ENVIRONMENTAL AND DEVELOPMENTAL REGULATION OF CAROTENOID METABOLISM IN ARABIDOPSIS LEAVES
A thesis submitted for the degree of Doctor of Philosophy
Namraj Dhami Hawkesbury Institute for the Environment Western Sydney University Australia December 2018 Dedication
I DEDICATE THIS THESIS (DOCTOR OF PHILOSOPHY) TO MY PARENTS
(KESHAV SINGH DHAMI (FATHER), WHOSE HARDWORK AND
PROMISES ENABLED WE THREE BROTHERS TO GO SCHOOL
AND
DURGA DEVI DHAMI (MOTHER), WHO SACRIFICED EVERY
MOMENT TIRELESSLY CARING US IGNORING HER OWN LIFE)
AND THE MOTHERLAND
(WHO NURTURED ME WITH HER TRUE BLESSINGS
UNCONDITIONALLY).
i
Acknowledgement
Many thanks to supervisory panel members Christopher Cazzonelli, David
Tissue, and Barry Pogson for immense support and mentorship during my PhD.
Commencing higher degree research as the very first graduate student in a newly established research group was quite exciting and challenging. Chris and David, I sincerely appreciate your encouragement and guidance that enabled me to persevere and, therefore, complete this research. The thesis, as in the current form, will not be possible without immense support from both of you. Thanks so much. I am grateful for the critical inputs from Barry Pogson streamlining the research projects and providing several germplasms to address the research questions in this thesis.
I thank Markus Riegler and Ben Moore for their support taking care of my research progress during the candidature. Many thanks to John Drake and Mark
Tjoelker in supporting data analysis and preparation of manuscript from the
Eucalyptus heatwave experiment. I express a deep sense of appreciation to Rishi
Aryal and EELab mates; Eric Brenya, Yagiz Alagoz, Pranjali Nayak, and Sidra
Anwar for immense support while performing experiments, data analysis and interpretation, and manuscript preparation. The generous support of the Pogson lab fellows, John Rivers, Xin Hou, and Ryan Mcquinn was commendable. Highly appreciate the help from Laura Castaneda Gomez, Julius Sagun, and Dushan
Kumarathunge during data collection.
I gratefully acknowledge David McCurdy (University of Newcastle, Australia),
Felix Kessler (University of Neuchatel, Switzerland), Luca Dall′Osto (University of
Verona, Italy), and Abdelali Hannoufa (Agriculture and Agri-Food Canada) for the generosity to provide seeds of mutant and transgenic lines used in this thesis. I thank
ii
Aakanksha Kanojia and Paul Dijkwel (Massey University, New Zealand) for the generosity to share Arabidopsis leaf transcriptome data.
I am indebted for the massive help from the administration and technical team of HIE. Thanks, so much David Harland, Patricia Hellier, Jenny Harvey, Lisa
Davison, Gavin McKenzie, Chris Mitchel, Marcus Klein, Andrew Gherlenda, Kerri
Sherriff, and Goran Lopaticki. You were always ready to help whenever I was in need.
The M14 crew, Coline, Chathu, John, Alexie, Laura, Leah, Desi, Elle, Julia, and
Alice, you guys were lovely people to mention here for your lively friendship throughout the campus life. Also, highly admire the friendliness and modesty of the fellow researchers affiliated with HIE who made PhD life socially vibrant.
Words are not enough, yet I take this opportunity to express my deep sense of gratitude to my parents. I’m indebted of your tireless deeds that enabled me to pursue
University degrees. Thanks so much. My sincere appreciation for elder brother
Govind Dhami for the constant support that encouraged me to stay in science. The everlasting backing of my wife, taking complete care of the two kids on her own during my studies was precious and genuinely admirable. Thank you so much Janaki, you are truly a life-partner. Highly appreciate the attention and compliments from
Bhauju, Ishwari Dhami, and brother, Umesh Dhami, that means quite a lot to me.
Thank you.
iii
Statement of authentication
The work presented in this dissertation is, to the best of my knowledge and belief, original except acknowledged in the text. I declare that I have not submitted in a whole or part of this dissertation for any other degree at this or other institution.
December 10, 2018 (First submission)
September 15, 2019 (Final submission, after revision)
iv
Declaration
The following supports made my PhD possible.
i. UWS Postgraduate Research Award (Intl) and UWS Fee Waiver
Scholarship from the Western Sydney University, Australia.
ii. The Doctoral Studies Support from the Pokhara University, Nepal.
iii. Australian Research Council Discovery Grant (DP130102593 to Chris
Cazzonelli and Barry Pogson).
iv. The Grammarly premium, an online grammar checking and proofreading
service (www.grammarly.com).
I declare no conflict of interest.
v
Preface
This thesis comprises the original research I conducted with close supervision from my supervisors Christopher Cazzonelli (primary supervisor), David Tissue, and
Barry Pogson. I, with guidance from the supervisory panel, conceptualised research projects, conducted experiments, and collected, analysed, and interpreted the data presented herein except acknowledged otherwise. I have written this thesis, and prepared manuscripts originated from the data included in this thesis to publish in peer review journals, with immense contribution from supervisors and co-authors. Co- authors listed in chapters (one, two, and three) made contributions best justifiable to their authorship in the respective publications. Each chapter in this thesis is self- contained and presented in a format appropriate for peer-review journals; therefore, repetition to some degree may exist where recurrent methodologies and contextual data and literature are highlighted. The HPLC method for carotenoid separation was improvised as the analysis progressed from wild type to a wide range of mutants that accumulate specific carotenoids, therefore the reverse phase solvent composition and gradient varies among chapters. The WSU thesis format guidelines are not specific on bibliography format; hence, I have followed the referencing style of the journal Plant
Physiology, which has a global acceptance in plant science.
The chronologically listed research and review papers below are part of the data and/or literature review included in this thesis that has been published and/or at the final stages of peer review. The list also includes manuscripts to which, as a co- author, I contributed to generate data and manuscript preparation.
1. Alagoz, Y., Nayak, P., Dhami, N., Cazzonelli, C. I. (2018). "cis-carotene
biosynthesis, evolution and regulation in plants: The emergence of novel signaling
metabolites." Archives of Biochemistry and Biophysics 654: 172-184. (Chapter 1,
part of).
vi
2. Dhami, N., Tissue, D. T., Cazzonelli, C. I. (2018). Leaf-age dependent response of
carotenoid accumulation to elevated CO2 in Arabidopsis. Archives of Biochemistry
and Biophysics 647: 67-75. (Chapter 2).
3. Dhami, N., Drake, J. E., Tjoelker, M. G., Tissue, D. T., Cazzonelli, C. I. (under
final review). An extreme heatwave enhanced the xanthophyll de-epoxidation state
in leaves of Eucalyptus trees grown in the field. Physiology and Molecular Biology
of Plants. (Chapter 3).
4. Cazzonelli C. I., Hou X., Alagoz, Y., Rivers, J., Dhami, N., Lee, J., Shashikanth,
M., Pogson, B. J. (under final review). A cis-carotene derived apocarotenoid
regulates etioplast and chloroplast development. eLife. (In the context of Chapter 5,
Abstract is in Annex II).
Besides, the data included in this thesis has been presented publicly in the following conferences in Australia and abroad.
1. Dhami, N., Pogson, B. J., Tissue, D. T., Cazzonelli C. I. (Talk). Young leaves of
Arabidopsis thaliana provide a model system to investigate carotenogenesis and
chloroplast development. 30th International Conference on Arabidopsis Research
(ICAR2019), June 16-21, 2019, Wuhan, China. (Annex III)
2. Dhami, N., Alagoz, Y., Tissue, D. T., Cazzonelli C. I. (Poster and short talk). Leaf
maturation affects carotenoid metabolism in Arabidopsis. ComBio2017, October
2-5, 2017, Adelaide, Australia. (Annex IV)
3. Dhami, N., Tissue, D. T., Pogson B. J., Cazzonelli C. I. (Poster presented by
Chris). Immature Arabidopsis leaves have a greater pigment sink capacity
revealing a subtle increase in carotenoids under elevated atmospheric CO2.
International Symposium on Carotenoids, July 9-14, 2017, Lucerne, Switzerland.
(Annex V)
vii
4. Dhami N., Aryal R., Pogson B. J., Cazzonelli C. I. (Poster). Carotenoid
homeostasis and environmental memory acquisition in plants. Mechanism and
Mysteries in Epigenetics Conference. Garvan Institute of Medical Research. April
21, 2016, Sydney, Australia. (Annex VI)
viii
Table of contents
Dedication ...... i
Acknowledgement ...... ii
Statement of authentication ...... iv
Declaration ...... v
Preface ...... vi
Table of contents ...... ix
List of figures ...... xvi
List of tables ...... xix
List of abbreviations and Latinised symbols ...... xx
Summary ...... xxiv
Thesis structure ...... xxv
...... 1
Abstract ...... 2
1.1 Carotenoids in general ...... 3
1.2 Biosynthesis of carotenoids ...... 4
1.3 Tissue-specific accumulation of carotenoids ...... 7
1.4 Degradation of carotenoids ...... 10
1.5 Regulation of carotenogenesis in leaves ...... 12
1.6 Function of carotenoids in plant development ...... 19
1.7 Carotenoids and leaf development: impacts of cell, plastid and retrograde
signals ...... 23
1.8 Environmental impacts on carotenogenesis ...... 27 ix
1.8.1 Light...... 28
1.8.2 Carbon dioxide ...... 30
1.8.3 Temperature ...... 33
1.8.4 Soil nutrient and water availability ...... 35
1.9 Knowledge gaps in carotenogenesis in leaves ...... 38
1.10 Aim of the study ...... 42
1.11 Hypotheses ...... 43
1.12 Objectives ...... 45
1.12.1 Impact of elevated CO2 on the growth performance and foliar carotenoid
pool in Arabidopsis ...... 46
1.12.2 Impact of elevated temperature on the foliar carotenoid pool in Eucalyptus
leaves ...... 46
1.12.3 Impact of cold exposure on carotenogenesis during leaf development in
Arabidopsis ...... 46
1.12.4 Regulation of carotenogenesis during the Arabidopsis leaf maturation .... 46
1.13 Research design ...... 47
...... 48
Abstract ...... 49
2.1 Introduction ...... 50
2.2 Materials and methods ...... 55
2.2.1 Plant growth conditions ...... 55
2.2.2 Phenotype assessment ...... 56
2.2.3 Leaf tissue collection for pigment measurement ...... 56 x
2.2.4 Pigment extraction ...... 57
2.2.5 Pigment measurement ...... 57
2.2.6 Gas exchange measurements ...... 59
2.2.7 Data analysis and illustrations ...... 59
2.3 Results ...... 59
2.3.1 CO2 enrichment enhanced photosynthesis and plant biomass...... 59
2.3.2 CO2 enrichment enhanced carotenoids in young recently emerged leaves . 61
2.3.3 Interaction between eCO2 and carotenoid accumulation in leaves is age-
dependent ...... 62
2.3.4 Carotenoid accumulation decreases with leaf-age ...... 64
2.4 Discussion ...... 67
...... 73
Abstract ...... 74
3.1 Introduction ...... 75
3.2 Materials and methods ...... 79
3.2.1 Experimental site and long-term warming and heatwave treatments ...... 79
3.2.2 Pigment measurements ...... 80
3.2.3 Data analysis ...... 81
3.3 Results ...... 82
3.3.1 Leaf maturation and long-term warming does not affect zeaxanthin content
or the xanthophyll de-epoxidation state ...... 82
3.3.2 Extreme heatwave enhanced zeaxanthin content and xanthophyll de-
epoxidation state ...... 85 xi
3.4 Discussion ...... 91
...... 96
Abstract ...... 97
4.1 Introduction ...... 98
4.2 Materials and methods ...... 100
4.2.1 Germplasm and plant growth conditions ...... 100
4.2.2 Carotenoid measurement ...... 101
4.2.3 Data analysis and illustrations ...... 103
4.3 Results ...... 103
4.3.1 Foliar carotenoid profile remains unchanged in prolonged cold exposed
leaves ...... 103
4.3.2 Shorter exposure to cold decreased foliar carotenoid content in young
leaves ...... 112
4.4 Discussion ...... 117
...... 122
Abstract ...... 123
5.1 Introduction ...... 125
5.2 Materials and methods ...... 131
5.2.1 Germplasm, source and screening ...... 131
5.2.2 Plant growth conditions ...... 133
5.2.3 Leaf tissue collection ...... 134
5.2.4 Seedling greening assay ...... 134
5.2.5 Norflurazon assay ...... 135 xii
5.2.6 Pigment extraction ...... 136
5.2.7 Pigment measurement ...... 136
5.2.8 Arabidopsis transcriptome database search ...... 137
5.2.9 Primer design ...... 138
5.2.10 Gene expression profiling by quantitative real-time PCR ...... 138
5.2.11 Data analysis ...... 139
5.3 Results ...... 139
5.3.1 Some genes involved in carotenoid metabolism regulatory pathways are
differentially expressed in young and old leaves ...... 140
5.3.2 Age-related decline in foliar carotenoid content is independent of leaf
developmental phase ...... 144
5.3.3 Carotenoid degradation does not cause an age-dependent decline in foliar
carotenoid content ...... 146
5.3.4 Carotenoid isomerase mutant impairs carotenoid accumulation in a leaf-age
dependent manner ...... 150
5.3.5 Age-related decline in foliar carotenoids is independent to changes in lutein
or other xanthophyll carotenoids ...... 156
5.3.6 Young leaves have a greater capacity to accumulate phytoene ...... 158
5.3.7 Carotenoid isomerase mutants enhance phytoene accumulation in young
leaf tissues...... 162
5.3.8 Norflurazon treatment reduced carotenoid content in young leaves ...... 165
5.3.9 Darkness and temperature fluctuations alter both phytoene and downstream
carotenoid accumulation in young leaves ...... 171
xiii
5.3.10 Dark and cold treatment alters carotenoid composition ...... 176
5.3.11 Chlorophyll content declines similar to carotenoids during leaf maturation
...... 179
5.3.12 Environmental factors alter chlorophyll content as carotenoids during leaf
maturation ...... 182
5.4 Discussion ...... 187
5.4.1 Leaf developmental phase identities do not affect the foliar carotenoid
content ...... 190
5.4.2 Enzymatic degradation is not responsible for declining carotenoid content
in older leaves ...... 191
5.4.3 Carotenoid and chlorophyll content are co-regulated during leaf maturation
...... 192
5.4.4 CRTISO regulates a cis-carotene derived apocarotenoid signal that affects
chloroplast development in young leaf tissues ...... 194
5.4.5 Young leaves synthesise a substantially higher level of phytoene ...... 198
5.4.6 Plastid development in young leaves is highly sensitive to cold, darkness,
and norflurazon ...... 200
5.4.7 Young leaves provide a new model tissue to hunt for intracellular signals
that control plastid biogenesis and carotenoid metabolism ...... 201
...... 211
6.1 Leaf-age and environmental conditions can alter the level of photosynthetic pigments ...... 212
6.2 Leaf-age related decline in carotenoid content is independent of the leaf developmental phase transition ...... 217
xiv
6.3 Enzymatic oxidation of carotenoids is not responsible for declining carotenoid content during leaf aging ...... 218
6.4 Developmental state of chloroplasts determines the level of photosynthetic pigments in leaves ...... 219
6.5 Young leaves have a high degree of plasticity to alter carotenoid content and composition to suit the prevailing environment ...... 224
6.6 Leaves are highly plastic to alter the xanthophyll cycle facilitating thermal tolerance in response to an extreme heatwave ...... 232
6.7 Young leaves of Arabidopsis can be an efficient in-planta model system to explore plastid development and plastidial metabolism ...... 234
6.8 Clarifications, Limitations, and Recommendations ...... 236
6.8.1 Leaf samples (Fresh vs Dried) ...... 236
6.8.2 Quantification of carotenoids and chlorophylls ...... 238
6.8.3 Future directions ...... 240
References ...... 242
Annex I ...... 293
Annex II...... 295
Annex III ...... 297
Annex IV ...... 299
Annex V ...... 301
Annex VI ...... 303
xv
List of figures
Figure 1.1 A general route for the carotenogenesis in plants...... 6
Figure 1.2 Schematic summary of the phenotypic, physiological and biochemical alterations in plants exposed to the elevated atmospheric CO2...... 31
Figure 1.3 A conceptual outline of the possible scenarios by which CO2, temperature, and leaf-age can influence carotenogenesis in Arabidopsis leaves...... 43
Figure 2.1 Elevated CO2 enhances Arabidopsis plant biomass and photosynthesis.... 60
Figure 2.2 Elevated CO2 increases carotenoid and chlorophyll levels in young expanding leaves...... 62
Figure 2.3 Leaf-age interaction effects carotenoid accumulation in response to elevated CO2...... 64
Figure 2.4 Younger leaves have higher carotenoid levels compared to older leaves. . 66
Figure 3.1 The effects of prolonged warming on carotenoid and chlorophyll content in
Eucalyptus parramattensis leaves...... 84
Figure 3.2 The effects of an extreme heatwave on carotenoid and chlorophyll content in the old leaves of Eucalyptus parramattensis...... 87
Figure 3.3 The effects of an extreme heatwave on carotenoid and chlorophyll content in Eucalyptus parramattensis leaves...... 88
Figure 3.4 The effects of an extreme heatwave on carotenoid and chlorophyll content in Eucalyptus parramattensis leaves...... 89
Figure 3.5 A simplified scheme illustrating the de-epoxidation of violaxanthin and antheraxanthin enriching zeaxanthin in Eucalyptus leaves during the heatwave exposure...... 95
Figure 4.1 Arabidopsis plants grown under ambient and prolonged cold conditions.
...... 104
xvi
Figure 4.2 Foliar carotenoid content and composition in Arabidopsis grown under normal growth conditions...... 107
Figure 4.3 Foliar carotenoid content and composition in prolong cold exposed plants.
...... 111
Figure 4.4 Foliar carotenoid content and composition in leaves exposed to short-term non-freezing cold...... 114
Figure 4.5 Changes in carotenoid and chlorophyll content and proportion in
Arabidopsis leaves in response to short-term cold exposure...... 116
Figure 5.1 Age-dependent expression profile of carotenoid metabolism regulatory pathway genes in Arabidopsis rosette leaves...... 143
Figure 5.2 Carotenoid content in the young and old leaves of developmental phase regulatory pathway altered lines...... 145
Figure 5.3 Carotenoid content in the young and old leaves of the carotenoid degradation pathway regulatory lines...... 147
Figure 5.4 Carotenoid content in the greening cotyledons in response to D15...... 149
Figure 5.5 Carotenoid content in the young and old leaves of carotenoid biosynthetic pathway regulatory lines...... 152
Figure 5.6 Carotenoid content in the young and old leaves of CrtI overexpression lines...... 155
Figure 5.7 Carotenoid content in the young and old leaves of the xanthophyll biosynthetic pathway mutant lines...... 157
Figure 5.8 Optimization of the norflurazon bioassay using Arabidopsis whole rosette.
...... 161
Figure 5.9 Phytoene accumulation in young and old leaves of Arabidopsis in response to norflurazon treatment...... 164
xvii
Figure 5.10 Carotenoid content in the young and old leaves of the norflurazon treated plants after different incubation time points...... 167
Figure 5.11 Norflurazon induced changes in foliar carotenoid content in the carotenoid pathway altered genotypes...... 170
Figure 5.12 Phytoene content in the young and old leaves of Arabidopsis treated with norflurazon under different temperature and light conditions...... 172
Figure 5.13 Carotenoid content in young and old leaves of Arabidopsis exposed to different temperature and light conditions...... 175
Figure 5.14 Proportions of the major foliar carotenoids in young and old leaves of
Arabidopsis exposed to the different conditions of light, temperature and norflurazon.
...... 178
Figure 5.15 Chlorophyll content in young and old leaves of carotenoid biosynthetic pathway impaired and overexpression lines of Arabidopsis...... 181
Figure 5.16 Chlorophyll content in young and old leaves of Arabidopsis exposed to different light and temperature conditions and norflurazon...... 183
Figure 5.17 Carotenoid to total chlorophyll ratio in response to leaf age and environmental treatments...... 186
Figure 6.1 Schematic diagrams showing structural differences in the cells from young and mature leaves...... 213
Figure 6.2 Illustration of the age-dependent response of photosynthetic pigments to environmental changes in Arabidopsis leaves...... 231
Figure 6.3 Foliar carotenoids in fresh and dry tissues of Arabidopsis leaves...... 238
Figure 6.4 Calibration curve of β-Carotene...... 239
xviii
List of tables
Table 1.1 Functional characteristics of mesophyll cells from young and mature leaves.
