor circuit as a model for understanding genes functioning to coordinate activity in the nervous system

1.1 Studying animal behaviour at the genetic and neural circuit levels

1.1.1 Animal behaviour is driven by interactions between the nervous system and the environment

All animal behaviour stems from movement triggered by the interplay between environmental and internal cues. Movement, in turn, results from the coordinated action of the nervous system controlling the activity of muscles, which convert chemical to mechanical energy to do work. How the nervous system, composed of discrete and interconnected neurons, controls and coordinates muscle activity has remained a central question in neurobiology for several centuries (Sherrington 1910; Clarac 2008). The question can be approached from many different avenues. Modern tools of molecular biology inform a reductionist view, for example pinpointing specific gait defects to a single molecular lesion in Lurcher mice (Zuo et al. 1997). More classic approaches applied a systems-level analysis of locomotion, for example studies of spinal reflexes and muscle action in cats and dogs (Sherrington 1910). Together, this spectrum of approaches aims to understand the biological mechanisms, as products of evolution, which underlie interactions between living forms and their environment.

1.1.2 Behavioural genetics links molecules to behaviours

The field of behavioural genetics attempts to identify genetic elements controlling behaviour. It entails a multi-disciplinary approach combining aspects of population genetics, molecular genetics and behavioural studies. The pursuit of behavioural genetics can trace its origins to the 1960s and 1970s, where classic experiments include the discovery of genes underlying circadian rhythms in Drosophila melanogaster (Konopka and Benzer 1971), and large scale forward genetic screens for isolating mutants affecting nervous system function (Brenner 1974). These studies layed the groundwork for extensive research into the genetic and neural basis of behaviour. More recently, there is a shift towards using quantitative genetics to elucidate cases in which naturally occuring polymorphisms affect behaviour and fitness in the wild, giving us a glimpse of the molecular basis of evolution in action (Edwards and Mackay 2009; Bendesky et al.

2011). It is important to keep in mind that behavioural genetics is but one approach of several that are being applied to develop a comprehensive understanding of nervous system form and function.

1.1.3 Model systems used to study fundamental aspects of behaviour

Several model systems to study this problem have emerged over the past few decades, each bringing a different level and depth of understanding of this problem. For example, the crustacean stomatogastric ganglion (STG) has demonstrated the ability of a small, well-characterized set of neurons to encode multiple rhythmic activities, which drive different behaviours (Marder and Bucher 2007). These groundbreaking studies,

using electrophysiology to define essentially all of the connections between the ~30 neurons in the ganglia, have revealed to us that neural circuits are not fixed, and that neuromodulators, hormones, biogenic amines, and diffusible gasses have profound influences on individual neuron and circuit-wide activities. Importantly, the pivotal role played by neuromodulators in mediating flexibility of the STG neural circuit is likely conserved in all other nervous systems, and this level of regulation cannot be deduced from the current trend towards “connectomic” approaches (Bargmann 2012). Recent studies have used transgenic methods to report neuromodulator receptor activation, paving the way towards supplementing connectomic information with maps of neuromodulator activity (Inagaki et al. 2012).

Nematodes have been invaluable tools for the study of many facets of genetics and neurobiology (Sulston et al. 1992; Bargmann 1998), and control of locomotion has been a point of focus since the beginning (Brenner 1974). Classic studies examined the nervous systems of larger parasitic nematodes of the Ascaris genus and proposed models for coordination of body bending (Stretton et al. 1985; Stretton et al. 1992), whereas studies of the popular genetic model organism C. elegans have revealed different levels of genetic control of motor circuit specification, anatomy, and function (Von Stetina et al.

2006). Over the last few decades, C. elegans has been widely used a model system to study motor, sensory, social, mating, and even sleep-like behaviours (Liu and Sternberg

1995; Mori and Ohshima 1995; de Bono and Bargmann 1998; Raizen et al. 2008;

Kawano et al. 2011), with many findings being relevant to other organisms including humans, as a result of a high degree of genetic and functional conservation (Bargmann

1998). The remainder of this thesis focuses on studies of the motor behavior of C. elegans.

1.2 C. elegans locomotion as a model for understanding behaviour generation

1.2.1 The C. elegans connectome guides our functional understanding of the nervous system

Pioneering studies by John White and colleagues provided the first complete

“connectome” – the synaptic wiring diagram – of any animal (White et al. 1986). This dataset, which was recently re-annotated, includes 282 neurons in the main nervous system connected by 6393 chemical and 890 electrical synapses between them (Varshney et al. 2011), in addition to 20 neurons controlling the activity of the feeding organ, the pharynx (Albertson and Thomson 1976). In the main nervous system, the amphid, phasmid, and deirid sensory organs, as well as the sensilla of the mouth contain the endings of sensory neurons, which feed signals into interneurons residing in ganglia in the head and tail regions of the animal (Inglis et al. 2006). These interneuons are highly interconnected, integrate sensory signals, and relay this information to control motor neurons residing in the head and along the body, to produce coordinated locomotion in response to changing environmental cues.

The connectome provides a useful framework to understand nervous system function. Studies of the crustacean stomatogastric ganglion (see above) also benefited

from having a conceptual “connectome” deduced from in situ electrophysiological recordings of many different and overlapping sets of the stereotypical ~30 neurons in the ganglion (Marder and Bucher 2007). These early examples of connectomics driving future functional characterization of “simple” nervous systems have led to several large scale projects towards obtaining connectomic information at multiple scales of other, more complex, invertebrate and mammalian brains (Kleinfeld et al. 2011). Over the 26 years that we have had the virtually complete (and subsequently re-annotated (Varshney et al. 2011)) C. elegans wiring diagram, we have gleaned much knowledge of the workings of the motor circuit, starting from the basic anatomy.

1.2.2 The anatomy and connectivity of the C. elegans motor circuit

Examination of the C. elegans connectome led to early predictions of the anatomy and connections within the “core” motor circuit (Figure 1). A set of 5 pairs of premotor interneurons – AVB, AVA, AVD, AVE in the head, and PVC in the tail – are the primary interneurons that are presynaptic to motor neurons. Five classes of motor neurons – A, B,

D, AS, and VC – reside in the ventral nerve cord of the animal and synapse onto the body wall muscle cells. Body wall muscles, which are arranged longitudinally in four quadrants, send membrane projections called muscle arms to the nearest nerve cord

(dorsal or ventral), where they form en passant neuromuscular junctions (NMJ) with motor neuron axons. The A, B, and D class motor neurons are subdivided into dorsal

(DA, DB, DD) or ventral (VA, VB, VD) depending on whether they innervate dorsal or ventral muscle, respectively.

The AS class motor neurons innervate dorsal muscle only, and the VC motor neurons innervate ventral muscles.

The A, B, AS, and VC motor neuron classes are cholinergic and drive muscle action potentials and contraction by stimulating two types of acetylcholine receptors on post-synaptic muscles (Richmond and Jorgensen 1999; Gao and Zhen 2011). The D class motor neurons are GABAergic, and induce muscle relaxation. A neural mechanism for cross-inhibition of muscle activity at a given body segment was proposed to explain local body bending (Chalfie et al. 1985; Stretton et al. 1985; White et al. 1986; Stretton et al.

1992). A and B class cholinergic motor neurons form dyadic synapses onto muscle and D motor neurons, pairing muscle excitation on one side of the animal with GABAergic signaling to the contralateral side. For example, a DA motor neuron synapses in the dorsal nerve cord onto dorsal muscle as well as the dendrite of a VD motor neuron, which synapses onto the ventral muscle of the same segment in response to stimulation from the

DA motor neuron (Figure 1B). This mechanism of cross-inhibition was shown to be at least partially responsible for coordinating anti-phase activity of ventral and dorsal musculature, because in GABA-deficient mutants, animals exhibit “shrinking” when they are stimulated to move. This indicates a lack of inhibition of muscle activity, although unstimulated animals are still able to bend and propagate forward movement-driving body waves (McIntire et al. 1993; Karbowski et al. 2008)

Individual components of the three layers of the core motor circuit – the premotor interneurons, the motor neurons of the ventral nerve cord, and the body wall muscles – are each interconnected among themselves in what has been called “lateral signaling”.

(Von Stetina et al. 2006). The premotor interneurons are likely to be glutamatergic, and

synapse heavily onto one another (Figure 1C). Within the set of 5 pairs, the AVA and

AVB pairs are the most common post-synaptic targets, and provide the most pre-synaptic input onto motor neurons via chemical synapses (AVA to A motor neurons) and gap junctions (AVA to A motor neurons, AVB to B motor neurons). The individual members of the VA, VB, and VD subclass of motor neurons are connected by gap junctions to their neighbours at the adjacent ends of the axons in the nerve cords, whereas these intra-class gap junctions are more sparse in the DA, DB, and DD motor neurons (White et al. 1986).

The reason for this ventral bias, and indeed the overall function, of these motor neuron gap junctions is poorly understood. Adjacent body wall muscle cells are electrically coupled via UNC-9 innexin low-conductance gap junctions (Chen et al. 2007). However, muscle coupling is unlikely to significantly affect locomotion, given that the unc-9(lf) locomotor phenotype can be fully rescued from expression in the nervous system (Starich et al. 2009als; Kawano et al. 2011) and inducing acute muscle contraction using optogenetics in a nervous system-dead (using ivermectin or unc-13(lf)) animal does not trigger bending of adjacent body segments (Wen et al. 2012).

1.2.3 C. elegans locomotion in the laboratory

The motor behaviour of the standard inbred laboratory wild type strain, N2, is typically studied on an agar plate, where it propagates smooth sinusoidal waves consisting of dorsal-ventral flexures to propel itself. Wild type animals are strongly biased towards forward movement, interrupted by brief spontaneous reversals (Brenner

1974). The decision between forward and backward movement has been extensively studied at the cellular and molecular levels. Laser ablation of individual and pairs of

premotor interneurons was used to tease apart their contribution to locomotion (Chalfie et al. 1985). Although killing any single pair of bilateral premotor neurons did not abolish locomotion in either direction completely, they did exhibit specific defects to either forward or backward movement, defining a “core” motor circuit, based on anatomy and crude functional requirements (Figure 1C). Further refinement of the role of these premotor interneurons in determining the directionality of locomotion revealed that directional selection involves a distributed network rather than neurons dedicated to either forward or backward movement (Zheng et al. 1999; Kawano et al. 2011).

Additional studies involved characterizing specific channels and receptors functioning in the premotor interneurons. For example, nmr-1, the C. elegans NMDA receptor homologue, is expressed in a subset of these premotor interneurons. nmr-1 loss of function alters electrophysiological properties of the AVA interneuron, which reduces the probability with which a worm will switch from forward to backward locomotion

(Brockie et al. 2001). Such studies have led to a detailed, relative to other model systems, but still largely incomplete understanding of the control of directional movement in C. elegans.

1.2.4 C. elegans gait analysis

When placed in liquids, the animals exhibit a C-shaped rather than S-shaped posture, and “thrash” between dorsal and ventral flexure. These two different behaviours are thought to arise from a single gait, through varying kinematic parameters of frequency, wavelength, and amplitude. When animals were free to move in media of intermediate densities, they were found to transition smoothly between the parameters for

crawling and those for swimming (Berri et al. 2009; Fang-Yen et al. 2010). However, recent evidence has emerged indicating that certain genetic mutants display clear switching between swimming and crawling locomotion in liquid, implying that a

“decision” is underlying the transition (Vidal-Gadea et al. 2011). Thus, the question of one modified gait versus multiple distinct gaits remains an open question in the field.

Understanding the control mechanisms underlying either crawling or swimming – which are determined by the parameters of frequency, wavelength, and amplitude – remains an interesting and important question to answer in the quest to understand behaviour.

1.2.5 Is the undulatory wave driven by a central pattern generator?

Central Pattern Generators (CPGs) are neural circuits that intrinsically produce rhythmic patterns of neural activity that are independent of sensory and other inputs.

CPGs have been found to underlie many continuous rhythmic activities, such as respiration (Del Negro et al. 2002) and heartbeat (Arbas and Calabrese 1987), as well as episodic rhythmic behaviours such as locomotion (Grillner 1985). Regarding C. elegans locomotion, there have been several attempted computational models of the forward locomotion circuit, either without an explicit CPG (Bryden and Cohen 2008), or with variation in the CPG’s dependence on proprioceptive feedback (Karbowski et al. 2008).

