Woo Et Al MS Ver 3 Blood Advances

Zfp281 (ZBP-99) plays a functionally redundant role with Zfp148 (ZBP-89) during erythroid development

The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters.

Citation Woo, Andrew J. et al. "Zfp281 (ZBP-99) plays a functionally redundant role with Zfp148 (ZBP-89) during erythroid development." Red Cells, Iron, and Erythropoiesis 3, 16 (August 2019): 2499–2511 © 2019 The American Society of Hematology

As Published http://dx.doi.org/10.1182/bloodadvances.2018030551

Publisher American Society of Hematology

Version Author's final manuscript

Citable link https://hdl.handle.net/1721.1/125917

Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/

Zfp281 (ZBP-99) Plays a Functionally Redundant Role with Zfp148 (ZBP-89) during

Erythroid Development

Andrew J. Woo,1,2,* Chelsea-Ann A. Patry,1 Alireza Ghamari,1 Gabriela Pregernig,3 Daniel

Yuan,1 Kangni Zheng,1 Taylor Piers,1 Moira Hibbs,2 Ji K. Li,2 Miguel Fidalgo,4,5 Jenny Y. Wang,6

Joo-Hyeon Lee,7 Peter J. Leedman,2 Jianlong Wang,4 Ernest Fraenkel,3 and Alan B. Cantor1,8,*

1Division of Pediatric Hematology-Oncology, Boston Children’s Hospital/Dana-Farber Cancer

Institute, Harvard Medical School, Boston, MA 02115, USA; 2Harry Perkins Institute of Medical

Research, QEII Medical Centre, Nedlands and Centre for Medical Research, The University of

Western Australia, Crawley, Western Australia, 6009, Australia; 3Department of Biological

Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA; 4Department of Cell, Developmental and Regenerative Biology, Black Family Stem Cell Institute, Icahn

School of Medicine at Mount Sinai, New York, NY 10029, USA; 5Center for Research in

Molecular Medicine and Chronic Diseases, University of Santiago de Compostela, Santiago de

Compostela 15782, Spain. 6Children’s Cancer Institute, Lowy Cancer Research Centre,

University of New South Wales, Sydney, NSW 2052, Australia; 7Wellcome Trust/Medical

Research Council Stem Cell Institute, University of Cambridge, Tennis Court Road, Cambridge

CB2 1QR, UK; 8Harvard Stem Cell Institute, Cambridge, MA, 02138, USA.

*Co-corresponding Authors

Conflict-of-interest statement: There are no conflict-of-interest to disclose.

Running Title: Zfp148/281 in erythroid development

Word count: Main Text: 3,999 words; Abstract: 204 words. Displays: 6 Figures, 1 Table, 8 Supplemental Figures and 4 Supplemental Tables References: 55

Corresponding authors contact details:

Alan B. Cantor, M.D., Ph.D. Boston Children's Hospital and Dana-Farber Cancer Institute Division of Pediatric Hematology/Oncology 300 Longwood Ave, Mailstop 3142 Boston, MA 02115 (TEL) 617-919-2026 (FAX) 617-730-0222 (e-mail) [email protected]

Andrew Jonghan Woo, Ph.D. Harry Perkins Institute of Medical Research and UWA Centre for Medical Research. Level 7, Rm 729 6 Verdun Street Nedlands WA 6009 MBDP: M519 (TEL): +61 08 6151 0758 (e-mail) [email protected]

Key Points

• The transcription factor Zfp281 (ZBP-99) plays a functional role during erythropoiesis

that overlaps with its family member Zfp148 (ZBP-89).

• Both Zfp281 and Zfp148 associate with GATA1.

Abstract

Erythroid maturation requires the concerted action of a core set of transcription factors. We previously identified the Krüppel-type zinc finger transcription factor Zfp148 (also called ZBP-

89) as an interacting partner of the master erythroid transcription factor GATA1. Here we report the conditional knockout of Zfp148 in mice. Global loss of Zfp148 results in perinatal lethality from non-hematologic causes. Selective Zfp148 loss within the hematopoietic system results in a mild microcytic and hypochromic anemia, mildly impaired erythroid maturation, and delayed recovery from phenylhydrazine-induced hemolysis. Based on the mild erythroid phenotype of these mice compared to GATA1 deficient mice, we hypothesized that additional factor(s) may complement Zfp148 function during erythropoiesis. We show that Zfp281 (also called ZBP-99), another member of the Zfp148 transcription factor family, is highly expressed in murine and human erythroid cells. Zfp281 knockdown by itself results in partial erythroid defects. However, combined deficiency of Zfp148 and Zfp281 causes a marked erythroid maturation block. Zfp281 physically associates with GATA1, occupies many common chromatin sites with GATA1 and

Zfp148, and regulates a common set of genes required for erythroid cell differentiation. These findings uncover a previously unknown role for Zfp281 in erythroid development and suggest that it functionally overlaps with that of Zfp148 during erythropoiesis.

Introduction

A complete understanding of hematopoietic transcriptional control requires that all functional trans-activating factors and cis-regulatory elements be identified. Within the erythroid system, the zinc finger transcription factor GATA1 acts as a master regulator controlling the expression of most, if not all, erythroid-specific genes.1-3 Targeted deletion of GATA1 blocks erythroid cell maturation and causes severe anemia in mice, leading to death by embryonic day 10.5 (e10.5) - e11.5.4,5 Enforced GATA1 expression reprograms alternate hematopoietic lineages into erythroid fates,6,7 and in combination with Tal1, Lmo2 and c-MYC, GATA1 directly converts fibroblasts into erythroid progenitor cells.8 These findings collectively highlight the dominant role that GATA1 plays in orchestrating erythroid cell fate decision and differentiation.

We previously performed a proteomic screen of GATA1-interacting proteins and identified the Krüppel-type zinc finger transcription factor Zfp148 (also called ZBP-89) as a GATA1 binding partner.9 Tetraploid complementation of Zfp148 gene-trap embryonic stem (ES) cells and chimeric mice showed that Zfp148 deficient cells have reduced contribution to definitive erythroid cells in vivo. Partial depletion of Zfp148 in primary human CD34+ (hCD34+) cells causes a mild impairment of erythroid maturation.10

The Zfp148 locus has been targeted previously in mice by disrupting exon 9, which removes

60% of the protein coding sequence but leaves a portion of the zinc finger DNA binding domain intact.11 This heterozygous allele was reported to cause defects in primordial germ cell development and the allele was not able to be passed through the germline.11 A conditional knockout (cKO) mouse model targeting exons 8 and 9 deletion was subsequently generated,12,13 and Mx1-Cre mediated Zfp148 deletion in the hematopoietic system showed acute, but transient anemia and thrombocytopenia in adult mice.12

The transcription factor Zfp281 (also called ZBP-99) was originally discovered as a guanine cytosine (GC)-rich DNA sequence binding Krüppel-like zinc finger protein that shares amino acid sequence homology with Zfp148 and binds to similar DNA sequences in vitro.14 Zfp281 has been extensively studied in embryonic stem (ES) cells where it is highly expressed and physically interacts with key stem cell transcription factors including Nanog, Oct4 and Sox2 to regulate pluripotency genes.15-19 Zfp281 is dispensable for the establishment and maintenance of

ES cells, but required for proper ES cell differentiation and embryo survival during the pre- implantation blastocyst stage.20-22

Here, we report a new conditional knockout mouse model for Zfp148 that deletes over 80% of the protein coding domains, including the entire DNA binding zinc finger region.

Hematopoietic selective loss causes a mild anemia and delayed recovery from phenylhydrazine- induced hemolysis. We provide evidence that Zfp281 plays an overlapping role with Zfp148 in erythropoiesis, accounting for the mild erythroid phenotype associated with Zfp148 loss alone.

Methods

Animal studies

The Zfp148 locus spans approximately 125 kb in mice and contains 9 exons (GRCm38,

Ensembl). A targeting strategy, using pFlexible vector,23 was designed to allow Cre-LoxP mediated deletion of exons 6 and 7, which introduces a premature translation termination codon

(PTC) “TGA” in exon 8. Homologous recombination of the targeting construct within Zfp148 locus was achieved in CJ9 (129/Sv) ES cells. A validated ES cell clone was injected into

C57BL/6 blastocysts to generate chimeric mice (Supplemental Methods). Germline transmission of the Zfp148 loxP allele was confirmed in F1 mice. To obtain hematopoietic-specific deletion of Zfp148, the Zfp148fl/fl mice were cross-bred with Vav1-Cre24 transgenic mice. To induce stress erythropoiesis, mice were injected intraperitoneally with 60 mg/kg of phenylhydrazine

(Sigma) in sterile phosphate buffered saline (pH 7.4) on two consecutive days, as previously described.25 Zfp148 germline knockout mice were generated by interbreeding with CD-1 mice expressing Cre under the control of the GATA-1 promoter (GATA-1 Cre).26 The resulting

Zfp148 heterozygous knockout (Zfp148+/-) F1 hybrids were mixed strains of 129/Sv, C57BL/6 and CD-1. All mice were backcrossed at least five to six generations with C57BL/6 mice. All experiments involving mice were approved by the Animal Care and Use Committee at Boston

Children’s Hospital.

Antibodies and reagents

Generation of rabbit polyclonal Zfp148 N14 antibody has previously been described.9

Zfp148 N1-500 antibody was a gift of Juanita Merchant (University of Michigan Medical

School). Additional antibodies were purchased from commercial sources (Supplemental

Methods) and all chemicals were purchased from Sigma-Aldrich, unless noted otherwise.

Blood counts and flow cytometry

Mouse peripheral blood (PB) was collected via retro-orbital plexus and analyzed on a

Hemavet HV950 multispecies hematology system (Drew Scientific, Inc.) All flow cytometry was performed on FACSCalibur, LSR II flow cytometry and AccuriTM instruments (BD

Biosciences) and data were analyzed with FACSDiva and FlowJoTM software.

cDNAs and oligonucleotides

The human Zfp148 cDNA was amplified from MGC clone 4423572 (GE Healthcare

Dharmacon, Inc.), Zfp281 cDNA was synthesized (Supplemental Method) and oligonucleotides used for PCRs, RT-qPCRs, ChIP-qPCRs and Southern blots are listed in the Supplemental Table

Cell culture

The MEL BirA, MelBioGATA-1, K562 BirA, K562BioZfp148 and K562BioZfp281 cell lines were generated in-house and primary hCD34+ cells were obtained from the Yale Center of

Excellence. Cells were cultured as previously described (Supplemental Methods).9,10

Co-immunoprecipitation (Co-IP) assays

Co-IP assays were performed by standard protocols as previously described,9,10 using 1 to 5 mg of nuclear extract (NE) protein (Supplemental Methods).

Chromatin immunoprecipitation (ChIP) and Sequencing analysis

K562 cell lines expressing recombinant BioZfp148 and BioZfp281 were induced with 50 µM hemin for 48 hours. ChIP assays and ChIP-seq analysis were performed using standard methods

(Supplemental Methods).

RNA interference, CRISPR/Cas9 and lentiviruses

Lentiviral short hairpin RNA (shRNA) knockdown was performed as previously described.10,21 shRNAs seed sequences against Zfp281 are shown in Supplemental Table 2.

CRISPR/Cas9 gRNA expressing plasmid targeting exon 4 of Zfp148 (Target ID:

HS0000451815) was obtained from Sigma-Aldrich.

Fetal liver erythroid differentiation

Fetal liver erythroid precursor cells were differentiated ex vivo as previously described.27 In brief, fetal livers were isolated from e12.5-e13.5 C57BL/6 wild-type (WT) and Zfp148-/- embryos. These were made into a single cell suspension and grown in an expansion medium.

WT and knockout cells were infected with lentiviruses harboring shLuc control or shZfp281 for

24 hours, allowed to recover for 48 hrs in expansion medium, and then selected for 48 hrs in puromycin (0.3 µg/mL). Surviving cells were switched to a differentiation media for 48 hrs

(Supplemental Methods).

Histocytochemistry

Cytocentrifuged cells were stained with o-dianisidine (benzidine) for the presence of hemoglobin according to standard procedures.28 Counts were performed in a blinded fashion.

Data Sharing Statement

The ChIP-Seq data has been deposited in the Gene Expression Omnibus (GEO) public database under accession number GSE121133.

Results

Generation of Zfp148 cKO mice.

Targeted deletions of Zfp148 in mice have yielded varying phenotypes, suggesting that different strategies and/or background strains can influence the in vivo outcome.9,11-13 Previously reported gene deletion strategies are predicted to retain a portion the zinc finger DNA binding domain.11-13 We generated a new Cre-LoxP cKO mouse that deletes more than 80% of the

Zfp148 coding region, including the entire zinc finger DNA binding domain, making it the most complete knockout model to our knowledge (Figure 1A-B). Correct gene targeting in 129/Sv ES cells was confirmed by Southern blot and PCR analysis (Supplemental Figure 1A-B). Zfp148fl/+

ES clones were karyotyped and injected into C57BL/6 blastocysts. High-level chimeric animals were obtained and germline transmission of the floxed allele (Zfp148fl/+) was achieved.