...... 25
Table 2.1 Elevated atmospheric CO2 has varied effects on foliar carotenoid and chlorophyll pigment content within and between different plant species...... 53
Table 3.1 Probability values for the effect of long-term warming and an extreme heatwave on carotenoid and chlorophyll content in young and old leaves of
Eucalyptus parramattensis...... 90
xix
List of abbreviations and Latinised symbols
Abbreviation/Symbol Description
ATP Adenosine triphosphate
Alpha
ANOVA Analysis of variance
BCH1 β-CAROTENOID HYDROXYLASE 1
BCH2 β-CAROTENOID HYDROXYLASE 2
Beta
Ca. Circa
CCD1 CAROTENOID CLEAVAGE DIOXYGENASE
CCD4 CAROTENOID CLEAVAGE DIOXYGENASE 4
CCD7 CAROTENOID CLEAVAGE DIOXYGENASE 7
CCD8 CAROTENOID CLEAVAGE DIOXYGENASE 8
CrtI PHYTOENE DESATURASE
CRTISO CAROTENOID ISOMERASE
D/N Day/Night
DXS1 1-DEOXY D-XYLULOSE-5 PHOSPHATE SYNTHASE 1
DXS2 1-DEOXY D-XYLULOSE-5 PHOSPHATE SYNTHASE 2
DXS3 1-DEOXY D-XYLULOSE-5 PHOSPHATE SYNTHASE 3 oC Degrees Celsius
∆ Delta
DAD Diode Array Detector
Epsilon
FIB4 FIBRILLIN 4
Gamma
GPPS GERANYL DIPHOSPHATE SYNTHASE
GGPPS1 GERANYLGERANYL DIPHOSPHATE SYNTHASE 1
xx
GGPPS2 GERANYLGERANYL DIPHOSPHATE SYNTHASE 2
GGPPS3 GERANYLGERANYL DIPHOSPHATE SYNTHASE 3
GGPPS4 GERANYLGERANYL DIPHOSPHATE SYNTHASE 4
GGPPS6 GERANYLGERANYL DIPHOSPHATE SYNTHASE 6
GGPPS7 GERANYLGERANYL DIPHOSPHATE SYNTHASE 7
GGPPS8 GERANYLGERANYL DIPHOSPHATE SYNTHASE 8
GGPPS9 GERANYLGERANYL DIPHOSPHATE SYNTHASE 9
GGPPS10 GERANYLGERANYL DIPHOSPHATE SYNTHASE 10
GGPPS11 GERANYLGERANYL DIPHOSPHATE SYNTHASE 11
GGPPS12 GERANYLGERANYL DIPHOSPHATE SYNTHASE 12 gfw Gram fresh weight gdw Gram dry weight
Hz Hertz
HPLC High-pressure liquid chromatography h Hour
4-HYDROXY-3-METHYLBUT-2-ENYL DIPHOSPHATE HDR REDUCTASE
L/D Light/Dark
LCYB LYCOPENE β-CYCLASE
LCYE LYCOPENE ε-CYCLASE m Meter
µl Microliter
µg Microgram
µmol Micromole miR156a MICRORNA 156A miR156b MICRORNA 156B miR172a MICRORNA 172A
xxi miR172b MICRORNA 172B
μmol m-2 sec-1 Micromole per meter2 per second mg Milligram mm Millimetre min Minute
MS media Murashige and Skoog media nm Nanometer nmol Nanomole
NADPH Nicotinamide adenine dinucleotide phosphate (reduced)
N Nitrogen ppm Parts per million
PAR Photosynthetically active radiation
PCR Polymerase chain reaction qRT PCR Quantitative real-time PCR rpm Revolutions per minute
N Sample size
NCED2 9-CIS-EPOXYCAROTENOID DIOXYGENASE 2
NCED3 9-CIS-EPOXYCAROTENOID DIOXYGENASE 3
NCED5 9-CIS-EPOXYCAROTENOID DIOXYGENASE 5
NCED6 9-CIS-EPOXYCAROTENOID DIOXYGENASE 6
NCED9 9-CIS-EPOXYCAROTENOID DIOXYGENASE 9,
NXS NEOXANTHIN SYNTHASE
PDS PHYTOSNE DESATURASE
PSY PHYTOENE SYNTHASE
Sec Second
SPL2 SQUAMOSA PROMOTER BINDING PROTEIN LIKE 2
SPL3 SQUAMOSA PROMOTER BINDING PROTEIN LIKE 3
xxii
SPL4 SQUAMOSA PROMOTER BINDING PROTEIN LIKE 4
SPL5 SQUAMOSA PROMOTER BINDING PROTEIN LIKE 5
SPL6 SQUAMOSA PROMOTER BINDING PROTEIN LIKE 6
SPL9 SQUAMOSA PROMOTER BINDING PROTEIN LIKE 9
SPL10 SQUAMOSA PROMOTER BINDING PROTEIN LIKE 10
SPL11 SQUAMOSA PROMOTER BINDING PROTEIN LIKE 11
SPL13 SQUAMOSA PROMOTER BINDING PROTEIN LIKE 13
SPL15 SQUAMOSA PROMOTER BINDING PROTEIN LIKE 15 spp. Species
VDE VIOLAXANTHIN DE-EPOXIDASE vol/vol Volume/Volume
ZEP ZEAXANTHIN EPOXIDASE
ζ Zeta
ZDS ζ-CAROTENE DESATURASE
Z-ISO or ZISO ζ-CAROTENE ISOMERASE
xxiii
Summary
The regulation of carotenogenesis during the leaf maturation, before the onset of senescence, remains poorly explored. In this thesis, I demonstrated that young leaves of Arabidopsis, which have a high chloroplast density because of the high density of actively dividing and expanding mesophyll cells, can accumulate nearly 60 % higher amounts of both carotenoids and chlorophylls compared to the older leaves. Analysis of a range of mutants and gene overexpression genotypes revealed that age-related decline in carotenoids in older leaves was not associated with biosynthesis or degradation pathways of carotenoids neither with the developmental phase identities of leaves. I also discovered younger leaves were highly plastic in decreasing the level of both carotenoids and chlorophylls rapidly in response to short-term (24-hours) exposure to darkness, low temperature (7 oC), and norflurazon (a bleaching herbicide) treatment while the elevated level of atmospheric CO2 increased the level of both pigments in younger leaves. The level of carotenoids and chlorophylls was unaffected in older leaves regardless of the perpetual increase in atmospheric CO2 and short-term environmental and norflurazon treatments. Pigment accumulation in younger leaves demonstrated rapid responsiveness to environmental conditions and norflurazon, arguably, due to the higher rate of plastid biogenesis and division in the rapidly dividing and expanding cells. Collectively, the state of chloroplast development and chloroplast density can be the primary determinants of the photosynthetic pigment content in leaves. Young leaves, thus, can provide better in-planta model systems to decipher how developmental and environmental signals affect plastid development, signalling, and carotenoid biosynthesis during Arabidopsis leaf development.
xxiv
Thesis structure
This thesis comprises six chapters, of which, chapter 2, 3, 4, and 5 include original data. An introductory chapter incorporates a literature review (Chapter 1), and a general discussion (Chapter 6) includes the in-depth synthesis of results.
Following sections are the highlights of each chapter.
Chapter 1 describes the generic aspects of carotenoid metabolism, including biosynthesis, degradation, sequestration, and regulation along with the fundamental roles of carotenoids in plant development emphasising leaves. It also incorporates impacts of environmental conditions such as light, carbon dioxide (CO2), temperature, drought, and soil nutrient availability regulating carotenogenesis in plants. Here, I have highlighted the knowledge gaps in carotenogenesis research, particularly during the developmental changes in leaves as challenged by environmental perturbations. In concert with the published literature, I have formulated the working hypothesis that the developmental changes in leaves can affect carotenogenesis; therefore, the response to the environmental perturbations.
Chapter 2 reveals the impacts of elevated atmospheric CO2 on the growth performance and level of photosynthetic pigments in Arabidopsis. Elevated CO2 increased the number of leaves, rosette area, shoot biomass, seed yield, and net photosynthesis. The highlight of the chapter is that CO2 enrichment significantly increased the level of both carotenoids and chlorophylls in young leaves, whereas that of old leaves remained unchanged. Here, I demonstrate a higher capacity of younger leaves to utilise additional carbon from enhanced photosynthesis under elevated CO2 to increase carotenoid content, yet older leaves have less ability to synthesise and/or store additional pigments.
xxv
Chapter 3 demonstrates the impacts of long-term warming (+3 oC) and short- term heatwave (> 43 oC) on carotenoid content in Eucalyptus parramattensis leaves from the plants grown in the whole-tree chamber (WTC) in the field conditions. Here,
I reveal de-epoxidation of violaxanthin to enhance zeaxanthin accumulation in both young and old leaves from heatwave exposed Eucalyptus trees. However, the level of carotenoids remained unaffected in leaves from the Eucalyptus grown under long- term warming (+3 oC) temperature. I describe how xanthophyll cycle carotenoids can attenuate heat-induced oxidative stress, enhancing heat tolerance in Eucalyptus leaves during extreme heatwave events.
Chapter 4 demonstrates the impacts of short- and long-term cold exposure on the level of carotenoid and chlorophyll during Arabidopsis leaf development. Here, I reveal the leaf-age dependent effects on the level of both carotenoid and chlorophyll contents in response to a short-term (24-hours) cold treatment. This chapter discloses the novel finding that cold exposure can decrease both carotenoid and chlorophyll content in young leaves, whereas that of old leaves remain unchanged. Also, young leaves that were emerged during cold treatment and exposed to long-term cold accumulated a significantly higher level of both carotenoids and chlorophylls, demonstrating a typical age-related decline in pigment content in old leaves.
Interestingly, a similar response of both carotenoids and chlorophylls to cold exposure implicates leaf-age related factor determining the photosynthetic pigment content in
Arabidopsis leaves.
Chapter 5 reveals the mechanistic aspects of carotenogenesis during
Arabidopsis leaf development. In this chapter, I have dissected all possible scenarios affecting the level of carotenoids in leaves during developmental changes and in response to the changing environmental conditions. The transcript profile of the
xxvi critical genes that control isoprenoid biosynthesis (MEP pathway), carotenoid biosynthesis and degradation, and leaf phase regulatory pathways displays the age- related differential expression of the respective genes in young and old leaves from
WT Arabidopsis. The carotenoid and chlorophyll profile in young and old leaves from a wide range of mutant and gene overexpression lines in carotenoid biosynthesis and degradation and leaf phase regulatory pathways demonstrates new insights in carotenogenesis during leaf development.
Examination of norflurazon induced phytoene accumulation in young and old leaves of different mutant and overexpression lines in combination with different light and temperature conditions highlights that carotenogenesis can be regulated strictly with chloroplast development as leaves progress through to maturation. This chapter discloses that short-term exposure (24-hours) to darkness, low temperature (7 oC), and norflurazon decrease the level of both carotenoids and chlorophylls in leaves implicating structural attributes of cell and chloroplasts to control photosynthetic pigment content in leaves. Collectively, I describe mechanistic insights whereby young leaves accumulate a substantially high level of carotenoids, which is, indeed, highly plastic to the environmental changes such as darkness, cold, and norflurazon.
Finally, chapter 6 summarises the outcomes of the thesis consolidating the developmental and environmental regulatory aspects of carotenogenesis in
Arabidopsis leaves. I have emphasised the state of chloroplast development and density as the primary determinants of the photosynthetic pigment content in
Arabidopsis leaves and highlighted how young leaves of Arabidopsis could become a unique in-vivo system to explore chloroplast development and carotenoid metabolism.
I have also highlighted limitations of the research and recommendations for the future research endeavours to explore the mechanism of what controls photosynthetic
xxvii pigment homeostasis in Arabidopsis leaves in response to environmental perturbations during maturation.
Cover-page photograph: A long photoperiod-grown four-week-old Arabidopsis thaliana (Col-0) rosette (lower surface) displaying an ontogenic leaf numbering.
xxviii
General introduction
I have co-authored a review article (part of this chapter) published as Alagoz, Y., Nayak, P., Dhami, N., Cazzonelli, C., I. (2018). "cis-carotene biosynthesis, evolution and regulation in plants: The emergence of novel signalling metabolites. "Archives of Biochemistry and Biophysics 654: 172-184. Abstract of the article is given below, but the full text is not included in this dissertation.
Abstract Carotenoids are isoprenoid pigments synthesised by plants, algae, photosynthetic bacteria as well as some non-photosynthetic bacteria, fungi and insects. Abundant carotenoids found in nature are synthesised via a linear route from phytoene to lycopene after which the pathway bifurcates into cyclised alpha- and beta-carotenes. Plants evolved additional steps to generate a diversity of cis-carotene intermediates, which can accumulate in fruits or tissues exposed to an extended period of darkness. Enzymatic or oxidative cleavage, light-mediated photoisomerisation and histone modifications can affect cis-carotene accumulation. cis-carotene accumulation has been linked to the production of signalling metabolites that feedback and forward to regulate nuclear gene expression. When cis-carotenes accumulate, plastid biogenesis and operational control can become impaired. Carotenoid-derived metabolites and phytohormones such as abscisic acid and strigolactones can fine-tune cellular homeostasis. There is a hunt to identify the cis-carotene-derived apocarotenoids and elucidate the molecular mechanism by which apocarotenoid signals facilitate communication between the plastid and nucleus. In this review, we describe the biosynthesis and evolution of cis-carotenes and their links to regulatory switches, as well as highlight how cis-carotene-derived apocarotenoid signals might control organelle communication, physiological and developmental processes in response to environmental change.
1
Environmental regulation of carotenoid metabolism in plants Abstract
Carotenoids and their oxidation products facilitate photosynthesis, photomorphogenesis, developmental transitions, thermal tolerance, drought tolerance, and environmental adaptation of plants. The regulation of biosynthesis, degradation, and sequestration of carotenoids in both photosynthetic and non-photosynthetic tissues has been rigorously researched in different plants. The fundamental developmental changes in plants and external environmental perturbations massively affect production as well as functions of both carotenoids and their oxidation products. The literature review included herein highlights the genetic regulatory aspects of carotenoid metabolism and the critical functions of carotenoids in plants. I have summarised the knowledge pool regarding the impacts of environmental conditions such as light, carbon dioxide (CO2), temperature, drought, and soil nutrient availability in regulating carotenoid metabolism in plants. Carotenogenesis has been extensively explored in non-photosynthetic tissues such as fruits and roots. Here, I have highlighted the knowledge gaps in carotenogenesis in leaves, particularly during the developmental changes challenged by the environmental perturbations. In concert with the published literature, I hypothesised that morphological characteristics such as developmental phase and functional attributes such as the photosynthetic capacity of leaves could affect carotenoid content in environmental condition-dependent manner.
2
1.1 Carotenoids in general
Carotenoids are 40-carbon isoprenoids that are synthesised de novo in carotenogenic organisms including plants (Sun et al., 2018), algae (Takaichi, 2011), cyanobacteria (Liang et al., 2006), bacteria (Klassen, 2010), and fungi (Echavarri-
Erasun and Johnson, 2002), although some microorganisms produce carotenoids with
50-, 35-, and 30-carbon backbones (Umeno and Arnold, 2003; Steiger et al., 2012;
Furubayashi et al., 2015). A few insects are the only known members from the animal kingdom, which can synthesise carotenoids de novo demonstrating the lateral transfer of carotenogenic gene cascades from the fungal donors such as pea aphids (Moran and Jarvik, 2010; Novakova and Moran, 2012), phylloxerids (Zhao and Nabity, 2017), spider mites (Grbic et al., 2011; Altincicek et al., 2012), and gall midges (Cobbs et al.,
2013). Despite ubiquitous occurrence of carotenoids in non-carotenogenic organisms, where they facilitate a wide array of biological functions (Vershinin, 1999; Britton et al., 2008; Takaichi, 2011), all non-carotenogenic organisms including humans fulfil biological carotenoid requirement via dietary intake of carotenoid-rich ingredients obtained from the carotenogenic organisms, most commonly the algae and higher plants.
The isolation of β-carotene from carrot roots by Wakenroder, HWF (1798-
1854) in 1831 was the first historic milestone in carotenoid biology research (Sourkes,
2009). A century later, Paul Karrer (1889-1971) confirmed the chemical structure of
β-carotene and vitamin A during 1930-33 (Karrer, 1934), and he received the Nobel
Prize in Chemistry in 1937 for his breakthrough in carotenoid chemistry. After 70 years of the pioneering work of elucidating the chemical structure of β-carotene,
Britton and co-workers enumerated approximately 750 naturally occurring carotenoids reported from plants, algae, bacteria and fungi in 2004 (Britton et al.,
2004). Recently, an updated carotenoid database based on Yabuzaki (2017) has 3 compiled 1,181 natural carotenoids from 700 biological sources
(http://carotenoiddb.jp/, as of August 31, 2019). The legacy of nearly 200 years of research in carotenoid biology has witnessed tremendous achievements exploring novel biological functions of a variety of carotenoids in both carotenogenic and non- carotenogenic organisms.
1.2 Biosynthesis of carotenoids
In plants, carotenoid biosynthesis is traced as early as the onset of seed germination until seed set and embryo development (Goodwin, 1980; Ruiz-Sola and
Rodriguez-Concepcion, 2012). Carotenoid biosynthetic pathways have been explored in many carotenogenic organisms; however, Arabidopsis (Ruiz-Sola and Rodriguez-
Concepcion, 2012) and tomato (Enfissi et al., 2017) tissues are extensively studied as the model systems. Besides, Chlamydomonas, Dunaliella, and Chlorella species have been increasingly utilised to explore carotenoid biology in algae (Pérez-Pérez et al.,
2012; Fachet et al., 2017; Wang et al., 2018). The carotenoid biosynthetic pathway is substantially similar in all carotenogenic organisms; however, algae and plants comprise additional enzymatic steps synthesising cis-carotenes, unlike prokaryotes
(Figure 1.1), indicating evolutionary conserved biological functions of cis-carotenes.
In all carotenogenic organisms, carotenoid biosynthesis begins with the condensation of two geranylgeranyl pyrophosphate (GGPP) molecules by
PHYTOENE SYNTHASE (PSY) enzyme to make a 15-cis-phytoene molecule, a linear 40 carbon-containing colourless parental carotenoid (Rodriguez-Concepcion,
2010; Sun et al., 2018). In plants and algae, the sequential desaturation and isomerisation of 15-cis-phytoene catalysed by PHYTOENE DESATURASE (PDS),
ΖETA-CAROTENE ISOMERASE (ZISO), ΖETA-CAROTENE DESATURASE
(ZDS), and CAROTENOID ISOMERASE (CRTISO) generate all-trans-lycopene.
4
However, the conversion of phytoene into all-trans-lycopene is catalysed by a single enzyme PHYTOENE DESATURASE (CrtI) in prokaryotes (Harada et al., 2001). The extra enzymatic steps producing cis-carotenes signify a functional evolution of carotenogenesis in plants and algae producing a range of cis-carotenes. However, the evolutionary significance of cis-carotenoid biosynthesis and their biological functions are less understood in plants and algae, which has been discussed in our recent review paper (Alagoz et al., 2018).
All-trans-lycopene is a gateway substrate for the biosynthesis of both α- and β- carotenoids in the downstream of the carotenoid biosynthetic pathway. A pair of lycopene cyclase enzymes introduce terminal β- and ε- or β- and β-ionone rings in all- trans-lycopene. LYCOPENE β-CYCLASE (LCYB) adds two β-ionone rings, one by one via a γ-carotene intermediate, generating β-carotene. LYCOPENE ε-CYCLASE
(LCYE) adds one ε-ionone ring to produce a δ-carotene intermediate to which LCYB introduces a second β-ionone ring generating α-carotene. Next, α-carotene is hydroxylated into lutein, whereas β-carotene undergoes hydroxylation and epoxidation to produce neoxanthin via β-cryptoxanthin, zeaxanthin, antheraxanthin, and violaxanthin intermediates. β-carotene and neoxanthin are the precursors utilised to produce apocarotenoid phytohormones such as strigolactones and abscisic acid, respectively. Both carotenoids and apocarotenoids, thus synthesised, accumulate in different tissues where they facilitate or perform several vital biological functions such as photosynthesis, photoprotection, and phytohormone production to regulate plant development orchestrating the environmental conditions.
5
Figure 1.1 A general route for the carotenogenesis in plants.
The overall carotenogenesis can be broadly divided into three phases (preparation, biosynthesis, and degradation) depending on the nature of biochemical processes occurring in the respective phases. The preparatory phase encompasses the primary metabolic pathways that generate metabolite precursors particularly geranylgeranyl diphosphate (GGPP) which is subsequently utilised to synthesise phytoene commencing carotenogenesis. The carbon fixation during photosynthesis is the primary route to produce glucose, which is oxidised into pyruvate and glyceraldehyde, eventually feeding the methylerythritol 4-phosphate (MEP) pathway in the upstream of carotenogenesis. Also, the MEP pathway produces different isoprenoids that are utilised to produce a wide range of plastidial metabolites performing specific functions such as terpenoids, plastoquinones, and chlorophylls (Banerjee and Sharkey, 2014). The multistep biosynthetic pathway of carotenogenesis sequentially synthesises many cis- and trans-carotenes and xanthophylls that are localised in a tissue- specific manner (Rodriguez-Concepcion et al., 2018). Strikingly, a single PHYTOENE DESATURASE (CrtI) enzyme can convert phytoene into all-trans-lycopene in prokaryotes (Harada et al., 2001). The all-trans forms of carotenoids are rather stable; however, the developmental and environmental condition-dependent oxidation of both cis-and trans- carotenoids produces apocarotenoids including key phytohormones strigolactones and 6 abscisic acid from β-carotene and neoxanthin respectively (Harrison and Bugg, 2014). In the biosynthetic pathway illustrated above, steps with the symbol of Sun represent light- dependent regulation of the individual gene expression and/or enzyme activity. In photosynthetic leaves, the epoxidation and de-epoxidation of zeaxanthin and violaxanthin, respectively via antheraxanthin intermediate maintains the xanthophyll cycle facilitating photoprotection of photosystems and chloroplasts during excessive illumination (Sacharz et al., 2017). The double-lined arching arrow represents a bypass pathway resembling prokaryotes in which a single PHYTOENE DESATURASE (CrtI) can directly synthesise all- trans-lycopene (Galzerano et al., 2014). 1.3 Tissue-specific accumulation of carotenoids
In plants, several tissues can synthesise and store carotenoids ranging from embryonic to vegetative and reproductive stages. The vegetative and reproductive tissues comprise different types of plastids, reflecting diversity in plastid morphology, carotenoid chemistry, and biological functions (Bartley and Scolnik, 1995; Howitt and
Pogson, 2006). Previous studies have explored the specific role and capacity of different plastid types in carotenoid biosynthesis and sequestration (Howitt and
Pogson, 2006; Li et al., 2016; Sun et al., 2018). The proplastids are undifferentiated plastids lacking both thylakoid membranes and carotenoids, but they are the progenitors of all plastid types (Jarvis and Lopez-Juez, 2013; Li et al., 2016). The etioplasts of dark-grown tissues, such as cotyledons from the etiolated seedlings, sequester the smaller amount of carotenoids, but most dominantly lutein and violaxanthin that remain associated to the prolamellar bodies (PLBs) (Park et al.,
2002; Rodriguez-Villalon et al., 2009). Light exposure triggers the transformation of etioplasts into the photosynthetically functional chloroplasts, which accommodate a range of carotenoids. Chloroplasts in the photosynthetic tissues usually comprise lutein, β-carotene, violaxanthin, neoxanthin, zeaxanthin and antheraxanthin, which are conserved regardless of the plant species (Goodwin, 1980). However, different plants accumulate specific carotenoids in various tissues such as lycopene in tomato fruits and β-carotene in carrot roots demonstrating the tissue-specific accumulation of carotenoids.