Specifically, Karbowski et al. (2008) propose that the CPG lies in a minimal network of three head interneurons and proprioceptive feedback to those neurons coming from head muscle and motor neurons. This CPG lies upstream of the AVB and PVC forward premotor interneurons, which have relatively stable activities and exhibit high frequency, low-amplitude oscillations in activity. Their oscillations act to maintain oscillatory

neuromuscular activity in the body region of the animal, in a proprioceptive feedback- dependent manner. The authors stated that in wild type and various neural-defective mutants, wave amplitude decays along the longitudinal axis of the worm during both forward and backward locomotion. This result would imply that all wave generation occurs in the head of the animal, and that the CPG is likely to reside in the head

(Karbowski et al. 2008). Strong experimental evidence for the existence of a CPG, whether in the head, ventral nerve cord, or tail (or distributed among them), however, is still lacking in the field.

1.3 Detailed analyses of C. elegans locomotion can reveal mechanisms underlying behaviour

1.3.1 Quantitative analysis of locomotion

Automated approaches to analyzing C. elegans locomotion have largely replaced traditional approaches, which relied on manual observation, making them time- consuming and more susceptible to experimenter bias. These automated approaches vary in their depth of feature extraction and throughput. For example, the Parallel Worm

Tracker is compatible with a range of hardware set-ups, and uses a centroid-based algorithm to measure the average speed and fraction paralyzed of up to 30 animals simultaneously, which facilitates screening for sensitivity to drugs (Ramot et al. 2008).

On the other hand, other trackers operate at higher magnification (40x-60x), and

“skeletonize” a high-contrast image of a single animal in order to extract many parameters, such as speed, reversal frequency, turning angle, body size, curvature and

postures over long time periods (Baek et al. 2002; Stephens et al. 2008). In particular, the measurement of body curvature was used to generate mathematical equations in which four dimensions, or “eigenworms” are able to capture 95% of the variation in body posture during all forms of locomotion on an agar surface (Stephens et al. 2008). The diversity of automated tracking implementations provides researchers with choice in the trade-off between resolution (i.e. for single animal studies) and efficiency (i.e. for genetic screens), and has been a boon to studying the motor circuit in C. elegans.

1.3.2 Ablation studies to understand motor circuit function

One approach to interrogate the workings of a neural circuit is to ablate specific, identified neurons in the nervous system, and assess the effects on neural output (i.e. locomotion), in analogy to “loss of function” mutations in genetics. This can be done using a laser microbeam targeted to cells of interest, identified either through morphology, lineage tracing, or fluorescent tagging (Sulston and White 1980; Bargmann and Avery 1995). More modern tools allow genetically targeted cell ablation by expressing pro-apoptotic factors (Shaham and Horvitz 1996) or reactive oxygen species- generators, such as miniSOG (Shu et al. 2011) and KillerRed (Bulina et al. 2006) to induce cell death. As previously mentioned, laser ablation was used to classify the components of the “core” motor circuit (Figure 1C and See section 1.2.3). Further ablation studies have characterized neurons falling outside the core motor circuit, but nonetheless having dramatic effects on locomotion. For example, laser ablation of the

SMB head motor neuron, which innervates head and neck muscles, was found to be increase the overall amplitude of the sinusoidal wave (Gray et al. 2005). Conversely,

ablation of the DVA interneuron was found to decrease wave amplitude (Li et al. 2006), suggesting that there is a positive regulator of bending angle functioning in that neuron.

Given that SMB is the major presynaptic neuron to DVA, this implicates head motor neurons and other “peripheral” neurons outside of the core motor circuit in regulation of such properties of locomotion as amplitude. In the first application of genetic ablation to study the motor circuit, Zheng et al. (Zheng et al. 1999) attempted to ablate all of the 5 pairs of premotor interneurons using a glutamate receptor promoter driving expression of a human caspase (ICE) in these neurons. The authors reported that the ablated animals retained the ability to produce sinusoidal movement in both directions, although this result was later challenged upon more thorough ablation of the premotor interneurons, which lead to a kinker phenotype and inability to produce directional locomotion

(Kawano et al. 2011). Finally, more modern tools allow for the ablation of genetically targeted cells to be temporally controlled by photo-activating a ROS-generating protein

(Bulina et al. 2006). This technique not only allows for more precision in killing cells of interest, but also avoids potential developmental effects of lacking the targeted cell during development. An engineered protein from Arabidopsis thaliana, called miniSOG, has been recently characterized as another tool for light-induced cell death (Shu et al.

2011)

1.3.3 Optogenetic approaches to understand the motor circuit

Over the last decade, optogenetic techniques have pushed forward the field of behavioural neuroscience by allowing unprecedented access to monitor and manipulate neural circuits underlying animal behaviour. Genetically encoded calcium sensors, such

as cameleon (Miyawaki et al. 1997), and GCaMP (Tian et al. 2009) allow the non- invasive, real-time readout of neural activity using changes in fluorescent signals that correlate with changes in the concentration of calcium ions, an important second messenger in neurons. Certain families of bacterial rhodopsins, namely channelrhodopsin

(Nagel et al. 2002) and halorhodopsin (Schobert and Lanyi 1982), are capable of depolarizing and hyperpolarizing neurons in response to blue and yellow light, respectively (Zhang et al. 2007). Combinations of these tools have been put to use in many studies involving different genetic model organisms, and in one recent example their use has revealed new levels of neural coding of thermosensory information in C. elegans (Kuhara et al. 2011). These techniques are especially suitable for use in C. elegans, which is transparent and has a compact nervous system, allowing the real-time monitoring and manipulation of multiple neurons and user-selected regions of the body in freely moving animals (Leifer et al. 2011; Stirman et al. 2011). These technological developments provide a platform for interrogating the motor circuitry and its production of locomotor output.

1.3.4 An altered waveform and bending frequency phenotype resulting from defects in the DGC complex and muscle acetylcholine transport

dys-1 is the C. elegans homologue of dystrophin, a large gene mutated in progressive neuromuscular diseases such as Duchenne Muscular Dystrophy. In assessing the effect of loss of dys-1, Bessou et al. (Bessou et al. 1998) found no obvious structural disorganization of muscle, but reported the “overbent” (increased bending of the head

and anterior regions of the animal) and hyperactive (increased frequency of body bending) phenotype. The authors also found that dys-1 mutants display hypersensitivity to the acetylcholinesterase inhibitor aldicarb, indicating that the mutants had increased acetylcholine signaling at the NMJ. Indeed, it was later found that mutations in another gene, snf-6, also mimicked the dys-1(lf) phenotype (Kim et al. 2004). snf-6 encodes an acetylcholine transporter localized to the post-synaptic side of the NMJ, where it is thought to promote acetylcholine clearance under conditions where acetylcholine signaling is increased. This finding implies that the shared phenotype between dys-1, snf-

6, and other Dystrophin Glycoprotein Complex (DGC) mutants – hyperactive locomotion and exaggerated anterior bending - results from increased cholinergic signaling. The link between increased cholinergic signaling and the regulation of wave amplitude remains unexplained.

1.4 Innexin gap junctions and stomatins regulate the C. elegans motor circuit

1.4.1 Innexins and stomatins are implicated in regulation of C. elegans motor circuit dynamics

An ongoing study in the Zhen lab is the application of optogenetic technologies to the study of C. elegans behaviour and physiology. Kawano et al. (2011) reported the development of a microscope setup capable of simultaneous calcium imaging, tracking of freely behaving animals, and locomotion parameter extraction. The authors further reported the application of this technology to examine A and B class motor neuron

activity in wild type animals, and observed a consistent relationship between them, where

B motor neuron activity was higher than A during forward movement, and vice versa.

The authors also examined motor and interneuron activities in locomotion mutants called

“kinkers” – characterized by overly bent and irregular postures (Figure 2), as well as an inability to sustain forward movement, and a resultant bias toward backward movement.

These animals displayed overlapping B and A motor neuron activities during kinking behaviour, and the normal A > B trend during backward movement, implying a shift in the balance between the B “forward” and A “backward” activities underlying directional locomotion.

The kinker phenotype arises from mutations in at least 4 genes, including two innexin genes unc-7 and unc-9, and two stomatin genes unc-1 and unc-24 (Sedensky et al. 2001). Innexins are invertebrate homologues of vertebrate pannexins (Panchin 2005), which, along with their structural homologues called connexins, form gap junctions

(Evans and Martin 2002).

Gap junctions form pores between apposing cell membranes that can be uni- or bi-directional, and are usually non-selective for solutes and metabolites smaller than a certain size (<1 kDa) (Schwarzmann et al. 1981). In Kawano et al, 2011, we found that the unc-7 innexin is required in the AVA backward command interneuron, while the unc-

9 innexin is required in the A class motor neurons, and postulated that these innexins form a gap junction between these two classes of neurons that is responsible for shunting depolarizing currents from the AVA to the A class motor neurons. Loss of this gap junction leads to increased mean AVA activity, as assessed by calcium imaging and in

situ whole-cell recording, that results in unregulated motor neuron activity during kinking.

1.4.2 Stomatins are conserved, lipid raft-associated, channel- modulating oligomeric proteins

Stomatins are membrane-tethered proteins bound to the inner leaflet of lipid bilayers (Umlauf et al. 2004), where they oligomerize on lipid rafts and regulate channel activities (Snyers et al. 1998). Stomatin protein architecture typically consists of an N- terminal region containing a hydrophobic segment along with palmitoylated cysteine residues, a cholesterol recognition motif, a prohibitin homology (PHB) domain, and an oligomerization motif towards the C terminus. Some stomatin family members also contain a lipid-transfer motif. The hydrophobic region and palmitoylation sites are thought to mediate membrane insertion (Snyers et al. 1999), while the cholesterol recognition motif recruits stomatins to steroid-rich lipid rafts (Epand et al. 2006). The

PHB domain, the major structural feature of stomatins, is mainly alpha-helical

(Yokoyama et al. 2008), and is responsible for the modulation of ion channel properties

(Goodman et al. 2002). The PHB domain arose early in evolution, and its bacterial homologues share significant identity and similarity with homologues in animals, suggesting a conserved and important role in membrane organization or channel modulation. Finally, the oligomerization motif is thought to allow clustering of stomatin

(20-50 monomers) (Huber et al. 2006) and target channels on cholesterol-rich lipid rafts, where they might influence channel activity. Additional roles in scaffolding and assembly

of membrane microdomains interacting with cytoskeletal components have also been proposed (Salzer et al. 2007).

1.4.3 Stomatin function is conserved between invertebrates and vertebrates

Of 13 stomatin-like genes in C. elegans, mec-2 is the best characterized, and has been found to directly modulate the activity of a mechanosensitive degenerin channel found in mechanosensory neurons (Huang et al. 1995; Goodman et al. 2002). Similarly, the mammalian mec-2 homologue, SLP3, was found to be essential for 36% of mechanosensory neurons to respond to mechanical stimulation in the mouse (Wetzel et al. 2007). It had previously been shown that the invertebrate Acid Sensing Ion Channel

(ASIC) homologues, the degenerins, function as primary mechanosensors in C. elegans

(Hong and Driscoll 1994) and Drosophila (Zhong et al. 2010). Wetzel et al. found that

SLP3 physically interacts with several ASICs, lending support to the idea that stomatins and ASICs form complexes (Price et al. 2000; Price et al. 2001). However, the role of

ASICs as primary mechanosensors in mammalian systems has recently come into question. In examining functional redundancy between the 4 ASICs encoded in the mouse and human genome, Kang et al. found that a triple knockout mouse of ASIC1a,

ASIC2, and ASIC3 (ASIC4 has no known function) exhibits increased mechanosensitivity (Kang et al. 2012), suggesting that ASICs and associated stomatin- related proteins play accessory rather than principal roles in the mechanosensory machinery. Thus, stomatin-related proteins are likely to interact with ASICs in a

conserved manner, functioning as primary mechanosensors in C. elegans, but contributing only indirectly to mammalian mechanosensation.

Another C. elegans stomatin, unc-1, was first shown to function in muscle where it is required for low-conductance coupling between adjacent body wall muscles (Chen et al. 2007). Given that loss of UNC-9 showed the same phenotype, the authors used a fluorescence complementation technique (Hu et al. 2002), where they tagged UNC-9 and

UNC-1 with complementary split YFP fragments, respectively, to examine whether or not the two proteins could physically interact. Animals co-expressing both constructs exhibited reconstituted YFP fluorescence, leading to the conclusion that UNC-9 and

UNC-1 could physically interact. However, the YFP fragments appeared to have the ability to reconstitute in the absence of either UNC-9, or UNC-1 (Michelle Po and Mei

Zhen, unpublished), casting doubt on the specificity of this experiment. Regardless, the authors proposed that UNC-1 is a positive regulator of UNC-9 gap junction conductance in C. elegans body wall muscle, but they noted that this role does not account for the kinker phenotype, since it is persistent in the muscle-rescued transgenic animals.