Fertility of Zfp148 heterozygous mice and survival of null mice on a mixed strain background.

We attempted generation of Zfp148-/+ mice to validate the previously reported germ cell defect associated with disrupting exon 9.11 The Zfp148 floxed allele was first excised in the germline by breeding with GATA1-Cre mice, which express Cre in sperm cells.26 In contrast to the previous report,11 we obtained live heterozygous Zfp148 knockout (Zfp148-/+) pups.

Interbreeding of the heterozygous mice produced homozygous null Zfp148 (Zfp148-/-) mice at the expected Mendelian ratio (Figure 1C and Supplemental Table 3). Sequencing of the Zfp148 transcripts from the knockout animals showed the expected fusion of exons 5 to 8 (Supplemental

Figure 1 C-D). Western blot analysis of whole embryos using two independent antibodies raised against amino-terminal regions of Zfp148 demonstrated an allele dose-dependent loss of the protein (Figure 1D-E).

Severe growth retardation of Zfp148-/- neonatal mice on mixed genetic background

The Zfp148-/- pups, on a mixed C57BL/6, CD-1, and 129/Sv genetic background, were severely runted compared to their littermate controls (Figure 1F). They appeared to have normal growth up until at least embryonic day 18.5 estimated days-post-coitus (e18.5 d.p.c.). The pups had poor weight gain, low plasma glucose levels and increased mortality over the first few weeks of life (Figure 1G, Supplemental Figure 2A-B). The early lethality did not appear to be related to hematologic causes. The Zfp148-/- animals had milk in their stomach indicating an ability to suckle (Supplemental Figure 2B). The Zfp148-/- pups continued to exhibit poor growth even when control littermates were removed. The animals that survived achieved equivalent body weights and glucose levels compared to their heterozygous and WT littermates by about 6 weeks of age (Supplemental Figure 2A), and had normal long-term survival.

Neonatal lethality of Zfp148-/- mice on a pure C57BL/6 background

Zfp148-/+ mice backcrossed onto a pure C57BL/6 background remained fertile but produced only rare live Zfp148-/- mice (< 2 %) beyond two days of life (Table 1). Most of the homozygous fetuses were lost between e18.5 d.p.c. and birth. The etiology of their death remains unclear.

The embryos did not have severe anemia, hemorrhage, or gross structural defects. No defects were observed upon histological analysis of lung tissues at postnatal day 1 (p1.5) (Supplemental

Figure 3).

Microcytic, hypochromic anemia of Vav1-Cre; Zfp148fl/fl mice

Zfp148fl/fl mice on a pure C57BL/6 background were then bred to pan-hematopoietic Cre expressing Vav1-Cre mice.24 The Vav1-Cre; Zfp148fl/fl mice were viable and had a normal lifespan. The mice had decreased hemoglobin levels (Hgb), mean cell volume (MCV), mean cell hemoglobin (MHC) and increased red blood cell (RBC) number consistent with a mild thalassemia-like phenotype (Figure 2A). There was no statistically significant difference in plasma iron levels or reticulocyte counts between the knockout and control mice (Supplemental

Figure 4A-B). The platelet counts were mildly elevated and the mean platelet volumes (MPV) were not significantly different (Figure 2B). The total white blood cell count showed a lower trend in the Vav1-Cre; Zfp148fl/fl mice, but this was not statistically significant (Figure 2C).

There was mildly impaired erythroid maturation based on flow cytometry for CD71 and Ter119, with an accumulation of immature CD71+Ter119- cells and reduction of mature CD71+Ter119+ cells in the bone marrow (Figure 2D-E). Splenic erythropoiesis was similar but only accumulation of CD71+Ter119- cells was observed (Figure 2F-G). We examined recovery following phenylhydrazine-induced transient hemolytic anemia. This showed a modestly delayed recovery of peripheral RBCs in male Vav1-Cre; Zfp148fl/fl mice, but not in females

(Figure 2H, I).

Expression of Zfp281 in erythroid cells and interaction with GATA1

The relatively mild hematopoietic phenotype of the Vav1-Cre; Zfp148fl/fl mice led us to hypothesize that Zfp281 may play a functionally redundant role with Zfp148 during erythroid development. Zfp281 shares 79% and 71% amino acid sequence similarity and identity, respectively, within the zinc finger DNA binding region of Zfp148.29 In ES cells, Zfp281 binds to consecutive guanine (G)-rich DNA motifs30 that are similar to Zfp148 motifs found in human

13 primary erythroid cells.10 We began investigating a role for Zfp281 in erythroid cells by first examining its expression in major hematopoietic tissues in mice. Both Zfp148 and Zfp281 are expressed in a variety of tissues, but with higher levels in spleen, bone marrow and thymus

(Figure 3A, D). In humans, Zfp281 is expressed concomitantly with Zfp148 at both the mRNA and protein level in purified erythroid populations from ex vivo differentiated from CD34+ peripheral blood mononuclear cells (PBMC)31 and cord blood cells32,33, with higher levels at immature versus late stages (Figure 3B-C). We confirmed the emergence of Zfp281 protein by

Western blot on day 4 of erythroid ex vivo differentiation of PBMC-derived hCD34+ cells

(Figure 3E). Zfp281 protein was not detected in undifferentiated primary human PBMC-derived

CD34+ cells. This expression pattern mirrors that of Zfp148.10

We previously showed that Zfp148 physically and functionally interacts with GATA1 to regulate erythroid cell differentiation.9,10 To examine if Zfp281 also associates with GATA1, we performed a streptavidin pull-down of multiprotein complexes containing metabolically biotinylated GATA1 (BioGATA1) in murine erythroid leukemic (MEL) cells.9 Western blot analysis showed that Zfp281 co-precipitated with these complexes, similar to Zfp148 and Zfpm1

(FOG-1), a known GATA1 cofactor (Figure 3F). We validated their association in the reverse direction by expressing BioZfp148 and BioZfp281 in human K562 erythroid leukemia cells followed by streptavidin pull-down and GATA1 Western blot (Figure 3G-H).

Common chromatin occupancy of Zfp148, Zfp281 and GATA1 in erythroid cells.

ChIP-seq was performed next to assess the degree of chromatin occupancy overlap between

Zfp148 and Zfp281. To avoid potential antibody cross-reactivity, we utilized a streptavidin

BioChIP-seq approach34 using K562 BioZfp148 and BioZfp281 clones that express metabolically

14 biotinylated Zfp148 or Zfp281 at or below the endogenous protein levels (Supplemental Figure

5A-B). Parental cells expressing the biotin ligase Bir A alone were used as controls.

Remarkably, close to half of the Zfp148 peaks (3008 of 6197, 49%), and two-thirds of the

Zfp281 peaks (3008 of 4755, 63%), corresponded to each other’s occupancy sites

(hypergeometric test of overlap, p-value<10500) (Figure 4A; Supplemental Figure 6).

Consecutive stretches of guanine-rich DNA motifs were highly enriched in all Zfp281/Zfp148 occupancy sites, consistent with prior reports of their DNA binding sequence preferences.10,14,21,29,35 The distributions of their peaks were also similar, with about half occurring at the promoter (Figure 4B). These occupancy peaks were then assigned to nearest target genes. More than half of Zfp281 (728 of 1339, 54%) and a third of Zfp148 target genes

(728 of 1942, 37%) were in common with each other (Supplemental Figure 7A). Gene ontology

(GO) term analysis revealed that the common target genes were enriched for transcriptional processes, nucleosome disassembly and covalent chromatin modification (Supplemental Figure

7D).

Zfp148 and Zfp281 target genes were next compared to those of GATA1 in K562 cells (GEO accession: GSM1003608)36 (Figure 4C). About 245 GATA target genes also contain occupancy by Zfp148 and/or Zfp281 (Supplemental Table 4). These genes are enriched for functions associated with positive regulation of transcription (GO:0045893) and erythrocyte differentiation

(GO:0030218, Figure 4E). GATA1 unique genes showed enrichment for heme biosynthetic processes (GO:0006783, Figure 4F). There was a bimodal chromatin occupancy peak distribution among genes bound by both GATA1 and Zfp148/Zfp281with 83 showing exact overlap of the GATA1 and Zfp148/Zfp281 peaks and the remainder being separated by several kilobases (Figure 4G). No statistically significant DNA binding motif enrichment was identified

15 that distinguished these two classes of binding configurations. Together with the physical interaction findings, the overall chromatin occupancy data suggest a cooperative role for both

Zfp281 and Zfp148 in driving a subset of the GATA1 mediated erythroid gene program.

Zfp281 plays a redundant role with Zfp148 in gamma-globin gene regulation

We previously showed that Zfp148 occupies both the alpha- and beta-globin loci in adult erythroid cells and positively regulate their gene expression.10 To examine the functional consequence of depleting both Zfp148 and Zfp281 in globin gene regulation, we first deleted

Zfp148 in K562 cells using CRISPR-Cas9 and confirmed the protein depletion by Western blot

(Figure 5A). Despite trying various guide RNA sequences to disrupt the Zfp281 locus, we were unable to obtain knockout clones. As an alternative approach, lentiviral delivered shRNAs were used to knockdown Zfp281 expression (Figure 5B). Zfp148 knockout cells were then infected with shZfp281c#1 lentivirus to establish K562 cells depleted for both Zfp148 and Zfp281

(Figure 5C). K562 cells express predominantly gamma-globin, and both Zfp148 and Zfp281 occupy a chromatin site ~3 kb upstream of the HBG2 transcriptional start site (TSS) (Figure 5D).

Zfp148 knockout alone led to a modest decrease in gamma-globin mRNA levels (Figure 5E), whereas Zfp281 knockdown by itself had no significant effect (Figure 5E). However, the double depletion of Zfp148 and Zfp281 reduced levels to ~50% lower than Zfp148 knockout by itself, supporting a redundant role for Zfp281 with Zfp148 in regulating gamma-globin gene expression in this cell system.

Cross examination of histone modification marks deposited in ENCODE36 showed an overlap of active histone marks (H3K27ac, H3K4me1, K3K4me2, H3K9ac) and depletion of a repressive

16 mark (H3K27me3) at the Zfp148/Zfp281 occupied peak (Figure 5D), suggesting that both factors act predominantly as mediators of gene activation in this context.

Both Zfp281 and Zfp148 are required for erythroid development

To examine the consequences of combined Zfp148 and Zfp281 loss in vivo, we attempted to generate Zfp281 conditional knockout mice. However, extensive trials failed to produce a clone with the properly targeted allele. This may be related to the high GC content of this locus and its unusual exonic structure (2 exons with a 216 base pair GC-rich intron). Thus, we resorted to using ex vivo differentiation27 of murine fetal liver progenitor cells from Zfp148-/- mice in combination with Zfp281 lentiviral shRNA knockdown.

shRNAs that efficiently knockdown murine Zfp281 in MEL cells were first identified (Figure

6A). Fetal liver cells from WT and Zfp148-/- mice (e12.5-e13.5 d.p.c.) were harvested, cultured in expansion medium for 8 days during which time they were transduced with Zfp281c#3 shRNA or control (shLuc) lentiviral vectors and selected (Figure 6B). The cells were then switched to differentiation medium and analyzed (see Methods). Benzidine staining showed over 60% of fetal liver cells transduced with shLuc became hemoglobinized at 48 hrs (Figure

6C-D). Zfp148 knockout led to a slightly increased percentage of benzidine positive cells in this system and no statistically significant alteration in erythroid maturation based on CD71 and

Ter119 surface expression. Fetal liver cells transduced with the Zfp281 shRNA had a marginally lower percentage of benzidine positive cells, and trends towards higher R2 (CD71highTer119low) and lower R3 (CD71highTer119high) cell populations, indicating a mild perturbation of erythropoiesis (Figure 6C-F). In contrast, when Zfp281 was depleted in Zfp148-/- fetal liver cells, the erythroid maturation became significantly more impaired compared to either knockout

17 or knockdown alone with less than 40% benzidine positive cells, and higher R2 and a significantly lower R3 populations (Figure 6C-F). These data support the model that Zfp148 and

Zfp281 play functionally redundant roles in erythroid maturation.

Discussion

In this study, we uncover a novel role for the Krüppel-type zinc finger transcription factor

Zfp281 in erythroid development and demonstrate that it functionally overlaps with that of its family member Zfp148. We also show that these two factors, likely in combination with other coregulators, associate with GATA1 to regulate genes during erythroid maturation.

Although Zfp281 was initially identified during a screen for Zfp148 gene family members,29 recent studies have focused on its activity in ES cell biology.16,17,20-22,38 Our study demonstrates that Zfp281 also has functional roles in adult tissues, such as the hematopoietic system. To the best of our knowledge, this is the first study to demonstrate that Zfp281 and Zfp148 occupy common chromatin sites and functionally compensate for one another. We also show that both

Zfp148 and Zfp281 physically associate with and occupy a common set of chromatin sites with

GATA1, although we have not yet established whether these interactions are direct.