7
In leaves, chloroplast membranes and thylakoids are the main sites of carotenoid biosynthesis and sequestration; however, the developmental stages of leaves can affect both chloroplast development and carotenogenesis (Cazzonelli and
Pogson, 2010). In Arabidopsis, recently emerged younger leaves comprise higher levels of foliar carotenoid content compared to older leaves (Stessman et al., 2002;
Dhami et al., 2018) and leaf senescence triggers chloroplast disintegration decreasing the level of carotenoids, concurrently with chlorophylls (Whitfield and Rowan, 1974;
Rottet et al., 2016). The ultrastructure and functional stages of chloroplasts vary drastically in young and mature leaves such as the rapid division and expansion of cells in young leaves gradually increase the leaf area (Gonzalez et al., 2012). Younger leaves contain poorly developed chloroplasts with fewer grana stacks and undifferentiated lamellae compared to the fully differentiated and larger chloroplasts comprising a highly ordered thylakoid network with a maximum number of grana stacks and thylakoid lamellae from the mature leaves (Gugel and Soll, 2017)(Kutík et al., 1999). However, an explanation for the observation that the level of carotenoids in young leaves was nearly double compared to that of old leaves remain unclear
(Stessman et al., 2002; Dhami et al., 2018). During leaf senescence, chloroplasts transform into gerontoplasts accommodating structural and functional alterations
(Parthier, 1988; Biswal et al., 2012). Thylakoid membranes degrade in gerontoplasts and carotenoids localise into plastoglobuli where carotenoids are enzymatically oxidised, as the leaf senescence progresses (Biswal, 1995; Thomas et al., 2003).
Collectively, the dynamic changes in the level and diversity of carotenoids in etioplasts, chloroplasts, and gerontoplasts from the leaves are tightly linked to enabling, performing, and ceasing the chloroplast functions, respectively. The regulation of carotenogenesis during leaf development is, therefore, tightly controlled
8 in concert with the prevailing environmental conditions to attain functional integrity of leaves.
In non-photosynthetic tissues, chromoplasts accumulate large quantities of specific carotenoids (Li and Yuan, 2013) such as lutein in marigold petals (Hadden et al., 1999), crocin in saffron stigma (Frusciante et al., 2014), lycopene in ripened tomato fruits (Enfissi et al., 2017), and β-carotene in carrot roots (Sourkes, 2009), which demonstrates the tissue-specific regulation of carotenoid sequestration. In chromoplasts, carotenoids form carotenoid-lipoprotein complexes remain associated with plastoglobuli (Li and Yuan, 2013). Crystalised carotenoids are also found in the chromoplasts such as in carrot roots (Frey-Wyssling and Schwegler, 1965; Maass et al., 2009; Kim et al., 2010) and ripe fruits such as tomato (Harris and Spurr, 1969), and mango (Vasquez-Caicedo et al., 2006). The biology of chloroplast-to-chromoplast transition and carotenogenesis is extensively studied during the development and ripening of climacteric fruits including tomato (de Vos et al., 2011; Egea et al., 2011;
Namitha et al., 2011; Pattison et al., 2015). The amyloplasts or leucoplasts are carotenoid sequestration sites in starch-rich tissues such as seeds, roots, and tubers
(Howitt and Pogson, 2006; Li et al., 2016). Lutein, zeaxanthin, and β-carotene are commonly found in starch-rich seeds of maize (Wurtzel, 2004; O'Hare et al., 2015), wheat (Abdel-Aal el et al., 2007; Hussain et al., 2015), rice (Lamberts and Delcour,
2008), millet (Shen et al., 2015), and soybean (Monma et al., 2014) and the tubers of potato (Brown et al., 1993; Morris et al., 2004), and sweet potato (Islam et al., 2016).
Likewise, elaioplasts store lutein and traces of other carotenoids in lipid-rich seeds
(Howitt and Pogson, 2006) such as canola (Shewmaker et al., 1999) and Arabidopsis
(Gonzalez-Jorge et al., 2013). The tissue-specific plastid types sequester specific carotenoids during plant development and in response to changes in the environmental conditions.
9
1.4 Degradation of carotenoids
Carotenoids and carotenoid-derived apocarotenoids are involved in multiple biological processes ranging from photosynthesis and photoprotection to phytohormone production and stress signalling in plants. The poly-unsaturated carbon skeleton of carotenoids allows them to generate multiple isomeric forms; however, being chemically stable, the trans-isomers dominate over cis-isomers (Schenk et al.,
2014; Baranski and Cazzonelli, 2016). The light and temperature conditions can affect isomerisation and, therefore, influence the stability of carotenoids both in vitro and in
14 vivo (Updike and Schwartz, 2003; Aman et al., 2005). The CO2 pulse-chase labelling technique demonstrated that incorporation of 14C in β-carotene occurred
14 within 30 minutes of CO2 administration, suggesting the continuous and a rapid biosynthesis and turnover of carotenoids in Arabidopsis leaves (Beisel et al., 2010;
Beisel et al., 2011). A developmentally programmed decrease in the level of carotenoids is seen during leaf maturation (Ghosh et al., 2001; Stessman et al., 2002;
Dhami et al., 2018), leaf senescence (Whitfield and Rowan, 1974; Rottet et al., 2016), and seed maturation (Gonzalez-Jorge et al., 2013) in plants. The CAROTENOID
CLEAVAGE DIOXYGENASE (CCD) and 9‐CIS‐EPOXYCAROTENOID
DIOXYGENASE (NCED) enzymes are known to catalyse oxidative cleavage of β- carotene and violaxanthin/neoxanthin respectively (Bouvier et al., 2005; Walter and
Strack, 2011) and produce biologically crucial apocarotenoids. The oxidation of β- carotene produces strigolactones and signalling apocarotenoids such as β-cyclocitral, dihydroactinidiolide and β-ionone in plants (Walter and Strack, 2011; Havaux, 2014;
Rottet et al., 2016). NCEDs are known to cleave violaxanthin and/or neoxanthin that commence abscisic acid biosynthesis (Nambara and Marion-Poll, 2005). The biological functions of strigolactones and abscisic acid in root as well as shoot branching and stomata functioning, respectively, signify the essential roles for
10 carotenoid turnover, but in a tissue-specific manner (Finkelstein, 2013; Al-Babili and
Bouwmeester, 2015).
In mature leaves, carotenoid content attains steady state regardless of the continuous turnover (Beisel et al., 2010; Beisel et al., 2011). However, enhanced enzymatic degradation of β-carotene (particularly by CCD4) takes place during leaf senescence and seed maturation (Biswal, 1995; Gonzalez-Jorge et al., 2013; Rottet et al., 2016). The ccd4 mutants accumulate a higher level of β-carotene, confirming
CCD4 as a negative regulator of β-carotene accumulation in Arabidopsis seeds
(Gonzalez-Jorge et al., 2013; Bruno et al., 2015). β-carotene is also cleaved by CCD7 to commence strigolactone biosynthesis (Bruno et al., 2014). Xanthophylls are the less likely substrates of CCDs; however, CCD4 dependent oxidative degradation of lutein and violaxanthin can occur in senescing chloroplasts (Rottet et al., 2016).
Interestingly, CCD genes demonstrated a tissue-specific expression profile and differential response to hormone treatment and stress conditions such as in apple
(Chen et al., 2018). In Arabidopsis roots, but not in shoots, application of D15 (an aryl-C3N hydroxamic acid analog), a chemical inhibitor of CCD activity, enhanced carotenoid content nearly 80% due to the reduced enzymatic degradation of carotenoids (Van Norman et al., 2014). Also, non-enzymatic oxidation contributes to carotenoid degradation and generation of apocarotenoids in leaves, particularly during environmental stress conditions (Havaux, 2014; Schaub et al., 2017). Carotenoid degradation, thus, represents a crucial regulatory phenomenon controlling the tissue- specific carotenoid accumulation and understanding how environmental and developmental cues can affect carotenoid turnover.
11
1.5 Regulation of carotenogenesis in leaves
The ubiquitous presence of a range of carotenoids in the different tissue types that perform specific biological functions requires a tight synchronisation in biosynthesis, degradation, and sequestration of carotenoids. Carotenogenesis is specialised in a tissue-specific manner; hence, fundamental developmental changes can affect biosynthesis as well as accumulation of carotenoids. The diurnal and seasonal changes in environmental conditions and instantaneous stresses imposed by different biotic and abiotic factors can also influence both biosynthesis and degradation of carotenoids (Kim et al., 2011; Holeski et al., 2012; Moore et al., 2014;
Esteban et al., 2015). In leaves, carotenoids are involved in a multitude of functions; hence, carotenogenesis is regulated, maintaining the functional integrity of chloroplasts in response to endogenous physiological cues and environmental changes. There are many contemporary reviews on the molecular interactions that regulate carotenogenesis in different tissue types (Liu et al., 2015; Nisar et al., 2015;
Yuan et al., 2015; Llorente, 2016). However, environment-induced regulation of carotenoid metabolism remains obscure despite noticeable alterations in carotenoid content in leaves under different magnitudes of light, temperature, CO2, drought, and nutrients.
The production of isoprenoid precursors is prerequisite to initiate carotenogenesis. The first rate-limiting step of the MEP pathway is catalysed by the enzyme DXS that commences and controls the production of isoprenoid precursors for carotenoid biosynthesis. The MEP pathway itself is dynamically regulated to orchestrate the developmental stage of the tissues and environmental conditions, which has been rigorously studied (Bruggemann and Schnitzler, 2002; Walter et al.,
2012) and reviewed (Cordoba et al., 2009; Banerjee and Sharkey, 2014). The end product of the MEP pathway, GGPP, is utilised by the enzyme PSY to commence 12 carotenogenesis; therefore, the abundance of GGPP directly affects carotenoid biosynthesis. For example, exogenous feeding of 1-deoxy-D-xylulose (DX) increased the lycopene content in tomato (Lois et al., 2000). Likewise, overexpression of 1- deoxy-D-xylulose-5-phosphate synthase (DXS) gene enhanced the level of isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate
(DMAPP), which subsequently increased lycopene production in Corynebacterium glutamicum (Heider et al., 2014). These pieces of evidence exemplify how a greater availability of isoprenoid precursors and an efficient utilisation of precursors can affect carotenogenesis.
The head-to-head condensation of two GGPP molecules into a phytoene commences carotenogenesis in all carotenogenic organisms, which is a crucial regulatory step determining the precursor flux into the carotenoid biosynthetic pathway (Dogbo et al., 1988; Han et al., 2015). Many molecular regulatory factors can affect transcription and translation of PSY and phytoene biosynthesis. Firstly, the number of PSY genes varies in different plants such as one in Arabidopsis (Welsch et al., 2003; Rodriguez-Villalon et al., 2009), two in carrot (Wang et al., 2014), three in tomato (Giorio et al., 2008; Fantini et al., 2013); maize (Li et al., 2008; Li et al.,
2008); rice (Welsch et al., 2008); and apple (Ampomah-Dwamena et al., 2015), and six in rapeseed (Lopez-Emparan et al., 2014). The existence of multiple PSY genes indicates distinct spatial and/or temporal regulation of carotenogenesis (Li et al.,
2008; Wang et al., 2014).
The light quality has pronounced effects on PSY expression, which involves a phytochrome-mediated regulatory network. During the dark condition, phytochrome interacting factors (PIFs), such as PIF1, represses the expression of PSY and, therefore, downregulates carotenogenesis (Toledo-Ortiz et al., 2010). The exposure to
13 far-red and red light enhances PSY expression, PSY protein level, and the carotenoid content in Arabidopsis seedlings (von Lintig et al., 1997). The expression of PSY is also regulated differentially in photosynthetic and non-photosynthetic tissues, as observed in carrot leaves and roots (Wang et al., 2014). Root tissues display PSY expression independent of PIFs revealing a tissue-specific regulation of PSY (Welsch et al., 2000; Ruiz-Sola et al., 2014). The inability of norflurazon treated leaves of
Capsicum annum to synthesise phytoene (Simkin et al., 2003) reiterates the light- dependent regulation of PSY in a tissue-specific manner.
The alternative splicing of the 5’UTR (untranslated region) of PSY regulates the differential expression of PSY itself in response to the developmental and/or environmental conditions in Arabidopsis (Alvarez et al., 2016). Of the two alternative splice variants of PSY (ASV1 and ASV2), the long ASV1 is involved in developmental regulation of PSY such as during de-etiolation, whereas the shorter
ASV2 is induced when an immediate burst of carotenoid level is required, such as during salt and light stress (Alvarez et al., 2016). Also, there are reports on the epigenetic signatures influencing the expression of PSY and carotenogenesis in plants
(Cazzonelli et al., 2009; Arango et al., 2016). For example, the DEMETER-like DNA demethylase (DML) mediated active demethylation of PSY1 promoter region is required to stimulate carotenoid accumulation and fruit ripening in tomato (Liu et al.,
2015). Therefore, tight regulation of PSY gene transcription is required in response to the developmental and environmental conditions.
The activity of PSY enzyme controls the metabolic precursor supply into the carotenoid biosynthetic pathway (Rodriguez-Villalon et al., 2009; Meier et al., 2011;
Moise et al., 2014; Tian, 2015), and differential localization of PSY within chloroplasts can affect its activity (Sugiyama et al., 2017), therefore, carotenogenesis.
14
The functional interactions of PSY with other enzymes can also affect phytoene biosynthesis. For example, GGPPS11 is a hub enzyme required to produce plastidial isoprenoids, including carotenoids. GGPPS11 physically interacts with PSY and facilitate GGPP channelling into the carotenoid biosynthetic pathway as evident in
Arabidopsis (Ruiz-Sola et al., 2016). The overexpression of ORANGE gene (AtOR) can increase the level of functional PSY, subsequently increasing carotenoid accumulation as evident in Arabidopsis (Zhou et al., 2015). OR proteins enhance chromoplast differentiation and β-carotene accumulation (Lu et al., 2006; Lopez et al.,
2008; Zhou et al., 2015). Interestingly, the alteration in a single nucleotide in melon
(Cucumis melo) OR gene (CmOR) that replace arginine with histidine in CmOR protein can convert green fruit pulp into orange with enriched β-carotene accumulation (Tzuri et al., 2015; Chayut et al., 2017). In contrast, Clp proteases degrade PSY under higher temperature conditions downregulating the carotenoid biosynthesis (Welsch et al., 2018). The overexpression of PSY increased carotenoid accumulation in Arabidopsis roots by 100-fold, whereas carotenoid levels remain unchanged in photosynthetic tissues (Maass et al., 2009; Alvarez et al., 2016), which reinforces the tissue-specific regulation of PSY. Therefore, multiple regulatory interactions involved in regulating PSY activity and, eventually, determine phytoene biosynthesis and carotenogenesis in a tissue-specific manner.
In the downstream of PSY, plants and algae utilise two desaturases (PDS &
ZDS) and two isomerases (ZISO & CRTISO), extending carotenoid biosynthetic pathway into four enzymatic steps, to obtain all-trans-lycopene unlike a single desaturase, CrtI, that converts phytoene into all-trans-lycopene in prokaryotes
(Harada et al., 2001). In plants and algae, multistep synthesis of different cis- carotenes, which can perform unique biological functions in plastid development and signalling, signify the functional evolution of carotenogenesis in higher plants
15
(Alagoz et al., 2018). The desaturation of phytoene into tri-cis-ζ-carotene is another critical regulatory step in carotenogenesis, which involves PLASTID TERMINAL
OXIDASE (PTOX) and plastoquinone (PQ)(Koschmieder et al., 2017). PTOX controls the redox state of PQ in chloroplasts (Kambakam et al., 2016) and the disruption of PTOX function can inhibit carotenoid biosynthesis, subsequently increasing the photosensitivity of chloroplasts followed by the severe developmental defects (Carol and Kuntz, 2001; Nawrocki et al., 2015). Likewise, the disruption of
PDS function or chemical inhibition of PDS activity by norflurazon both accumulate phytoene and inhibit carotenogenesis, which enhances photooxidation of chloroplasts and produce bleached leaf phenotypes (Mayfield et al., 1986; Qin et al., 2007). PDS controls the metabolite flux into the carotenoid biosynthetic pathway as evident from the fact that the overexpression of Arabidopsis PDS gene (AtPDS) in tomato increased the transcript abundance of both MEP pathway and carotenoid biosynthetic pathway genes, therefore, carotenoid content (McQuinn et al., 2018). However, transcription of
PDS is independent of the pigment pool in leaves (Wetzel and Rodermel, 1998). ZDS is also a crucial enzyme that catalyses the conversion of di-cis-carotene into tetra-cis- lycopene and affects chloroplast development (Dong et al., 2007). Like PDS, overexpression of ZDS can enhance the transcription of the downstream pathway genes, therefore, increase carotenoid accumulation as evident from the increase in lutein and β-carotene in sweet potato (Li et al., 2017). The transcription of PDS gene and enzyme kinetics of PDS both are critical in regulating carotenogenesis in plastids
(Brausemann et al., 2017); however, the functional regulation of ZDS remains unknown.
The function of ZISO and CRTISO is crucial to maintain the level of both cis- carotenes and downstream carotenoids and, therefore, plastid development. However, the fact that photoisomerisation can compensate for the function of both ZISO and
16
CRTISO during light exposure is intriguing. ZISO is an integral membrane protein and catalyses ferrous heme b cofactor-dependent isomerisation of tri-cis-ζ-carotene into di-cis-ζ-carotene (Chen et al., 2010; Beltran et al., 2015). CRTISO requires anaerobic condition for activity and catalyses FADRED-dependent non-redox isomerisation of tetra-cis-lycopene into all-trans-lycopene (Yu et al., 2011). The differential methylation surrounding the CRTISO region controls the level of its transcription epigenetically, which is evident from the substantial reduction in
CRTISO transcripts in histone methylase transferase (SET DOMAIN GROUP 8) sdg8 mutant plants (Cazzonelli et al., 2009; Cazzonelli et al., 2009). The loss of CRTISO and SDG8 function both reduce the lutein content and increase β-branch carotenoids demonstrating a crucial role of CRTISO in regulating pathway flux into α- and β- branch (Park et al., 2002). In dark-grown seedlings, cotyledons from both ziso and crtiso accumulate cis-carotenes and impair PLB formation in etioplasts consequently delaying the cotyledon greening after light exposure (Park et al., 2002). However, light exposure facilitates the photoisomerisation of cis-carotenes and resume both carotenogenesis and plastid development in ziso (Chen et al., 2010) and crtiso (Park et al., 2002) mutants, which demonstrates the developmental regulation of both ZISO and CRTISO. Collectively, ZISO and CRTISO both displayed the transcriptional and post-transcriptional regulation, perhaps their interactions in response to the intrinsic developmental signals and environmental changes remain open to exploration.
The cyclisation of all-trans-lycopene by LCYE and LCYB to generate α- and β- branch carotenoids is another crucial step in carotenogenesis. The differential regulation of LCYE and LCYB can alter the pathway flux into α- and β-branches. It is evident that the loss of CRTISO function, such as in crtiso, downregulated the transcription of LCYE and decreased the level of lutein concurrently shifting the pathway flux into β-branch (Cazzonelli et al., 2009; Cazzonelli et al., 2009).
17
Likewise, loss of LCYE function or downregulation of LCYE expression both enhanced the level of β-branch carotenoids (Pogson et al., 1996; Kim et al., 2013).
However, overexpression of LCYE increased the lutein content and enhanced cold tolerance in Arabidopsis (Song et al., 2016). It is interesting to note that the overexpression of LCYB enhanced the expression of genes involved in both the MEP pathway and carotenogenesis increasing the level of β-branch carotenoids (Moreno et al., 2016). The cyclisation step is, thus, a critical regulatory checkpoint determining the precursor flux into the carotenoid biosynthetic pathway and the ratio of α- and β- branch carotenoids.