Another phenotype in which stomatins have been implicated is sensitivity to volatile anaesthetics (Rajaram et al. 1999). The functional loss of unc-1 and unc-24, which both encode stomatins, leads to an identical kinker phenotype (see following section), and both alter sensitivity to anaesthetics, whose cellular targets remain elusive

(Sedensky et al. 2004). Additionally, how the loss of unc-1 and unc-24 stomatin proteins leads to the kinker phenotype is currently unresolved, but the similar phenotype to innexin mutants suggests a link with gap junctions. Whether stomatin-mediated

regulation of gap junctions is a conserved phenomenon that occurs in other organisms remains open to investigation.

1.4.4 A forward genetic screen for suppressors of the unc-7 kinker phenotype identifies stomatins as potential regulators of gap junctions

In order to better understand regulatory mechanisms involving UNC-7 innexin,

Michelle Po, a former Ph.D. student in the Zhen lab, performed a standard non-clonal

EMS forward genetic screen for suppressors of the UNC-7 kinker phenotype (Po 2011).

Specifically, she identified a number of second site mutations that would allow unc-7(lf) kinkers to sustain forward locomotion (Figure 2). The best suppressor, hp395, which restored near wild-type locomotion to unc-7 kinker animals, was mapped to and identified as a SNP in the previously uncharacterized stomatin gene sto-6. STO-6 is 63% identical to UNC-1 and 61% identical to human Stomatin, suggesting a high degree of functional conservation (Figure 3). Preliminary characterization of sto-6 revealed that the putative null allele, sto-6(tm1610), which causes a frameshift and deletes the PHB domain, does not display an overt movement phenotype.

1.5 Outline and Rationale

In the remainder of this thesis, I will present my studies on the gene sto-6, focusing on its role in regulating the C. elegans motor circuit.

First, I will describe the characteristics of the sto-6 gain- and loss-of-function mutant phenotypes. The sto-6(hp395) single mutant, isolated in the unc-7(lf) suppressor screen, displays two features that make it of interest in the pursuit of a detailed understanding of C. elegans behaviour. First, it displays increased bending of the anterior region of the animal, implying a loss of regulation in the mechanism that regulates wave amplitude. Secondly, it displays increased decay of the waveform as it progresses along the main body axis, implying a defect in the mechanism underlying wave propagation along the length of the body (See section 2.2.1). The neural and molecular mechanisms underlying both of these features are completely unknown, largely due to a lack of tools to study and understand them. Thus, the study of sto-6 affords the opportunity to understand these mysterious mechanisms of motor circuit coordination.

Another interesting phenotype arising from mutation of sto-6 is the restoration of sustained forward movement to unc-7(lf) kinker animals. Previous work in the Zhen lab pinpointed the neural activity correlates of the kinker phenotype, and suggested an imbalance between forward and backward components of the motor circuit (Kawano et al. 2011). Additionally, sto-6 displays genetic interactions with another innexin and stomatin gene (Po 2011) (See section 2.1.2), raising the possibility that stomatins are conserved regulators of gap junctions and/or hemichannels.

In an attempt to understand these facets of the sto-6 mutant phenotype, I will describe the analysis of the expression and localization pattern of the gene sto-6 within the motor circuit, which validates its role and further study within the motor circuit. Then

I will describe a set of experiments, in which I narrowed down the site of action of STO-6 within the motor circuit, in order to know which neurons are affected to produce unique

changes in locomotor output. Finally, I will propose a model of STO-6 function within the C. elegans motor circuit that highlights potential mechanisms regulating wave amplitude and propagation, as well as restoration of forward movement to unc-7(lf) kinkers.

2 Chapter 2: STO-6 regulates motor behaviour in C. elegans

2.1 Specific Background

2.1.1 hp395 is a semi-dominant gain of function mutation of sto-6

As described in the Introduction, the hp395 allele was isolated from a forward genetic screen for suppressors of the unc-7(lf) behavioural phenotype. It was subsequently mapped to the gene sto-6 on the X-chromosome, rescued with a fosmid containing sto-6, and sequencing revealed a missense mutation (A212V) in a conserved region of the Prohibitin Homology (PHB) domain (Figure 3, (Po 2011)). Several lines of evidence suggest that this mutation is a gain of function allele of sto-6. First, sto-

6(hp395) heterozygous animals display a weaker version of the homozygous phenotype

(Po 2011), suggesting either gain-of-function or haploinsufficiency. Haploinsufficiency is ruled out because neither the heterozygous loss of function nor a deficiency covering the sto-6 gene, displays a locomotion phenotype (Po 2011). Second, the hp395 mutation alters the residue corresponding to that changed in an unc-1 dominant allele e1598, which was shown to be a gain of function mutation (Park and Horvitz 1986). Since UNC-1 and

STO-6 share 63% identity at the amino acid level, and the mutated regions are highly conserved even in mammalian homologues, this suggests that the mutations are affecting the proteins in a similar manner. Third, a complete loss of function of the sto-6 gene does not display a detectable locomotion phenotype (See section 2.2.1), suggesting that the

sto-6(hp395) phenotype observed arises from a gain of function effect. I will hereafter refer to sto-6(hp395) as sto-6(gf).

2.1.2 sto-6(gf) lies in a genetic pathway with other innexins and stomatins

Previous genetic studies in our lab had demonstrated that loss of function of the innexin unc-9 is epistatic to unc-1(gf), and that unc-1(gf) suppresses unc-7(lf) in an UNC-

9 dependent manner (Po 2011). To determine if sto-6(gf) functions analogously to unc-

1(gf) in mediating suppression of unc-7(lf), Michelle Po examined the phenotype of sto-

6(gf) unc-9(lf) and sto-6(gf) unc-7(lf) unc-9(lf) animals. Both strains exhibited a kinker phenotype, indicating that sto-6(gf) does not suppress the kinker phenotype in general, and requires UNC-9 to suppress unc-7(lf) (Po 2011). Furthermore, it was found that unc-

1(lf) is also epistatic to sto-6(gf) in both its single mutant phenotype, as well as the suppression of unc-7(lf). Taken together, these genetic analyses suggest that STO-6(gf) acts through UNC-1 and UNC-9, both of which function predominantly in motor neurons

(Po 2011), in order produce its single mutant phenotype, as well as to suppress the unc-

7(lf) kinker phenotype.

2.1.3 sto-6(gf) does not restore the AVA-A motor neuron gap junction to suppress unc-7(lf)

Given that the unc-7(lf) kinker phenotype arises from a loss of the AVA-A motor neuron gap junction (Kawano et al. 2011), two potential mechanisms of sto-6(gf)- mediated suppression are possible. First, STO-6(gf) may restore functional gap junction

connectivity between AVA and A motor neurons by influencing the activities of other innexin proteins. Indeed, the C. elegans genome contains 22 innexin genes, of which inx-

7, unc-7, and unc-9 are expressed in AVA, and inx-3 and unc-9 in motor neurons (Altun et al. 2009). It is possible that STO-6(gf) allows the formation of gap junctions using new combinations of innexins, likely involving UNC-9 in the motor neurons and other innexins in the AVA neuron. However, this possibility was tested and ruled out by assessing the gap junction connectivity between AVA and A motor neurons. AVA interneuron activity is increased in unc-7(lf) animals, as assessed by calcium imaging

(Kawano et al. 2011). This increase is thought to result from a loss of shunting of depolarizing currents from the AVA to the A class motor neurons through gap junctions.

The AVA activity in sto-6(gf) unc-7(lf) double mutants remains significantly higher than wild type animals, suggesting a lack of functional gap junctions between the AVA and A motor neurons (Po 2011).

Another possibility is that STO-6(gf) bypasses the requirement of the AVA-A motor neuron gap junction for sustained forward movement. This may involve STO-6(gf) coordinating spontaneous motor neuron activity between A and B class motor neurons, which have become dysregulated and overlapping in kinker animals (Kawano et al.

2011). Mechanistically, this could result from STO-6(gf) acting through UNC-9 hemichannels to modulate motor neuron activity, or could result from novel gap junction connections in the motor circuit. This hypothesis has yet to be directly tested.

2.2 Results

2.2.1 sto-6(gf), but not sto-6(lf), displays an overt locomotion phenotype

To examine the locomotion phenotypes of sto-6 mutants in more detail, I applied software developed in-house in R and Matlab to extract quantitative curvature information from videos of moving animals (Kawano et al. 2011) (see Methods). Briefly, the video is contrast-enhanced and converted to a binary image with the animal’s body boundary sharply defined. This silhouette is then skeletonized and curvature is defined at

37 points along the skeleton and tabulated for each frame of the clip. These data can be visualized using a heat map to reveal properties of animal locomotion (Figure 4A). sto-

6(lf) mutants do not display overt differences in locomotion when assessed qualitatively by eye (Po 2011). Curvature analysis revealed a significant increase in wave initiation between sto-6(lf) and wild type controls (18.3 ± 0.6 versus 15.4 ± 0.9, p = 0.024, n = 10 animals, 30 seconds of forward locomotion, Figure 4E), and a trend towards increased forward velocity and deeper curvature is apparent (Figure 4A, D). This subtle phenotype would not be conducive to performing rescue experiments where different phenotypes are scored first by eye.

Next, I examined sto-6(gf) mutants by curvature analysis, and observed two key features that allowed me to develop a method to reliably quantify the difference between sto-6(gf) and wild type. As shown in Figure 4E, sto-6(gf) mutants initiate fewer waves per unit time than wild type controls (7.8 ± 0.3 versus 15.4 ± 0.9, p = 0.003, Figure 4E).

Additionally, those waves have deeper curvature in the anterior part of the animal versus

the posterior part. I quantified this longitudinal asymmetry in curvature using a Matlab script that takes the average curvature of an anterior segment over time and subtracts the average curvature of a posterior segment, and averages these curvature differences over

10 animals (see Methods). This method reliably distinguishes the sto-6(gf) phenotype from wild type (0.0228 ± 0.0040 versus 0.0101 ± 0.0024, p = 0.03, Figure 4B), whereas other methods examining the proportion of time spent moving forward, backward, or paused, do not (Figure 4C). These results indicate that both the sto-6(gf) and sto-6(lf) mutants display changes in specific properties of locomotion that can be quantified and distinguished from wild type controls. Specifically, both mutants affect the initiation of backward-travelling waves (which underlie forward propagation of the animal), while only the sto-6(gf) mutation affects the propagation of the wave along the longitudinal axis of the animal. I use this latter phenotype as the primary gauge for rescue in later experiments, described below.

2.2.2 sto-6 is expressed in motor neurons and localizes to puncta in the axonal compartment

To determine how STO-6 affects motor circuit function, it is necessary to see where it is expressed. A previous student in the lab made a C-terminal GFP-tagged STO-

6 construct (Psto-6-sto-6::GFP). They then created an integrated transgenic line expressing this construct, and this line fully rescues the locomotion defects of sto-6(gf) mutants (Po 2011). Using this transgenic array, Michelle Po observed that STO-6 is expressed in cholinergic motor neurons along the ventral nerve cord, and multiple unidentified neurons in the head region. Moreover, STO-6::GFP was found to show

punctate expression and was restricted to the axonal compartment of these neurons

(Figure 5A and (Po 2011)).

To find out whether sto-6 is expressed in other parts of the motor circuit, I examined transgenic lines co-expressing transcriptional reporters of Psto-6 and Pnmr-1, the latter of which drives reporter expression in the AVA, AVE, AVD, and PVC interneurons (Brockie et al. 2001). No overlapping expression was observed between

Psto-6-STO-6::GFP and the Pnmr-1 transcriptional reporters, indicating that the head neurons expressing Psto-6 are not the backward command interneurons (Figure 5B). A previous experiment had been conducted that also excluded the remaining pair of command interneurons, the AVBs, from the set of Psto-6-expressing head neurons (Po

2011). To confirm the expression of Psto-6 in the cholinergic motor neurons, I re- examined transgenic lines co-expressing Psto-6 and Pacr-2 reporters, the latter being expressed in the A and B class motor neurons in the ventral nerve cord. In addition to being expressed in the A and B motor neurons, Psto-6 is also found in the AS-class motor neurons, as assessed by neuron placement and commissure orientation (crossing on the right side of the body). Taken together, these results demonstrate that STO-6 is found in the axonal compartment of cholinergic motor neurons of the A, B, and AS classes, as well as a set of unidentified head neurons, but excluding the command interneurons.

Further attempts to determine the head neurons in which STO-6 is expressed were not pursued.

2.2.3 The sto-6(gf) phenotype arises from effects in the B-class motor neurons

With the finding that STO-6 is expressed in the cholinergic motor neurons, I devised two sets of experiments to use the sto-6(gf) phenotype to elucidate where STO-6 is acting to exert its effects on locomotion.