Interestingly, Zfp281 was recently shown to bind with the GATA family member GATA4 and enhance GATA4 activity in reprograming of cardiac cells.39 We previously showed that Zfp148 interacts with GATA2 and GATA3, in addition to GATA1.9 These findings suggest that

Zfp148/Zfp281 and GATA family transcription factors may cooperate broadly in diverse tissues and cellular contexts.

We previously showed a high correlation between Zfp148 chromatin occupancy and activating histone marks in human erythroid cells.10 In addition, we and others showed that

Zfp148 physically associates with the p30010,40 and the GCN5/Trrap (GNAP) histone acetyltransferases, and that Zfp148 deficiency reduces GCN5 recruitment at selected activated gene loci.10 Our new ChIP-seq data show a predominance of Zfp148 and Zfp281 chromatin occupancy at gene promoters. Analysis of GATA1 occupancy sites of activated versus repressed

19 genes in an estradiol-induced GATA1-ER cell system41,42 also shows high enrichment for

Zfp148/Zfp281 consensus binding motifs within the first intron of GATA1 activated genes (A.

Ghamari, G. Pregernig, E. Fraenkel, and A. Cantor, unpublished observation). Collectively, these data, suggest that Zfp148 and Zfp281 functionally synergize with GATA1 and act predominantly in gene activation during erythroid maturation, likely through mechanisms operating near gene transcription start sites.

Although Zfp148 and Zfp281 are present in a wide array of tissues, their expression was not detected in hCD34+ cells, which represent stem and early multipotent progenitor cells. Both proteins are upregulated during hCD34+ cell erythroid ex vivo differentiation, first becoming detectable at the protein level in early erythroid progenitors (Figure 3C, E and ref. 10). This developmental regulation is consistent with them playing stage-specific roles during erythroid commitment and maturation.

Hematopoietic-specific deletion of Zfp148 causes a hypochromic and microcytic anemia with elevated RBC number. This likely represents a mild thalassemia-like phenotype given our previous data showing that Zfp148 occupies key cis-regulatory elements within the globin locus in primary human erythroid progenitor cells, that Zfp148 shRNA knockdown reduces globin mRNA levels in primary erythroid progenitors, and the new data in this study showing

Zfp148/Zfp281 occupancy upstream of the gamma-globin gene in K562 cells and reduced gamma-globin mRNA transcript levels upon double Zfp148/Zfp281 depletion. This supports a direct role for Zfp148/Zfp281 family transcription factors in globin gene expression. However, while Zfp281 clearly compensates for Zfp148 loss in general, the fact that Zfp148 knockout mice have an erythroid phenotype indicates that Zfp281 by itself is insufficient to completely replace

Zfp148 deficiency. Whether this is because there is a total combined level of Zfp148/Zfp281

20 protein necessary for normal erythropoiesis, or that Zfp148 and Zfp281 have unique biologic properties will require additional study.

Delayed recovery from phenylhydrazine-induced anemia of Vav1-Cre; Zfp148fl/fl mice was observed only in males. The etiology of this remains unclear. Testosterone facilitates erythropoiesis by inducing erythropoietin expression, however glucocorticoids counteract this effect.43-45 The glucocorticoid receptor synergizes with hypoxia response genes to rapidly expand erythroid progenitor cell populations during stress erythropoiesis.46,47 Zfp281 occupied target genes are enriched for hypoxia response (GO:0001666, Supplemental Figure 7C). Thus, it is possible that in the absence of Zfp148, an altered Zfp281 mediated hypoxia response impacts the testosterone-erythropoietin axis. Since GATA1 is X-linked and Zfp148 controls GATA1 expression,48 another possibility is that females are able to epigenetically compensate for Zfp148 loss in ways not possible in males. Future in vivo studies will be needed to clarify these mechanisms.

Our study also reports a novel Zfp148 conditional knockout mouse model. Although our targeting strategy deletes more coding region than the model previously described by Takeuchi et al.,11 including the entire DNA binding region, we did not observe the primordial germ cell development defects and infertility described in heterozygous mice in that report. One possible explanation for this discrepancy is that the residual Zfp148 protein containing DNA binding generated in the earlier report may have neomorphic effects. Introduction of nonsense mutations or premature termination codons in the last exon of genes increases the chance of nonsense- mediated mRNA decay escape, generating a C-terminal truncated protein.49,50 In support of this notion, various truncating de novo heterozygous mutations in exon 9 of Zfp148 have been described recently in humans.51 These are associated with pleiotropic developmental

21 abnormalities, suggesting possible dominant-negative or gain-of-function effects of the truncated

Zfp148 protein.

The cause of death in Zfp148-/- neonates remains unclear. Pulmonary defects in some neonates from a gene-trap mouse strain have been previously described,52 however these were not observed in our Zfp148-/- neonates (Supplemental Figure 3). We did find a requirement for

Zfp148 in regulating glucose metabolism and growth, consistent with previous reports of Zfp148 controlling the growth hormone gene53. However, the observed phenotype was transient.

Recently described symptoms commonly associated with de novo mutations in exon 9 of Zfp148 in humans include mild to moderate developmental delay, short stature and feeding problems.

Further study will be required to fully understand the mechanisms of perinatal lethality of

Zfp148-/- mice. It is of interest to note the strong genetic background effect on the Zfp148 knockout phenotype. This implies that genetic modifiers significantly influence Zfp148 activity.

In summary, this study adds Zfp281 to the network of known transcription factors involved in erythroid differentiation and globin regulation. It also provides evidence for the potential cooperative role of Zfp148/Zfp281 family transcription factors in GATA1-mediated gene control.

Acknowledgements

The authors thank Yuko Fujiwara for assistance in generating Zfp148 gene targeted mice, Rod

Bronson for rodent pathology, Jonathan Snow and Ronald Mathieu for flow cytometry assistance. A.J.W. is supported by the Royal Perth hospital Medical Research Foundation,

Cancer Council of Western Australia (WA), Department of Health, Government of WA and the

Ride to Conquer Cancer, Perth. A.B.C. is supported by a grant from the National Institutes of

Health (P01 HL32262-30).

Authorship Contributions

Contribution: A.J.W., C.A.P., A.G., G.P., D.Y., K.Z., T.P., M.H., J.K.L., G.C. and J-H.L. performed the experiments and analyzed the data. J.Y.W., M.F., P.J.L, J.W. and E.F. provided key materials and analyzed the data. J.W. edited the manuscript. A.J.W. and A.B.C. designed the experiments, analyzed the data and wrote the manuscript.

Disclosure of Conflicts of Interest

The authors declare no competing financial interests.

References

1. Katsumura KR, Bresnick EH, Group GFM. The GATA factor revolution in hematology. Blood. 2017;129(15):2092-2102.

2. Yu M, Riva L, Xie H, et al. Insights into GATA-1-mediated gene activation versus repression via genome-wide chromatin occupancy analysis. Mol Cell. 2009;36(4):682-695.

3. Cantor AB, Orkin SH. Transcriptional regulation of erythropoiesis: an affair involving multiple partners. Oncogene. 2002;21(21):3368-3376.

4. Fujiwara Y, Browne CP, Cunniff K, Goff SC, Orkin SH. Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA-1. Proc Natl Acad Sci U S A. 1996;93(22):12355-12358.

5. Pevny L, Lin CS, D'Agati V, Simon MC, Orkin SH, Costantini F. Development of hematopoietic cells lacking transcription factor GATA-1. Development. 1995;121(1):163-172.

6. Iwasaki H, Mizuno S, Wells RA, Cantor AB, Watanabe S, Akashi K. GATA-1 converts lymphoid and myelomonocytic progenitors into the megakaryocyte/erythrocyte lineages. Immunity. 2003;19(3):451-462.

7. Kulessa H, Frampton J, Graf T. GATA-1 reprograms avian myelomonocytic cell lines into eosinophils, thromboblasts, and erythroblasts. Genes Dev. 1995;9(10):1250-1262.

8. Capellera-Garcia S, Pulecio J, Dhulipala K, et al. Defining the Minimal Factors Required for Erythropoiesis through Direct Lineage Conversion. Cell Rep. 2016;15(11):2550-2562.

9. Woo AJ, Moran TB, Schindler YL, et al. Identification of ZBP-89 as a novel GATA-1- associated transcription factor involved in megakaryocytic and erythroid development. Mol Cell Biol. 2008;28(8):2675-2689.

10. Woo AJ, Kim J, Xu J, Huang H, Cantor AB. Role of ZBP-89 in human globin gene regulation and erythroid differentiation. Blood. 2011;118(13):3684-3693.

11. Takeuchi A, Mishina Y, Miyaishi O, Kojima E, Hasegawa T, Isobe K. Heterozygosity with respect to Zfp148 causes complete loss of fetal germ cells during mouse embryogenesis. Nat Genet. 2003;33(2):172-176.

12. Li X, Romain RD, Park D, Scadden DT, Merchant JL, Arnaout MA. Stress hematopoiesis is regulated by the Kruppel-like transcription factor ZBP-89. Stem Cells. 2014;32(3):791-801.

13. Essien BE, Grasberger H, Romain RD, et al. ZBP-89 regulates expression of tryptophan hydroxylase I and mucosal defense against Salmonella typhimurium in mice. Gastroenterology. 2013;144(7):1466-1477, 1477 e1461-1469.

14. Lisowsky T, Polosa PL, Sagliano A, Roberti M, Gadaleta MN, Cantatore P. Identification of human GC-box-binding zinc finger protein, a new Kruppel-like zinc finger protein, by the yeast one-hybrid screening with a GC-rich target sequence. FEBS Lett. 1999;453(3):369-374.

15. Wang ZX, Teh CH, Chan CM, et al. The transcription factor Zfp281 controls embryonic stem cell pluripotency by direct activation and repression of target genes. Stem Cells. 2008;26(11):2791-2799.

16. Kim J, Chu J, Shen X, Wang J, Orkin SH. An extended transcriptional network for pluripotency of embryonic stem cells. Cell. 2008;132(6):1049-1061.

17. Wang J, Rao S, Chu J, et al. A protein interaction network for pluripotency of embryonic stem cells. Nature. 2006;444(7117):364-368.

18. Wei CL, Miura T, Robson P, et al. Transcriptome profiling of human and murine ESCs identifies divergent paths required to maintain the stem cell state. Stem Cells. 2005;23(2):166- 185.

19. Brandenberger R, Wei H, Zhang S, et al. Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation. Nat Biotechnol. 2004;22(6):707-716.

20. Huang X, Balmer S, Yang F, et al. Zfp281 is essential for mouse epiblast maturation through transcriptional and epigenetic control of Nodal signaling. Elife. 2017;6.

21. Fidalgo M, Huang X, Guallar D, et al. Zfp281 Coordinates Opposing Functions of Tet1 and Tet2 in Pluripotent States. Cell Stem Cell. 2016;19(3):355-369.

22. Fidalgo M, Shekar PC, Ang YS, Fujiwara Y, Orkin SH, Wang J. Zfp281 functions as a transcriptional repressor for pluripotency of mouse embryonic stem cells. Stem Cells. 2011;29(11):1705-1716.

23. van der Weyden L, Adams DJ, Harris LW, Tannahill D, Arends MJ, Bradley A. Null and conditional semaphorin 3B alleles using a flexible puroDeltatk loxP/FRT vector. Genesis. 2005;41(4):171-178.

24. Georgiades P, Ogilvy S, Duval H, et al. VavCre transgenic mice: a tool for mutagenesis in hematopoietic and endothelial lineages. Genesis. 2002;34(4):251-256.

25. Katz SG, Cantor AB, Orkin SH. Interaction between FOG-1 and the corepressor C- terminal binding protein is dispensable for normal erythropoiesis in vivo. Mol Cell Biol. 2002;22(9):3121-3128.

26. Mao X, Fujiwara Y, Orkin SH. Improved reporter strain for monitoring Cre recombinase- mediated DNA excisions in mice. Proc Natl Acad Sci U S A. 1999;96(9):5037-5042.

27. Dolznig H, Kolbus A, Leberbauer C, et al. Expansion and Differentiation of Immature Mouse and Human Hematopoietic Progenitors. In: Baron MH, ed. Developmental Hematopoiesis: Methods and Protocols. Totowa, NJ: Humana Press; 2005:323-343.

28. Cantor AB, Katz SG, Orkin SH. Distinct domains of the GATA-1 cofactor FOG-1 differentially influence erythroid versus megakaryocytic maturation. Mol Cell Biol. 2002;22(12):4268-4279.

29. Law DJ, Du M, Law GL, Merchant JL. ZBP-99 defines a conserved family of transcription factors and regulates ornithine decarboxylase gene expression. Biochem Biophys Res Commun. 1999;262(1):113-120.

30. Wang Y, Shen Y, Dai Q, et al. A permissive chromatin state regulated by ZFP281-AFF3 in controlling the imprinted Meg3 polycistron. Nucleic Acids Res. 2016.

31. Merryweather-Clarke AT, Atzberger A, Soneji S, et al. Global gene expression analysis of human erythroid progenitors. Blood. 2011;117(13):e96-108.