In leaves, the level of xanthophyll cycle carotenoids is tightly controlled as per the light and temperature conditions such that the intense light and high-temperature stress both increase zeaxanthin accumulation to protect chloroplast from the oxidative stress (Milanowska and Gruszecki, 2005; Sacharz et al., 2017). Likewise, overexpression of β-carotene hydroxylase (bOHase) caused a two-fold increase in xanthophyll cycle pigment pool, which substantially enhanced high light and temperature tolerance in Arabidopsis (Davison et al., 2002). The intense light and temperature stresses trigger de-epoxidation of violaxanthin to accumulate zeaxanthin that neutralises the heat and light-induced oxidative stress (Lawanson et al., 1978;
Milanowska and Gruszecki, 2005; Magdaong and Blankenship, 2018). Thus, xanthophyll cycle pigments display stringent control in response to the environmental conditions imparting stress tolerance and acclimation.
Finally, carotenoid turnover is a continuous process that maintains carotenogenesis as well as the production of the physiologically essential apocarotenoids (Beisel et al., 2010) such as strigolactones from β-carotene (Al-Babili and Bouwmeester, 2015) and abscisic acid from neoxanthin (Nambara and Marion-
18
Poll, 2005). Xanthophylls and carotenes both undergo enzymatic and non-enzymatic oxidation, but β-carotene is the main target of carotenoid degradative enzymes such as
CCD4 (Gonzalez-Jorge et al., 2013). Apocarotenoids are crucial metabolites that affect plant development and environmental signalling and acclimation; therefore, the state of carotenoid degradation can be influenced by both developmental and environmental changes (Ramel et al., 2012; Havaux, 2014). For example, a phosphate-deprived condition can enhance strigolactone production and root branching, subsequently stimulating mycorrhizal symbiosis (Decker et al., 2017).
Likewise, drought stress triggers the degradation of neoxanthin to produce abscisic acid to stimulate stomatal closure (Golldack et al., 2014; Dong et al., 2015). Also, there are reports on microRNAs affecting carotenoid degradation in seeds. For example, overexpression of miR156 downregulated SQUAMOSA PROMOTER
BINDING PROTEIN LIKE (SPL) family transcription factors and increased carotenoid accumulation in seeds potentially by reducing carotenoid degradation (Wei et al., 2010; Wei et al., 2012). However, the effects of miRNAs and SPLs on the carotenoid metabolism in leaves are unexplored. The regulation of carotenoid degradation and apocarotenoid production is not within the scope of this review, but there are many useful contemporary reviews such as Dong et al. (2015), Walter and
Strack (2011), and Hou et al. (2016). Collectively, both genetic and epigenetic factors affect carotenoid metabolism, but there is much to explore regarding environmental regulation of carotenogenesis in leaves.
1.6 Function of carotenoids in plant development
Carotenoids and carotenoid-derived apocarotenoids facilitate multiple biological functions in both carotenogenic and non-carotenogenic organisms. Various functions of carotenoids in different organisms (including human health benefits) are described in several reviews such as Britton (2008) and Rodriguez-Concepcion et al. (2018). 19
The plant kingdom is rich in carotenoid diversity; perhaps most of the carotenoids are associated with the species- or tissue-specific developmental and ecophysiological functions in plants. In photosynthesising tissues, carotenoids are involved in light- harvesting during photosynthesis and protect photosystems from photooxidative damage. Lutein, β-carotene, violaxanthin, and neoxanthin are the most abundant carotenoids found in the structural components of the light-harvesting complexes in plants (Grudzinski et al., 2001; Liguori et al., 2015; Qin et al., 2015; Mazor et al.,
2017). In light-harvesting complexes, carotenoids absorb photons from the blue-green zone (ca. 450-570 nm) of the visible spectrum, subsequently transferring energy to the chlorophylls (Croce et al., 2001; Scott, 2001; Bode et al., 2009; Holleboom and
Walla, 2014). Thus, as accessory antennae pigments, carotenoids enhance photosynthetic light-harvesting in plants.
Besides photon harvesting, carotenoids are antioxidants and protect photosynthetic apparatus from the photo-oxidative damage during excessive illumination via nonphotochemical quenching (NPQ) of chlorophyll triplets and singlet oxygen (Young and Frank, 1996; Cogdell et al., 2000; Santabarbara et al.,
2013; Kusama et al., 2015). During NPQ, de-epoxidation of violaxanthin into zeaxanthin favours dissipation of excess chlorophyll excitation excess energy in the form of heat (Papageorgiou and Govindjee, 2014; Ruban, 2016). Lutein is the most abundant xanthophyll, occupying nearly 50 % of the total foliar carotenoids in photosynthetic tissues, and facilitates structural stabilisation of antenna proteins, light- harvesting, and quenching triplet excited chlorophylls (3Chl*) (Pogson et al., 1996;
Jahns and Holzwarth, 2012). Lutein facilitates quenching of singlet excited chlorophyll (1Chl*), NPQ, in the zeaxanthin deficient npq1 mutant (Li et al., 2009). In contrast, lutein deficient mutants accumulate a higher amount of xanthophyll cycle carotenoids, demonstrating enhanced light stress tolerance (Ware et al., 2016).
20
Zeaxanthin can modify the physical properties of lipid membranes including thylakoids by decreasing membrane fluidity and, hence, enhances membrane stability against lipoxidation under intense light and temperature conditions (Havaux, 1998;
Gruszecki and Strzalka, 2005; Augustynska et al., 2015; Grudzinski et al., 2017).
Thus, xanthophylls perform vital functions in tissue and/or environment-specific manner.
Many plants accumulate cis-carotenes in a tissue-specific manner and response to the environmental conditions, see our recent review on cis-carotenes (Alagoz et al.,
2018) for further details, yet their biological functions remain open to exploration.
During seed germination and seedling development under dark conditions
(skotomorphogenesis), carotenoid biosynthesis takes place in the etioplasts of yellowish cotyledons. Carotenoids facilitate the formation of PLBs, which are subsequently transformed into thylakoids after light exposure and initiate chlorophyll biosynthesis and photomorphogenesis (Park et al., 2002; Denev et al., 2005; Cuttriss et al., 2007). The dark-grown cotyledons of ziso mutants accumulate 9,15,9’-tri-cis-ζ- carotene and produce a small number of impaired PLBs in the etioplasts (Chen et al.,
2010). However, etioplasts of crtiso mutants accumulate cis-carotenes, most dominantly 7,9,9’-tri-cis- neurosporene and 7,9,7’,9’-tetra-cis-lycopene, which are linked to the complete perturbation of PLB formation and delay cotyledon greening after light exposure (Park et al., 2002; Cuttriss et al., 2007). Interestingly, norflurazon
(an inhibitor of PDS activity) treatment blocks cis-carotene biosynthesis and restore
PLB formation in crtiso (Cuttriss et al., 2007). Likewise, ziso crtiso double mutants can restore PLB formation and chloroplast development, indicating a potential role of the tri-cis- neurosporene or tetra-cis-lycopene in controlling the plastid development
(Cazzonelli et al., 2019). Under light exposure, photoisomerisation can compensate for the loss-in-function of ZISO and CRTISO activity, subsequently resuming both
21
PLB formation and chloroplast development. It is interesting to highlight that cis- carotene derived cleavage products can facilitate intra-cellular retrograde signalling during plastid development to post-transcriptionally control protein levels (Cazzonelli et al., 2019). The cis-carotene and cis-carotene-derived apocarotenoids are foreseen as the potential regulatory signals maintaining chloroplast biogenesis and plant development (Hou et al., 2016). For instance, phytofluene and ζ-carotene or their oxidation products (apocarotenoids), accumulated in Arabidopsis zds/clb5 mutants affect the expression of nuclear genes and leaf development (Avendano-Vazquez et al., 2014). As highlighted in Alagoz et al. (2018), the evolutionary significance and biological functions of cis-carotenes and cis-carotene-derived apocarotenoids are open for further discovery.
In higher plants, carotenoids are the precursors of apocarotenoid phytohormones particularly abscisic acid (Nambara and Marion-Poll, 2005) and strigolactones
(Ruyter-Spira et al., 2013) and both control vital physiological activities during plant development and environmental acclimation processes. The seed dormancy and repression of seed germination under unfavourable conditions is one of the critical functions of abscisic acid (Kang et al., 2015). In leaves, abscisic acid controls stomatal opening integrating carbon and water relations in response to the environmental conditions (Chater et al., 2014). Strigolactones control root and shoot branching in plants. The phosphate limitation in soil stimulates strigolactone production, which subsequently stimulates lateral root formation and root hair elongation (Kapulnik et al., 2011; Kapulnik and Koltai, 2014). In contrast, increase in the level of strigolactones inhibits shoot branching (Gomez-Roldan et al., 2008). In addition, carotenoids are precursors of the environment signalling metabolites β- cyclocitral (Ramel et al., 2012), dihydroactinidiolide (Shumbe et al., 2014), and other apocarotenoids (Havaux, 2014; Hou et al., 2016). Various carotenoids and their
22 derivatives generate a vibrant colouration and aroma in flowers and fruits that attract pollinators and seed carriers to facilitate reproductive success and seed dispersal in plants (Cazzonelli, 2011). The functional diversity of a variety of carotenoids and carotenoid-derived apocarotenoids signify the evolutionary significance of carotenoids in plants particularly to regulate plant development and environmental acclimation.
1.7 Carotenoids and leaf development: impacts of cell, plastid and retrograde signals
Carotenoids directly affect the early development of leaves and chloroplasts as evident in dark-grown leaves and cotyledons of crtiso mutants, where an accumulation of cis-carotenes impair PLB formation and photomorphogenesis (Park et al., 2002; Cuttriss et al., 2007). In photosynthetically functional leaves, carotenoids are synthesised and sequestered in chloroplasts. In leaves, chloroplast development displays a distinct transition from proplastid to etioplast to chloroplast to gerontoplast as the leaves grow from primordia through to the senescing leaves (Jarvis and Lopez-
Juez, 2013; Sun et al., 2018). Etioplasts in the yellowish cotyledons from the recently emerged seedlings mainly accumulate lutein and violaxanthin with the traces of β- carotene and neoxanthin (Rodriguez-Villalon et al., 2009). However, light exposure alters both content and proportions of foliar carotenoids concurrently transforming etioplasts into photosynthetically functional chloroplasts, as the cotyledon/leaf greening progress (Arsovski et al., 2012). Carotenoids and carotenoid-derived metabolites facilitate functional homeostasis in leaves in general and, more so, during light, temperature, and drought stress conditions (Britton, 2008; Ruban, 2016).
During leaf maturation, a rapid cell division follows a gradual expansion in cell size, mainly due to the development of a central vacuole occupying up to 90 % of the cell volume (Rojo et al., 2001; Gonzalez et al., 2012; Kruger and Schumacher, 2018)
23 in the young developing leaves, consequently increasing leaf area, light-harvesting, and carbon acquisition (Rojo et al., 2001; Gonzalez et al., 2012; Kruger and
Schumacher, 2018). Massive changes in density, size, and ultrastructure of chloroplasts occur during leaf expansion (Table 1), which is affected by the light availability and pigment biosynthesis, both carotenoids and chlorophylls (Jarvis and
Lopez-Juez, 2013). The number of grana stacks and thylakoid lamellae vary in the chloroplasts of different maturity level such as fully differentiated chloroplasts from the mature leaves comprise a highly ordered thylakoid network with a maximum number of grana stacks and thylakoid lamellae, whereas the immature chloroplasts from younger leaves possess fewer grana stacks with poorly developed thylakoids and undifferentiated lamellae as evident in Arabidopsis (Gugel and Soll, 2017) and maize
(Kutík et al., 1999). Older leaves comprise relatively larger cells accommodating a higher number of larger sized chloroplasts compared to younger leaves, which can provide a higher capacity to store carotenoids.
The increase in cell size during leaf maturation is also accompanied with the increase in ploidy level due to endoreduplication of the nuclear DNA, which shows the links between environmental conditions and functional plasticity of leaves
(Melaragno et al., 1993; Cookson et al., 2006). In contrast, chloroplast DNA (ptDNA) copy number decreases in the cells from mature leaves (Rowan et al., 2009; Golczyk et al., 2014). However, it is unclear whether the change in DNA copy number affects the level of photosynthetic pigment content in leaves. In Arabidopsis, the total protein content, rate of photosynthesis, and chlorophyll pigment levels in recently emerged leaves were higher than that of the mature leaves (Stessman et al., 2002; Ishihara et al., 2015). In concert, the levels of both carotenoids and chlorophylls were substantially higher in the recently emerged young leaves compared to the old leaves
24
(Dhami et al., 2018), which demonstrates the leaf-age dependent regulation of the photosynthetic pigment pool.
Table 1.1 Functional characteristics of mesophyll cells from young and mature leaves.
Cell attributes Young leaf Mature leaf References Cell size Small Large (Possingham and Saurer, 1969) Cell density/area High Low (Possingham and Saurer, 1969) Vacuole size Small Large (Noguchi and Hayashi, 2014; Kruger and Schumacher, 2018) Chloroplast size Small Large (Gugel and Soll, 2017) Grana stacks and thylakoids High Low (Kutík et al., 1999; Gugel and Soll, 2017) Chloroplast density/cell Low High (Kutík et al., 1999; Stettler et al., 2009) Total protein content High Low (Stessman et al., 2002; Ishihara et al., 2015) Chlorophyll content High Low (Stessman et al., 2002; Dhami et al., 2018) Carotenoid content High Low (Dhami et al., 2018) Nuclear DNA content Low High (Melaragno et al., (ploidy) 1993; Cookson et al., 2006) Chloroplast DNA copy High Low (Rowan et al., 2009; number Golczyk et al., 2014)
In addition to the chloroplast development and carotenoid biosynthesis and degradation, leaves display distinctive developmental phase identities such as embryonic (cotyledons), juvenile, and adult phases and the leaves of each phase are unique in morphology as well as molecular signatures. All leaves retain their 25 ontogenetic attributes such as leaf morphology, trichomes, and cell types throughout their lifespan (Poethig, 1997; Kerstetter and Poethig, 1998; Poethig, 2013; Nguyen et al., 2017) and achieve the optimum level of carotenoids and chlorophylls corresponding to the functional stage of the respective leaves and ambient environmental conditions. Interestingly, suppression of SQUAMOSA PROMOTER
BINDING PROTEIN LIKE 15 (SPL15) via overexpression of microRNA156b
(miR156b); both affect leaf developmental phase transition, enhanced carotenoid content in the seeds of Arabidopsis (Wei et al., 2012) and Brassica napus (Wei et al.,
2010), which indicates a possible link between leaf vegetative phase identity and carotenoid metabolism. A group of SPL family transcription factors together with miR156 and miR172 control the juvenile to adult and vegetative to the reproductive phase transition, which is evident in Arabidopsis (Jung et al., 2011; Xu et al., 2016;
Nguyen et al., 2017). Nguyen et al. (2017) demonstrated the high and low transcript abundance of miR156 and SPL15, respectively in juvenile leaves and vice versa in the adult leaves. The outstanding question is, does the developmental phase of leaves affect carotenogenesis in an age-dependent manner? Indeed, the functional changes in chloroplasts during leaf development and tissue- and plastid-specific accumulation of carotenoids unveils a challenge to decipher how carotenoid homeostasis can be fine- tuned to leaf developmental transitions and environmental change.
In leaves, chloroplasts produce retrograde signals that can be transported to the nucleus and control the expression of photosynthesis associated nuclear genes
(PhANGs) and protein levels (Chan et al., 2016; de Souza et al., 2017). For example, tetrapyrrole pathway intermediates are the vital retrograde signals affecting nuclear gene expression, such as the norflurazon induced accumulation of Mg-protoporphyrin
IX (Mg-ProtoIX) in chloroplasts represses the expression of PhANGs (Strand et al.,
2003; Moulin et al., 2008; Zhang et al., 2011), although there are controversies on 26 whether Mg-ProtoIX is a universal determinant of the plastid-to-nucleus signalling
(Mochizuki et al., 2008). Heme and billin also demonstrated roles in regulating nuclear gene expression in Chlamydomonas reinhardtii (von Gromoff et al., 2008;
Duanmu et al., 2013). Besides, chloroplast localised carotenoids themselves and/or their oxidative derivatives such as apocarotenoids involve in retrograde control of nuclear gene expression and leaf development (Ramel et al., 2012; Avendano-
Vazquez et al., 2014). The functional changes in leaves and chloroplasts during the developmental progression unveils a challenge to decipher the mechanisms that fine- tune carotenogenesis orchestrating leaf developmental transitions and environmental change.
1.8 Environmental impacts on carotenogenesis
Carotenoids and carotenoid-derived apocarotenoids play crucial roles in environmental sensing and acclimation of plants. Carotenoids undergo enzymatic and non-enzymatic cleavage to synthesise apocarotenoids such as abscisic acid, strigolactones, β-ionone, β-cyclocitral, and dihydroactinidiolide (Ramel et al., 2012;
Havaux, 2014), which facilitate environment signalling and control plant architecture.
There are cross-talks between carotenoid and other metabolic pathways such as biosynthesis of sugars, terpenoids, flavonoids, and anthocyanins (Ghirardo et al.,
2014; Cao et al., 2015), which are primarily affected by both developmental and environmental conditions (Kliebenstein, 2004; Bundy et al., 2008). However, the mechanistic aspects of how short- and long-term environmental changes can affect carotenoid biosynthesis, storage, and degradation, and their interplay with developmental signals are unclear. The following sections highlight the current understanding of how different environmental conditions can affect carotenoid metabolism in photosynthetic tissues. The regulation of carotenogenesis in non- photosynthetic tissues is not covered in depth here, which is elsewhere reviewed for 27 tomato fruits (Liu et al., 2015), carrot roots (Rodriguez-Concepcion and Stange,
2013), rice endosperm (Bai et al., 2016), and maize kernels (O'Hare et al., 2015).
1.8.1 Light The intensity and quality of light can influence molecular and biochemical networks including carotenogenesis in plants, and concomitantly affect plant development and phenology (Chen et al., 2004; Casal, 2013; Llorente et al., 2017;
Solovchenko and Neverov, 2017). For example, dark-grown tissues, such as etiolated seedlings, of Arabidopsis mainly accumulate lutein and violaxanthin with the traces of
β-carotene and neoxanthin; whereas light exposure enhances the accumulation of all foliar carotenoids. In photosynthetic tissues, variation in light intensity triggers enzymatic inter-conversion of zeaxanthin, antheraxanthin, and violaxanthin maintaining xanthophyll cycle with the peak accumulation of zeaxanthin during intense illumination and violaxanthin during low-light and/or shade conditions
(Demmig-Adams and Adams, 1996; von Lintig et al., 1997; Gao et al., 2011).
Photosynthetic tissues exhibit diurnal changes in carotenogenesis with the peak expression of the most carotenoid biosynthesis pathway genes at dawn, except for the peak accumulation of violaxanthin deepoxidase (VDE) transcripts in the dusk
(Covington et al., 2008). Zeaxanthin accumulation increases under intense illumination and protects chloroplasts and photosystems from photooxidation
(Davison et al., 2002; Triantaphylides et al., 2008; Kopsell et al., 2012). In Algae, the higher light intensity increased β-carotene content such as in Dunnaliella salina
(Lamers et al., 2010). The light quality also affects carotenoid accumulation such as blue light increased carotenoid content in Brassica juncea, Brassica rapa, and Beta vulgaris (Brazaityte et al., 2015; Samuoliene et al., 2017). In contrast, ultraviolet-B light reduced β-carotene and zeaxanthin content in Agrostis stolonifera, which was
28 unchanged in Festuca arundinacea and Lolium perenne (Nangle et al., 2015). The intensity and quality of light impart strong effects on carotenogenesis.
The light-dependent expression of PSY gene and functional integrity of PSY enzyme demonstrate the mechanistic insights on the light-mediated regulation of carotenoid biosynthesis. For instance, the expression of PSY and PSY activity increases with the concomitant increase in carotenoid accumulation during the photomorphogenesis of dark-grown seedlings (Welsch et al., 2000). Intriguingly, dark exposure downregulates the expression of carotenoid biosynthesis pathway genes, including PSY, which completely blocks carotenoid biosynthesis in leaves as observed in Capsicum annum L. (Simkin et al., 2003). The phytochrome-mediated signalling pathway controls the carotenoid biosynthesis, such as PHYTOCHROME
INTERACTING FACTOR 1 (PIF1) directly binds to the promotor of PSY and repress its expression in the dark conditions; and light-triggered de-repression of PSY allows an immediate burst in carotenoid accumulation as observed during the deetiolation of the dark-grown seedlings (Toledo-Ortiz et al., 2010). The decrease in carotenoid content under shade or far-red light also suggests a mechanistic association of PIFs in regulating carotenogenesis (Bou-Torrent et al., 2015). In contrast, PSY expression is independent of PIFs in non-photosynthetic tissues such as roots (Ruiz-Sola et al.,
2014). Collectively, PSY demonstrates light-dependent regulation of carotenogenesis in a tissue-specific manner (Rodriguez-Villalon et al., 2009).