2.2.3.1 The sto-6(gf) phenotype is reverted by overexpression of wild- type copies of STO-6 in B motor neurons

In the first experiment, I overexpressed wild type STO-6 in sto-6(gf) animals under the control of various established promoters driving expression in subsets of neurons in the motor circuit (See methods for promoters used and references). As a positive control, overexpression of STO-6(wt) from its endogenous promoter rescued the wave initiation defects of sto-6(gf) (12.8 ± 0.2 versus 7.2 ± 0.2 for sto-6(gf), p < 0.0001, n

= 10 animals, Figure 6C) to wild type levels (12.8 ± 0.2 versus 13.7 ± 0.4 for wild type, p

> 0.05), as well as the anterior-posterior curvature difference (0.0147 ± 0.0018 versus

0.0292 ± 0.002 for sto-6(gf), p = 0.0004; 0.0147 ± 0.0018 versus 0.0086 ± 0.0013 for wild type, p = 0.0085, Figure 6B). The curvature difference is not completely rescued to wild-type levels, possibly because of the mosaic nature of extrachromosomal transgenic lines. I found that the Pacr-5 promoter, which expresses in B motor neurons and the PVC interneuron, also rescued the wave initiation defects (12.8 ± 0.3 versus 7.2 ± 0.2 for sto-

6(gf), p = 0.0001, Figure 6C) to wild type levels (12.8 ± 0.3 versus 13.7 ± 0.4 for wild type, p = 0.211), as well as the anterior-posterior curvature difference (0.0135 ± 0.001 versus 0.0292 ± 0.002 for sto-6(gf), p = 0.0001, Figure 6B). The Pnmr-1 promoter, which

drives gene expression in the backward command interneurons AVA, AVE, AVD and

PVC, but not in motor neurons, did not rescue the wave initiation defects of sto-6(gf) (6.8

± 0.3 versus 7.2 ± 0.2, p = 0.303, Figure 6C) or the curvature difference (0.0254 ± 0.0029 versus 0.0292 ± 0.0020, p = 0.418, Figure 6B). The Punc-4 promoter, which expresses in

A motor neurons, did not rescue either defect of sto-6(gf). These result indicates that outcompeting STO-6(gf) with STO-6(wt) in B motor neurons and PVC is sufficient to revert the sto-6(gf) phenotype. Since Psto-6 is not expressed in PVC, and the Pnmr-1 promoter that drives expression in PVC did not rescue the sto-6(gf) phenotype, this result implies that the effects of STO-6(gf) occur predominantly in the B motor neurons.

2.2.3.2 Recapitulation of the sto-6(gf) phenotype by exclusively expressing STO-6(gf) in B motor neurons and PVC interneurons

In the second experiment, I overexpressed STO-6(gf) under the control of established promoters in the sto-6(lf) background, to examine where STO-6(gf) expression is necessary in order to recapitulate the sto-6(gf) phenotype. As in the previous experiment, as a positive control, Psto-6-driven expression of STO-6(gf) was able to recapitulate both the wave initiation (7.0 ± 0.3 versus 16.0 ± 0.6 for sto-6(lf), p =

0.0002; 7.0 ± 0.3 versus 7.1 ± 0.2 for sto-6(gf), p = 0.818, Figure 7C) and propagation aspects (0.043 ± 0.003 versus 0.003 ± 0.001 for sto-6(lf), p = 0.0002; 0.043 ± 0.003 versus 0.030 ± 0.0042 for sto-6(gf), p = 0.02, Figure 7B) of the sto-6(gf) phenotype. In fact, overexpression of STO-6(gf) increased the anterior-posterior curvature difference above the differences exhibited by sto-6(gf) animals, indicating possible dependence of the phenotype on the level of dosage of STO-6(gf). As in the previous experiment, the

Pacr-5-STO-6(gf) (B motor neuron and PVC promoter) alone was able to recapitulate the

wave initiation defect (9.8 ± 0.3 versus 16 ± 0.6 for sto-6(lf), p=0.0002, Figure 7C) In this case, the recapitulation of the wave initiation defects was incomplete (9.8 ± 0.3 versus 7.1 ± 0.2 for sto-6(gf), p = 0.0002). Pacr-5-STO-6(gf) also recapitulated the wave propagation defects (0.030 ± 0.003 versus 0.003 ± 0.001 for sto-6(lf), p = 0.0006, Figure

7B) to sto-6(gf) levels (0.030 ± 0.003 versus 0.030 ± 0.004, p = 0.84). A note should be made that these ‘recapitulating’ transgenic lines expressed uniquely low levels of STO-

6(gf)::GFP, relative to other lines obtained from the same DNA injections, which did not recapitulate the phenotype. This also supports the idea of the sto-6(gf) phenotype being sensitive to STO-6(gf) dosage levels. Further investigation and application of more nuanced techniques (e.g. single copy insertion transgenes) will be important to assess the neuron-specific requirements for recapitulation. Because STO-6 expression has been previously excluded from the PVC interneurons (Po 2011), together, both of these experiments strongly indicate that the sto-6(gf) phenotype arises mainly from STO-6(gf)- mediated effects in B-type motor neurons.

2.2.4 sto-6(gf) suppresses unc-7(lf) mutants in a developmental stage-specific manner

During the examination of sto-6(gf) unc-7(lf) mutants, I noticed that the ability of sto-6(gf) to restore the ability of unc-7(lf) kinker animals to move forward in a sustained manner is developmental stage-dependent. Larval animals in the double mutant strain sto-

6(gf) unc-7(lf) remained strong kinkers, whereas adults displayed robust rescuing effects.

I quantified this effect by comparing the proportion of time moving in each direction, the instantaneous velocities, and the distance travelled in each run, for the same L4 and

young adult (YA) animals, 1 day apart (Figure 8). Specifically, sto-6(gf) unc-7(lf) L4 animals display reduced distance travelled for each forward run compared to sto-6(gf)

L4s (6.78 ± 0.44 versus 74.9 ± 11.1 for sto-6(gf), p < 0.0001, Figure 8B), approaching the level of unc-7(lf) L4s (6.78 ± 0.44 versus 3.95 ± 0.21, p < 0.0001). sto-6(gf) unc-7(lf) adults, on the other hand, travel the same distance for each forward run as sto-6(gf) adults

(75.4 ± 14.3 versus 73.0 ± 15.2, p = 0.118, Figure 8B), which is significantly higher than unc-7(lf) adults (75.4 ± 14.3 versus 5.43 ± 0.34, p < 0.0001). These results indicate an all- or-none stage-dependence of the ability of STO-6(gf) to restore forward locomotion to unc-7(lf) animals. What mediates this effect is unknown, as Psto-6 is expressed throughout larval stages and adulthood (Hillier et al. 2009). It is possible that the stage- dependence of STO-6(gf) action arises from developmental regulation of a gene/protein required for STO-6(gf) function rather than STO-6 itself.

2.2.5 sto-6 is likely required in multiple neurons, including those outside the core motor circuit, to suppress unc-7(lf)

Finding that STO-6(gf) likely functions in B motor neurons to elicit the unique phenotypic profile of sto-6(gf) mutants, I proceeded to perform similar experiments in the double mutant background, to determine whether STO-6(gf) is acting in the same cells to suppress unc-7(lf), or if it is required in a different set of neurons.

2.2.5.1 The sto-6(gf) unc-7(lf) suppressed kinker phenotype requires multiple neuronal groups, including those outside of the core motor circuit

Given that overexpression of STO-6(wt) in the sto-6(gf) single mutant is able to revert the phenotype to wild type, I reasoned that reversion to the unc-7(lf) kinker phenotype should be possible in the sto-6(gf) unc-7(lf) background. The positive control, the Psto-6 endogenous promoter driving STO-6(wt) transgene was only able to partially revert the sto-6(gf) unc-7(lf) to a more kinker-like phenotype using the proportion of time spent moving forward, backward, and paused, the forward distance travelled, and instantaneous velocity criteria (Figure 9). Specifically, the sto-6(gf) unc-7(lf) + Psto-6-

STO-6(wt) animals displayed reduced forward distance travelled compared to non- transgenic sto-6(gf) unc-7(lf) controls (8.27 ± 0.65 versus 158.4 ± 30.2, p < 0.0001,

Figure 9B). Although the reduction of distance travelled is approaches unc-7(lf) levels

(8.27 ± 0.65 versus 4.86 ± 0.31, p < 0.0001), there remains a significant difference, indicating that reversion is incomplete, even in the positive control.

No reduction in average forward distance travelled, compared to sto-6(gf) unc-

7(lf), was observed from overexpression of STO-6(wt) from the A and B class cholinergic motor neurons (driven by Pacr-2; 166.7 ± 39.5, p = 0.242), B motor neurons and PVC (driven by Pacr-5; 476.7 ± 90.7, p = 0.0002), or B motor neurons and all backward interneurons (driven by Pacr-5 + Pnmr-1; 266.4 ± 57.0, p = 0.317). In fact, overexpression of STO-6(wt) from the Pacr-5 promoter significantly increased average forward distance travelled. I found that an overexpression of STO-6(gf) in the A, B, and

AS cholinergic motor neurons (driven by Punc-3), was able to significantly reduce

forward distance travelled of sto-6(gf )unc-7(lf) animals (30.86 ± 4.40 versus 158.4 ±

30.2, p < 0.0001), approaching unc-7(lf) levels but remaining significantly different

(30.86 ± 4.40 versus 4.86 ± 0.31, p < 0.0001). This reversion is also weaker than Psto-6- mediated reversion 30.86 ± 4.40 versus 8.27 ± 0.65, p < 0.0001). These results indicate that the suppression effects of sto-6(gf) on unc-7(lf) arise partially from effects in AS cholinergic motor neurons, and may require multiple neuron classes including the A, B, and AS class motor neurons, as well as other unidentified neurons in which STO-6 is normally expressed. The incomplete reversion by the endogenous promoter suggests that dosage levels of STO-6 may be a critical factor in the ability to rescue. This was tested by crossing the transgenic line used as the positive control in the sto-6(gf) single mutant rescue experiment into the sto-6(gf) unc-7(lf) double mutant background, which still resulted in only partial reversion.

2.2.5.2 The sto-6(gf)-mediated restoration of forward movement to unc-7(lf) kinkers could not be recapitulated by expressing STO-6(gf) in the motor circuit.

In an experiment analogous to the sto-6(gf) single mutant phenotype recapitulation, I attempted to recapitulate the ability of STO-6(gf) to restore forward locomotion to unc-7(lf) animals by exogenously overexpressing STO-6(gf) in a sto-6(lf) unc-7(lf) background. sto-6(lf) unc-7(lf) animals display a kinker phenotype identical to unc-7(lf) single mutants (Po 2011). As the positive control, overexpression of Psto-6-

STO-6(gf) in sto-6(lf) unc-7(lf) led to a complete recapitulation of the sto-6(gf) unc-7(lf) double mutant phenotype as assessed by the proportion of time moving forward,

backward, and paused, instantaneous velocity, and total average curvature over time

(Figure 10). I quantified this effect by taking the average absolute value of curvature along the entire body over time, which is significantly increased in sto-6(lf) unc-7(lf) animals, compared to sto-6(gf) unc-7(lf) animals (0.085 ± 0.003 versus 0.057 ± 0.002, p =

0.0002, Figure 10C). The positive control reduced this increase in total curvature observed in sto-6(lf) unc-7(lf) kinker animals (0.060 ± 0.001 versus 0.085 ± 0.003, p =

0.0001) to sto-6(gf) unc-7(lf) levels (0.060 ± 0.001 versus 0.057 ± 0.002, p = 0.238).

The Pacr-5 promoter driving overexpression of STO-6(gf) in B motor neurons and PVC was unable to recapitulate any aspects of the phenotype (total average curvature, 0.093 ± 0.003 versus 0.057 ± 0.002 for sto-6(gf) unc-7(lf), p = 0.0003). I was unable to obtain any stable transgenic lines expressing in the A, B, and AS neurons

(driven by Punc-3), despite numerous attempts. However, since I did not observe any recapitulation of the phenotype in any of >180 transgenic F1 animals, the overexpression of STO-6(gf) in A, AS and B motor neurons is unlikely to be sufficient to recapitulate the effect. Taken together, these results suggest that other unidentified neurons not tested in this experiment also participate in sto-6(gf)-mediated suppression of unc-7(lf).