32. An X, Schulz VP, Li J, et al. Global transcriptome analyses of human and murine terminal erythroid differentiation. Blood. 2014;123(22):3466-3477.

33. Gautier EF, Ducamp S, Leduc M, et al. Comprehensive Proteomic Analysis of Human Erythropoiesis. Cell Rep. 2016;16(5):1470-1484.

34. Kim J, Cantor AB, Orkin SH, Wang J. Use of in vivo biotinylation to study protein- protein and protein-DNA interactions in mouse embryonic stem cells. Nat Protoc. 2009;4(4):506-517.

35. Wang Y, Shen Y, Dai Q, et al. A permissive chromatin state regulated by ZFP281-AFF3 in controlling the imprinted Meg3 polycistron. Nucleic Acids Res. 2017;45(3):1177-1185.

36. Consortium EP. An integrated encyclopedia of DNA elements in the human genome. Nature. 2012;489(7414):57-74.

37. Dickinson ME, Flenniken AM, Ji X, et al. High-throughput discovery of novel developmental phenotypes. Nature. 2016;537(7621):508-514.

38. Fidalgo M, Faiola F, Pereira CF, et al. Zfp281 mediates Nanog autorepression through recruitment of the NuRD complex and inhibits somatic cell reprogramming. Proc Natl Acad Sci U S A. 2012;109(40):16202-16207.

39. Zhou H, Morales MG, Hashimoto H, et al. ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression. Genes Dev. 2017;31(17):1770-1783.

40. Bai L, Merchant JL. Transcription factor ZBP-89 cooperates with histone acetyltransferase p300 during butyrate activation of p21waf1 transcription in human cells. J Biol Chem. 2000;275(39):30725-30733.

41. Gregory T, Yu C, Ma A, Orkin SH, Blobel GA, Weiss MJ. GATA-1 and erythropoietin cooperate to promote erythroid cell survival by regulating bcl-xL expression. Blood. 1999;94(1):87-96.

42. Weiss MJ, Yu C, Orkin SH. Erythroid-cell-specific properties of transcription factor GATA-1 revealed by phenotypic rescue of a gene-targeted cell line. Mol Cell Biol. 1997;17(3):1642-1651.

43. Bachman E, Travison TG, Basaria S, et al. Testosterone induces erythrocytosis via increased erythropoietin and suppressed hepcidin: evidence for a new erythropoietin/hemoglobin set point. J Gerontol A Biol Sci Med Sci. 2014;69(6):725-735.

44. Morrison D, Capewell S, Reynolds SP, et al. Testosterone Levels during Systemic and Inhaled Corticosteroid-Therapy. Respiratory Medicine. 1994;88(9):659-663.

45. MacAdams MR, White RH, Chipps BE. Reduction of serum testosterone levels during chronic glucocorticoid therapy. Ann Intern Med. 1986;104(5):648-651.

46. Flygare J, Rayon Estrada V, Shin C, Gupta S, Lodish HF. HIF1alpha synergizes with glucocorticoids to promote BFU-E progenitor self-renewal. Blood. 2011;117(12):3435-3444.

47. Bauer A, Tronche F, Wessely O, et al. The glucocorticoid receptor is required for stress erythropoiesis. Genes Dev. 1999;13(22):2996-3002.

48. Ohneda K, Ohmori S, Ishijima Y, Nakano M, Yamamoto M. Characterization of a functional ZBP-89 binding site that mediates Gata1 gene expression during hematopoietic development. J Biol Chem. 2009;284(44):30187-30199.

49. Popp MW, Maquat LE. Organizing principles of mammalian nonsense-mediated mRNA decay. Annu Rev Genet. 2013;47:139-165.

50. Hentze MW, Kulozik AE. A perfect message: RNA surveillance and nonsense-mediated decay. Cell. 1999;96(3):307-310.

51. Stevens SJ, van Essen AJ, van Ravenswaaij CM, et al. Truncating de novo mutations in the Kruppel-type zinc-finger gene ZNF148 in patients with corpus callosum defects, developmental delay, short stature, and dysmorphisms. Genome Med. 2016;8(1):131.

52. Sayin VI, Nilton A, Ibrahim MX, et al. Zfp148 deficiency causes lung maturation defects and lethality in newborn mice that are rescued by deletion of p53 or antioxidant treatment. PLoS One. 2013;8(2):e55720.

53. Xu Q, Springer L, Merchant JL, Jiang H. Identification of zinc finger binding protein 89 (ZBP-89) as a transcriptional activator for a major bovine growth hormone receptor promoter. Mol Cell Endocrinol. 2006;251(1-2):88-95.

54. Taniuchi T, Mortensen ER, Ferguson A, Greenson J, Merchant JL. Overexpression of ZBP-89, a zinc finger DNA binding protein, in gastric cancer. Biochem Biophys Res Commun. 1997;233(1):154-160.

55. Machanick P, Bailey TL. MEME-ChIP: motif analysis of large DNA datasets. Bioinformatics. 2011;27(12):1696-1697.

Tables

Table 1. Percentage of surviving mice by genotype following breeding of Zfp148+/- parents on a pure C57BL/6 genetic background.

Figure Legends

Figure 1. Gene targeting of Zfp148 locus. (A) Schematic diagram of the Zfp148 locus and gene targeting strategy, showing the Zfp148 allele with short Flippase recognition target (frt, F) and

Cre recombinase recognition target (LoxP, L). (B) Diagram of the Zfp148 protein in wild-type

(WT) and null allele showing more than 80% deletion including all four zinc finger domains.

Western blot analysis of protein extracts from e14.5 WT, Zfp148+/- and Zfp148-/- whole embryos on mixed genetic background strains using two independent anti-Zfp148 antibodies from Woo et al.9 in “D” and Taniuchi et al.54 in “E”. The epitope used to generate the antibodies is indicated on the schematic diagrams. (F) Photographs of representative Zfp148 conventional KO e18.5 embryos (upper panel) and p14.5 (bottom panel) neonates on mixed C57BL/6, CD-1, and 129/Sv genetic background showing the runted post-natal phenotype. (G) Survival curves of Zfp148

WT (n=14), Zfp148+/- (n=21) and Zfp148-/- (n=11) mice over first 6 weeks of life. A significant difference in survival curve is observed between WT and Zfp148-/- (Mantel-Cox Log-rank p=0.0319) while the WT and Zfp148+/- is not significant (Log-rank p=ns). (H) Growth curves of male WT (n=5), Zfp148+/- (n=7) and Zfp148-/- (n=3) on the left panel, and female WT (n=8),

Zfp148+/- (n=11) and Zfp148-/- (n=6) mice on the right panel over first 6 weeks of life. Growth of both female and male Zfp148-/- mice are significantly delayed compared to WT (two-tailed paired T-test p<0.05).

Figure 2. Defective erythropoiesis in mice with pan-hematopoietic Zfp148 deletion. (A-C)

Peripheral blood counts and indices from Zfp148fl/fl and Vav1-Cre; Zfp148fl/fl mice at 15-26 weeks of age. Abbreviation: Hemoglobin, Hgb; Mean Cell Volume, MCV; Mean Cell

Hemoglobin, MCH and Red Blood Cell, RBC. (D) Representative flow cytometric analysis profiles of bone marrow for erythroid progenitor maturation using anti-CD71 and anti-Ter119 antibodies in Zfp148fl/fl and Vav1-Cre; Zfp148fl/fl mice. (E) Dot plots depicting the percentage of live BM cells in non- and early erythroid cells (CD71- Ter119-), late proerythroblasts CD71+

Ter119-), early erythroid cells (CD71+ Ter119+) and RBCs (CD71- Ter119+) from the flow analysis “D” (n=5). (F-G) Representative flow cytometric analysis profile for spleen as in “D” and “E”. (H-I) Recovery from phenylhydrazine-induced hemolytic anemia in male (n=8) and female (n=12) mice. Spun hematocrit levels from zfp148fl/fl; Vav1-Cre and Zfp148fl/fl control littermates preceding and following a 2-day course of phenylhydrazine intraperitoneal injection.

A baseline spun hematocrit was obtained prior to phenylhydrazine injection and then repeated on days 3, 4, 5, 6 and/or 7 following initial injection.

Figure 3. Zfp281 expression and physical interaction with GATA1 in erythroid cells. (A) qRT-

PCR analysis showing Zfp148 and Zfp281 mRNA levels relative to Gapdh in C57BL/6 mouse tissues. (B) Heatmap of Zfp148 and Zfp281 mRNA levels in flow cytometric sorted erythroid progenitor cells from ex vivo differentiated peripheral blood mononuclear cell (GSE22552)31 (left panel) and CD34+ cord blood cells (GSE53983)32 (right panel). (C) Heatmap showing mean copy number of Zfp148 and Zfp281 protein per erythroid progenitor cell, determined by mass spectrometry-based absolute quantification approach (PXD004313, PXD004314, PXD004315 and PXD004316).33 Following the expansion of cord blood CD34+ cells, CD36+ progenitors were flow-sorted and differentiated ex vivo under erythroid conditions. Erythroid Prog1 and 2 equates to BFU-E and CFU-E cells respectably.33 (D) Western blot analysis of Zfp281 protein in major hematopoietic organs, spleen (Sp), bone marrow (BM) and thymus (Th) in mice. (E)

Western blot showing Zfp281 protein levels during erythroid ex vivo differentiation of hCD34+ cells. (F) Western blot analysis following streptavidin affinity purification (SA-IP) from nuclear extracts of MEL cells stably expressing Bir A alone or Bir A and recombinant GATA1 containing an amino terminal FLAG and BirA recognition motif (FB-GATA1). 2% of the input material is shown. (G) Western blot analysis following SA-IP from nuclear extracts of K562 cells stably expressing Bir A alone or Bir A and recombinant FB-Zfp148. 2% of the input material is shown. (H) Western blot analysis following SA-IP from nuclear extracts of K562 cells stably expressing Bir A or Bir A and recombinant FB-Zfp281. 2% of the input material is shown.

Figure 4. Common gene targets of Zfp148 and Zfp281 in erythroid cells. (A) Venn diagram showing the overlap of Zfp148 and Zfp281 chromatin occupancy peaks (left panel). MEME-

ChIP motif analysis55 result showing three representative motifs for unique and common peaks

(right panel). (B) Pie graphs showing the distribution of chromatin occupancy peak location.

Abbreviation: UTRs, untranslated regions. (C) Venn diagram showing the number of genes commonly occupied by Zfp148, Zfp281 and/or GATA1. (D) GO term analysis of the 658 target genes common to Zfp148 and Zfp281, but devoid of GATA1. (E) GO term analysis of the 245 target genes common to GATA1 and Zfp148 and/or Zfp281. (F) GO term analysis of the 534 genes unique to GATA1. GO term analysis of unique Zfp148 and Zfp281 target genes are shown in Supplemental Figure 8. G) Distribution of Zfp148/Zfp281 peaks with respect to

GATA1 peaks at the 245 commonly occupied genes.

Figure 5. Redundant roles of Zfp281 and Zfp148 in gamma-globin gene expression in K562 cells. (A) Western blot showing knockout (KO) of Zfp148 in K562 cells by CRISPR/Cas9. (B)

Western blot showing knockdown (KD) of Zfp281 protein levels in K562 cells using lentiviral transduction of shRNA constructs c#1 and c#2. A lentiviral shRNA against luciferase (shLuc) is shown as a control. (C) Western blot showing Zfp148 and Zfp281 protein levels in Zfp148 KO cells or control cells transduced with shZfp281c#1 or shLuc. (D) Representative BioChIP-seq signals at the gamma-globin locus in hemin-induced K562 cells expressing Bir A alone or Bir A and BioZfp148 or BioZfp281. Peak calls for H3K27ac, H3K27me3, H3K4me1, H3K4me2,

H3K4me3, and H3K9ac from ENCODE36 are indicated. (E) Quantitative RT-PCR analysis of gamma-globin mRNA transcripts from cells in “C”. The levels were normalized to GAPDH mRNA transcript levels and are shown relative to the Zfp148 WT and shLuc control.

Figure 6. Redundant roles of Zfp148 and Zfp281 in primary murine fetal liver erythroid cells.