Light availability influences the isomerisation of cis-carotenes. ZISO is an essential enzyme converting 9,15,9′-tri-cis-ζ-carotene to produce 9,9′-di-cis-ζ- carotene in plants (Beltran et al., 2015). The ziso mutants of Arabidopsis and maize showed a delay in the greening of the dark-grown seedlings and accumulate 9,15,9′- tri-cis-ζ-carotene; however, light exposure triggers photoisomerisation and restores
29 the standard carotenoid profile (Chen et al., 2010). Likewise, the dark-grown cotyledons of crtiso mutants dominantly accumulate 5,9,5′,9′-tera-cis-lycopene and
7,9,9′-tri-cis-neurosporene with the traces of the other cis-carotenes, up in the pathway, resulting in the developmental defects in PLBs (Park et al., 2002). The photoisomerisation compensates CRTISO function, such as in crtiso mutants, and converts tetra-cis-lycopene into all-trans-lycopene restoring the average carotenoid profile and plastid development (Park et al., 2002; Isaacson et al., 2004). The photoisomerisation of cis-carotenes and concomitant restoration of plastid development reinforces the light-dependent regulation of carotenogenesis in plants.
Besides, the accumulation of soluble sugars, which is strictly controlled by the availability of light, downregulates the carotenoid biosynthesis in leaves (Fanciullino et al., 2014; Cao et al., 2015). While there is a good understanding of how light can affect carotenogenesis in different tissues, the mechanism by which light intensity and quality affect carotenoid metabolism during leaf development remains unclear.
1.8.2 Carbon dioxide
Atmospheric carbon dioxide (CO2) is the primary substrate for carbon assimilation leading to the production of sugars in photosynthesising organisms.
Increase in atmospheric CO2 concentration enhances photosynthesis, sugar biosynthesis, and biomass accumulation in plants, when adequate mineral nutrients are available (Ellsworth et al., 2004; Li et al., 2013; Florian et al., 2014; Watanabe et al., 2014; Misra and Chen, 2015; Noguchi et al., 2015; Xu et al., 2015; Hager et al.,
2016). The leaves from the plants exposed to elevated CO2 levels produce a higher number of large-sized chloroplasts; thereby, enhancing the production of chloroplast associated secondary metabolism (Griffin et al., 2001; Teng et al., 2006; Li et al.,
2013). The functional impacts of elevated atmospheric CO2 concentration can vary
(Figure 1.2) mostly in species- or ecotype-specific manner, which is interlinked with
30 other ecological factors (Li et al., 2008; Song et al., 2009; Marty and BassiriRad,
2014).
Figure 1.2 Schematic summary of the phenotypic, physiological and biochemical alterations in plants exposed to the elevated atmospheric CO2.
Elevated atmospheric CO2 has shown a substantial decrease in stomatal density and conductance, transpiration, and photorespiration that alters overall plant metabolism and performance (Teng et al., 2006). Elevated CO2 affects photosynthesis, which drives increased glycolysis and MEP pathway, subsequently enhancing chlorophylls, carotenoids and subsequently affecting phytohormone biosynthesis (Xu et al., 2015). There is a species- specific increase or decrease in production and accumulation of secondary metabolites including isoprenoid volatiles, terpenoids, carotenoids, flavonoids and anthocyanins (Prins et al., 2011; Misra and Chen, 2015; Niinemets and Sun, 2015). Alterations in physiological and developmental processes result in net increased flux to a carbon sink (Teng et al., 2006; Florian et al., 2014). The metabolic sinks for additional carbon assimilation remain poorly studied.
Elevated atmospheric CO2 has shown noticeable; yet variable, effects on the level of photosynthetic pigments, both carotenoids and chlorophylls, in several plants.
In photosynthetic tissues, the level of carotenoids and chlorophylls may be increased, decreased, or remain unchanged in response to elevated atmospheric CO2 concentration (Table 2.1). The differential impacts of elevated CO2 concentration on the level of carotenoids and chlorophylls are mostly species-specific. The decrease in carotenoid content under elevated CO2 has reported in soybean (Glycine max) 31
(Pritchard et al., 2000; Mishra et al., 2008; Wang et al., 2015), maize (Zea mays)
(Miliauskienė et al., 2016), winter rape (Brassica napus) (Miliauskienė et al., 2016), lettuce (Lactuca sativa) (Pérez-López et al., 2015; Pérez-López et al., 2015), poplars
(Populs spp.) (Wustman et al., 2001; Way et al., 2013), and pines (Houpis et al.,
1988; Wang et al., 2003). In contrast, tomato fruits (Dannehl et al., 2012; Zhang et al.,
2014) and leaves of Gyanura bicolor (Wang et al., 2016) and Catharanthus roseus
(Singh and Agrawal, 2015) grown under elevated CO2 conditions showed an increase in carotenoid content. Other plants such as Arabidopsis (Kooij et al., 1999; Bae and
Sicher, 2004), beetroot (Beta vulgaris) (Kumari et al., 2013), and maize (Zea mays)
(Wijewardana et al., 2016) which were grown under elevated CO2 conditions showed no change in carotenoid content. Likewise, several algae species displayed contrasting effects of elevated CO2 concentration on the carotenoid content such as an increase in
Pyropia haitanensis (Chen et al., 2015), decreases in Bryopsis plumose (Yildiz and
Dere, 2015) and no change in Ulva lactuca (Liu and Zou, 2015). Interestingly, recently emerged young leaves of Arabidopsis exhibited increased carotenoid content in response to elevated atmospheric CO2 concentration, while that in older leaves remained unchanged; thereby, demonstrating a leaf-age dependent interaction of CO2 and carotenoid accumulation (Dhami et al., 2018).
Like carotenoids, majority of CO2 enrichment studies revealed a decrease in chlorophyll content (Table 2.1) in different plants such as soybean (Pritchard et al.,
2000; Wang et al., 2015), maize (Miliauskienė et al., 2016; Wijewardana et al., 2016), and poplars (Wustman et al., 2001; Way et al., 2013). In contrast, an increase in total chlorophyll content was reported in Arabidopsis (Takatani et al., 2014), Gyanura bicolor (Wang et al., 2016), Catharanthus roseus (Singh and Agrawal, 2015), and
Chlorella vulgaris (Chinnasamy et al., 2009). Moreover, some reports demonstrate a null effect of elevated CO2 on chlorophyll content such as in soybean (Li et al., 2013)
32 and poplar (Tissue and Lewis, 2010). There are also contrasting effects of elevated
CO2 on pigment accumulations in Arabidopsis leaves, with reports of increased
(Takatani et al., 2014), decreased (Li et al., 2006; Li et al., 2008), and no change
(Cheng et al., 1998; Kooij et al., 1999; Bae and Sicher, 2004) in response to higher
CO2 concentration (Table 2.1). The variation in the photosynthetic pigment content in photosynthetic tissues in response to elevated CO2 demonstrates the stochastic effects of elevated CO2 concentration plausibly interacting with other environmental conditions, differences in tissues analysed, and/or variable efficacies in CO2 treatments. A systematic assessment of photosynthetic pigment content in the leaves of different plants at different developmental stages and in response to elevated CO2 is desirable to overcome prevailing ambiguities on the impacts of elevated atmospheric
CO2 concentration on the levels of chlorophylls and carotenoids.
1.8.3 Temperature The fluctuation in air temperature is one major environmental factor influencing molecular and biochemical phenomena in plants (Delker et al., 2014; Johansson et al., 2014; Liu et al., 2015; Quint et al., 2016). In leaves, exposure to higher temperature alters the level of xanthophyll cycle pigments, which enhances heat tolerance by neutralizing heat-induced oxidative stress as seen in Zea mays
(Lawanson et al., 1978), Solanum tuberosum (Havaux et al., 1996), Arabidopsis thaliana (Davison et al., 2002), Oryza sativa (Yin et al., 2010), Quercus pubescens
(Haldimann et al., 2008), Buxus sempervirens (Hormaetxe et al., 2007),
Rhododendron ferrugineum, Senecio incanus and Ranunculus glacialis (Buchner et al., 2015). Heat stress causes swelling of chloroplasts and concomitantly inhibits photosynthesis, and trigger plastoglobule formation, which are the sites of carotenoid degradation (Zhang et al., 2010). The extreme heat exposure triggers de-epoxidation of violaxanthin; consequently increasing the level of zeaxanthin in leaves
33
(Milanowska and Gruszecki, 2005). An increase in zeaxanthin content favours thermal energy dissipation during heat stress; which is regarded as the acclimation strategy used by plants to neutralise heat-induced oxidative stress.
Zeaxanthin accumulation enhances the rigidity of thylakoid membranes and maintains the functional integrity of the photosynthetic apparatus during heat stress
(Latowski et al., 2002; Strzałka et al., 2003; Havaux et al., 2007). Exposure to a temperature beyond the range of 12-32 oC decreased lycopene and other carotenoids in tomato fruits (Dumas et al., 2003; Hernandez et al., 2015) and 35 °C downregulated carotenoid biosynthesis in the seed aril of bitter melon (Tran and
Raymundo, 1999). Of the three phytoene synthases reported in maize, PSY1 is required to maintain the carotenogenesis during thermal stress indicating a tissue- specific role of PSY paralogs in response to the different temperature regimes (Li et al., 2008). In Arabidopsis seeds, elevated temperature activates carotenoid degradation pathways leading to abscisic acid biosynthesis and simultaneous repression of gibberellic acid biosynthesis; thereby, inhibiting seed germination (Toh et al., 2008). An elevated temperature could impose tissue-specific effects on carotenogenesis; however, increase in zeaxanthin accumulation can potentially alleviate high temperature-induced oxidative stress in photosynthesising leaves
(Havaux et al., 2007).
Low temperature also induces a wide array of cold acclimatory responses at the molecular and biochemical level, which alter developmental programming in plants
(Seo et al., 2009; Janska et al., 2010; Knight and Knight, 2012). Prolonged exposure to a severe cold such as 4-10 oC reduces photosynthesis and delays the growth and development in plants (Allen and Ort, 2001; Savitch et al., 2001; Paredes and Quiles,
2015). The most striking biochemical effect of cold was an increase in sucrose and
34 abscisic acid content both facilitate cold stress acclimation of plants (Nagele et al.,
2012; Bakht et al., 2013; Ruan, 2014). An increase in soluble sugars content can cause negative feedback on the carotenoid pool in leaves. For example, exogenous application of glucose can downregulate the MEP pathway; subsequently decreasing the level of both carotenoids and chlorophylls in spinach (Krapp et al., 1991) and tomato (Mortain-Bertrand et al., 2008) leaves. Also, as evident in Arabidopsis, the higher level of soluble sugar content including glucose in old leaves corresponds with the reduced level of carotenoid and chlorophylls (Stessman et al., 2002) indicating negative feedback of glucose to carotenoid pool in leaves.
Cold exposure activates cold-responsive gene cascades to increase the accumulation of antioxidants, including carotenoids in plants (Fowler and
Thomashow, 2002; Sinha et al., 2015). It is interesting to note that cold exposure increased lutein and neoxanthin content, simultaneously decreasing β-carotene content in maize (Haldimann, 1997; Haldimann, 1998) and Arabidopsis (Harvaux and
Kloppstech, 2001). Besides, the overexpression of LCYE substantially increased foliar lutein content ameliorating the chilling-induced sensitivity of photosynthesis in
Arabidopsis (Song et al., 2016). The temperature fluctuations can alter carotenoid content, and there is a potential role for carotenoids in facilitating heat and cold stress acclimation responses. However, the function that foliar carotenoids play in short- term and prolong stressing temperature regimes remain open for discovery.
1.8.4 Soil nutrient and water availability Soil nutrients, particularly nitrogen and phosphorus, play a crucial role in carbon assimilation and subsequent carbon flow through the primary and secondary metabolic pathways including carotenoid biosynthesis in plants (Stitt and Krapp,
1999; Jin et al., 2015). Application of additional nitrogen supplements can increase lutein and β-carotene accumulation in vegetable crops as revealed in carrots 35
(Boskovic-Rakocevic et al., 2012), spinach (Lefsrud et al., 2007; Reif et al., 2012), and various Brassica species (Kopsell et al., 2007; Reif et al., 2013). In contrast to the higher plants, nitrogen starvation increased β-carotene accumulation in microalga
Dunaliella salina (Marin et al., 1998; Lamers et al., 2010; Lamers et al., 2012).
Likewise, a nitrogen-depleted condition increased the carotenoid (neurosporaxanthin) accumulation in fungi Fusarium fujikuroi (Garbayo et al., 2003; Rodriguez-Ortiz et al., 2009). However, both high and low C/N ratio negatively affect carotenoid accumulation in the red yeast Rhodotorula glutini (Braunwald et al., 2013) and green algae Chlorella vulgaris (Zhang et al., 2017).
In contrary to the nitrogen, the phosphorus starvation decreased the total carotenoid content in the microalga Tetraselmis marina (Dahmen-Ben Moussa et al.,
2017). In higher plants, the phosphorus limitation enhances the degradation of carotenoids (specifically β-carotene) and produces strigolactones that stimulate adventitious root formation and mycorrhizae colonisation in the rhizosphere to meet plant phosphate requirement (Al-Babili and Bouwmeester, 2015; Lopez-Raez et al.,
2015). Nitrogen and phosphorus limitation retards the overall plant growth concomitantly altering carotenoid accumulation strategies, yet, regulatory effects of nitrogen and phosphorus on carotenoid biosynthesis, degradation, and accumulation are poorly studied.
The different soil types and soil supplements are also known affecting carotenoid accumulation such as supplementation of coffee grounds to the soil increased lutein and β-carotene by 90 % and 72 % in lettuce (Cruz et al., 2012). An intriguing question is why algae and plants would adopt different strategies in carotenoid accumulation in response to nutrient availability. A deeper understanding of how soil nutrient profile can affect carotenoid metabolism is required to improve
36 the conventional cropping practices to enrich health-promoting carotenoids in the food and vegetable crops, mainly referring to future environmental changes.
Likewise, limitation in soil water causes noticeable impacts on the plant physiology and architecture including changes in secondary metabolite accumulation such as isoprenoids, anthocyanins, and flavonoids (Chalker-Scott, 1999; Ramakrishna and Ravishankar, 2011; Sanchez-Rodriguez et al., 2011). Carotenoids play vital roles in drought stress signalling, and acclimation in plants such as carotenoid-derived phytohormone abscisic acid induces stomatal closure inhibiting transpiration whenever plants experience drought and salinity signals (Golldack et al., 2014; Dong et al., 2015).
In Arabidopsis, drought stress increases the production of zeaxanthin epoxidase
(ZEP) in roots with a concomitant decrease in leaves yet maintains a higher level of abscisic acid in both tissues (Schwarz et al., 2015). Interestingly, high salt concentration upregulates PSY expression in Arabidopsis roots to ensure a proper supply of carotenoid precursors for abscisic acid biosynthesis, which enhances salt stress tolerance (Ruiz-Sola et al., 2014). Besides, strigolactones are known to control stomatal closure in an abscisic acid independent manner (Lopez-Raez et al., 2010; Lv et al., 2018), which has confirmed by the hypersensitivity of ccd mutants to drought
(Ha et al., 2014). The down-regulation of LCYE channelises precursors towards β- carotenoids, subsequently enhancing apocarotenoid production leading to improved drought and salinity tolerance as observed in Nicotiana tabacum (Shi et al., 2015).
Both carotenoids and carotenoid-derived apocarotenoids are involved in stress signalling and drought acclimation in plants; however, the regulatory mechanism that ensures tissue-specific production of carotenoids and apocarotenoids to ameliorate the effects of drought stress remain open to discovery.
37
1.9 Knowledge gaps in carotenogenesis in leaves
In both photosynthetic and non-photosynthetic tissues, carotenoid metabolism
requires stringent regulation in biosynthesis, degradation, and accumulation to
accommodate intrinsic developmental and short- and long-term environmental
changes, which has been thoroughly discussed in reviews (Cazzonelli and Pogson,
2010; Ruiz-Sola and Rodriguez-Concepcion, 2012; Nisar et al., 2015; Yuan et al.,
2015; Solovchenko and Neverov, 2017; Sun et al., 2018). Several anthropogenic and
natural activities increase the level of atmospheric carbon dioxide concentration
leading to the unavoidable perhaps unprecedented ecological consequences including
the catastrophic global warming (Reichstein et al., 2013; Frank et al., 2015; Xu and
Ramanathan, 2017). The increased concentration of atmospheric CO2 and subsequent
rise in the global temperature affect plant physiology, primary productivity as well as
ecosystem functions. The regulation of carotenogenesis in leaves, particularly in
response to the fluctuations in CO2 and temperature regimes, remain poorly
understood. The following sections highlight the gaps in understanding
carotenogenesis in leaves during developmental changes and in response to the
changing environmental conditions, specifically atmospheric carbon dioxide and
temperature.
i) Previous studies have revealed varying effects of CO2 enrichment on the level
of both carotenoid and chlorophyll content in the leaves of different plants,
including Arabidopsis (Table 2.1). Surprisingly, most of the CO2 enrichment
studies have ignored describing the level of individual carotenoids. The
strategies plants adapt to maintain carotenoid homeostasis during leaf
development; and how plants synchronise endogenous developmental cues, and
the level of atmospheric CO2 concentration remains unclear. Also, the CO2
enrichment studies have entirely ignored the maturity (age) and developmental 38
phase of the leaves that were chosen to measure pigments and photosynthetic
efficiency in response to the varying levels of atmospheric CO2. The
compounding factors could be responsible for the apparent variability in the
level of photosynthetic pigments in response to elevated CO2 (Table 2.1).
Whether carotenogenesis in young and old leaves or the leaves of different
developmental phases (juvenile and adult phase) respond similarly to elevated
CO2 requires further exploration. Chapter 2 of this thesis demonstrates the
impacts of elevated CO2 on foliar carotenoid content inculcating the prevalent
ambiguity. ii) Both warming and cooling beyond the optimum temperature range reduce the
rate of photosynthesis (Paredes and Quiles, 2015; Drake et al., 2018), which
decreases the metabolite precursor pool and subsequently can affect the level of
photosynthetic pigments. In leaves, the level of zeaxanthin content substantially
increased under higher temperature conditions; therefore, neutralises the heat-
induced oxidative stress (Davison et al., 2002). The intercalation of violaxanthin
and zeaxanthin in lipid membranes decreases the membrane fluidity that makes
membranes less-permeable for ROS, eventually contributing anti-oxidative
capacity (Subczynski et al., 1991; Kupisz et al., 2008). Also, an increase in
zeaxanthin content rigidifies the thylakoid membranes; thereby, increases
thermostability against stressful light and temperature conditions (Tardy and
Havaux, 1997; Grudzinski et al., 2017). Zeaxanthin is, thus, crucial to
maintaining functional homeostasis of the photosynthetic apparatus under high-
temperature stress (Latowski et al. 2002; Strzałka et al. 2003; Havaux et al.
2007). The de-epoxidation of violaxanthin is the major event leading to a
concomitant increase in zeaxanthin; however, the fate of other carotenoids and
39
carotenogenesis in response high-temperature stress remain unclear in the
previous studies.
On the other hand, the non-freezing cold also reduces the rate of
photosynthesis (Paredes and Quiles, 2015), but increases sucrose and abscisic
acid content to acclimate plants to the cold stress (Nagele et al., 2012; Bakht et
al., 2013; Ruan, 2014). Both sucrose and abscisic negatively impact the
carotenoid biosynthesis. While the impacts of high and low temperature on
photosynthetic traits have been substantially explored in many plants; how
carotenogenesis coordinates leaf development during short- and long-term
exposure to high and low temperature is unclear. An outstanding concern is
whether the recently emerged young leaves and mature (old) leaves respond
similarly to increase or decrease in temperature. Chapters 3 and 4 demonstrate
how the basal warming, stressing high temperature, and non-freezing cold can
affect the level of photosynthetic pigments in recently emerged young leaves
compared to the old leaves. iii) In leaves, the level of photosynthetic pigments can be stable at steady state,
which matches the state of photosynthetic efficiency (Biswal, 1995). However,
the state of chloroplast development and function determines the cellular
pigment homeostasis in leaves. The multitude of functional changes can occur
at a cellular, subcellular, physiological, and morphological level during leaf
development as they progress from a leaf primordium to fully functional to
senescence; eventually, affecting the foliar pigment profile. For example, the
disintegration of chloroplasts and enzymatic degradation of carotenoids is
evident in many plants during senescence, including Arabidopsis (Nath et al.,
2013; Rottet et al., 2016). In leaves, the critical developmental characteristics
that retain throughout the lifespan are ontogenetic attributes such as juvenile and
40 adult phase identities (Kerstetter and Poethig, 1998; Poethig, 2013). The unique leaf morphology, abaxial trichomes, and cell types are the typical leaf phase identities (Poethig, 1997; Nguyen et al., 2017). Another developmental scenario in leaves is that the recently emerged leaves comprise a high density of small and rapidly dividing cells with smaller chloroplasts having poorly developed thylakoid network compared to the enlarged cells accommodating larger chloroplasts having a fully developed thylakoid network in mature leaves
(Gonzalez et al., 2012; Gugel and Soll, 2017). While carotenoids are continuously synthesised and degraded within chloroplasts (Beisel et al., 2010), leaves maintain a functional-state of carotenoid profile facilitating photosynthesis and photoprotection. However, it is intriguing that the level of foliar carotenoids was substantially higher in the recently emerged young leaves compared to old leaves in Arabidopsis (Stessman et al., 2002) and Brassica napus (Ghosh et al., 2001). Regardless of the deep understanding of carotenogenesis in both photosynthetic and nonphotosynthetic tissues, an outstanding question here is, how carotenogenesis orchestrates developmental changes in leaves concomitantly accommodating the instantaneous environmental fluctuations. Also, accumulation of cis-carotene intermediates affects plastid development and photomorphogenesis as revealed in zds/clb5 and crtiso leaves (Park et al., 2002; Avendano-Vazquez et al., 2014), which indicates a strict regulation of carotenogenesis during leaf development. As mentioned earlier, young and old leaves are drastically different in size and ultrastructure of chloroplasts, which is directly associated with the plastidial metabolism, including carotenogenesis. It is not clear whether the ontogenic identities of leaves govern the functional specificity of chloroplasts; therefore, the carotenoid content. Likewise, as described above, the substantially higher
41
carotenoid content in recently emerged leaves can be the function of higher cell
and chloroplast density in contrast to the low density of larger cells and
chloroplasts in the old leaves. The Chapter 5 dissects developmental, molecular,
and environmental scenarios revealing the age-dependent control of foliar
carotenoid pool.