3 Chapter 3: Discussion and Future Directions

3.1 The unique phenotypic profile of sto-6 mutants can shed light on novel mechanisms of regulation of the motor circuit

In this thesis, I have presented the characterization of a novel gene, sto-6, as a regulator of the C. elegans motor circuit. Out of 13 stomatin-like genes encoded in the C. elegans genome, only 3 (unc-1, unc-24, and mec-2) have been characterized in any detail

(Goodman et al. 2002; Sedensky et al. 2004), making sto-6 one of the few characterized stomatins in genetic studies. Since there is a high degree of protein sequence identity between sto-6 and human Stomatin (61%), learning about the biological function of sto-6 could shed light on the function of mammalian homologues: namely Stomatin, which is involved in mediating ascorbic acid transport through the Glut1 transporter (Montel-

Hagen et al. 2008), and SLP3, which is an accessory protein with effects on mechanosensation (Wetzel et al. 2007). Furthermore, given the unique effects of the sto-

6(gf) mutation on locomotion in C. elegans, sto-6 mutants could be informative in understanding mechanisms of coordination in the motor circuit, which serves as a proxy for neural circuits in general.

3.1.1 Mutations in sto-6 alter the frequency of body bending through an unknown mechanism

In quantitatively studying the loss-of-function of sto-6, I found that these animals display an increased frequency of body bending, while other parameters of locomotion resemble wild type (Figure 4). This phenotype is not unique, considering that many other

genetic and environmental perturbations can cause a similar increase in bending frequency. For example, loss of function in the Gαo subunit goa-1 leads to increased bending frequency, to a higher degree than sto-6(lf), which is thought to result from blocked serotonergic signaling (Segalat et al. 1995). Another example is the trp-4 channel, loss of which also results in increased frequency of body bending (Li et al.

2006). This is a result of a defective “basal slowing response” which slows down locomotion upon detection of the mechanical properties of bacteria in the environment, mediated by TRP-4 function in sensory dopaminergic neurons (Sawin et al. 2000; Li et al. 2006). These examples illustrate the many pathways that converge on properties of C. elegans locomotion like frequency of body bending. In fact, this property can be modulated by the environment alone, irrespective of genotype. Studies using microfabricated agar environments (e.g. an ordered array of posts) have shown increases in locomotion speed and frequency of bending of up to 10-fold and 3-fold, respectively(Park et al. 2008). Taken together, it is possible that the increased frequency of bending in sto-6(lf) mutants arises from mechanisms affected in these examples of bending frequency modulation. Based on findings from calcium imaging studies, it is likely that all of these examples lead to a common downstream effect of increased B motor neuron activity versus A motor neuron activity (Figure 11). Additionally, it is possible that a more prominent sto-6(lf) phenotype is masked by redundancy with another stomatin(s), most likely sto-4, which shares 70% amino acid identity with sto-6 and is adjacent to sto-6 in the genome. Three approaches (RNAi knockdown, transposon- mediated deletion (mosDEL), and building a genetic double mutant) to assess the double loss of function of these two genes were attempted but did not succeed.

3.1.2 The increased anterior wave amplitude and decay seen in sto- 6(gf) may result from altered cholinergic signaling in B motor neurons

The sto-6(gf) mutant displays a unique combination of locomotor features. In contrast to the sto-6(lf) phenotype, sto-6(gf) animals show a reduction in frequency of body bending (Figure 4). The more striking feature of the sto-6(gf) phenotype is the increased wave amplitude in the anterior part of the animal, as well as the increased wave decay and lack of bending in the posterior part. I quantified this effect by taking the difference in average absolute curvature over time between anterior segments 6-10 and posterior segments 26-30 (Figure 4). Some degree of wave decay could also be observed in the wild type and sto-6(lf) strains, but the decay is much stronger in the sto-6(gf) mutant. Wave decay has been previously noted in wild type and mutant backgrounds

(Karbowski et al. 2008), but not to the extent seen in sto-6(gf). Interestingly, Karbowski et al. note that the decay in body bending occurs in an anterior-posterior gradient regardless of direction of wave propagation (i.e. it holds during backing, when the wave travels anteriorly toward the head), and suggest that this supports the idea of a CPG located in the head, although they do not provide any concrete ideas for the mechanism of wave decay in the anterior-posterior direction.

Mutations in the muscular dystrophin-glycoprotein complex (DGC) components, including dys-1, dyc-1, dyb-1, and snf-6, all lead to an identical phenotype characterized by increased frequency of body bending as well as increased amplitude of bending in the anterior parts of the animal, without obviously affecting the structural integrity of muscle

(Bessou et al. 1998; Gieseler et al. 1999; Kim et al. 2004; Lecroisey et al. 2008).

Additionally, these mutants display hypersensitivity to an acetylcholinesterase inhibitor,

which, combined with the finding that snf-6 encodes a muscle-expressed acetylcholine transporter, led to the idea that these phenotypes arise from increased cholinergic signaling at neuromuscular junctions. Kinematic analysis of a dys-1(lf); hlh-1(ts) double mutant between the C. elegans dystrophin homologue and the MyoD homologue showed that the body curvature at the head increases by ~70% compared to wild-type, whereas the rate of decay along the body is increased by ~40% (Sznitman et al. 2010). These values more closely resemble those of sto-6, although in this genetically sensitized background, age-dependent muscle degradation was observed and likely correlates with the phenotype. Nevertheless, the similarity in the anterior bending phenotype raises the possibility that the sto-6(gf) anterior bending phenotype arises from effects on cholinergic signaling, although the effect on frequency of body bending is opposite between sto-6(gf)

(decreased) and the DGC mutants (increased). A simple way to test this idea is to perform the aldicarb assay on sto-6(gf) and sto-6(lf) mutants to determine whether levels of cholinergic signaling are altered. Wave amplitude is also modulated by trp-4, a homologue of the mechanosensitive TRPN channel, which functions as a negative regulator of wave amplitude in the DVA neuron (Li et al. 2006). Interestingly, the DVA neuron has many reciprocal synapses with the B class cholinergic motor neurons, to which I pinpointed the site of action of sto-6(gf). This raises the possibility that sto-6(gf) displays a wave amplitude phenotype because STO-6(gf) influences the flow of mechanosensory information between the B class motor neurons and DVA, possibly by altering chemical synaptic communication between the two neuron classes.

I performed experiments to rescue and recapitulate the sto-6(gf) phenotype from specific cell types within the motor circuit (Figure 6 and 7), which revealed that a

promoter driving sto-6 expression in the B motor neurons and the PVC premotor interneuron is sufficient to rescue and recapitulate the phenotype. Given that sto-6 is not expressed in PVC, and that other promoters expressing in the PVC did not rescue or recapitulate any aspects of the sto-6(gf) phenotype, it is likely that the site of action of sto-6 with respect to its single mutant phenotype is the B motor neurons. This class of cholinergic motor neurons has classically been thought to drive forward movement, and recent calcium imaging studies support this hypothesis, although the neural encoding of movement seems to be distributed among the “forward” and “backward” motor neuron pools (Kawano et al. 2011). Most computational models of C. elegans movement have exclusively focused on forward movement, and the B motor neurons and their gap junctions to the premotor interneuron AVB figure prominently in these models (Bryden and Cohen 2008; Karbowski et al. 2008). These models also include proprioceptive feedback onto the motor neurons, as first hypothesized by Byerly and Russel

(unpublished communication reported in (White et al. 1986)), who suggested that the long, synapse-free processes of the cholinergic motor neurons harbor stretch-sensitive channels that signal bending of adjacent segments back to the motor neuron soma. Recent unpublished experimental data using a microfluidic device to artificially induce and control curvature of individual animals supports this presence of some form of proprioceptive feedback (Wen et al. 2012). When the midbody of an animal was curved either ventrally or dorsally, the posterior regions of the animal adopted the same curvature as the clamped region. This curvature extension was found to be dependent on the activity of A and B class cholinergic motor neurons, suggesting they form part of the proprioceptive feedback loop. The degenerin channel-encoding genes unc-8 and del-1

have been postulated to function as stretch sensors in motor neurons (Tavernarakis et al.

1997), although their central role is put into question due to their mild loss-of-function effects on locomotion. Nevertheless, their potential role raises the possibility that sto-6, like mec-2 and human SLP3, regulates mechanosensory degenerin/ASIC channels.

As previously mentioned, the mild effect of sto-6(lf) may result from functional redundancy with another stomatin. Indeed, recreating the sto-6(hp395) polymorphism in

STO-4 in transgenic strains mimics the sto-6(gf) single mutant phenotype as well as the suppression of unc-7(lf), suggesting that STO-6 and STO-4 play similar roles in the motor circuit (Michelle Po, personal communication). Thus, the sto-6(gf) phenotype may arise from neomorphic effects of STO-6(gf) that partially interfere with proprioceptive feedback mediated by degenerin channels in the B class cholinergic motor neurons.

3.2 The stage-specificity of sto-6(gf)-mediated unc-7(lf) suppression likely arises from developmental regulation of stomatin and innexins

The sto-6(gf) mutation was isolated from a screen for suppressors of the unc-7(lf) kinker phenotype. Analysis of the double mutant revealed that rescue is specific to the adult stage (Figure 8). L4 stage sto-6(gf) unc-7(lf) animals are indistinguishable from unc-7(lf) L4s, while 1 day old adult sto-6(gf) unc-7(lf) animals are fully rescued for the ability to sustain forward movement (Figure 8). This result indicates that a developmental switch occurs in the motor circuit of this mutant during this narrow time window, which can greatly influence the ability of the motor circuit to produce near wild type directional locomotion. unc-7(lf) L4 and young adult animals are not distinguishable in terms of

directional locomotion (Figure 8A), so the switch likely lies in the mechanism of action of STO-6. The sto-6(gf) single mutant phenotype is qualitatively the same throughout development, implying that the stage-dependence is specific to the suppression of unc-

7(lf). sto-6 is expressed in all developmental stages and in adulthood (Hillier et al. 2009).

Given that sto-6(gf) requires UNC-9 and UNC-1 to suppress unc-7(lf), it is possible that these components are only present in the right stoichiometry for suppression of unc-7(lf) in the adult stage.

Kawano and Po et al. demonstrated that kinker behaviour is correlated with overlapping activity levels of A and B class motor neurons (Kawano et al. 2011).

Calcium imaging of the sto-6(gf) unc-7(lf) rescued adults would be expected to restore the B > A activity pattern associated with forward movement, and preliminary analyses suggest this is indeed the case (See model in Figure 12; Michelle Po, personal communication).

3.3 The AS class cholinergic motor neurons contribute to sto- 6(gf)-mediated rescue of unc-7(lf) kinkers

I performed analogous experiments to those described above to rescue and recapitulate the sto-6(gf) suppression of unc-7(lf) kinker animals (Figures 9 and 10).

Interestingly, this analysis did not point to the B motor neurons, as found in the single mutant analysis. This suggests that sto-6(gf) is acting in a different way to produce its

unique phenotypic profile versus its restoration of sustained forward movement to unc-

7(lf) animals. The rescue of sto-6(gf) unc-7(lf) was only partially obtained by overexpressing STO-6(wt) from its endogenous promoter, as well as a promoter driving expression in the A, B, and AS class cholinergic motor neurons (Figure 9). Lack of complete rescue may reflect the mosaic nature of these stable transgenic lines, or dosage effects, since extrachromosomal arrays contain many tandem copies of the injected plasmid (Mello et al. 1991). Given that the A, B, and AS promoter rescues more weakly than the endogenous promoter, this suggests that there are neurons expressing the endogenous promoter that I did not capture in the cell-type specific analysis. Expression analysis described here and previously (Po 2011), did not attempt to identify Psto-6- expressing neurons outside of the core motor circuit. Nevertheless, partial rescue by the

A, B, and AS promoter, and complete lack of rescue from the A and B promoter, suggests a role of AS neurons in the sto-6(gf)-mediated suppression of unc-7(lf). AS neurons form

NMJs with dorsal muscle only, and receive extensive synaptic input from all five pairs of premotor interneurons, but mainly from the AVAs and AVBs (White et al. 1986),

Notably, the AVA input is biased towards the posterior AS neurons, indicating an anterior/posterior innervation bias (Varshney et al. 2011). Whether this bias has any physiological relevance is unknown, as the AS neurons have been virtually unstudied, and their role in the motor circuit is completely unknown. This study establishes a role for AS neurons in regulation of the C. elegans motor circuit, and this involvement warrants further study. For example, one useful experiment would be to see if AS neurons are sufficient to partially rescue the sto-6(gf) unc-7(lf) phenotype, or if the A and

B motor neuron expression is necessary. New techniques for achieving higher cell-type

resolution for transgenic analyses, using combinatorial techniques with overlapping but distinct promoters, now allows this level of analysis. (Wei et al. 2012). Future work should aim to determine the identities of the remaining Psto-6-expressing cells, in particular, to identify any head inter/motor neurons that have been implicated in the regulation of sto-6-affected parameters, such as the SMB and RME neurons which affect wave amplitude (McIntire et al. 1993; Gray et al. 2005).