(A) Western blot showing knockdown of murine Zfp281 protein levels in MEL cells transduced with lentiviral shRNA constructs shZfp281c#3, zhZfp281c#4 and shLuc. (B) Schematic diagram showing an experimental timeline of ex vivo culture, lentiviral transduction, and puromycin selection of fetal liver cells. (C) Representative benzidine stains of cytospun cells from murine e12.5-e13.5 d.p.c. Zfp148-/- or WT (littermates) fetal liver cells transduced with the indicated shRNA lentiviruses, selected with puromycin, and ex vivo differentiated into erythroid cells (8 days in expansion medium followed by 48 hours in differentiation medium; see Methods). (D)

Bar graph shows blinded benzidine counts from five biologic replicates of cultures in “C”. (E-F)

Representative CD71/Ter119 flow cytometric plots and quantitation of the cultures in “C”. Each

33 plot shows the percentage of R1 to R5 populations in five biological replicates. *p<0.05,

**p<0.01.

Woo et al. Figure 1

A 1 2 3 4 5 6 7 8 9 B 4 x zf PEST C WT f/+ f/f -/- ATG TAA WT 794 aa Zfp148 WT -/- 153 aa Null flox pFlexible Zfp148 Vector L F puro∆tk F L >80% deletion WT PmeI AscI PacI NotI Zfp148 frt L F puro∆tk F L D WT +/- -/- E WT +/- -/- Zfp148 loxP L F L kDa kDa Zfp148 -/- L 225 225 Frame shift mutation introduced stop “TGA” TAA 150 150 WT Zfp148+/- Zfp148-/- F G 102 zfp148 102 zfp148 non- 100 76 76 specific p=ns l (%)

a 80 52 52 v i e18.5 v 38 38 r 60 u WT p=0.0319 s

31 31 t 40 +/- n Zfp148 e

c -/- r 20 Zfp148 e β-actin 38 β-actin P 38 0 0 10 20 30 40 1 zinc fingers 794 1 zinc fingers 794

p14.5 Days

α-Zfp148 epitope N1-521 α-Zfp148 epitope N1-14

H WT Zfp148+/- Zfp148-/-

30 Male 30 Female ) g (

t 20 20 h g i e

W 10 p<0.05 10 p<0.05

0 0 7 14 21 28 35 42 7 14 21 28 35 42 Days Days Woo et al. Figure 2

A p<0.01 p<0.01 p<0.01 p<0.01 B p<0.01 C p=0.07 15 55 18 10 4000 15 9

14 9 50 16 12 3000 13 9 10 45 14 12 (x10 /L) 2000 C

11 40 12 B 8 5 WBC (x10 /L) Hgb (g/dL) MCV (fL/cell) MCH (pg/cell) R 1000 Platelet (x10 /L) 0 0 0 0 0 0 Zfp148 f/f f/f f/f f/f f/f f/f f/f f/f Zfp148 f/f f/f Zfp148 f/f f/f Vav1-Cre Vav1-Cre Vav1-Cre

D Bone marrow E Bone marrow f/f f/f Zfp148 Vav1-Cre; Zfp148 CD71- Ter119- CD71+ Ter119- CD71+ Ter119+ CD71- Ter119+ 15.8 16.9 26.1 15.7 100 30 30 30 ) %

( 80 p<0.05 s

l 20 20 20 l 60 p<0.05 e c

e 40 p<0.01 l 10 10 10 b a

i 20 V 0 0 0 0 59.2 8.09 51.5 6.68 Zfp148 f/f f/f f/f f/f f/f f/f f/f f/f CD71 Vav1-Cre Ter119

F Spleen G Spleen Zfp148f/f Vav1-Cre; Zfp148f/f CD71- Ter119- CD71+ Ter119- CD71+ Ter119+ CD71- Ter119+

) 100 30 30 30 8.38 3.66 20.9 3.97 p<0.05 %

( 80

s l

l 20 20 20 60 e c

e 40 l 10 10 10 b a i 20 p<0.01 V 0 0 0 0

79.0 8.5 66.7 8.39 Zfp148 f/f f/f f/f f/f f/f f/f f/f f/f CD71 Vav1-Cre Ter119

H Male I Female 50 50 PHZ p<0.05 PHZ 40 40 30 30 20 20 f/f f/f Hematocrit (%) 10 Zfp148 Hematocrit (%) 10 Zfp148 Vav1-Cre; Zfp148f/f Vav1-Cre; Zfp148f/f 0 0 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 Days post PHZ injection Days post PHZ injection Woo et al. Figure 3

A B Zfp148 0.06 Zfp281

0.04

CFU- Erythroid Pro- erythroblast Intermediate Erythroblast Late Erythroblast 10 Pro Erythroblast Early Basophilic Late Basophilic Poly- chromatic Ortho- chromatic 8

0.02 Zfp148 Zfp281 6 0

GSE22552 GSE53983

Relative mRNA expression Relative mRNA 0.00 t in r e e is g y n w s a a in in t n e e o u r e t t s u n le rr m B H s s e L id p a y te te T K S h n n M T I I e g n m L o S B C D Sp BM Th F Input SA-IP kDa bir A Zfp281 100 FB-GATA1 Gapdh kDa 37 100 Zfp148

Zfp281 Erythroid Prog1 Erythroid Prog2 Proerythroblast Basophilic 1 Basophilic 2 Polychromatic Orthochromatic 5000 E Days of differentiation 100 Zfp148 0 2 4 6 8 kDa non-specific 150 Zfpm1 0 Zfp281 Zfp281 100 PXD004313, PXD004314, 50 β-Actin PXD004315, PXD004316

G Input SA-IP H Input SA-IP bir A bir A FB-Zfp148 FB-Zfp281 Bio Bio kDa Zfp148 kDa Zfp281 100 100

50 GATA1 50 GATA1 Woo et al. Figure 4

A Zfp148 CentriMo E-value 2.5e-106 CentriMo E-value 9.7e-089 CentriMo E-value 1.1e-088 Zfp148 3189 unique CentriMo E-value 5.9e-058 DREME E-value 2.7e-055 CentriMo E-value 2.5e-048 3008 Common

1747 Zfp281 DREME E-value 7.4e-025 CentriMo E-value 1.9e-024 CentriMo E-value 1.2e-018 unqiue Zfp281

B 2% 2% 1%

UTRs 24% 24% 24% Distal Intergenic Downstream (<3kb) 50% 47% 51% 1% 1% 1% Exon 21% 23% 20% 3% Intron 3% 3% Promoter (<5kb)

Zfp148 unique Zfp281 unique Common

C Zfp148 unqiue D Common to Zfp148 and Zfp281 Common to Zfp148 negative reg. of transcription RNA pol II promoter & Zfp281 transcription, DNA-templated 1107 regulation of transcription, DNA-templated positive reg. of transcription RNA pol II promoter 658 positive reg. of transcription, DNA-templated 543 negative reg. of transcription, DNA-templated transcription from RNA polymerase II promoter 245 Zfp281 unique covalent chromatin modification regulation of mRNA splicing, via spliceosome 534 intracellular estrogen receptor signaling pathway GATA1 unique Common with GATA1 0 5 10 15 20 -log10 (p value)

E Common with GATA1 F Unique to GATA1 positive reg. of transcription, DNA-templated heme biosynthetic process erythrocyte differentiation protoporphyrinogen IX biosynthetic process brain development apoptotic process actin cytoskeleton organization cellular response to amino acid starvation viral entry into host cell protein N-linked glycosylation via asparagine embryonic organ development homeostasis of number of cells within a tissue cellular response to hypoxia regulation of autophagosome assembly membrane assembly in embryonic body programmed cell death peptidyl-tyrosine autophosphorylation cellular response to hypoxia positive regulation of GTPase activity sialylation 0 1 2 3 4 5 0 2 4 6 -log10 (p value) -log10 (p value) G 80

60 eaks

20 Number of P

0 0 2 4 6 Distance to nearest GATA1 peak (log10 bps) Woo et al. Figure 5

A B C Zfp148 WT KO WT KO shLuc shZfp281 kDa Zfp148 K562 Zfp148 KO K562 shLuc shZfp281c#1shZfp281c#2 100 kDa kDa 100 Zfp148 Zfp281 Zfp281 100 100 37 GAPDH 37 GAPDH 37 GAPDH

D Scale 5 kb hg19 E chr11: 5,270,000 5,275,000 5,280,000 HBG _ 50 p<0.01 1.0 Zfp148 1 _ 50 0.5 Zfp281 1 _ 50

Relative Expression 0.0 BirA Zfp148 WT KO WT KO 1 shLuc HBG1 HBG2 HBG2 shZfp281 K562 H3K27ac K562 H3K27me3 K562 H3K4me1 K562 H3K4me2 K562 H3K4me3 K562 H3K9ac Woo et al. Figure 6

A B Puromycin Lentivirus Selection 24 hr 48 hr Fetal Liver Cells Mock shLuc shZfp281c#3shZfp281c#4 (e12.5-e13.5) non-specific 0 1 2 3 4 5 6 7 8 9 10 days Zfp281 Expansion medium Differentiation medium -/- -/- C WT + shLuc Zfp148 + shLuc WT + shZfp281 Zfp148 + shZfp281

-/- -/- D 100 E WT + shLuc Zfp148 + shLuc WT + shZfp281 Zfp148 + shZfp281 * * ** 80 R2 R3 50.5 56.7 9.93 73.0 15.1 85.1 3.62 60 24.4 40 11.2 9.65 24.7 3.49 6.52 3.18 8.57 1.08 20 R1 R4 Benzidine positive cells (%) 0 0.45 0.2 0.27 0.10 Zfp148 WT KO WT KO CD71 R5 shLuc shZfp281 Ter119

F R1 R2 R3 R4 R5

) 100 40 25 10

% 30 ( 75 30 20 8 s l l

e 20 * 15 6 c 50 20

e 10 4 l

b 10

a 25 10 i p=0.09 5 2 V 0 0 0 0 0 Zfp148 WT KO WT KO WT KO WT KO WT KO WT KO WT KO WT KO WT KO WT KO shLuc shZfp281 Supplemental Methods

Zfp148 cKO mouse strain generation

Analysis of splice donor-acceptor sites predicts that deletion of exons 6 and 7 of Zfp148 causes a frameshift mutation and introduces a premature translation termination codon (PTC)

“TGA” in exon 8, resulting in the removal of over 80% of the coding region, including all C2H2 zinc finger DNA binding domains. Genomic DNA from CJ9 (129/Sv) mouse ES cells were used as a template and high-fidelity long-range PCR was used to amplify the targeting arms of a targeting vector, pFlexible. The vector was constructed to carry a neomycin-delta thymidine kinase (Neo-delta-TK) fusion gene flanked with two FRT sites and a loxP site 3’of exon 7. A single loxP site was placed within the intron between exon 5 and exon 6. High-fidelity, long- range PCR amplified the homology arms from murine 129sv embryonic stem cell genomic

DNA. The short homology arm 3’of frt-NeoDTK-frt-loxP was 2.3 kb. The long homology arm

5’ of the single loxP site was 6 kb. The conditional homology arm between the single loxP site and frt-NeoDTK-frt-loxP, which includes exons 6 and 7, was 2.2 kb. All targeting arms cloned into the vector are sequence verified.

The Zfp148 targeting construct (pFlexible Zfp148) was linearized and electroporated into

CJ9 (129/Sv) ES cells. After the positive selection of ES cells with G418 and negative selection in gancyclovir, individual colonies of ES cell clones were collected and analyzed for homologous recombination by Southern blot. Presence of 5’ single loxP site in the positive ES clones was confirmed by PCR. The Neo-DTK cassette was removed in vitro by transfecting with flip recombinase. After karyotyping, a single targeted ES cell clone was injected into

C57BL/6 blastocysts to generate chimeric mice heterozygous for the Zfp148 targeted allele.

Germline transmission of the Zfp148 loxP allele was confirmed in F1 mice. These were

1 subsequently backcrossed to C57BL/6 strain for more than 10 generations to achieve pure background then inbred to generate Zfp148 loxP homozygous mice (Zfp148f/f).

Glucose Level Measurements

Overnight fasted mice were tail bled and blood glucose levels were determined with a

LifeScan One Touch glucometer.

Antibodies and reagents

Following antibodies and reagents were purchased from commercial sources: Zfp281 (A303-

118A, Bethyl Laboratories Inc; ab101318, Abcam Inc), Zfpm1 (sc-9362, Santa Cruz

Biotechnology Inc.), GATA-1 (HPA000233, Sigma-Aldrich), GAPDH (sc-25778, Santa Cruz

Biotechnology Inc.) and Beta-ACTIN (A2228, Sigma-Aldrich). Following reagents are purchased from BD Pharmingen™; CD-71 FITC (553266), Ter-119 APC (561033) and 7-AAD

(559925).

Human Zfp281 cDNA.

Human Zfp281 cDNA was synthesized (GeneScript) with thymine to cytosine mutations at two locations 402 bp and 1872 bp, and a cytosine to guanine mutation at 1260 bp from the start of cDNA. These are silent mutations that remove two BamHI and AgeI restriction digest enzyme sites respectively and do not change the amino acid sequences.