1.10 Aim of the study
The overarching aim of this study was to decipher how the environmental changes in atmospheric CO2 concentration and temperature impact foliar carotenoid content in the leaves of different age and developmental phase by utilising mutants and chemicals that affect the biosynthesis, storage, and degradation of carotenoids.
The goal was to determine if young leaves undergoing rapid cell and plastid division were more amenable to environmental perturbations compared to the physiologically mature older leaves that restrict cell expansion and plastid replication. The key questions addressed in this project are as follows.
i) What are the impacts of elevated CO2 on carotenoid content in Arabidopsis leaves? ii) What are the impacts of basal warming and an extreme heatwave on carotenoid
content in Eucalyptus leaves? iii) What effect does a short and prolonged cold treatment have on carotenoid content
in Arabidopsis leaves? iv) How is carotenoid homeostasis maintained during foliar development, from a
recently emerged and young leaf primordia through to an old and fully expanded
mature leaf? v) Which leaf types are the most responsive to environmental alterations, and what
are the signalling metabolites and processes?
42
1.11 Hypotheses
This thesis encompasses the facts demonstrating how carotenoid metabolism cross-talks with the leaf-development, and what are the intracellular signalling processes that link physiological acclimation to elevated carbon dioxide, prolong warming, high-temperature stress, and severe, but non-freezing, cold treatments.
Figure 1.3 illustrates the critical assumptions undertaken to conduct this study.
Figure 1.3 A conceptual outline of the possible scenarios by which CO2, temperature, and leaf-age can influence carotenogenesis in Arabidopsis leaves.
The solid arrows and round-headed lines represent the positive and negative effects, respectively, of the respective conditions in the respective scenario. The dashed arrows represent hypothesised steps. Following sections describe the assumptions illustrated in Figure 1.3. i) Increase in atmospheric CO2 enhances carbon assimilation and primary metabolite
pool, including sugars and amino acid, in plants when the level of mineral nutrients
is adequate (Florian et al., 2014; Watanabe et al., 2014; Noguchi et al., 2015). CO2
enrichment increases the number and size of chloroplasts (Griffin et al., 2001;
Wang et al., 2004; Teng et al., 2006); therefore, enhance sink area for carotenoid
accumulation. The reduced level of isoprene emission in response to elevated CO2
(Rosenstiel et al., 2003) could also favour more isoprenoid precursor availability
for the carotenoid biosynthesis. Here, I hypothesise that elevated CO2 would
enhance precursor flux through the carotenoid biosynthetic pathway and/or 43
carotenoid storage capacity, consequently enhancing the foliar carotenoid pool
(Figure 1.3 A). ii) Heat stress affects the chloroplast physiology, particularly inhibit photosynthesis
(Drake et al., 2018) and reduce chlorophyll content (Haldimann et al., 2008). The
higher temperature downregulates biosynthesis and/or accumulation of carotenoids
as evident in tomato fruits (Dumas et al., 2003; Hernandez et al., 2015) and bitter
melon (Tran and Raymundo, 1999). However, an increase in the level of
xanthophylls, particularly zeaxanthin, is essential to enhance heat tolerance by
neutralising the heat-induced oxidative stress (Davison et al., 2002). Also, heat
stress triggers plastoglobule formation, which are the sites of carotenoid
degradation (Zhang et al., 2010). The high temperature-induced alteration in leaf
physiology and heat-stress tolerance is deeply explored in mature leaves from trees
and grasses. However, as the level of carotenoids varies in young and old leaves,
how the long-term warming and sudden exposure to high-temperature stress can
affect carotenogenesis in the leaves of different maturity level, young vs old, is
unclear. I hypothesise that elevated temperature would enhance the zeaxanthin
pool triggering de-epoxidation of violaxanthin regardless of the leaf-age to cope
high-temperature stress (Figure 1.3 B). iii) Cold stress reduces photosynthesis (Allen and Ort, 2001; Paredes and Quiles,
2015). However, as an acclimatory process, increase in sugar accumulation in
response to the non-freezing cold exposure (Nagele et al., 2012; Bakht et al., 2013;
Ruan, 2014) can downregulate the carotenoid biosynthesis in leaves (Fanciullino et
al., 2014; Cao et al., 2015). I hypothesise that both young and old leaves would
decrease carotenoid content in response to the cold exposure, subsequently
affecting apocarotenoid production in the downstream (Figure 1.3 C).
44 iv) The cells, as well as chloroplasts, undergo a series of developmental and
functional changes during leaf maturation. The fully expanded cells in mature
leaves comprise large-sized and fully differentiated chloroplasts; whereas the
chloroplasts of young leaves are smaller with poorly developed thylakoids as
observed in Arabidopsis (Gugel and Soll, 2017). The structural and functional
changes in chloroplasts during leaf expansion potentially modulate the chloroplast
associated metabolic activities, including carotenogenesis. For example, the rate of
photosynthesis and level of photosynthetic pigments both were higher in the
recently emerged leaves than mature leaves of Arabidopsis (Stessman et al., 2002).
Alternatively, overexpression of miR156 that suppress SPL15 enhanced carotenoid
content in the seeds of Arabidopsis (Wei et al., 2012) and Brassica napus (Wei et
al., 2010). Both SPL15 and miR156 control the developmental phase identities in
Arabidopsis leaves (Jung et al., 2011; Xu et al., 2016; Nguyen et al., 2017).
Therefore, the leaf vegetative phase regulators can affect carotenoid biosynthesis
and/or degradation in leaves. I hypothesise that the high cell density and actively
dividing chloroplasts in young leaves can enhance carotenogenesis and
accumulate a substantially high level of carotenoids. I also hypothesise that young
leaves are highly amenable to environmental change due to higher plasticity for
cell and plastid development to be altered by intracellular signals. Lastly, I
hypothesise that older leaves undergone cell expansion and having mature
chloroplasts are more resilient to show changes in carotenogenesis in response to
environmental perturbations (Figure 1.3 D).
1.12 Objectives
This study was aimed to explore the effects of different CO2 and temperature regimes on foliar carotenoids and the mechanisms controlling carotenogenesis during leaf maturation in Arabidopsis. The main objectives of the project are as follows. 45
1.12.1 Impact of elevated CO2 on the growth performance and foliar carotenoid pool in Arabidopsis i) Determine the plant growth traits in response to ambient and elevated CO2. ii) Determine the carotenoid and chlorophyll content in the young and old leaves of
juvenile and adult phase in response to ambient and elevated CO2. iii) Determine the interactive effects of elevated CO2 and leaf age in carotenoid
content.
1.12.2 Impact of elevated temperature on the foliar carotenoid pool in Eucalyptus leaves i) Determine the effects of basal warming and experimental heatwave on the
carotenoid profile of the young and old leaves. ii) Determine the interactive effects of heatwave and leaf-age on carotenoid and
chlorophyll accumulation.
1.12.3 Impact of cold exposure on carotenogenesis during leaf development in Arabidopsis i) Determine the carotenoid content in young and old leaves exposed to short cold
exposure. ii) Determine the impact of long-term cold treatment on the carotenoid content in
young and old.
1.12.4 Regulation of carotenogenesis during the Arabidopsis leaf maturation iii) Explore the transcriptome databases to determine the expression profile of the
genes involved in vegetative phase regulatory, carotenoid biosynthetic, and
carotenoid degradation pathways. iv) Determine the expression profile of the genes involved in vegetative phase
regulatory, carotenoid biosynthetic, and carotenoid degradation pathways. v) Determine the carotenoid and chlorophyll content in young and old leaves of
vegetative phase regulatory, carotenoid biosynthetic, and carotenoid degradation
pathway mutants and overexpression lines. 46 vi) Determine the effect of norflurazon on the accumulation of phytoene and
downstream carotenoids and chlorophylls in young and old leaves of carotenoid
biosynthesis and degradation pathway mutants. vii) Determine the effect of norflurazon on the accumulation of phytoene,
downstream carotenoids, and chlorophylls in young and old leaves in response to
the short-term dark, cold, and warm conditions.
1.13 Research design
A 2x2 factorial balanced design was adopted to conduct the experiments unless indicated otherwise. The two levels of environmental treatments (ambient vs high or low) were applied, and impacts of treatments on the level of foliar carotenoids and chlorophylls were measured in two types of leaves (young vs old) within and across a wide range of genotypes. The experiment specific details are described in the respective chapters.
………. ……….
47
Leaf-age dependent response of carotenoid accumulation to elevated CO2 in Arabidopsis Except for a few minor changes, the content of this chapter is as appeared in
Dhami, N., Tissue, D., T., Cazzonelli, C. I. (2018). Leaf-age dependent response of carotenoid accumulation to elevated CO2 in Arabidopsis. Archives of Biochemistry and Biophysics 647: 67-75.
48
Abstract
Carotenoids contribute to photosynthesis, photoprotection, phytohormone and apocarotenoid biosynthesis in plants. Carotenoid-derived metabolites control plant growth, development and signalling processes and their accumulation can depend upon changes in the environment. Elevated carbon dioxide (eCO2) often enhances carbon assimilation, growth patterns and overall plant biomass, and may increase carotenoid accumulation due to higher levels of precursors from isoprenoid biosynthesis. Variable effects of eCO2 on the carotenoid accumulation in leaves have been observed for different plant species. Here, I determined whether the variable response of carotenoids to eCO2 was potentially a function of leaf age and the impact of eCO2 on leaf development by growing Arabidopsis in ambient CO2 (400 ppm) and eCO2 (800 ppm). eCO2 increased plant leaf number, rosette area, biomass, seed yield and net photosynthesis. Besides, eCO2 increased carotenoid content by 10-20 % in younger emerging leaves, but not in older mature leaves. Older leaves contained approximately 60 % less total carotenoids compared to younger leaves. The age- dependent effect on carotenoid content was observed for cotyledon, juvenile and adult phase leaves. I conclude that younger leaves utilise additional carbon from enhanced photosynthesis in eCO2 to increase carotenoid content, yet older leaves have less capacity to store additional carbon.
49
2.1 Introduction
Carotenoids contribute to photosynthesis and photoprotection in plants. They are the key metabolites maintaining functional stability of the photosynthetic apparatus during fluctuations in light intensity and the quality of light spectrum
(Davison et al., 2002; Santabarbara et al., 2013; Kusama et al., 2015). Carotenoids also provide metabolic precursors for the biosynthesis of phytohormones such as abscisic acid (Nambara and Marion-Poll, 2005) and strigolactones (Ruyter-Spira et al., 2013), as well as apocarotenoid signalling metabolites such as β-cyclocitral
(Ramel et al., 2012) and dihydroactinidiolide (Shumbe et al., 2014). These signalling molecules regulate physiological processes, plant growth, development and reproduction, contributing to plant acclimation processes (Cazzonelli, 2011; Nisar et al., 2015; Hou et al., 2016). As such carotenoid biosynthesis, degradation, and storage are concomitantly modulated to suit prevailing environmental conditions in a tissue- specific manner.
Photosynthetic pigments capture solar energy to facilitate carbon fixation during photosynthesis in plants. In higher plants, chlorophyll a and b and carotenoids are universal components in the light-harvesting complexes (Grudzinski et al., 2001;
Liguori et al., 2015; Qin et al., 2015; Mazor et al., 2017). In chloroplasts, chlorophylls absorb photons in the blue (ca. 400-500 nm) and red (ca. 620-680 nm) regions, whereas carotenoids absorb photons from the blue (ca. 450-500 nm) regions and subsequently transfer energy to chlorophylls, thereby facilitating photosynthesis
(Croce et al., 2001; Scott, 2001). Carotenoids are accessory photosynthetic pigments and partially contribute to light-harvesting, thereby facilitating sustainable photosynthesis in the chloroplasts. In plants, an optimum level of carotenoids is required to sustain growth and development under ambient environmental conditions
(Cazzonelli and Pogson, 2010; Nisar et al., 2015; Yuan et al., 2015). In photosynthetic 50 tissues, carotenoid biosynthesis occurs in chloroplasts where lutein, β-carotene, violaxanthin, and neoxanthin accumulate as the four major carotenoid components of the light-harvesting complexes (Grudzinski et al., 2001; Liguori et al., 2015; Qin et al., 2015; Mazor et al., 2017). These carotenoids maintain the functional stability of the photosynthetic apparatus and the chlorophyll to carotenoid ratio must be tightly maintained (Santabarbara et al., 2013; Kusama et al., 2015).
Photosynthetic efficiency and rate of carbon dioxide assimilation need to be maintained in plants (Ritz et al., 2000; Wang et al., 2015; Jin et al., 2016).
Carotenogenesis can be altered within leaves to suit prevailing environmental and developmental changes, while also maintaining the production of carotenoid-derived signalling metabolites that maintain cellular homeostasis. In most instances, overall carotenoid content in leaves is viewed as being rather stable with constant and rapid rates of biosynthesis and degradation (Beisel et al., 2010; Beisel et al., 2011). The availability of isoprenoid precursors produced via the 2-C-methyl-D-erythritol 4- phosphate (MEP) pathway can affect carotenoid biosynthesis in both tomato and carrot (Lois et al., 2000; Rodriguez-Concepcion et al., 2001; Simpson et al., 2016).
An increase in MEP pathway precursors particularly isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP) through the overexpression of
1-deoxy-D-xylulose-5-phosphate synthase (DXS) also enhanced lycopene production in Corynebacterium glutamicum (Heider et al., 2014). Also, the functional interaction of geranylgeranyl diphosphate synthase 11 (GGPPS11) and phytoene synthase (PSY) was shown to control phytoene biosynthesis (Ruiz-Sola et al., 2016). Interestingly, the overexpression of PSY increased carotenoid accumulation in Arabidopsis roots by
100-fold, whereas carotenoid levels remain unchanged in photosynthetic tissues
(Maass et al., 2009; Alvarez et al., 2016). Collectively, these studies exemplify how a
51 greater availability of isoprenoid precursors and efficient utilisation of the precursor substrate pool can affect carotenoid accumulation.
Atmospheric CO2 concentration primarily governs the biological carbon fixation in plants. An increase in plant vigour, delay in vegetative to reproductive phase transition and a notable increase in biomass, are well-known impacts of elevated CO2 on plant growth (Springer and Ward, 2007; Castro et al., 2009;
Andresen et al., 2017). Elevated CO2 also increases number and size of chloroplasts concomitantly enhancing photosynthesis and carbohydrate biosynthesis (Griffin et al.,
2001; Wang et al., 2004; Teng et al., 2006; Li et al., 2013). Rising CO2 increases the
C:N ratio in plants with concomitant alterations in elemental composition (Loladze,
2002; Myers et al., 2014), isoprenoids (Sun et al., 2013; Way et al., 2013), flavonoids
(Karowe and Grubb, 2011; Goufo et al., 2014), anthocyanins (Tallis et al., 2010), and alkaloids (Ziska et al., 2008; Singh and Agrawal, 2015) in many plants. In general,
CO2 enrichment enhances carbon assimilation thereby increasing foliar soluble sugars, starch, and amino acids (Moore et al., 1998; Florian et al., 2014; Noguchi et al., 2015). Therefore, it is a reasonable assumption that CO2 enrichment would increase the availability of isoprenoid substrates required for carotenogenesis.
The effects of CO2 enrichment on carotenoid and chlorophyll levels in leaves are variable among different plants (Table 1). For example, some plants show an increase (e.g. Solanum lycopersicum, Gyanura bicolor, Catharanthus roseus), a decrease (e.g. Glycine max, Zea mays, Brassica napus, Lactuca sativa, Populus tremuloides, and Pinus ponderosa) or no change (e.g. Arabidopsis thaliana, Beta vulgaris, and Zea mays) in carotenoid content under eCO2 (Table 1). Similarly, there is considerable variability in total chlorophyll levels in response to CO2 enrichment
(Table 1). The phenomenal variation in chlorophyll and carotenoid levels in response
52 to eCO2 suggests that eCO2 and carotenoid pigment production may be partially regulated by the developmental stage and/or age of the leaf.
Table 2.1 Elevated atmospheric CO2 has varied effects on foliar carotenoid and chlorophyll pigment content within and between different plant species.
SN Plants Family Carotenoid Chlorophyll Reference content content 1 Arabidopsis thaliana (L.) Henyh. Brassicaceae ND No change (Cheng et al., 1998) 2 Arabidopsis thaliana (L.) Henyh. Brassicaceae No change No change (Kooij et al., 1999; Bae and Sicher, 2004) 3 Arabidopsis thaliana (L.) Henyh. Brassicaceae ND Decrease (Li et al., 2006; Li et al., 2008) 4 Arabidopsis thaliana (L.) Henyh. Brassicaceae ND Increase (Takatani et al., 2014) 5 Beta vulgaris L. Amaranthaceae No change Decrease (Kumari et al., 2013) 6 Brassica napus L. Brassicaceae Decrease Decrease (Miliauskienė et al., 2016) 7 Catharanthus roseus (L.) G. Don. Apocynaceae Increase Increase (Singh and Agrawal, 2015) 8 Glycine max (L.) Merr. Fabaceae Decrease Decrease (Pritchard et al., 2000; Mishra et al., 2008; Wang et al., 2015; Singh et al., 2017) 9 Glycine max (L.) Merr. Fabaceae No change No change (Li et al., 2013) 10 Gynura bicolor (Roxb. ex Willd.) Asteraceae Increase Increase (Wang et al., 2016) DC. 11 Helianthus sp. Asteraceae ND No change (Moore et al., 1998) 12 Labisia pumila Benth. & Hook. f. Primulaceae ND Decrease (Ibrahim et al., 2014) 13 Lactuca sativa L. Asteraceae Decrease Decrease (Pérez-López et al., 2015)
53
SN Plants Family Carotenoid Chlorophyll Reference content content 14 Liriodendron tulipifera Magnioliaceae No change Increase (Je et al., 2017) 15 Musa sp. Musaceae ND No change (Moore et al., 1998) 16 Pinus ponderosa Douglas ex C. Pinaceae Decrease Decrease (Houpis et al., 1988) Lawson 17 Pinus sylvestris L. Pinaceae Decrease Decrease (Wang et al., 2003) 18 Populus deltoides W. Bartram ex Salicaceae ND No change (Tissue and Lewis, 2010) Humphry Marshall 19 Populus tremuloides Michx. Salicaceae Decrease Decrease (Wustman et al., 2001) 20 Populus × canescens (Aiton) Sm. Salicaceae Decrease Decrease (Way et al., 2013) 21 Pseudotsuga menziesii (Mirb.) Pinaceae Decrease Decrease (Ormrod et al., 1999) Franco var. menziesii 22 Quercus robur L. Fagaceae Decrease ND (Schwanz and Polle, 2001) 23 Raphanus sp. Brassicaceae ND Decrease (Moore et al., 1998) 24 Raphanus sp. Brassicaceae ND Increase (Urbonaviciute et al., 2006) 25 Zea mays L. Poaceae No change No change (Wijewardana et al., 2016) 26 Zea mays L. Poaceae Decrease Decrease (Wang et al., 2015; Miliauskienė et al., 2016) (ND, not determined)
54
In plants, leaves display characteristic developmental patterns as the plant grows
(Poethig, 2013) and the developmental changes in the leaf functional traits continuously interact with the ambient environmental conditions (Jin et al., 2011).
Arabidopsis rosette leaves show an age-dependent change in morphology (Tsukaya et al., 2000; Tsukaya, 2013; Xu et al., 2016) with a characteristic developmental transition that is epigenetically regulated by rearrangements in cellular architecture
(Xu et al., 2016; Nguyen et al., 2017). The early emergent juvenile phase leaves and late-emerging adult phase leaves retain their phase identity even though all leaf types undergo an age-dependent maturation process (Poethig and Sussex, 1985; Gonzalez et al., 2010; Nguyen et al., 2017). The homeostasis of carotenoids during the leaf developmental transitions and interactions with changing environmental conditions remain surprisingly unexplored. Here, I investigated the potential impacts of leaf developmental phase and age on leaf carotenoid accumulation in response to CO2 enrichment. Carotenoid and chlorophyll levels were quantified in juvenile-to-adult leaves and young-to-old leaves from Arabidopsis plants growing under ambient and eCO2. I describe an age-dependent effect of eCO2 on foliar carotenoid levels and partially resolve ambiguities regarding the variable effects of eCO2 on carotenoid pigment accumulation in plants.