3.4 Closing perspectives

In this work, I have characterized a new stomatin gene sto-6, which I have demonstrated to function in B class cholinergic motor neurons to regulate wave frequency, amplitude, and decay. I have also found that sto-6(gf) suppresses the kinker phenotype of unc-7(lf) animals in a stage-dependent manner, and partially through effects in the AS class cholinergic motor neurons, for which no role in motor circuit regulation has been previously identified. Together, these findings lay the groundwork for further understanding and characterization of stomatin function and mechanisms of coordination in neural circuits driving behaviour. One outstanding question is whether or not sto-6 plays a role in a long-postulated stretch-sensitive feedback mechanism for wave propagation involving either degenerin or TRP channels.

Understanding how a nervous system controls behaviour is a central question in neuroscience. Studies in model organisms such as C. elegans provide the opportunity for an in depth understanding of nervous system function at the molecular, cellular, and

circuit levels. However, a comprehensive understanding of nervous system function cannot be achieved without detailed single-gene analyses such as the one described in this work, as well as many other systematic studies of currently underappreciated facets of neurobiology, for example the broad effects of neuromodulators. Over time, these studies should converge toward an increasingly realistic model of the C. elegans nervous system.

4 Methods

4.1 Strains

Standard methods were used for culturing and manipulating animals on NGM plates (Brenner 1974). The inbred laboratory strain N2, obtained from the Caenorhabditis

Genetics Centre, was thawed annually to minimize the effects of accumulation of spontaneous mutations. Transgenic animals were generated by microinjection using standard protocols (Mello et al. 1991). Plasmids were prepared and their concentrations checked on agarose gels or via spectrophotometry. Co-injection markers used were Podr-

1-GFP, Pmyo-2-mCherry, and Pmyo-3-mCherry, and were consistent among sets of transgenic lines within experiments. A complete list of strains used to generate data presented in the thesis is provided in Table 1.

4.2 Molecular Biology

All plasmids were created using standard cloning techniques. Promoters were generated by PCR amplification from genomic DNA template of wild type animals, ending immediately upstream of the ATG start codon of each gene. A complete list of plasmids used in these studies is provided in Table 2. STO-6::GFP translational fusion proteins were generated by PCR amplifying the sto-6 genomic or cDNA coding sequence with a primer pair (See Table 4) that changed the final three base pairs TGA (*) to TTG

(Leu), and inserting the GFP coding sequence (including introns) in frame, separated by a

six amino acid linker (LVPVEK). All PCR-generated inserts were sequenced from both ends to confirm sequence fidelity. Sequence files were created, visualized, and manipulated with the free software “ApE - A Plasmid Editor”, available online

(http://biologylabs.utah.edu/jorgensen/wayned/ape/). Promoters used were the 5.1 kb

Pnmr-1 (Maricq et al. 1995), 2.8 kb Psra-11 (Troemel et al. 1995), 3.4 kb Pacr-2 (Jospin et al. 2009), 2.2 kb Psto-6 (Po 2011), 4.3 kb Pacr-5 (Winnier et al. 1999, 2.5 kb Punc-4

{Miller, 1992 #158), 2.6 kb Punc-3 (Prasad et al. 1998).

4.3 Site-Directed mutagenesis

sto-6(cDNA) was PCR amplified from the plasmid pJH2003, adding a BamHI restriction site 5’ to the ATG. The downstream primer altered the TGA (*) to TTG (Leu) and added an LVPVEK linker upstream of a KpnI restriction site. This PCR product was subcloned into the pBSK vector using BamHI and KpnI, and several individual transformants were sequenced to ensure sequence fidelity. This plasmid pBSK-sto-

6(cDNA) served as the template a PCR reaction with two mutagenic primers altering the cDNA to match the sto-6(hp395) mutation. DpnI was used to digest the parent plasmid immediately after PCR, and the resulting sample was transformed into DH5a cells.

Several colonies were picked, mini-prepped, and the resulting plasmids were digested with MwoI to screen for the hp395 mutation-containing clones (the hp395 mutation destroys an MwoI restriction site), and positive colonies were sequenced. A mutant clone with the correct sequence was cloned out of pBSK-sto-6(hp395cDNA) into plasmids with the desired promoter, upstream of GFP.

4.4 Imaging

All pictures were taken through a Zeiss Axioplan 2 compound fluorescent microscope with 10X, 63X, and 100X objective lenses, with a Hamamatsu ORCA-ER camera. Image acquisition and processing was performed using Openlab. Images used to draw conclusions of overlapping expression were processed in the following way: Z- stacks were acquired over the desired focal length with a step length of 0.5 uM, with images taken from both channels for each step. Each channel was deconvolved separately to create single channel image. These images were then merged to create the final image.

4.5 Locomotion Analysis

Individual young adult animals were placed on a thinly-seeded large NGM plate.

A Fujifilm Finepix digital camera was mounted with a Celestron Digital Camera Adapter on the Leica M50 dissecting microscope eyepiece to record animal behavior at 10X microscope magnification and full digital zoom on the camera. Recording commenced one minute after placing the animal on the plate, and videos were taken for two minutes.

The plate was smoothly shifted to accommodate for the worm moving out of the frame.

Videos were processed using in-house java software (Kawano et al. 2011), which thresholded the captured area, leaving only a black silhouette of the animal on a white background. The process also accounted for plate shifting by removing frames during which motion of the background was detected, and stitching the loose frames together.

This process was reiterated for 10 animals for each strain being tested in the same day.

Another script written in R was used to perform statistical analysis of and graph the information in the resulting text files of all strains tested. Microsoft Excel was used to further process and re-graph the data. Statistics were calculated using the two-tailed

Mann-Whitney U test.

4.6 Curvature Analysis

Behaviour of individual animals was recorded as described in section 4.5. When possible, gaps (empty frames) in the processed collection of frames were removed to yield smooth stitching in which the animal’s posture and direction of locomotion was continuous. Otherwise, that segment of the video was not used. Processed image stacks were then run through in-house Matlab software which performed the following tasks:

Identifying the worm and defining the polarity of the head and tail, segmenting the body into 37 longitudinal segments, defining vectors between each nieghbouring segment, calculating the curvature at each segment and tabulating and displaying the curvature values over time using a color-conversion metric. Tabulated curvature values were then run through a Matlab script to yield a matrix of the mean of the absolute curvature values over time at specific segments along the worm versus individual samples in the experiment. For each animal, the difference between the anterior and posterior average curvature values was calculated, and the two-tailed Mann-Whitney U test was used to determine P-values for curvature differences between strains.

Table I – Complete list of Strains used in this study

Experiment Genetics/Controls

Name Alias

CB5 unc-7(e5) X

ZM7022 sto-6(hp395) X

ZM4442 sto-6(tm1610) X

ZM1859 sto-6(hp395) unc-7(e5) X

ZM4470 sto-6(tm1610) unc-7(e5) X

Experiment Expression Analysis

Name Alias Transgene

ZM4388 hpIs154 Psto-6-sto-6::GFP

ZM6924 hpIs154; hpEx2963 Psto-6-sto-6:GFP; Punc-3-mCherry

ZM6755 hpIs190; hpEx2388 Pnmr-1-D3cpv; Psto-6-mCherry

ZM6918 hpIs171; hpEx2960 Pacr-2-D3cpv; Psto-6-mCherry

Experiment sto-6(gf) rescue

Name Alias Transgene

ZM6493 sto-6(hp395) X; hpEx2730 Psto-6-sto-6::GFP

ZM6623 sto-6(hp395) X; hpEx2805 Pacr-5-sto-6(cDNA)::GFP

Pacr-5-sto-6(cDNA)::GFP; Pnmr-1-sto- ZM6715 sto-6(hp395) X; hpEx2829 6(cDNA)::GFP

ZM6728 sto-6(hp395) X; hpEx2840 Psra-11-sto-6(cDNA)::GFP

ZM6717 sto-6(hp395) X; hpEx2831 Pnmr-1-sto-6(cDNA)::GFP

Experiment sto-6(gf) unc-7(lf) rescue

Name Alias Transgene

sto-6(hp395) unc-7(e5) X; ZM6496 hpEx2733 Psto-6-sto-6::GFP

sto-6(hp395) unc-7(e5) X; ZM6672 hpEx2821 Pacr-5-sto-6(cDNA)::GFP

sto-6(hp395) unc-7(e5) X; ZM6765 hpEx2868 Pacr-2-sto-6(cDNA)::GFP

sto-6(hp395) unc-7(e5) X; Pacr-5-sto-6(cDNA)::GFP; Punc-4-sto- ZM6767 hpEx2870 6(cDNA)::GFP

sto-6(hp395) unc-7(e5) X; Pacr-5-sto-6(cDNA)::GFP; Pnmr-1-sto- ZM6716 hpEx2830 6(cDNA)::GFP

sto-6(hp395) unc-7(e5) X; ZM6718 hpEx2832 Pnmr-1-sto-6(cDNA)::GFP

Experiment sto-6(lf) recapitulation

Name Alias Transgene

ZM6843 sto-6(tm1610) X; hpEx2867 Psto-6-sto-6(gf)::GFP

ZM6516 sto-6(tm1610) X; hpEX2751 Pacr-5-sto-6(hp395)::GFP

sto-6(lf) unc-7(lf) Experiment recapitulation

Name Alias Transgene

sto-6(tm1610) unc-7(e5) X; ZM6764 hpEx2867 Psto-6-sto-6(gf)::GFP

sto-6(tm1610) unc-7(e5) X; ZM6829 hpEx2900 Pacr-5-sto-6(hp395cDNA)::GFP

sto-6(tm1610) unc-7(e5) X; ZM6847 hpEx2912 Pacr-2-sto-6(hp395cDNA)::GFP

Table 2 – Complete list of Plasmids used in this study

Experiment Sto-6 expression analysis

Name Alias Purpose

pJH1569 Psto-6-sto-6::GFP STO-6 expression and localization

pJH1808 Psto-6-mCherry Psto-6 expression pattern

pJH1863 Pacr-2-D3cpv Pacr-2 expression pattern

pJH1969 Pnmr-1-D3cpv Pnmr-1 expression pattern

pJH2816 Punc-3-mCherry Punc-3 expression pattern

Experiment sto-6(gf) reversion

Name Alias Purpose

pJH1569 Psto-6-sto-6::GFP Endogenous expression

pJH2726 Pacr-5-sto-6(cDNA)::GFP B MN + PVC expression

pJH2749 Pnmr-1-sto-6(cDNA)::GFP AVA, AVE, AVD, PVC expression

pJH2750 Prig-3-sto-6(cDNA)::GFP AVA expression

pJH2751 Psra-11-sto-6(cDNA)::GFP AVB expression

pJH2770 Pcex-1-sto-6(cDNA)::GFP RIM expression

pJH2774 Pacr-2-sto-6(cDNA)::GFP A + B MN expression

pJH2776 Punc-4-sto-6(cDNA)::GFP A MN expression

pJH2822 Punc-3-sto-6(cDNA)::GFP A + B + AS MN expression

Experiment sto-6(gf) recapitulation

Name Alias Purpose

pJH2485 Psto-6-sto-6(hp395)::GFP Endogenous expression

pJH2748 pBSK-sto-6(cDNA) Substrate for site-directed mutagenesis

pJH2771 pBSK-sto-6(hp395cDNA) Product of site-directed mutagenesis

pJH2772 Pacr-5-sto-6(hp395cDNA)::GFP B MN + PVC expression

pJH2775 Pacr-2-sto-6(hp395cDNA)::GFP A + B MN expression

pJH2823 Punc-3-sto-6(hp395cDNA)::GFP A + B + AS MN expression

Table 3 – Oligonucleotides used for genotyping

Experiment Genotyping Alleles

Gene(allele) Primer pair Wild type band Mutant band

unc-7(e5) OZM401/2652 none 580 bp

OZM401/2653 580 bp none

sto-6(hp395) OZM1869/1870 (+ MwoI digest) 522 bp 641 bp

sto-6(tm1610) OZM1869/1872 1946 bp 685 bp

Table 4 – Oligonucleotides used for plasmid construction

Experiment PCR for constructs

Name Sequence Purpose

OZM3391 tactgcagtaacaatgtccggtcttgg Amplify 5' PstI-Punc-3-BamHI 3'

OZM3392 aaggatccgccacagttttcggatcaag

PCR amplify 5' BamHI-sto-6(cDNA)- OZM3215 aaaggatccatgcctaaccaaccacaacc KpnI 3'

OZM3216 tatggtaccaagctgtacttcagcgcacc

Site directed mutagenesis of sto- OZM3299 cgtaatggctgctgaagtagaagcgacaagagatgc 6(cDNA)

OZM3300 gcatctcttgtcgcttctacttcagcagccattacg

Experiment Sequencing for plasmid verification

Name Sequence Purpose

T7 forward primer for sequencing OZM978 taatacgactcactataggg pBSK insert

M13 reverse primer for sequencing OZM3011 caggaaacagctatgaccatg pBSK insert

5 References

Albertson, D. G. and J. N. Thomson (1976). "The pharynx of Caenorhabditis elegans." Philos Trans R Soc Lond B Biol Sci 275(938): 299-325.