Cell Culture

K562 and MEL cells were cultured in RPMI with 10% FCS, 2mM Glutamine and 2%

2 penicillin-streptomycin (P/S). The cells were incubated at 37°C with 5% CO2 air atmosphere and maintained at 0.2 to 1 x 106 cells/mL density. Primary hCD34+ cells were obtained from the

Yale Center of Excellence and were from G-CSF-mobilized peripheral blood of de-identified donors. The hCD34+ cells were shipped frozen in aliquots of 2 x 106 cells per vial. The frozen vials were thawed in a 37°C water bath with gentle agitation. The vial contents were washed in

10-20 x volumes of StemSpan SFEM medium (09650, StemCell Technologies) medium by centrifuging at 125 x g for 5 minutes. The resuspended hCD34+ cells were expanded for 6 days in StemSpan SFEM medium with 1xCC100 cytokine mix (02690, StemCell Technologies),

2mM Glutamine and 2% P/S. Next, expanded hCD34+ cells were reseeded into erythroid differentiation medium (StemSpan SFEM medium with 20 ng/mL SCF, 1 U/mL erythropoietin,

5 ng/mL IL-3, 2 µM dexamethasone, 1mM Glutamine, 2% P/S and 1 µM b-estradiol) and

cultured for 8 additional days. During the culture, the cells were incubated at 37°C (5% CO2) and the media was completely changed every 2-3 days to maintain the cell density at 0.2-1 x 106 cells/mL.

Co-immunoprecipitation (Co-IP) assays

A total of 1 to 5 mg of nuclear extract (NE) protein were prepared from K562 or MEL cells expressing biotinylated Zfp148, Zfp281 or GATA-1. The NE protein is supplemented with ethidium bromide (50 µg/mL) then incubated with streptavidin-agarose beads (20347, Thermo) for 2 hours to overnight at 4°C with gentle continuous tube rotation. The beads were subsequently washed four times. Each wash was for 20 minutes at 4°C with gentle continuous tube rotation in PBS containing 0.5% of IGEPAL® CA-630 (I8896, Sigma). After each wash the beads were centrifuged at 300 x g for 5 minutes at 4°C. Final bound protein complexes were

3 eluted by boiling in Laemmli SDS loading buffer. The eluates and 2% of the input material were loaded into each lane of an SDS-polyacrylamide gel for Western blot analysis.

Chromatin immunoprecipitation (ChIP) assay

The K562 cells were maintained at 0.2 to 1 x 106 cells/mL density. Cultured cells were cross- linked with 1% formaldehyde for 10 minutes at room temperature with constant rocking and quenched in 125mM glycine. For each ChIP reaction approximately 75 x 106 cells were used.

The cells were washed in PBS containing 1/1000 dilution of protease inhibitor (P8340, Sigma) and then lysed, first by incubating in PIPES lysis buffer (5mM PIPES pH 8.0, 85 mM KCL and

0.5% IGEPAL® CA-630) for 10 minutes, followed by 300 x g 5min centrifuge to pellet the nuclei.

The nuclei pellet was lysed by resuspending in SDS lysis buffer (1% SDS, 10mM EDTA, 50mM

Tris-HCL pH 8.0). The genomic DNA was sonicated to 200 to 1000 bps using Covaris m220 sonicator in 130 µL volume AFA microtubes (Covaris). The sonication parameters were set to peak power 50W, duty factor 20%, cycle/bust at 200 and treatment time 800 and the temperature set to 4°C. The sonicated lysates were centrifuged at 14000 x g for 5 minutes to remove cell debris. The supernatant was diluted to 10 x volume in ChIP dilution buffer (0.01% SDS, 1%

Triton X-100, 2mM EDTA, 20 mM Tris-HCL, 160 mM NaCl) supplemented with 1/1000 dilution of protease inhibitor. After saving the 1/10th volume of the input, the biotin-protein-DNA complexes were precipitated with Dynabeads™ M-280 Streptavidin (11205D, Thermo) at 4°C for 2 hours to overnight. For 1 mL of sheared chromatin, 100 µL of the Dynabead slurry was used. The beads were separated using Dynabeads magnetic particle concentrator (MPC) for 2 minutes, followed by washing 2 minutes in Wash buffer 1 (0.5% SDS, 0.1% Deoxycholate, 1%

Triton X-100, 1mM EDTA, 50 mM HEPES pH7.5 and 150 mM NaCl), 5 minutes in Wash

4 buffer 2 (0.1% Deoxycholate, 1% Triton X-100, 1mM EDTA, 50mM HEPES pH7.5 and 500 mM NaCl), 5 minutes in Wash buffer 3 (250 mM LiCl, 0.5% IGEPAL® CA-630, 0.5%

Deoxycholate, 1 mM EDTA and 10mM Tris-HCL pH 8.0) and twice in TE buffer. The precipitated chromatin was subjected to de-crosslinking and elution overnight at 65°C in 300 µL of SDS elution buffer (1% SDS, 10mM EDTA and 50mM Tris-HCL pH 8.0). The eluate was separated from the beads using Dynabead MCP. To approximately 300 µL of eluate an equal volume of TE was added, followed by 30 minutes of digestion with RNAse A (1.5 µg) then 2 hours with Proteinase K (60 µg), supplemented with glycogen (2 µg). DNA purification by phenol and ethanol purification was performed and the purified ChIP DNA was subjected to subsequent analysis.

ChIP Sequencing and analysis

Sequenced reads were aligned to human (hg19) genome using Bowtie (1.0.0). Enriched peaks were annotated using the ChIPseeker R package. Target genes are defined using a 5kb window around the transcription start site and the target gene expression levels were extracted from the

ENCODE K562 RNA-Seq dataset GSE78560. DNA binding motif analysis was performed by

MEME-ChIP (4.10) using 500 bp fasta sequences surrounding the peak centers. DAVID (ver 6.8) was used for gene ontology functional annotation analysis. Statistical analysis of peak overlap was performed using a hypergeometric test, assuming that the background number of accessible chromatin sites is 3% of the total human genome size, and an average peak width of 5kb (total background # of accessible peaks = 0.03 * human genome size / 5kb).

5 Fetal Liver Erythroid Differentiation

Fetal livers were isolated from e12.5 to e13.5 C57BL/6 (WT) and Zfp148-/- (KO) embryos.

These were made into a single cell suspension by passing through 70 µm cell strainer (352350,

BD FalconTM) and pipetting up and down rigorously. Cells were grown in an expansion media

(10639011, GibcoTM) supplemented with SCF (200 ng/ml), Dexamethasone (2 µM) IGF-1 (80 ng/ml), EPO (4 U/ml). On day 2 of the expansion phase, WT and KO cells were either infected with lentiviruses harboring shLuc control or shZfp281 in the presence of 4 µg/ml polybrene

(107689, Sigma-Aldrich). On day 3, the lentiviruses were removed by washing the cells in PBS.

Puromycin selection (0.3 µg/mL) commenced on day 5 for two days. During days 3 to 8, cells were refed every two days and maintained at 2 x106 cells/ml density. On day 8, the puromycin- selected cells were switched to a differentiation media (10639011, GibcoTM) supplemented with human insulin (10 ng/mL), human transferrin (1mg/ml), mifepristone (3 x 10-6 M) and EPO (10

U/ml). All media are supplemented with 100 U/ml Pen/Strep, and 2 mM glutamine (GibcoTM).

On day 10, or 48 hours post erythroid differentiation, cells were collected for FACS sorting and analysis, cytospin, and RNA extraction.

Analysis of lung

Mouse lung tissues were fixed with 4% paraformaldehyde (PFA) in PBS and paraffin sections were used for analysis. Sectioned lung tissues were stained with hematoxylin and eosin

(H&E) or immunostained with antibodies as followed: primary antibodies were goat anti-SP-C

(1:200, Santa Cruz Biotechnology Inc., sc-7706) and rabbit anti-CC10 (1:200, Santa Cruz

Biotechnology Inc., sc-25555). Alexa Fluor-coupled secondary antibodies (Invitrogen) were used at 1:500. Images were acquired using an Olympus IX80 microscope and a confocal microscope

(Leica TCS SP5). All the images were further processed with ImageJ software

Supplemental Figure 1

A EcoRV 19.5kb EcoRV WT Zfp148fl/+ zf1 zf2 WT 3’ Probe 23kb exon 5 6 7 19.5kb 15kb EcoRV EcoRV EcoRV 15kb EcoRV

fl/+ 9.4kb Zfp148 L F PGK-Puro F L 3’ Probe exon 5 6 7

BamHI 16kb BamHI B WT Zfp148fl/+ zf1 zf2 23kb WT 5’ Probe 16kb exon 5 6 7 14kb

BamHI 14kb PacI BamHI BamHI 9.4kb

fl/+ Zfp148 L F PGK-Puro F L 5’ Probe exon 5 6 7

C 1 2 3 4 5 6 7 8 9 WT Zfp148-/- WT 581bp 373bp Zfp148-/-

Exon 6 Exon 5

Zfp148-/-

Exon 8 Exon 5

Supplemental Figure 1. Targeting Zfp148 locus for Cre-LoxP mediated conditional deletion. (A) Schematic representation of wild type Zfp148 and exons flanked by LoxP. Expected genomic DNA fragment size upon EcoRV endonuclease digestion and the location of 3’end probe is shown in red. Representative Southern blot assay image of a positive ES clone is shown in the right panel. (B) Strategy for confirming correct gene targeting by Southern blot from the 5’end using BamHI endonuclease, location of 5’ end probe and Southern blot assay image of a positive clone shown as in “A”. (C) Schematic representation of WT (top) and Zfp148-/- null allele (bottom) with the exons deleted upon Cre mediated recombination of LoxP sites. Location of PCR primers are shown as red arrows and an image of RT-PCR are shown in the right panel. (D) Sequencing of purified RT-PCR products from “C”. Supplemental Figure 2

A p14.5 p28.5 p42.5 200 200 200 p<0.01 L)

d p<0.05 / 150 150 150 g 100 100 100 50 50 50

Glucose ( m 0 0 0 Zfp148 WT Het Null WT Het Null WT Het Null

B +/- -/- WT zfp148 zfp148

Supplemental Figure 2. Neonatal growth failure and low plasma glucose levels of Zfp148-/- mice on mixed C57BL/6, CD-1 and 129/Sv genetic backgrounds. (A) Dot plots of plasma glucose levels of Zfp148 mice on postnatal P14.5, P28.5 and P42.5 on mixed genetic background. (B) Representative photographs showing gastric milk in 3 weeks old Zfp148 mice necropsies. Supplemental Figure 3

-/- A WT Zfp148

100µm 100µm 100µm 100µm

-/- B WT Zfp148 Sftpc

100µm 100µm 100µm 100µm

-/- C WT Zfp148 Scgb1a1

100µm 100µm 100µm 100µm

Supplemental Figure 3. Neonates of Zfp148-/- mice on pure C57BL/6 background show normal lung histology. (A) H&E staining of lung sections from WT and Zfp148-/- neonates (p1.5). (B-C) Immunofluorescent staining with anti-SP-C antibody in “C” and anti-CC10 antibody in “D”. Supplemental Figure 4

A Plasma iron level B Reticulocyte count p=0.06 p=ns 180 0.4 6 150 0.3 120

90 0.2 Iron (mcg/dL) 80

0 Retic count (10 / µ L) 0.0 Zfp148 f/f f/f Zfp148 f/f f/f Vav1-Cre Vav1-Cre

Supplemental Figure 4. Plasma iron levels and reticulocyte counts following pan-hematopoietic deletion of Zfp148. (A) Plasma iron levels, (B) Reticulocyte counts of Zfp148fl/fl (n=3) and Vav1- Cre; Zfp148fl/fl mice (n=3). Supplemental Figure 5

A ∗ B ∗ MSGLNDIFEAQKIEWHEGAPSSR MSGLNDIFEAQKIEWHEGAPSSR

Bir A Zfp148 794 aa/89 kD Bir A Zfp281 893 aa/99 kD 4 zinc fingers 4 zinc fingers Flag Flag

Bir A Bir A FB-Zfp148 FB-Zfp281 Bio Bio Zfp148 Zfp281 Zfp148 Zfp281 α-Zfp281 Streptavidin (Endogenous) α-Zfp148 Streptavidin (Endogenous)

GAPDH GAPDH

Supplemental Figure 5. Generation of K562 clones stably expressing Zfp148 and Zfp281 flag- biotin (FB) clones. (A) Schematic diagram of Zfp148 containing the amino-terminal FLAG peptide (black box) and the bir A recognition sequence (gray box) (FLAG-Bio). The biotin acceptor lysine is indicated with an asterisk. Western blot analysis of nuclear extracts from K562 clones stably expressing bir A alone or bir A and Zfp148FB. These blots are stripped and re-probed with streptavidin horseradish peroxidase as indicated. The Zfp148 protein bands are indicated by an arrow. Abbreviation: BirA, E. coli biotin ligase. (B) Schematic diagram and Western blot analysis of Zfp281FB as in “A”. Supplemental Figure 6