2.2 Materials and methods
2.2.1 Plant growth conditions Arabidopsis thaliana (ecotype Col-0) plants were grown in growth cabinets
(Climatron Star700, Thermoline Scientific, Australia) under controlled growth conditions. The Debco Seed Raising and Superior germinating mix (Scotts Australia) with additional fertiliser supplement (3 % Osmocote) was used to grow plants in the
30-Cell Kwikpot-trays (Garden City Plastics, Australia) with 50x50x60 mm cell dimensions and 100 ml cell volume. Arabidopsis seeds were sown on the moistened
55 soil mix and stratified at 4 oC in the dark for three days. Stratified Arabidopsis trays were kept under ambient conditions for 48 h until germination, thereby eliminating the possible effect of eCO2 on seed germination. The trays with germinated seedlings were transferred to the growth cabinets customised for ambient (400 ppm) or elevated
(800 ppm) CO2 concentration. The photoperiod, light intensity, and temperature conditions were 16/8 h (light/dark), 130-150 µmol m-2 sec-1 (provided with high- pressure sodium lamps) and 22/18 oC (day/night) respectively in all experimental chambers. Experiments were repeated at least twice randomising the chambers to minimise the growth chamber dependent variations.
2.2.2 Phenotype assessment The rosette characteristics such as the number of rosette leaves, rosette area, and rosette biomass were measured four weeks after stratification when the main bolt became visible in ~90 % of the plants. The rosette area was measured by analysing plants photographs using ImageJ, an open-source Java-based image processing computer program (Schneider et al., 2012). Rosettes were dried at 40 oC for 48 h for the dry weight measurement. The rosette biomass of the two and three-week-old plants was also recorded to determine if there were plant age effects due to eCO2. The final harvest was conducted when most of the siliques were mature, and about 5-7 basal siliques of the main bolt started shattering. Harvested plants were dried at 40 oC for 4-5 days, and seed yield was recorded.
2.2.3 Leaf tissue collection for pigment measurement Arabidopsis rosette leaves of different developmental stages were analysed to measure the content and composition of photosynthetic pigments (carotenoids and chlorophylls) in response to eCO2. Leaf tissues of 25-50 mg/sample were collected during the middle of the photoperiod (within 7-9 hours after the start of an experimental day) from the 21 days old Arabidopsis plants or as stated otherwise. The
56 time of emergence (ontogeny) based numbering of rosette leaves was adopted to identify the leaves of different age and position. In this connection, the first emerged true leaf was numbered as #1, and subsequent leaves were numbered serially. Every biological sample comprised of the same leaf from 3-7 plants and at least four biological replicates were taken for each leaf each treatment. Unless specified otherwise, young leaf tissues were collected from the recently emerged leaves (leaf length was about 5 mm or smaller and within 4-5 days of emergence) and old leaves were fully expanded, but without any visual sign of senescence. Leaf samples were snap-frozen in liquid nitrogen and stored in -80 oC until extraction except for the dry samples where leaves were dried at 40 oC under dark for 24 hours.
2.2.4 Pigment extraction The extraction and quantification of chlorophylls and carotenoids was performed as previously reported (Pogson et al., 1996). The frozen leaf samples were milled in the TissueLyser® (Qiagen) and finely powdered 25-50 mg leaf tissues were extracted with 1 ml extraction buffer containing acetone and ethyl acetate (60:40) and
0.1 % butylated hydroxytoluene (BHT). Extraction mixture was vortexed for a minute, and 0.8 ml milliQ water was added to separate pigments by the phase separation. Microtubes were gently inverted for three times avoiding vigorous shaking and centrifuged at 15,000 rpm for 5 minutes at 4 oC. The upper pigmented ethyl acetate phase was collected in a new microtube, inverted once, and centrifuged for another five minutes as before. Finally, 200 μl pigmented supernatant was collected in a clean vial and stored at 4 oC until analysed by HPLC.
2.2.5 Pigment measurement Chromatographic separation of carotenoids and chlorophylls were performed using HPLC (Agilent 1260 Infinity). The 20 μl ethyl acetate extract of leaf samples was injected into the HPLC system equipped with YMC-C30 (250 x 4.6 mm, S-5 μm)
57 column and Diode Array Detector (DAD) detector. Pigments were separated using a reverse-phase solvent gradient comprised of mobile phase A (methanol with 0.1 %
(v/v) triethylamine) and B (methyl tert-butyl ether). The initial solvent composition was 85 % and 15 % of the solvent A and B respectively until one minute, followed by a gradient that reached 35% of B at 11.0 minute. The ratio of B increased to 65 % at
11.1 minutes, followed by a gradient up to 100 % at 15.0 minute and stabilised until
17.0 minute. The solvent flow rate was 1 ml/min until 17.0 minutes. The solvent composition was returned to the initial state (15 % of B) at 17.1 minutes, and the column was equilibrated until 25 minutes with the flow rate of 2.0 ml/minute.
Carotenoid and chlorophyll peak signals were recorded at 440 nm, and individual pigments were identified by comparing their retention time and absorption spectra with the published literature (Rodriguez-Amaya and Kimura, 2004). The pigment concentration was interpreted in terms of microgram per gram of fresh or dry weight of tissue by integrating peak area with the standard curve as described by (Pogson et al., 1996) and (Cuttriss et al., 2007).
The DAD signals were recorded at 440 nm, and carotenoid species were identified by retention time, spectral structure and the ratios of maximum absorption peaks. The absolute quantities of carotenoids in micrograms (µg) of carotenoids per gram fresh weight (gfw) was derived by integrating the peak area to a standard curve value, as previously described (Pogson et al., 1996). Slope values used for converting peak area into µg/gfw leaf tissue include; neoxanthin (8.787E-05), violaxanthin
(7.986E-05), lutein (9.498E-05; also used for antheraxanthin and zeaxanthin), - carotene (9.22E-05), chlorophyll b (2.849E-04) and chlorophyll a (2.74E-04). The proportions of individual carotenoids were presented as a percentage of total carotenoid content.
58
2.2.6 Gas exchange measurements The mid-day leaf-level gas exchange was measured under plant growth conditions using the LI-6400 XT (LI-COR Biosciences, Lincoln, USA) to determine photosynthesis in response to atmospheric CO2 concentrations (Ca). Four plants of the similar developmental stage were sampled from each treatment group for the mid-day gas exchange measurements. The fully expanded inner rosette leaves of similar size were maintained for 10-20 minutes at their growth conditions (i.e. leaf temperature
(22 °C), humidity (60 %), light intensity (150 PAR) and 400 or 800 ppm CO2) in the
Li-COR leaf chamber to attain steady-state photosynthesis before measurement. The carbon assimilation rate (A) as a function of intercellular CO2 (Ci) was measured by applying external CO2 in 13 steps, increasing from 50 to 1400 ppm. The gas exchange responses were recorded at each Ca set-point after three minutes of photosynthesis stabilisation. The ACi responses at the growth Ca were used to compare treatment effects on the net CO2 assimilation rate (Anet).
2.2.7 Data analysis and illustrations The test parameters were presented in terms of the sample mean ± standard errors of means (SEM). Student t-test was performed to interpret the paired comparisons, and Two-Way ANOVA was performed for the unpaired multiple mean comparisons.
2.3 Results
2.3.1 CO2 enrichment enhanced photosynthesis and plant biomass
In order to test the effects of CO2 enrichment on leaf carotenoid levels, I first evaluated the effects of eCO2 on Arabidopsis growth, development and photosynthesis. Seeds were germinated and grown in environmentally controlled growth chambers maintained with either 400 ppm (aCO2) or 800 ppm (eCO2) CO2. To minimise the impact of the plant developmental stage on the biomass response to
59 eCO2, I analysed biomass accumulation throughout vegetative development. Two-, three- and four-week-old plants all displayed a consistent increase (>50 %) in rosette biomass in eCO2 (Figure 2.1 A). At the time of vegetative to reproductive phase transition when the floral bolt emerged, the rosettes of eCO2 treated plants were significantly larger, and the leaf blades of adult leaves were partially curling toward the abaxial surface (Figure 2.1 B-C). There was a marginal (1-2 days) delay in the time of flowering for the eCO2 plants and a significant increase in leaf number (Figure
2.1 D). Overall, the flowering 4-week-old eCO2 grown plants had a 60 % greater shoot biomass (fresh and dry) and 30 % higher seed yield compared to aCO2 grown plants (Figure 2.1E-G). Photosynthesis (Anet) in the fully expanded adult leaves (leaf
9-11) of bolting-stage Arabidopsis plants was 60 % higher (t-test p>0.001) in eCO2 plants (Figure 2.1 H) leading to a substantial effect on overall Arabidopsis growth
(Figure 2.1 I). The rate of photosynthesis was not measured in recently emerged leaves due to their small size (<5 mm).
Figure 2.1 Elevated CO2 enhances Arabidopsis plant biomass and photosynthesis.
60
A) Rosette biomass of Arabidopsis plants grown under ambient and elevated CO2. Rosettes were harvested 2, 3 and 4 weeks after germination. B-E) Images of whole rosettes (B), leaf rosette area (C), number of rosette leaves (D), and rosette fresh (E) and dry weight (F) from four-week-old plants grown under ambient and elevated CO2 (n=30). G) Yield of seed from individual plants (60 DAG) grown to full maturity under ambient and elevated CO2 (n=10). H) Rate of photosynthesis (Anet) in the fully expanded rosette leaves of ambient and elevated CO2 grown plants (n=4). I) Percentage increase in growth traits under elevated CO2. Data is representative of at least two independent experiments. Error bars represent standard error. Statistical analysis by paired t-test (p<0.05; *** represents p<0.001). Amb; Ambient CO2, Elev; elevated CO2, DW; Dry Weight, FW: Fresh Weight.
2.3.2 CO2 enrichment enhanced carotenoids in young recently emerged leaves Carotenoids and chlorophyll pigments in mature fully expanded adult leaves exhibited no significant difference in response to eCO2 (Figure 2.2 A-B). However, the recently emerged younger leaves from plants grown under eCO2 showed a significant ~20 % increase in total carotenoid content (Figure 2.2 C). The levels of lutein, -carotene, violaxanthin, and neoxanthin were all significantly higher in younger leaves than in older leaves in eCO2 (Figure 2.2 D). The percentage composition of individual carotenoids, relative to the total, remained unchanged except for neoxanthin, which showed a subtle yet significant increase (Figure 2.2 E).
The amounts of carotenoids and chlorophylls are tightly coordinated to maintain photosystem assembly and maximum photosynthetic efficiency. Indeed, I did observe a significant ~10 % increase in total chlorophyll levels in younger emerging leaves from eCO2 plants (Figure 2.2 F). The chlorophyll a/b, as well as the carotenoid/chlorophyll ratios, remained constant in younger leaves in response to eCO2 (Figure 2.2 G-H). Therefore, despite the increased rate of photosynthesis in older leaves from plants grown under eCO2, foliar carotenoid and chlorophylls level levels were only enhanced in the recently emerged younger leaves.
61
Figure 2.2 Elevated CO2 increases carotenoid and chlorophyll levels in young expanding leaves.
Total carotenoid (A) and chlorophyll (B) content in the fully expanded and older adult phase leaves (leaf#5-7) from three-week-old plants grown under ambient (amb) and elevated (elev) CO2. C-F) Pigment quantifications in recently emerged and younger adult phase leaves (leaf#10-12) from three-week-old plants grown under ambient and elevated CO2. C) Total carotenoid content. D) Individual carotenoid content. E) Percentage of individual carotenoids to the total carotenoid content. F) Total chlorophyll content. G) chlorophyll a/b, and H) chlorophyll/carotenoid ratios. Data is representative of three independent experiments. Error bars represent standard error (n=10). Statistical analysis by paired t-test (p<0.05; *, p<0.01; **, p<0.001; ***). Car; carotenoids, Chl; Chlorophylls, Neo; Neoxanthin, Viol; Violaxanthin, Lut; Lutein, -c; -carotene.
2.3.3 Interaction between eCO2 and carotenoid accumulation in leaves is age- dependent I next quantified carotenoid levels in Arabidopsis leaves of different age and developmental phases to determine if the eCO2 enhancement of carotenoids was dependent upon leaf age or ontogeny. Intriguingly, carotenoids displayed a linear decrease while moving from the recently emerged and younger adult phase leaves through to the early emerged juvenile phase leaves (Figure 2.3 A). The recently emerged adult phase leaves (leaf 11) comprised nearly 80 % higher carotenoid levels than the juvenile phase leaves (leaf 3). The linear decrease in carotenoids from younger to an older adult (leaves 11 to 7) and younger to older juvenile (leaves 5 to 3) leaves revealed an age-dependent process that reduces total carotenoids in aging
62 leaves, irrespective of their developmental phase (Figure 2.3 B). The individual carotenoids, lutein, -carotene, neoxanthin and violaxanthin, involved in photosystem assembly or photoprotection were reduced as leaves matured and became older
(Figure 2.3 C-F).
I examined the interaction between eCO2 and carotenoid accumulation during the stages of leaf development and observed a significant effect on total carotenoid accumulation that correlated tightly with leafage, and not the developmental phase
(Figure 2.3 B). Similarly, the individual carotenoids lutein, -carotene and violaxanthin were significantly enhanced in the young expanding leaves (Leaf 11 and
9), but not in the fully expanded older adult (leaf#7) or juvenile (Leaf#5 and 3) leaves
(Figure 2.3 C-E). Surprisingly, neoxanthin was significantly increased in all leaves from plants grown under eCO2; however, the enhanced effect diminished with leaf age (Figure 2.3 F). Taken together, I demonstrate an interaction whereby eCO2 enhances carotenoid accumulation in an age-, but not phase-dependent manner.
63
Figure 2.3 Leaf-age interaction effects carotenoid accumulation in response to elevated CO2.
Analysis of carotenoid pigmentation in aging adult and juvenile phase leaves from four-week- old plants (pre-bolting stage) grown under ambient (amb) and elevated (elev) CO2. A) Phase development and leaf ontology of an Arabidopsis rosette. B) Total carotenoids, C) Lutein, D) -carotene, E) Violaxanthin, and E) Neoxanthin content in the leaves of different developmental phases and ages. Data is representative of two experimental repeats. Plots represent sample mean with error bars displaying the standard error (n=5). Statistical analysis by paired t-test (p<0.05; *, p<0.01; **, p<0.001; ***). 2.3.4 Carotenoid accumulation decreases with leaf-age Younger leaves contained higher levels of carotenoids when compared to older leaves. Multiple experimental and biological repetitions were performed using different lighting conditions. Despite the absolute levels of carotenoids in young or older leaves being slightly variable, approximately 60-80 % higher level of carotenoids was observed in younger leaf tissues irrespective of the independent experiments (Figure 2.4 A). I quantified pigment content in dried leaf samples of young and older leaves to ascertain whether the leaf water content could cause an anomaly in the differently-aged leaf tissues. In concert with our previous results, I observed about 50 % more carotenoids in younger leaves when compared to the older
64 leaves (Figure 2.4 B). Therefore, younger leaves have a higher capacity to accumulate carotenoids when compared to older leaves.
To further validate the age-related reduction in leaf carotenoid levels, I quantified carotenoids during the aging of embryonic (cotyledons), juvenile and adult leaves (Figure 2.4 C). Total carotenoids in cotyledons decreased by 45 % after five days of aging, reflected by decreases in lutein, -carotene, neoxanthin and violaxanthin (Figure 2.4 D; day 9 vs 14). A similar age-related 66 % decrease of total carotenoids was observed for the juvenile-phase rosette leaves after 10 days of aging
(Figure 2.4 E, leaves#3 and 4). The individual carotenoids also declined accordingly after seven days of maturation (Figure 2.4 E). The total and individual carotenoids in the adult-phase leaf (the last pair of rosette leaves) also showed a consistent decrease
(40 %) after 10 days of maturation, further supporting previous observations that higher levels of carotenoids accumulate in the most recently emerged adult leaf
(Figure 2.4 F and 3). Interestingly, the total levels of carotenoids among the three different leaf types, young or old, appears to be higher in adult leaves when compared to juvenile leaves and cotyledons contained the lowest content (Compare Figures 2.4
D-F). Taken together, all leaf types examined show an age-dependent decline in total carotenoid content, particularly lutein. I conclude that leaf-age is a crucial factor affecting carotenoid accumulation within any leaf type, and perhaps leaf-phase can affect maximum carotenoid content.
65
Figure 2.4 Younger leaves have higher carotenoid levels compared to older leaves.
A) Total carotenoid content was consistently higher in younger leaves, despite some small variation among independent experiments. B) Carotenoid content in young and old dried leaf tissues. C) Images of Arabidopsis plants at different developmental stages (9, 14, 21 and 31 DAG). (D) Carotenoid content in cotyledons aged from 9 to 14 DAG. E) Carotenoid content in juvenile phase leaves (leaf#3) aged from 14 to 21 DAG. E) Carotenoid content in the recently emerged adult phase leaves aged from 21 (leaf#10-13) to 31 (the last rosette leaf#13)
66
DAG. Figures are representative of two independent experiments. Plots represent sample means, and error bars display standard error (n=5). Statistical analysis by paired t-test (p<0.01; **, p<0.001; ***). Car; carotenoids, Neo; Neoxanthin, Vio; Violaxanthin, Lut; Lutein, -c; -carotene, AL; adult leaf, JL; juvenile leaf, Ct; cotyledon. 2.4 Discussion
CO2 enrichment generated a significant enhancement in plant biomass and photosynthesis in Arabidopsis as previously revealed (Smith et al., 2000; Andresen et al., 2017). Increase in the number and size of chloroplasts may accompany the enhanced rate of carbon assimilation (Teng et al., 2006); and therefore, additional carotenoids and chlorophylls may be required to fulfil the requirements of light- harvesting and enhance the efficiency of photosynthesis (Ritz et al., 2000; Wang et al., 2015; Jin et al., 2016). Here, eCO2 increased photosynthesis, as observed in the fully expanded leaves (Figure 2.1 H). However, eCO2 enhanced carotenoid and chlorophyll pigments in the young emerging leave only, and not in the fully expanded mature and older leaves (Figure 2.2 C-D). The discrepancy in CO2 dependent enrichment of pigments in young and older leaves was not consistent with the 60 % increase in photosynthesis in mature older leaves. The leaf-age related effect of eCO2 on the carotenoid content implicates the differential strategies of young and mature leaves to utilise additional carbon source.
Several reports are available describing how the state of photosynthesis can affect carotenoid pigments levels in different plants in response to the seasonal changes such as light and temperature (Stylinski et al., 2002; Lobato et al., 2010).
These facts highlight that a change in pigments to a level below that of a critical threshold due to stress or sub-optimal lighting can rate-limit photosynthesis.
Photosynthetic capacity is not necessarily linked to pigment levels, but critically important is the content of ribulose-1,5-bisphosphate carboxylase/oxygenase
(Rubisco) and availability of intracellular CO2 (Jiang and Rodermel, 1995). Similar, a heterogeneity in photosynthetic capacity among different aged leaves has been linked 67 to nitrogen allocation and photon flux density (Hikosaka et al., 1994). Since our light levels and growth conditions were optimal for sufficient photon capture and nitrogen assimilation, any change in pigment levels due to leaf aging would be unlikely to affect photosynthesis. Finally, CO2 enrichment studies have shown insignificant changes in leaf carotenoid and chlorophyll levels for many plant species despite increased photosynthesis (Cheng et al., 1998; Kooij et al., 1999; Bae and Sicher,
2004). Therefore, in mature Arabidopsis leaves when photosynthetic capacity is enhanced by eCO2, carotenoid and chlorophyll levels remain unchanged under optimal light and growth conditions. Rather an interaction between leaf age, chloroplast and thylakoid development and Rubiso activity more likely underpins the higher rate of photosynthesis observed in older leaves in response to eCO2.
An increase in metabolic precursors and larger plastid storage capacity, together with higher photosynthesis in eCO2, should increase the foliar carotenoid and chlorophyll content. While species-specific and different environmental conditions
(light, temperature, water, and nutrient) can alter carotenoid and chlorophyll levels, inconsistent results are commonly seen even in the same plant species under similar conditions. For example, in Arabidopsis eCO2 caused an increase (Takatani et al.,
2014), decrease (Li et al., 2006; Li et al., 2008), and no change (Cheng et al., 1998;
Kooij et al., 1999; Bae and Sicher, 2004) in leaf chlorophyll content. Similarly, carotenoids in leaves from different species, including Arabidopsis, showed a variable response to eCO2 (Table 2.1). Surprisingly, only a few studies have investigated carotenoid levels in leaves from plants grown in eCO2 and those in Arabidopsis showed no significant change in carotenoid content (Kooij et al., 1999; Bae and
Sicher, 2004).
68
An unresolved issue is whether the developmental transition of a leaf could affect the accumulation of foliar carotenoids and chlorophylls in response to eCO2.
The distinct variation in morphology (Boyes et al., 2001), developmental phase identity (Kerstetter and Poethig, 1998; Poethig, 2013), and cell types (Tsukaya et al.,
2000; Nguyen et al., 2017) of Arabidopsis rosette leaves could alter the effects of eCO2 enrichment on carotenoids and chlorophyll content in leaves. The photosynthetic pigment pool is presumed to be in the steady-state in the photosynthetically active leaves until the onset of senescence (Biswal, 1995). Indeed,
I showed that eCO2 altered Arabidopsis leaf growth, causing mild curling and enhancing the size and biomass (Figure 2.1). Initially, I thought that the leaf developmental phase (juvenile vs adult) rather than the age (young vs old) was the cause for the significant reduction (>60 %) in carotenoid and chlorophyll levels of the older leaves. However, a significant linear decline in carotenoids from the newly emerged and younger adult leaves through to the oldest and most mature juvenile phase leaves indicated that it was not a phase-dependent process. While comparing the carotenoid levels between the recently emerged (younger) adult phase leaves
(leaf#9 and 11) or earlier emerged (older) juvenile phase leaves (leaf#3 and 5) it became apparent that there was a significant age-dependent difference of carotenoids in each phase-type. Every leaf of Arabidopsis rosette displays a different level of maturity depending on the time of emergence (Figure 2.3 A), and it seemed more likely that the age of leaf, rather than the phase of the developmental transition was affecting eCO2 effect on carotenoid levels in leaves. It is also possible that different leaf phases can affect maximum carotenoid levels, although further research is necessary to uncouple this interaction.