Altun, Z. F., B. Chen, Z. W. Wang and D. H. Hall (2009). "High resolution map of Caenorhabditis elegans gap junction proteins." Dev Dyn 238(8): 1936-50.

Arbas, E. A. and R. L. Calabrese (1987). "Slow oscillations of membrane potential in interneurons that control heartbeat in the medicinal leech." J Neurosci 7(12): 3953-60.

Baek, J. H., P. Cosman, Z. Feng, J. Silver and W. R. Schafer (2002). "Using machine vision to analyze and classify Caenorhabditis elegans behavioral phenotypes quantitatively." J Neurosci Methods 118(1): 9-21.

Bargmann, C. I. (1998). "Neurobiology of the Caenorhabditis elegans genome." Science 282(5396): 2028-33.

Bargmann, C. I. (2012). "Beyond the connectome: How neuromodulators shape neural circuits." Bioessays 34(6): 458-465.

Bargmann, C. I. and L. Avery (1995). "Laser killing of cells in Caenorhabditis elegans." Methods Cell Biol 48: 225-50.

Bendesky, A., M. Tsunozaki, M. V. Rockman, L. Kruglyak and C. I. Bargmann (2011). "Catecholamine receptor polymorphisms affect decision-making in C. elegans." Nature 472(7343): 313-8.

Berri, S., J. H. Boyle, M. Tassieri, I. A. Hope and N. Cohen (2009). "Forward locomotion of the nematode C. elegans is achieved through modulation of a single gait." HFSP J 3(3): 186-93.

Bessou, C., J. B. Giugia, C. J. Franks, L. Holden-Dye and L. Segalat (1998). "Mutations in the Caenorhabditis elegans dystrophin-like gene dys-1 lead to hyperactivity and suggest a link with cholinergic transmission." Neurogenetics 2(1): 61-72.

Brenner, S. (1974). "The genetics of Caenorhabditis elegans." Genetics 77(1): 71-94.

Brockie, P. J., D. M. Madsen, Y. Zheng, J. Mellem and A. V. Maricq (2001). "Differential expression of glutamate receptor subunits in the nervous system of Caenorhabditis elegans and their regulation by the homeodomain protein UNC- 42." J Neurosci 21(5): 1510-22.

Bryden, J. and N. Cohen (2008). "Neural control of Caenorhabditis elegans forward locomotion: the role of sensory feedback." Biol Cybern 98(4): 339-51.

Bulina, M. E., D. M. Chudakov, O. V. Britanova, Y. G. Yanushevich, D. B. Staroverov, T. V. Chepurnykh, E. M. Merzlyak, M. A. Shkrob, S. Lukyanov and K. A. Lukyanov (2006). "A genetically encoded photosensitizer." Nat Biotechnol 24(1): 95-9.

Bulina, M. E., K. A. Lukyanov, O. V. Britanova, D. Onichtchouk, S. Lukyanov and D. M. Chudakov (2006). "Chromophore-assisted light inactivation (CALI) using the phototoxic fluorescent protein KillerRed." Nat Protoc 1(2): 947-53.

Chalfie, M., J. E. Sulston, J. G. White, E. Southgate, J. N. Thomson and S. Brenner (1985). "The neural circuit for touch sensitivity in Caenorhabditis elegans." J Neurosci 5(4): 956-64.

Chen, B., Q. Liu, Q. Ge, J. Xie and Z. W. Wang (2007). "UNC-1 regulates gap junctions important to locomotion in C. elegans." Curr Biol 17(15): 1334-9.

Clarac, F. (2008). "Some historical reflections on the neural control of locomotion." Brain Res Rev 57(1): 13-21.

de Bono, M. and C. I. Bargmann (1998). "Natural variation in a neuropeptide Y receptor homolog modifies social behavior and food response in C. elegans." Cell 94(5): 679-89.

Del Negro, C. A., C. Morgado-Valle and J. L. Feldman (2002). "Respiratory rhythm: an emergent network property?" Neuron 34(5): 821-30.

Edwards, A. C. and T. F. Mackay (2009). "Quantitative trait loci for aggressive behavior in Drosophila melanogaster." Genetics 182(3): 889-97.

Epand, R. F., A. Thomas, R. Brasseur, S. A. Vishwanathan, E. Hunter and R. M. Epand (2006). "Juxtamembrane protein segments that contribute to recruitment of cholesterol into domains." Biochemistry 45(19): 6105-14.

Evans, W. H. and P. E. Martin (2002). "Gap junctions: structure and function (Review)." Mol Membr Biol 19(2): 121-36.

Fang-Yen, C., M. Wyart, J. Xie, R. Kawai, T. Kodger, S. Chen, Q. Wen and A. D. Samuel (2010). "Biomechanical analysis of gait adaptation in the nematode Caenorhabditis elegans." Proc Natl Acad Sci U S A 107(47): 20323-8.

Gao, S. and M. Zhen (2011). "Action potentials drive body wall muscle contractions in Caenorhabditis elegans." Proc Natl Acad Sci U S A 108(6): 2557-62.

Gieseler, K., C. Bessou and L. Segalat (1999). "Dystrobrevin- and dystrophin-like mutants display similar phenotypes in the nematode Caenorhabditis elegans." Neurogenetics 2(2): 87-90.

Goodman, M. B., G. G. Ernstrom, D. S. Chelur, R. O'Hagan, C. A. Yao and M. Chalfie (2002). "MEC-2 regulates C. elegans DEG/ENaC channels needed for mechanosensation." Nature 415(6875): 1039-42.

Gray, J. M., J. J. Hill and C. I. Bargmann (2005). "A circuit for navigation in Caenorhabditis elegans." Proc Natl Acad Sci U S A 102(9): 3184-91.

Grillner, S. (1985). "Neurobiological bases of rhythmic motor acts in vertebrates." Science 228(4696): 143-9.

Hillier, L. W., V. Reinke, P. Green, M. Hirst, M. A. Marra and R. H. Waterston (2009). "Massively parallel sequencing of the polyadenylated transcriptome of C. elegans." Genome Res 19(4): 657-66.

Hong, K. and M. Driscoll (1994). "A transmembrane domain of the putative channel subunit MEC-4 influences mechanotransduction and neurodegeneration in C. elegans." Nature 367(6462): 470-3.

Hu, C. D., Y. Chinenov and T. K. Kerppola (2002). "Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation." Mol Cell 9(4): 789-98.

Huang, M., G. Gu, E. L. Ferguson and M. Chalfie (1995). "A stomatin-like protein necessary for mechanosensation in C. elegans." Nature 378(6554): 292-5.

Huber, T. B., B. Schermer, R. U. Muller, M. Hohne, M. Bartram, A. Calixto, H. Hagmann, C. Reinhardt, F. Koos, K. Kunzelmann, E. Shirokova, D. Krautwurst, C. Harteneck, M. Simons, H. Pavenstadt, D. Kerjaschki, C. Thiele, G. Walz, M. Chalfie and T. Benzing (2006). "Podocin and MEC-2 bind cholesterol to regulate the activity of associated ion channels." Proc Natl Acad Sci U S A 103(46): 17079-86.

Inagaki, H. K., S. Ben-Tabou de-Leon, A. M. Wong, S. Jagadish, H. Ishimoto, G. Barnea, T. Kitamoto, R. Axel and D. J. Anderson (2012). "Visualizing neuromodulation in vivo: TANGO-mapping of dopamine signaling reveals appetite control of sugar sensing." Cell 148(3): 583-95.

Inglis, P. N., Ou, G., Leroux, M. R., Scholey, J. M. "The sensory cilia of Caenorhabditis elegans." The C. elegans Research Community. Wormbook. November 27, 2006. 1551-8507. 10.1895/wormbook.1.126.1 http://www.wormbook.org.

Jospin, M., Y. B. Qi, T. M. Stawicki, T. Boulin, K. R. Schuske, H. R. Horvitz, J. L. Bessereau, E. M. Jorgensen and Y. Jin (2009). "A neuronal acetylcholine receptor regulates the balance of muscle excitation and inhibition in Caenorhabditis elegans." PLoS Biol 7(12): e1000265.

Kang, S., J. H. Jang, M. P. Price, M. Gautam, C. J. Benson, H. Gong, M. J. Welsh and T. J. Brennan (2012). "Simultaneous Disruption of Mouse ASIC1a, ASIC2 and ASIC3 Genes Enhances Cutaneous Mechanosensitivity." PLoS One 7(4): e35225.

Karbowski, J., G. Schindelman, C. J. Cronin, A. Seah and P. W. Sternberg (2008). "Systems level circuit model of C. elegans undulatory locomotion: mathematical modeling and molecular genetics." J Comput Neurosci 24(3): 253-76.

Kawano, T., M. D. Po, S. Gao, G. Leung, W. S. Ryu and M. Zhen (2011). "An imbalancing act: gap junctions reduce the backward motor circuit activity to bias C. elegans for forward locomotion." Neuron 72(4): 572-86.

Kim, H., M. J. Rogers, J. E. Richmond and S. L. McIntire (2004). "SNF-6 is an acetylcholine transporter interacting with the dystrophin complex in Caenorhabditis elegans." Nature 430(7002): 891-6.

Kleinfeld, D., A. Bharioke, P. Blinder, D. D. Bock, K. L. Briggman, D. B. Chklovskii, W. Denk, M. Helmstaedter, J. P. Kaufhold, W. C. Lee, H. S. Meyer, K. D. Micheva, M. Oberlaender, S. Prohaska, R. C. Reid, S. J. Smith, S. Takemura, P. S. Tsai and B. Sakmann (2011). "Large-scale automated histology in the pursuit of connectomes." J Neurosci 31(45): 16125-38.

Konopka, R. J. and S. Benzer (1971). "Clock mutants of Drosophila melanogaster." Proc Natl Acad Sci U S A 68(9): 2112-6.

Kuhara, A., N. Ohnishi, T. Shimowada and I. Mori (2011). "Neural coding in a single sensory neuron controlling opposite seeking behaviours in Caenorhabditis elegans." Nat Commun 2: 355.

Lecroisey, C., E. Martin, M. C. Mariol, L. Granger, Y. Schwab, M. Labouesse, L. Segalat and K. Gieseler (2008). "DYC-1, a protein functionally linked to dystrophin in Caenorhabditis elegans is associated with the dense body, where it interacts with the muscle LIM domain protein ZYX-1." Mol Biol Cell 19(3): 785-96.

Leifer, A. M., C. Fang-Yen, M. Gershow, M. J. Alkema and A. D. Samuel (2011). "Optogenetic manipulation of neural activity in freely moving Caenorhabditis elegans." Nat Methods 8(2): 147-52.

Li, W., Z. Feng, P. W. Sternberg and X. Z. Xu (2006). "A C. elegans stretch receptor neuron revealed by a mechanosensitive TRP channel homologue." Nature 440(7084): 684-7.

Liu, K. S. and P. W. Sternberg (1995). "Sensory regulation of male mating behavior in Caenorhabditis elegans." Neuron 14(1): 79-89.

Marder, E. and D. Bucher (2007). "Understanding circuit dynamics using the stomatogastric nervous system of lobsters and crabs." Annu Rev Physiol 69: 291- 316.

Maricq, A. V., E. Peckol, M. Driscoll and C. I. Bargmann (1995). "Mechanosensory signalling in C. elegans mediated by the GLR-1 glutamate receptor." Nature 378(6552): 78-81.

McIntire, S. L., E. Jorgensen and H. R. Horvitz (1993). "Genes required for GABA function in Caenorhabditis elegans." Nature 364(6435): 334-7.

Mello, C. C., J. M. Kramer, D. Stinchcomb and V. Ambros (1991). "Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences." EMBO J 10(12): 3959-70.