A HBG2 KLF1 TAL1 60 - 60 - 90 -

Zfp148 1 1 1 60 - 60 - 90 -

Zfp281 1 1 1 60 - 156 - 90 -

GATA1 0 0 0 60 - 60 - 90 -

BirA 1 1 1

HBG2 KLF1 TAL1

B HBG2 KLF1 TAL1 20 20 20 ** ** ** β -actin) 15 ** ** 15 15

10 10 10

5 5 5

Relative Enrichment (Normalized to 0 0 0 Bir A FB-Zfp148 FB-Zfp281

Supplemental Figure 6. Chromatin occupancy of Zfp148 and Zfp281. (A) BioChIP-seq signals at the gamma-globin locus (HBG2), Kruppel-like factor 1 (KLF1), TAL bHLH transcription factor 1 (TAL1) in hemin-induced K562 cells expressing Bir A alone or Bir A and BioZfp148 or BioZfp281, or GATA1 (GEO accession: GSM1003608). (B) Quantitative ChIP-PCR validation of BioZfp148 and BioZfp281 chromatin enrichment peaks shown in “A”. The enrichment levels were normalized to actin beta (ACTB) and expressed relative to corresponding peaks in Bir A. **p<0.01. Supplemental Figure 7

1214 Zfp148 unique 728 Common 611 Zfp281 unique

535 B Zfp148 unique positive regulation of transcription from RNA polymerase II promoter negative regulation of transcription, DNA-templated covalent chromatin modification negative regulation of transcription from RNA polymerase II promoter transcription, DNA-templated transcription from RNA polymerase II promoter viral process cell-cell adhesion vascular endothelial growth factor receptor signaling pathway G1/S transition of mitotic cell cycle 0 2 4 6 8 10 -log10 (p value)

C Zfp281 unique response to hypoxia ephrin receptor signaling pathway positive regulation of cellular component movement keratan sulfate catabolic process substrate adhesion-dependent cell spreading cell division regulation of apoptotic process autophagosome maturation cell cycle regulation of cell adhesion 0 1 2 3 4 -log10 (p value)

D Common to Zfp148 and Zfp281 negative regulation of transcription from RNA polymerase II promoter transcription, DNA-templated positive regulation of transcription, DNA-templated positive regulation of transcription from RNA polymerase II promoter regulation of transcription, DNA-templated negative regulation of transcription, DNA-templated transcription from RNA polymerase II promoter nucleosome disassembly covalent chromatin modification protein phosphorylation 0 5 10 15 20 -log10 (p value) Supplemental Figure 7. Gene ontology (GO) term analysis of Zfp148 and Zfp281 bound genes. (A) Venn diagram showing the overlap of Zfp148 and Zfp281 target genes in K562 cells. 1214 genes are unique to Zfp148, 611 genes are unique to Zfp281 and 728 gene are common to both Zfp148 and Zfp281. (B-D) Bar graphs depicting top 10 most significant biological processes regulated by 1214 unique Zfp148 target genes in “B”, 611 unique target genes in “C” and 728 common genes in “D”. Supplemental Figure 8

A Zfp148 Unique positive regulation of transcription from RNA polymerase II promoter covalent chromatin modification negative regulation of transcription, DNA-templated transcription, DNA-templated negative regulation of transcription from RNA polymerase II promoter transcription from RNA polymerase II promoter vascular endothelial growth factor receptor signaling pathway cell-cell adhesion viral process mRNA splicing, via spliceosome 0 2 4 6 8 10 -log10 (p value)

B Zfp281 Unique ephrin receptor signaling pathway response to hypoxia positive regulation of cellular component movement cell division autophagosome maturation regulation of cell adhesion protein transport cell cycle cellular response to dexamethasone stimulus response to drug 0 1 2 3 4 -log10 (p value)

Supplemental Figure 8. GO term analysis of Zfp148, Zfp281 and GATA1 bound genes. (A) Bar graphs depicting top 10 most significant biological processes regulated by 1107 Zfp148 unique target genes. (B) As in “A” showing 543 unique Zfp281 target genes. Supplemental Table 1. List of Oligonucleotides

Name Use Forward 5'-3' Reverse 5'-3'

3' Arm Zfp148 Int7-8 NotI Gene targetting PCR atGCGGCCGCATTTCGATGTGGTCTTATGGTATGT atGCGGCCGCAGACTCACTTCATATCTGGCTGTTC

5' Arm Zfp148 Int5-6 PmeI AscI Gene targetting PCR taGTTTAAACATACAGAGAAACAGCAACAAAAACC atGGCGCGCCAATCAATTAATGAGAACTGCTAA

Conditional Arm Zfp148 Int5-6 PacI Gene targetting PCR cTTAATTAAGATACTGAACTTTTCTCCCTGCATA cTTAATTAACACCATTCTTAATTCCAACAAAATC

3' Probe Zfp148 int7-8 Southern Blot Probe PCR CAACTGGTCAGAAGTACAGATGAGA CTAAACCACCAATGAAAGAAAACAC

5' Probe Zfp148 int5-6 Southern Blot Probe PCR TTTTGTGTGTGTGAAGAGAAGTGTT CTGTCTCAGTCTAGGGTCTGTAAGG

Geno_Zfp148 int5-6 WT / Flox Genotyping PCR AGTTAAATTGGTTTTCTGTGCTTT ACTACCAGAGTTCCTGCGTGTTC

Geno_Zfp148 int7-8 Null Genotyping PCR AGTTAAATTGGTTTTCTGTGCTTT ACTGAGGCATAAAGACAGAGTTCC

Zfp148 exon 5/exon 9 RT-PCR ACAGAAAAAGAAGAAGCGGAAA CCAGCACACTCTCCTTGTCC

HBG qRT-PCR TGGATGATCTCAAGGGCAC TCAGTGGTATCTGGAGGACA

GAPDH qRT-PCR ACCCAGAAGACTGTGGATGG TTCAGCTCAGGGATGACCTT

HBG2 qChIP-PCR GCTCACTGACTGCATGGAAA ATCAGGAAAGTGGGGGAAAG

KLF1 qChIP-PCR GACCCCCAAGTCTCTCCTTC CTGTGTCCAAAGCCAAGTCA

TAL1 qChIP-PCR TCTGTGTCCGAGTGTGGTGT AACGAAGAAAACGCAGAAGG

ACTB qChIP-PCR GATGAGATTGGCATGGCTTT CACCTTCACCGTTCCAGTTT Supplemental Table 2. shRNA Seed Sequences

Short Hairpin Name Target species Seed sequence Zfp281 shRNAc#1 human GTAATGGAATATCCAATTTAC Zfp281 shRNAc#2 human GCAGAGTTACTCAGTAGAAAT Zfp281 shRNAc#3 mouse GTTTCTACACGATCCTATTAA Zfp281 shRNAc#4 mouse TTGCTAGGATTAAGGTTATTC Supplemental Table 3. Surviving Zfp148 mice on a mixed strain background