Miyawaki, A., J. Llopis, R. Heim, J. M. McCaffery, J. A. Adams, M. Ikura and R. Y. Tsien (1997). "Fluorescent indicators for Ca2+ based on green fluorescent proteins and calmodulin." Nature 388(6645): 882-7.

Montel-Hagen, A., S. Kinet, N. Manel, C. Mongellaz, R. Prohaska, J. L. Battini, J. Delaunay, M. Sitbon and N. Taylor (2008). "Erythrocyte Glut1 triggers dehydroascorbic acid uptake in mammals unable to synthesize vitamin C." Cell 132(6): 1039-48.

Mori, I. and Y. Ohshima (1995). "Neural regulation of thermotaxis in Caenorhabditis elegans." Nature 376(6538): 344-8.

Nagel, G., D. Ollig, M. Fuhrmann, S. Kateriya, A. M. Musti, E. Bamberg and P. Hegemann (2002). "Channelrhodopsin-1: a light-gated proton channel in green algae." Science 296(5577): 2395-8.

Panchin, Y. V. (2005). "Evolution of gap junction proteins--the pannexin alternative." J Exp Biol 208(Pt 8): 1415-9.

Park, E. C. and H. R. Horvitz (1986). "Mutations with dominant effects on the behavior and morphology of the nematode Caenorhabditis elegans." Genetics 113(4): 821- 52.

Park, S., H. Hwang, S. W. Nam, F. Martinez, R. H. Austin and W. S. Ryu (2008). "Enhanced Caenorhabditis elegans locomotion in a structured microfluidic environment." PLoS One 3(6): e2550.

Po, M. D. (2011). Gap Junctions and Stomatins Dictate Directional Movement in Caenorhabditis elegans. Molecular Genetics. Toronto, University of Toronto. Ph.D. Thesis.

Prasad, B. C., B. Ye, R. Zackhary, K. Schrader, G. Seydoux and R. R. Reed (1998). "unc- 3, a gene required for axonal guidance in Caenorhabditis elegans, encodes a member of the O/E family of transcription factors." Development 125(8): 1561-8.

Price, M. P., G. R. Lewin, S. L. McIlwrath, C. Cheng, J. Xie, P. A. Heppenstall, C. L. Stucky, A. G. Mannsfeldt, T. J. Brennan, H. A. Drummond, J. Qiao, C. J. Benson, D. E. Tarr, R. F. Hrstka, B. Yang, R. A. Williamson and M. J. Welsh (2000). "The

mammalian sodium channel BNC1 is required for normal touch sensation." Nature 407(6807): 1007-11.

Price, M. P., S. L. McIlwrath, J. Xie, C. Cheng, J. Qiao, D. E. Tarr, K. A. Sluka, T. J. Brennan, G. R. Lewin and M. J. Welsh (2001). "The DRASIC cation channel contributes to the detection of cutaneous touch and acid stimuli in mice." Neuron 32(6): 1071-83.

Raizen, D. M., J. E. Zimmerman, M. H. Maycock, U. D. Ta, Y. J. You, M. V. Sundaram and A. I. Pack (2008). "Lethargus is a Caenorhabditis elegans sleep-like state." Nature 451(7178): 569-72.

Rajaram, S., T. L. Spangler, M. M. Sedensky and P. G. Morgan (1999). "A stomatin and a degenerin interact to control anesthetic sensitivity in Caenorhabditis elegans." Genetics 153(4): 1673-82.

Ramot, D., B. E. Johnson, T. L. Berry, Jr., L. Carnell and M. B. Goodman (2008). "The Parallel Worm Tracker: a platform for measuring average speed and drug-induced paralysis in nematodes." PLoS One 3(5): e2208.

Richmond, J. E. and E. M. Jorgensen (1999). "One GABA and two acetylcholine receptors function at the C. elegans neuromuscular junction." Nat Neurosci 2(9): 791-7.

Salzer, U., M. Mairhofer and R. Prohaska (2007). "Stomatin: A New Paradigm of Membrane Organization Emerges." Dynamic Cell Biology 1(1): 20-33.

Sawin, E. R., R. Ranganathan and H. R. Horvitz (2000). "C. elegans locomotory rate is modulated by the environment through a dopaminergic pathway and by experience through a serotonergic pathway." Neuron 26(3): 619-31.

Schobert, B. and J. K. Lanyi (1982). "Halorhodopsin is a light-driven chloride pump." J Biol Chem 257(17): 10306-13.

Schwarzmann, G., H. Wiegandt, B. Rose, A. Zimmerman, D. Ben-Haim and W. R. Loewenstein (1981). "Diameter of the cell-to-cell junctional membrane channels as probed with neutral molecules." Science 213(4507): 551-3.

Sedensky, M. M., J. M. Siefker, J. Y. Koh, D. M. Miller, 3rd and P. G. Morgan (2004). "A stomatin and a degenerin interact in lipid rafts of the nervous system of Caenorhabditis elegans." Am J Physiol Cell Physiol 287(2): C468-74.

Sedensky, M. M., J. M. Siefker and P. G. Morgan (2001). "Model organisms: new insights into ion channel and transporter function. Stomatin homologues interact in Caenorhabditis elegans." Am J Physiol Cell Physiol 280(5): C1340-8.

Segalat, L., D. A. Elkes and J. M. Kaplan (1995). "Modulation of serotonin-controlled behaviors by Go in Caenorhabditis elegans." Science 267(5204): 1648-51.

Shaham, S. and H. R. Horvitz (1996). "An alternatively spliced C. elegans ced-4 RNA encodes a novel cell death inhibitor." Cell 86(2): 201-8.

Sherrington, C. S. (1910). "Flexion-reflex of the limb, crossed extension-reflex, and reflex stepping and standing." J Physiol 40(1-2): 28-121.

Shu, X., V. Lev-Ram, T. J. Deerinck, Y. Qi, E. B. Ramko, M. W. Davidson, Y. Jin, M. H. Ellisman and R. Y. Tsien (2011). "A genetically encoded tag for correlated light and electron microscopy of intact cells, tissues, and organisms." PLoS Biol 9(4): e1001041.

Snyers, L., E. Umlauf and R. Prohaska (1998). "Oligomeric nature of the integral membrane protein stomatin." J Biol Chem 273(27): 17221-6.

Snyers, L., E. Umlauf and R. Prohaska (1999). "Cysteine 29 is the major palmitoylation site on stomatin." FEBS Lett 449(2-3): 101-4.

Starich, T. A., J. Xu, I. M. Skerrett, B. J. Nicholson and J. E. Shaw (2009). "Interactions between innexins UNC-7 and UNC-9 mediate electrical synapse specificity in the Caenorhabditis elegans locomotory nervous system." Neural Dev 4: 16.

Stephens, G. J., B. Johnson-Kerner, W. Bialek and W. S. Ryu (2008). "Dimensionality and dynamics in the behavior of C. elegans." PLoS Comput Biol 4(4): e1000028.

Stirman, J. N., M. M. Crane, S. J. Husson, S. Wabnig, C. Schultheis, A. Gottschalk and H. Lu (2011). "Real-time multimodal optical control of neurons and muscles in freely behaving Caenorhabditis elegans." Nat Methods 8(2): 153-8.

Stretton, A., J. Donmoyer, R. Davis, J. Meade, C. Cowden and P. Sithigorngul (1992). "Motor behavior and motor nervous system function in the nematode Ascaris suum." J Parasitol 78(2): 206-14.

Stretton, A. O., R. E. Davis, J. D. Angstadt, J. Donmoyer and C. D. Johnson (1985). "Neural control of behaviour in Ascaris." Trends in Neurosciences 8: 294-300.

Sulston, J., Z. Du, K. Thomas, R. Wilson, L. Hillier, R. Staden, N. Halloran, P. Green, J. Thierry-Mieg, L. Qiu and et al. (1992). "The C. elegans genome sequencing project: a beginning." Nature 356(6364): 37-41.

Sulston, J. E. and J. G. White (1980). "Regulation and cell autonomy during postembryonic development of Caenorhabditis elegans." Dev Biol 78(2): 577-97.

Sznitman, J., P. K. Purohit, P. Krajacic, T. Lamitina and P. E. Arratia (2010). "Material properties of Caenorhabditis elegans swimming at low Reynolds number." Biophys J 98(4): 617-26.

Tavernarakis, N., W. Shreffler, S. Wang and M. Driscoll (1997). "unc-8, a DEG/ENaC family member, encodes a subunit of a candidate mechanically gated channel that modulates C. elegans locomotion." Neuron 18(1): 107-19.

Tian, L., S. A. Hires, T. Mao, D. Huber, M. E. Chiappe, S. H. Chalasani, L. Petreanu, J. Akerboom, S. A. McKinney, E. R. Schreiter, C. I. Bargmann, V. Jayaraman, K. Svoboda and L. L. Looger (2009). "Imaging neural activity in worms, flies and mice with improved GCaMP calcium indicators." Nat Methods 6(12): 875-81.

Troemel, E. R., J. H. Chou, N. D. Dwyer, H. A. Colbert and C. I. Bargmann (1995). "Divergent seven transmembrane receptors are candidate chemosensory receptors in C. elegans." Cell 83(2): 207-18.

Umlauf, E., E. Csaszar, M. Moertelmaier, G. J. Schuetz, R. G. Parton and R. Prohaska (2004). "Association of stomatin with lipid bodies." J Biol Chem 279(22): 23699- 709.

Varshney, L. R., B. L. Chen, E. Paniagua, D. H. Hall and D. B. Chklovskii (2011). "Structural properties of the Caenorhabditis elegans neuronal network." PLoS Comput Biol 7(2): e1001066.

Vidal-Gadea, A., S. Topper, L. Young, A. Crisp, L. Kressin, E. Elbel, T. Maples, M. Brauner, K. Erbguth, A. Axelrod, A. Gottschalk, D. Siegel and J. T. Pierce- Shimomura (2011). "Caenorhabditis elegans selects distinct crawling and swimming gaits via dopamine and serotonin." Proc Natl Acad Sci U S A 108(42): 17504-9.

Von Stetina, S. E., M. Treinin and D. M. Miller, 3rd (2006). "The motor circuit." Int Rev Neurobiol 69: 125-67.

Wen, Q., E. Hulme, S. Chen, X. Liu, M. Gershow, A. M. Leifer, V. Butler, C. Fang-Yen, W. R. Schafer, G. Whitesides, M. Wyart, D. B. Chklovskii and A. D. T. Samuel (2012). "Bending waves during C. elegans locomotion are driven and organized by proprioceptive coupling." Under Review.

Wetzel, C., J. Hu, D. Riethmacher, A. Benckendorff, L. Harder, A. Eilers, R. Moshourab, A. Kozlenkov, D. Labuz, O. Caspani, B. Erdmann, H. Machelska, P. A. Heppenstall and G. R. Lewin (2007). "A stomatin-domain protein essential for touch sensation in the mouse." Nature 445(7124): 206-9.

White, J. G., E. Southgate, J. N. Thomson and S. Brenner (1986). "The structure of the nervous system of the nematode Caenorhabditis elegans." Philos Trans R Soc Lond B Biol Sci 314(1165): 1-340.

Winnier, A. R., J. Y. Meir, J. M. Ross, N. Tavernarakis, M. Driscoll, T. Ishihara, I. Katsura and D. M. Miller, 3rd (1999). "UNC-4/UNC-37-dependent repression of motor neuron-specific genes controls synaptic choice in Caenorhabditis elegans." Genes Dev 13(21): 2774-86.

Yokoyama, H., S. Fujii and I. Matsui (2008). "Crystal structure of a core domain of stomatin from Pyrococcus horikoshii Illustrates a novel trimeric and coiled-coil fold." J Mol Biol 376(3): 868-78.

Zhang, F., L. P. Wang, M. Brauner, J. F. Liewald, K. Kay, N. Watzke, P. G. Wood, E. Bamberg, G. Nagel, A. Gottschalk and K. Deisseroth (2007). "Multimodal fast optical interrogation of neural circuitry." Nature 446(7136): 633-9.

Zheng, Y., P. J. Brockie, J. E. Mellem, D. M. Madsen and A. V. Maricq (1999). "Neuronal control of locomotion in C. elegans is modified by a dominant mutation in the GLR-1 ionotropic glutamate receptor." Neuron 24(2): 347-61.

Zhong, L., R. Y. Hwang and W. D. Tracey (2010). "Pickpocket is a DEG/ENaC protein required for mechanical nociception in Drosophila larvae." Curr Biol 20(5): 429- 34.

Zuo, J., P. L. De Jager, K. A. Takahashi, W. Jiang, D. J. Linden and N. Heintz (1997). "Neurodegeneration in Lurcher mice caused by mutation in delta2 glutamate receptor gene." Nature 388(6644): 769-73.