Genotypes Live birth Expected Frequency Expected birth WT 14 0.25 11.5 +/- 21 0.5 23 -/- 11 0.25 11.5 Total number = 46 Chi-square = 0.74 (Degree of freedom 2, Chi-square value <5.99) Not significant deviation from the expected frequency of possible genotypes. Supplemental Table 4 List of Genes Bound by GATA1 and Zfp148 and/or Zfp281 Gene symbol Gene name Chromosome location Locus group ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1q25.2 protein-coding gene ACOT7 acyl-CoA thioesterase 7 1p36.31 protein-coding gene ACSL3 acyl-CoA synthetase long chain family member 3 2q36.1 protein-coding gene ACSL6 acyl-CoA synthetase long chain family member 6 5q31.1 protein-coding gene ADAMTSL4 ADAMTS like 4 1q21.2 protein-coding gene ADAR adenosine deaminase RNA specific 1q21.3 protein-coding gene ADARB1 adenosine deaminase RNA specific B1 21q22.3 protein-coding gene ADCY7 adenylate cyclase 7 16q12.1 protein-coding gene AFP alpha fetoprotein 4q13.3 protein-coding gene AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 21q22.3 protein-coding gene AIDA axin interactor, dorsalization associated 1q41 protein-coding gene AMFR autocrine motility factor receptor 16q13 protein-coding gene AMHR2 anti-Mullerian hormone receptor type 2 12q13.13 protein-coding gene AMN1 antagonist of mitotic exit network 1 homolog 12p11.21 protein-coding gene ANK1 ankyrin 1 8p11.21 protein-coding gene ANKRD27 ankyrin repeat domain 27 19q13.11 protein-coding gene ANPEP alanyl aminopeptidase, membrane 15q26.1 protein-coding gene APLNR apelin receptor 11q12.1 protein-coding gene ARF4 ADP ribosylation factor 4 3p14.3 protein-coding gene ARHGEF11 Rho guanine nucleotide exchange factor 11 1q23.1 protein-coding gene ASAP2 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 2p25.1 protein-coding gene ASB13 ankyrin repeat and SOCS box containing 13 10p15.1 protein-coding gene ATM ATM serine/threonine kinase 11q22.3 protein-coding gene ATP2A3 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 3 17p13.2 protein-coding gene ATP7B ATPase copper transporting beta 13q14.3 protein-coding gene AXL AXL receptor tyrosine kinase 19q13.2 protein-coding gene BCL7B BAF chromatin remodeling complex subunit BCL7B 7q11.23 protein-coding gene BCOR BCL6 corepressor Xp11.4 protein-coding gene BLCAP BLCAP apoptosis inducing factor 20q11.23 protein-coding gene BMPR1A bone morphogenetic protein receptor type 1A 10q23.2 protein-coding gene BNIP3L BCL2 interacting protein 3 like 8p21.2 protein-coding gene BSG basigin (Ok blood group) 19p13.3 protein-coding gene CA14 carbonic anhydrase 14 1q21.2 protein-coding gene CAPN1 calpain 1 11q13.1 protein-coding gene CASS4 Cas scaffold protein family member 4 20q13.31 protein-coding gene CBFA2T3 CBFA2/RUNX1 translocation partner 3 16q24.3 protein-coding gene CCM2 CCM2 scaffold protein 7p13 protein-coding gene CD55 CD55 molecule (Cromer blood group) 1q32.2 protein-coding gene CDC42EP4 CDC42 effector protein 4 17q25.1 protein-coding gene CDK5RAP2 CDK5 regulatory subunit associated protein 2 9q33.2 protein-coding gene CEP68 centrosomal protein 68 2p14 protein-coding gene CHD8 chromodomain helicase DNA binding protein 8 14q11.2 protein-coding gene CHM CHM Rab escort protein Xq21.2 protein-coding gene CHST12 carbohydrate sulfotransferase 12 7p22.3 protein-coding gene CLASP1 cytoplasmic linker associated protein 1 2q14.2-q14.3 protein-coding gene CLN6 CLN6 transmembrane ER protein 15q23 protein-coding gene CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 11q13.4 protein-coding gene CMBL carboxymethylenebutenolidase homolog 5p15.2 protein-coding gene CMIP c-Maf inducing protein 16q23.2-q23.3 protein-coding gene CMPK2 cytidine/uridine monophosphate kinase 2 2p25.2 protein-coding gene CORO1C coronin 1C 12q24.11 protein-coding gene COX17 cytochrome c oxidase copper chaperone COX17 3q13.33 protein-coding gene CREB3 cAMP responsive element binding protein 3 9p13.3 protein-coding gene CSK C-terminal Src kinase 15q24.1 protein-coding gene CTSB cathepsin B 8p23.1 protein-coding gene CYB561 cytochrome b561 17q23.3 protein-coding gene D2HGDH D-2-hydroxyglutarate dehydrogenase 2q37.3 protein-coding gene DAG1 dystroglycan 1 3p21.31 protein-coding gene DAGLB diacylglycerol lipase beta 7p22.1 protein-coding gene DDR1 discoidin domain receptor tyrosine kinase 1 6p21.33 protein-coding gene DIAPH3 diaphanous related formin 3 13q21.2 protein-coding gene DMBX1 diencephalon/mesencephalon homeobox 1 1p33 protein-coding gene DNAAF5 dynein axonemal assembly factor 5 7p22.3 protein-coding gene DNMT3A DNA methyltransferase 3 alpha 2p23.3 protein-coding gene DOCK9 dedicator of cytokinesis 9 13q32.3 protein-coding gene E2F1 E2F transcription factor 1 20q11.22 protein-coding gene EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 3p26.1 protein-coding gene ELK4 ETS transcription factor ELK4 1q32.1 protein-coding gene ELOF1 elongation factor 1 homolog 19p13.2 protein-coding gene ELOVL1 ELOVL fatty acid elongase 1 1p34.2 protein-coding gene EPAS1 endothelial PAS domain protein 1 2p21 protein-coding gene EPB41 erythrocyte membrane protein band 4.1 1p35.3 protein-coding gene EPB42 erythrocyte membrane protein band 4.2 15q15.2 protein-coding gene EPHB4 EPH receptor B4 7q22.1 protein-coding gene EPHX2 epoxide hydrolase 2 8p21.2-p21.1 protein-coding gene EPN1 epsin 1 19q13.42 protein-coding gene EPOR erythropoietin receptor 19p13.2 protein-coding gene ERMAP erythroblast membrane associated protein (Scianna blood group) 1p34.2 protein-coding gene ETFBKMT electron transfer flavoprotein subunit beta lysine methyltransferase 12p11.21 protein-coding gene FAM178B family with sequence similarity 178 member B 2q11.2 protein-coding gene FAM193A family with sequence similarity 193 member A 4p16.3 protein-coding gene FAM193B family with sequence similarity 193 member B 5q35.3 protein-coding gene FAM214B family with sequence similarity 214 member B 9p13.3 protein-coding gene FCHSD2 FCH and double SH3 domains 2 11q13.4 protein-coding gene FCRLB Fc receptor like B 1q23.3 protein-coding gene FDXR ferredoxin reductase 17q25.1 protein-coding gene FOXH1 forkhead box H1 8q24.3 protein-coding gene FOXK1 forkhead box K1 7p22.1 protein-coding gene FOXO3 forkhead box O3 6q21 protein-coding gene FUT1 fucosyltransferase 1 (H blood group) 19q13.33 protein-coding gene FYN FYN proto-oncogene, Src family tyrosine kinase 6q21 protein-coding gene GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 11q13.4-q13.5 protein-coding gene GFOD1 glucose-fructose oxidoreductase domain containing 1 6p24.1-p23 protein-coding gene GLB1 galactosidase beta 1 3p22.3 protein-coding gene GLRX glutaredoxin 5q15 protein-coding gene GRAP2 GRB2 related adaptor protein 2 22q13.1 protein-coding gene GUK1 guanylate kinase 1 1q42.13 protein-coding gene GYPC glycophorin C (Gerbich blood group) 2q14.3 protein-coding gene HDAC6 histone deacetylase 6 Xp11.23 protein-coding gene HDDC2 HD domain containing 2 6q22.31 protein-coding gene HEMGN hemogen 9q22.33 protein-coding gene HERC1 HECT and RLD domain containing E3 ubiquitin protein ligase family member 1 15q22.31 protein-coding gene HLTF-AS1 HLTF antisense RNA 1 3q24 non-coding RNA HPCAL1 hippocalcin like 1 2p25.1 protein-coding gene HVCN1 hydrogen voltage gated channel 1 12q24.11 protein-coding gene IKBKB inhibitor of nuclear factor kappa B kinase subunit beta 8p11.21 protein-coding gene IL15RA interleukin 15 receptor subunit alpha 10p15.1 protein-coding gene INTS6L integrator complex subunit 6 like Xq26.3 protein-coding gene ITGB1 integrin subunit beta 1 10p11.22 protein-coding gene ITPR3 inositol 1,4,5-trisphosphate receptor type 3 6p21.31 protein-coding gene KCNAB1 potassium voltage-gated channel subfamily A member regulatory beta subunit 1 3q25.31 protein-coding gene KCNH2 potassium voltage-gated channel subfamily H member 2 7q36.1 protein-coding gene KIAA1614 KIAA1614 1q25.3 protein-coding gene KIF2A kinesin family member 2A 5q12.1 protein-coding gene KIF5A kinesin family member 5A 12q13.3 protein-coding gene KLF1 Kruppel like factor 1 19p13.13 protein-coding gene KLHL6 kelch like family member 6 3q27.1 protein-coding gene LINC00656 long intergenic non-protein coding RNA 656 20p11.21 non-coding RNA LINC00853 long intergenic non-protein coding RNA 853 1p33 non-coding RNA LOXL2 lysyl oxidase like 2 8p21.3 protein-coding gene LRRC37B leucine rich repeat containing 37B 17q11.2 protein-coding gene LYL1 LYL1 basic helix-loop-helix family member 19p13.13 protein-coding gene MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 1p13.2 protein-coding gene MAP3K8 mitogen-activated protein kinase kinase kinase 8 10p11.23 protein-coding gene MAP4K3-DT MAP4K3 divergent transcript 2p22.1 non-coding RNA MAPRE3 microtubule associated protein RP/EB family member 3 2p23.3 protein-coding gene MDM4 MDM4 regulator of p53 1q32.1 protein-coding gene MED15 mediator complex subunit 15 22q11.21 protein-coding gene MFSD12 major facilitator superfamily domain containing 12 19p13.3 protein-coding gene MICALL2 MICAL like 2 7p22.3 protein-coding gene MICB MHC class I polypeptide-related sequence B 6p21.33 protein-coding gene MOB1B MOB kinase activator 1B 4q13.3 protein-coding gene MRPL35 mitochondrial ribosomal protein L35 2p11.2 protein-coding gene MSANTD2 Myb/SANT DNA binding domain containing 2 11q24.2 protein-coding gene MTRF1L mitochondrial translational release factor 1 like 6q25.2 protein-coding gene MYB MYB proto-oncogene, transcription factor 6q23.3 protein-coding gene MYH10 myosin heavy chain 10 17p13.1 protein-coding gene MYH9 myosin heavy chain 9 22q12.3 protein-coding gene NF1 neurofibromin 1 17q11.2 protein-coding gene NFE2 nuclear factor, erythroid 2 12q13 protein-coding gene NFIB nuclear factor I B 9p23-p22.3 protein-coding gene NR2F2 nuclear receptor subfamily 2 group F member 2 15q26.2 protein-coding gene NTRK1 neurotrophic receptor tyrosine kinase 1 1q23.1 protein-coding gene OR52A5 olfactory receptor family 52 subfamily A member 5 11p15.4 protein-coding gene PACSIN2 protein kinase C and casein kinase substrate in neurons 2 22q13.2 protein-coding gene PCNT pericentrin 21q22.3 protein-coding gene PCSK6 proprotein convertase subtilisin/kexin type 6 15q26 protein-coding gene PDE4DIP phosphodiesterase 4D interacting protein 1q21.2 protein-coding gene PHLDB1 pleckstrin homology like domain family B member 1 11q23.3 protein-coding gene PKNOX1 PBX/knotted 1 homeobox 1 21q22.3 protein-coding gene POLD4 DNA polymerase delta 4, accessory subunit 11q13.2 protein-coding gene PRDM10 PR/SET domain 10 11q24.3 protein-coding gene PTH2R parathyroid hormone 2 receptor 2q34 protein-coding gene PTK2B protein tyrosine kinase 2 beta 8p21.2 protein-coding gene PTPA protein phosphatase 2 phosphatase activator 9q34.11 protein-coding gene PTPRH protein tyrosine phosphatase receptor type H 19q13.4 protein-coding gene PTTG1IP PTTG1 interacting protein 21q22.3 protein-coding gene RAB6B RAB6B, member RAS oncogene family 3q22.1 protein-coding gene RAD23B RAD23 homolog B, nucleotide excision repair protein 9q31.2 protein-coding gene RASGRP3 RAS guanyl releasing protein 3 2p22.3 protein-coding gene RCC1 regulator of chromosome condensation 1 1p35.3 protein-coding gene RCL1 RNA terminal phosphate cyclase like 1 9p24.1 protein-coding gene RFC1 replication factor C subunit 1 4p14 protein-coding gene RHBDD2 rhomboid domain containing 2 7q11.23 protein-coding gene RHOT1 ras homolog family member T1 17q11.2 protein-coding gene RIPOR3 RIPOR family member 3 20q13.13 protein-coding gene RMND5B required for meiotic nuclear division 5 homolog B 5q35.3 protein-coding gene RNASE1 ribonuclease A family member 1, pancreatic 14q11.2 protein-coding gene RNF145 ring finger protein 145 5q33.3 protein-coding gene ROR2 receptor tyrosine kinase like orphan receptor 2 9q22.31 protein-coding gene RPP25 ribonuclease P and MRP subunit p25 15q24.2 protein-coding gene RUBCN rubicon autophagy regulator 3q29 protein-coding gene S100Z S100 calcium binding protein Z 5q13.3 protein-coding gene SCAF4 SR-related CTD associated factor 4 21q22.11 protein-coding gene SCARB1 scavenger receptor class B member 1 12q24.31 protein-coding gene SCRN2 secernin 2 17q21 protein-coding gene SDE2 SDE2 telomere maintenance homolog 1q42.12 protein-coding gene SENP6 SUMO specific peptidase 6 6q14.1 protein-coding gene SERINC3 serine incorporator 3 20q13.12 protein-coding gene SESN2 sestrin 2 1p35.3 protein-coding gene SFMBT1 Scm like with four mbt domains 1 3p21.1 protein-coding gene SGK1 serum/glucocorticoid regulated kinase 1 6q23.2 protein-coding gene SH2B3 SH2B adaptor protein 3 12q24.12 protein-coding gene SHLD1 shieldin complex subunit 1 20p12.3 protein-coding gene SKAP2 src kinase associated phosphoprotein 2 7p15.2 protein-coding gene SLC11A2 solute carrier family 11 member 2 12q13.12 protein-coding gene SLC13A4 solute carrier family 13 member 4 7q33 protein-coding gene SLC25A37 solute carrier family 25 member 37 8p21.2 protein-coding gene SLC25A51 solute carrier family 25 member 51 9p13.2-p13.1 protein-coding gene SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 6p21.1 protein-coding gene SLC3A2 solute carrier family 3 member 2 11q12.3 protein-coding gene SLC45A4 solute carrier family 45 member 4 8q24.3 protein-coding gene SLC48A1 solute carrier family 48 member 1 12q13.11 protein-coding gene SLC6A9 solute carrier family 6 member 9 1p34.1 protein-coding gene SLC7A8 solute carrier family 7 member 8 14q11.2 protein-coding gene SLCO2B1 solute carrier organic anion transporter family member 2B1 11q13 protein-coding gene SMAP2 small ArfGAP2 1p34.2 protein-coding gene SMARCAL1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a like 1 2q35 protein-coding gene SNAP47 synaptosome associated protein 47 1q42.13 protein-coding gene SPAG17 sperm associated antigen 17 1p12 protein-coding gene SPATS2 spermatogenesis associated serine rich 2 12q13.12 protein-coding gene SPI1 Spi-1 proto-oncogene 11p11.2 protein-coding gene SPIDR scaffold protein involved in DNA repair 8q11.21 protein-coding gene SPTB spectrin beta, erythrocytic 14q23.3 protein-coding gene SSH1 slingshot protein phosphatase 1 12q24.11 protein-coding gene SSX2IP SSX family member 2 interacting protein 1p22.3 protein-coding gene STK11 serine/threonine kinase 11 19p13.3 protein-coding gene STK40 serine/threonine kinase 40 1p34.3 protein-coding gene TAL1 TAL bHLH transcription factor 1, erythroid differentiation factor 1p33 protein-coding gene TBC1D24 TBC1 domain family member 24 16p13.3 protein-coding gene TBX19 T-box 19 1q24.2 protein-coding gene TCP11L2 t-complex 11 like 2 12q23.3 protein-coding gene TFR2 transferrin receptor 2 7q22.1 protein-coding gene TGM2 transglutaminase 2 20q11.23 protein-coding gene THEMIS2 thymocyte selection associated family member 2 1p35.3 protein-coding gene TJP2 tight junction protein 2 9q21.11 protein-coding gene TLDC2 TBC/LysM-associated domain containing 2 20q11.23 protein-coding gene TLE2 TLE family member 2, transcriptional corepressor 19p13.3 protein-coding gene TLE3 TLE family member 3, transcriptional corepressor 15q23 protein-coding gene TLE6 TLE family member 6, subcortical maternal complex member 19p13.3 protein-coding gene TMC8 transmembrane channel like 8 17q25.3 protein-coding gene TMEM120A transmembrane protein 120A 7q11.23 protein-coding gene TMEM245 transmembrane protein 245 9q31.3 protein-coding gene TMEM74B transmembrane protein 74B 20p13 protein-coding gene TNFAIP3 TNF alpha induced protein 3 6q23.3 protein-coding gene TNFSF9 TNF superfamily member 9 19p13.3 protein-coding gene TPM4 tropomyosin 4 19p13.12-p13.11 protein-coding gene TRDMT1 tRNA aspartic acid methyltransferase 1 10p13 protein-coding gene TRPS1 transcriptional repressor GATA binding 1 8q23.3 protein-coding gene TSPAN32 tetraspanin 32 11p15.5 protein-coding gene TUBA3FP tubulin alpha 3f pseudogene 22q11.21 pseudogene UBXN10 UBX domain protein 10 1p36.12 protein-coding gene USP6NL USP6 N-terminal like 10p14 protein-coding gene VPS13B vacuolar protein sorting 13 homolog B 8q22.2 protein-coding gene VPS8 VPS8 subunit of CORVET complex 3q27.2 protein-coding gene YIF1B Yip1 interacting factor homolog B, membrane trafficking protein 19q13.2 protein-coding gene ZBTB4 zinc finger and BTB domain containing 4 17p13.1 protein-coding gene ZFAND3 zinc finger AN1-type containing 3 6p21.2 protein-coding gene ZFAND6 zinc finger AN1-type containing 6 15q25.1 protein-coding gene ZFPM2 zinc finger protein, FOG family member 2 8q23 protein-coding gene ZMYND8 zinc finger MYND-type containing 8 20q13.12 protein-coding gene ZNF175 zinc finger protein 175 19q13.41 protein-coding gene ZNF331 zinc finger protein 331 19q13 protein-coding gene ZNF398 zinc finger protein 398 7q35 protein-coding gene ZNF608 zinc finger protein 608 5q23.2 protein-coding gene