Leaf maturation encompasses a plethora of morphological and cellular changes, including the expansion of cell size concomitantly increasing chloroplast size and
69 density per cell (Table 1.1). Mature leaves usually comprise more giant cells which may affect chlorophyll and carotenoid accumulation in the leaf tissues of the different maturity level. I confirmed that indeed this was not problematic as the individual carotenoids (lutein, -carotene, violaxanthin, and neoxanthin) were all reduced in older juvenile phase leaves compared to younger adult phase leaves when expressed on a dry weight basis (Figure 2.4). The variation in carotenoid and chlorophyll levels observed between juvenile and adult phase leaves was an age-dependent process.
Both juvenile phase (day 14 vs 21) and adult phase leaves (day 21 vs 31) show a decrease in carotenoid content that is age-dependent (Figure 2.4 D, E, F).
Similarly, even cotyledons (embryonic leaves) show an age-dependent reduction in carotenoid content following 7 days after germination. Collectively, three different Arabidopsis leaf phases all demonstrated a similar age-related process that reduces carotenoid content on both a fresh and dry weight basis (Figure 2.4). Such an age-dependent decrease in chlorophyll content has been observed in senescing leaves of Arabidopsis (Matile et al., 1999; Lim et al., 2007; Nath et al., 2013). Carotenoid content also decreases in senescing leaves of tobacco (Whitfield and Rowan, 1974), which is mostly associated with the chloroplast disintegration (Lim et al., 2007) and a higher rate of carotenoid degradation has been observed in Arabidopsis leaves (Rottet et al., 2016). Nevertheless, it is striking to observe substantially higher levels of carotenoid and chlorophyll levels in younger leaves that undergo a sequential age- related decrease in the absence of any visible signs of senescence, while still maintaining a steady-state pigment pool for photosystem assembly and photosynthesis.
The leaf age-dependent variation in the photosynthetic pigment pool led us to hypothesise that eCO2 could also show a leaf age-dependent interaction on the foliar
70 carotenoid levels. Indeed, I observed that eCO2 significantly increased carotenoid
(~20%) and chlorophyll (~10 %) levels in the younger leaves (Figure 2.2), becoming less significant as the leaves matured and became older. It was interesting that while lutein, -carotene and violaxanthin all showed a significant increase in the younger of leaves (#7-11), only neoxanthin was significantly enhanced in all leaves from the plants grown under eCO2. Multiple experimental repetitions confirmed significantly higher levels of carotenoids in young leaves in eCO2 conditions. The significant increase in neoxanthin content under eCO2, regardless of the leaf-age, corresponds with the increase in abscisic acid and stomatal closure in response to eCO2 (Chater et al., 2015), although it needs further validation.
The distinct and consistent impacts of leaf age on both carotenoid and chlorophyll content highlight that the selection of leaves of different ages could be the most plausible explanation for the apparent variability in photosynthetic pigment response to eCO2 (as of the available literature). Also, because carotenoids show an age-dependent decline during leaf maturation (Figure 2.2, 2.3, and 2.4), an unexplored regulatory mechanism for maintaining photosynthetic pigment homeostasis during
Arabidopsis leaf aging remains to be discovered. The substantially higher level of photosynthetic pigments in young leaves corresponds with the higher rate of protein synthesis (Ishihara et al., 2015) and, therefore, higher level of soluble proteins
(Stessman et al., 2002). However, why do young leaves accumulate higher levels of carotenoids, and how is the carotenoid pool maintained during leaf maturation before the onset of senescence remain unexplored. The cell size is much smaller in young leaves; hence, high cell density (Possingham and Saurer, 1969), and eCO2 can increase cell density, chloroplast density, and cellular protein level (Griffin et al.,
2001; Teng et al., 2006; Li et al., 2013). The significant increase in the level of photosynthetic pigments in young leaves in response to eCO2 implicates cell and 71 chloroplast density affecting the level of foliar pigments. Would it be due to the higher cell and chloroplast density in young leaves; which demands further experimentation? Understanding these processes could provide new tools towards maintaining carotenoid homeostasis within a cell and ultimately enhance the efficiency of carbon assimilation and photosynthesis in response to increasing atmospheric CO2.
Acknowledgements An International Australian postgraduate research fellowship was awarded to
ND by Western Sydney University. PhD study leave to ND was supported by Pokhara
University. We thank Julius Sagun and Rishi Aryal from the Hawkesbury Institute for the Environment for their supporting technical assistance. This work was partly supported by an Australian Research Council DP130102593 to CIC. We thank Barry
Pogson for his suggestions and co-supervision of ND.
Author contributions CIC and ND conceived ideas, and DT contributed to the research design. ND performed experiments, data analysis, and wrote the manuscript. ND and CIC prepared figures. CIC and DT contributed to data analyses and edited the manuscript.
………. ……….
72
An extreme heatwave enhances xanthophyll de-epoxidation and zeaxanthin content in leaves of Eucalyptus parramattensis
Both data and text appeared in this chapter are as presented in the manuscript, except modifications where appropriate, that has been submitted to a journal
“Physiology and Molecular Biology of Plants, ISSN: 0971-5894 (Print) 0974-0430
(Online) as “Dhami N., Drake J. E., Tjoelker M. J., Tissue D. T., Cazzonelli C. I.
(2019, under final review). An extreme heatwave enhanced the xanthophyll de- epoxidation state in leaves of Eucalyptus trees grown in the field”.
Arabidopsis thaliana was used to generate most of the data presented in this thesis. As Arabidopsis was not appropriate to apply extreme heatwave temperature
(>40oC) for four consecutive days, I took advantage of an ongoing experiment with
Eucalyptus parramattensis trees in the whole tree chambers (WTCs) facility and examined foliar carotenoids in Eucalyptus leaves from the plants exposed to the long- term warming followed by an experimental heatwave (>43oC).
73
Abstract
Heatwaves are becoming more frequent with climate warming and can impact tree growth and reproduction. In the field with a full sun-shine, Eucalyptus parramattensis C. Hall trees can cope with an extreme heatwave via transpirational cooling and enhanced leaf thermal tolerance that protects foliar tissues from photo- inhibition and photo-oxidation during natural midday irradiance. Here, we explored whether changes in foliar carotenoids and/or the xanthophyll cycle state can facilitate leaf acclimation to long-term warming and/or an extreme heatwave event. We found that Eucalyptus leaves had similar carotenoid levels when grown for one year under ambient and experimental long-term warming (+3 oC) conditions in whole-tree chambers (WTCs) in the field. Exposure to a 4-day heatwave (> 43 oC) significantly enhanced xanthophyll de-epoxidation state and zeaxanthin content regardless of the warming history revealing a mechanism by which trees could minimise high temperature and light-induced oxidative damage of foliar tissues. The levels of zeaxanthin were significantly higher in both young and old leaves during the heatwave, revealing that violaxanthin de-epoxidation and perhaps de novo zeaxanthin synthesis contributed to the enhancement of the xanthophyll cycle state. A higher xanthophyll de-epoxidation rate of de-epoxidation could contribute to thermal dissipation of the harmful excessive excitation energy during midday irradiance and help to minimise photosystem damage. Also, an increase in zeaxanthin can efficiently protect chloroplasts from heat-induced oxidative damage. In an era of global warming with an increased number of heatwave events in future, E. parramattensis trees can utilise biochemical strategies to alter the xanthophyll cycle state and cope with extreme heatwaves under natural solar irradiation.
74
3.1 Introduction
Heatwaves can consist of several consecutive days of extremely hot temperature and are predicted to increase in intensity and frequency as the climate change scenarios continue (Teskey et al., 2015). Indeed, several extreme heatwaves were recently observed in Europe, Australia, and China (Ciais et al., 2005; van Gorsel et al., 2016; Yuan et al., 2016). Heatwaves occur concomitantly with rising global mean temperature (+0.85 °C from 1880 to 2012, +1 °C for Australia from 1910-2016) that could increase as much as +3 °C by 2100 (Australian Bureau of Meteorology; IPCC,
2014). Heatwaves can have detrimental effects on plant growth and physiological performance as well as ecosystem function (Teskey et al., 2015; O'Sullivan et al.,
2017; Niinemets, 2018). However, trees can perceive and rapidly respond to heatwave events by maintaining the leaf temperature within the limits of thermal tolerance (Liu et al., 2015; Urban et al., 2017; Drake et al., 2018). The higher air temperatures or heatwave events may exceed optimal temperature limits for photosynthesis and reduce/inhibit leaf photosynthesis because of increased mitochondrial respiration, photorespiration, stomatal closure and impairment to photosynthetic biochemistry
(Lin et al., 2012; Teskey et al., 2015). The photosynthetic rate and stomatal conductance are often altered under heatwave conditions leading to a higher rate of transpiration that maintains latent cooling of leaves, thereby protect leaves against thermal damage (von Caemmerer and Evans, 2015; Urban et al., 2017; Urban et al.,
2017; Drake et al., 2018).
The thermal acclimation of respiration is another key physiological strategy in plants to cope with high-temperature stress (Atkin and Tjoelker, 2003; Tjoelker,
2018). High temperature-induced reduction and/or inhibition in photosynthetic rate accompanied with the increased rate of photorespiration and mitochondrial respiration
(Lin et al., 2012; Teskey et al., 2015) triggers the accumulation of reactive oxygen 75
1 species (ROS) such as singlet oxygen ( O2), excited triplet and singlet chlorophylls
3 1 ( Chl* and Chl*), and hydrogen peroxide (H2O2) (Gonzalez-Perez et al., 2011; Wang et al., 2014; Shumbe et al., 2016). Increase in ROS accumulation can cause lipid peroxidation disrupting membrane structures and functions that often result in lethal consequences such as cell death (Huve et al., 2011; Shumbe et al., 2016). Therefore, dissipation of excess photon energy and attenuation of ROS production and/or activity is necessary to avoid photooxidative damage facilitating functional integrity of the cell and subcellular organelles (Kato et al., 2003; Foyer et al., 2009; Roach and
Krieger-Liszkay, 2014).
In chloroplasts, besides accessory role in light-harvesting (Ritz et al., 2000;
Balevicius et al., 2017), carotenoid pigments play a vital role in photoprotection of structure and function of chloroplasts particularly during high light stress conditions
(Pascal et al., 2005; Magdaong and Blankenship, 2018). In the thylakoid membranes, carotenoids regulate excitation energy usage during fluctuations in intensity and quality of light spectrum (Demmig-Adams and Adams, 1996; Strzałka et al., 2003;
Pogson et al., 2005). Under high light stress, when CO2 fixation becomes minimal or absent, a quick enzymatic de-epoxidation of violaxanthin to zeaxanthin via antheraxanthin, in a process referred to as the xanthophyll cycle, provides a mechanism for the thermal dissipation of excess excitation energy (non- photochemical quenching; NPQ) from the photosystems attenuating photooxidative damage (Niyogi et al., 1998; Wehner et al., 2004; Jahns and Holzwarth, 2012;
Demmig-Adams et al., 2014; Papageorgiou and Govindjee, 2014; Ruban, 2016). The xanthophyll cycle is, thus, critically regulated in response to the high light stress.
The state of xanthophyll cycle pigments can provide an adaptive strategy to cope with the high temperature-induced oxidative stress in plants. For example, the
76
Eucalyptus seedlings exposed to a short-term heatwave (45 oC) increased the foliar xanthophyll pool enriching antheraxanthin and zeaxanthin (Roden and Ball, 1996).
The level of xanthophyll cycle carotenoids may vary over a timescale of days to seasons, and the capacity for energy dissipation depends upon the intensity of light and seasonal temperatures (Logan et al., 1998; Logan et al., 2009). For example,
Mediterranean species are highly efficient to acclimate extremely hot summer compared to Atlantic species (García-Plazaola et al., 2008). Likewise, long-term exposure of Eucalyptus seedlings to a warmed environment (+4 oC) generated variable effects on the xanthophyll pool composition, depending upon the species
(Logan et al., 2010). Therefore, the thermal tolerance of leaves may vary among the different plant species.
Zeaxanthin has the highest antioxidant capacity among carotenoids (Havaux et al., 2007) and it is the primary receptor and quencher of the excess excitation energy in photosystem II (PSII) (Havaux and Niyogi, 1999; Holt et al., 2005; Demmig-
Adams et al., 2014), but not in PSI (Tian et al., 2017). In thylakoid membranes, differential localisation and orientation of xanthophyll molecules can modulate the membrane fluidity and stabilise membrane structures, more so during the environmental stress conditions (Gruszecki and Strzaŀka, 1991; Kupisz et al., 2008;
Grudzinski et al., 2017). The violaxanthin de-epoxidase catalyses the conversion of violaxanthin into zeaxanthin that can occur within seconds to 2-3 minutes, and higher membrane fluidity favours de-epoxidation (Latowski et al., 2002). Under elevated temperature, zeaxanthin can enhance the rigidity of thylakoid membranes and maintain functional homeostasis of the photosynthetic apparatus (Subczynski et al.,
1991; Havaux and Niyogi, 1999; Latowski et al., 2002; Strzałka et al., 2003; Havaux et al., 2007; Kupisz et al., 2008). The intercalation of zeaxanthin in lipid membranes decreases the membrane fluidity that makes membranes less-permeable for ROS,
77 eventually enhancing the anti-oxidative capacity (Subczynski et al., 1991; Kupisz et al., 2008). Also, an increase in zeaxanthin content rigidifies the thylakoid membranes and, thereby increasing the thermostability against stressful light and temperature conditions (Tardy and Havaux, 1997; Grudzinski et al., 2017). Zeaxanthin, thus, can stabilise lipid membranes and attenuate oxidative stress maintaining both physical and functional integrity of chloroplasts and, therefore, leaves during high-temperature stress conditions.
Zeaxanthin is the most potent antioxidant carotenoid among xanthophylls, therefore, considered as a major thermo-stabilizer carotenoid of chloroplast membranes (Bukhov et al., 2001; Havaux et al., 2007). Increase in zeaxanthin content is an adaptive strategy that plants can utilise to attenuate the deleterious effects of high light and/or high-temperature stress condition, thereby safeguarding the chloroplast structure and functions (Demmig-Adams and Adams, 1996; Havaux et al.,
2004; Jahns and Holzwarth, 2012). High-temperature priming can enhance cellular antioxidant capacity enabling plants more tolerant to the subsequent events of more severe heat stress as evident in wheat (Wang et al., 2014). De-epoxidation of violaxanthin enriching the zeaxanthin content appears to be the major adaptive strategy to minimise heat-induced oxidative stress in different plants such as maize/Zea mays (Lawanson et al., 1978), potato/Solanum tuberosum (Havaux et al.,
1996), Arabidopsis thaliana (Davison et al., 2002), rice/Oryza sativa (Yin et al.,
2010), oak/Quercus pubescens (Haldimann et al., 2008), evergreen boxtree/Buxus sempervirens (Hormaetxe et al., 2007) and alpine mountain shrubs including
Rhododendron ferrugineum, Senecio incanus and Ranunculus glacialis (Buchner et al., 2015). Besides xanthophylls, there are possibilities, whereby various cis-carotenes and apocarotenoids can regulate chloroplast functions facilitating signalling and acclimation to extreme temperature conditions (Beltran and Stange, 2016; Hou et al.,
78
2016; Alagoz et al., 2018). The objective of this study was to determine how an extreme heatwave (>43 oC) event in combination with the long-term warming (+3 oC), affect the state of the xanthophyll cycle carotenoids in the leaves from Eucalyptus parramattensis trees grown in whole-tree chambers (WTCs) in field condition under natural solar irradiation.
3.2 Materials and methods
3.2.1 Experimental site and long-term warming and heatwave treatments The experimental site was in Richmond, NSW, Australia (33°36ʹ40ʺS,
150°44ʹ26.5ʺE), where we used 12 whole tree chambers (WTCs) equipped with the facilities to manipulate air temperature (Tair), vapour pressure deficit (VPD), relative humidity (RH), and atmospheric CO2 concentration at ambient levels in the canopy air space of a local woodland tree, Eucalyptus parramattensis grown in field conditions as described previously (Drake et al., 2018). The experimental design and physiological responses of E. parramattensis trees to long-term warming and the heatwave event are described in detail by Drake et al. (2018). In brief, the WTCs were large cylindrical structures topped with a cone (3.25 m in diameter, 9 m in height, the volume of ~53 m3). One potted seedling (average height was 60 cm) was planted into each WTC on 23rd December 2015 and grown to a maximum height of the WTC
(trees aged ~ 342 days). Six WTCs were used to track and simulate the natural variation in ambient Tair and RH at the site (i.e. ambient treatment). Another six
o WTCs were used to simulate a long-term warming treatment (ambient Tair plus 3 C and ambient RH). Trees were watered every fortnight with half the mean monthly rainfall for the site until one month before the heatwave when irrigation was
o suspended. An experimental heatwave with a peak Tair of 43-44 C (over the day/night cycles) was applied during the Austral Spring-Summer for four consecutive sunny days (Oct 31 - Nov 3, 2016) to three of the WTCs maintained at ambient Tair and three
79 subjected to long-term warming (Drake et al., 2018). The heatwave and long-term warming was biologically relevant as the most severe heatwave recorded for this location over four consecutive days had a maximum Tair of 40-41 °C (heatwave from
5-8 Feb 2009, data from 1953-2016) and +3 oC increase in maximum temperature has been predicted for this region by 2100 (Sillmann et al., 2013; Cowan et al., 2014).
3.2.2 Pigment measurements Three old (dark green, tough textured) and three young (light green, tender in texture) leaves were collected from the basal and apical regions, respectively, of the same branch from the upper third of the crown of each experimental tree on the 4th
o day of the heatwave between 14:30-15:30 hours, when Tair exceeded 43 C. Leaf samples were kept on ice. It took approximately an hour to transfer leaf samples from
WTCs to the ice in the lab, which might have affected the level of xanthophyll cycle pigments. Therefore, I maintained appropriate control samples to establish a baseline of pigment ratios for the heatwave experiment. Approximately 10-20 mg of fresh leaf tissue (two leaf discs 5 mm diameter) were taken from the base of each leaf avoiding the midrib and frozen immediately in liquid nitrogen (in 2 ml vials) and later stored at
-80 oC until pigment extraction. Frozen leaf tissues were homogenised to a fine powder in TissueLyser® (QIAGEN) for two minutes at 20 Hz speed using stainless steel beads (~3 mm diameter) in 2 ml clear microtubes. Finely powdered leaf tissues were extracted in 1 ml of acetone: ethyl acetate (60:40) containing 0.1 % BHT
(butylated hydroxytoluene; an oxidant that prevents oxidation of carotenoids) under dim light conditions. Next, 0.8 ml of water was added and mixed gently followed by centrifugation for 5 minutes at 15,000 rpm at 4 oC to separate pigments in the ethyl acetate phase.
The 20 μl of the upper phase (ethyl acetate phase containing carotenoids) was analysed by HPLC (Agilent 1260 Infinity) equipped with YMC-C30 (250 x 4.6 mm, 80
S-5 μm) column and Diode Array Detector (DAD). Individual carotenoids were separated using a reverse-phase gradient of methanol with 0.1 % (v/v) triethylamine
(solvent A) and methyl tert-butyl ether (solvent B). The initial solvent composition was maintained at 85 % solvent A, and 15 % solvent B and reverse-phase solvent gradient started at 1.0 min, which was reached to 35 % of B at 11.0 min. The second gradient started at 11.1 min, and the ratio of B was increased to 65 % at 15.0 min. The ratio of B was increased to 100 % at 15.1 min and stabilised until 17.0 min. The solvent flow rate was maintained 1 ml/min until 17.0 min and, after which the solvent composition returned to 15 % of B and was subsequently equilibrated for 8 minutes with a flow rate of 2.0 ml/min.
The DAD signals were recorded at 440 nm, and carotenoid species were identified by retention time, spectral structure and the ratios of maximum absorption peaks. The micrograms (µg) of carotenoids per gram fresh weight (gfw) was derived by integrating the peak area to a standard curve (described in Chapter 2), as previously described (Pogson et al., 1996). Slope values used for converting peak area into µg/gfw leaf tissue include; neoxanthin (8.787E-05), violaxanthin (7.986E-05), lutein (9.498E-05; also used for antheraxanthin and zeaxanthin), -carotene (9.22E-
05), chlorophyll b (2.849E-04) and chlorophyll a (2.74E-04). The proportions of individual carotenoids were presented as a percentage of total carotenoid content. The de-epoxidation of xanthophyll cycle pigments (violaxanthin; V, and antheraxanthin;
A, to zeaxanthin; Z), was determined by the calculating the ratio (A + Z) / (V+A+Z), which is, herein, referred as the de-epoxidation state.
3.2.3 Data analysis The experiment consisted of a factorial combination of temperature treatment, heatwave treatment, and leaf age cohort. The temperature treatment levels were ambient and warmed (+ 3 °C) and constituted the growth temperatures of the trees 81 before the imposition of the heatwave and not during the heatwave. The 4-day heatwave treatment levels were control (peak daily temperature of 28-29 °C) and heatwave (peak daily temperature of 43-44 °C) and were randomly assigned to trees of both the growth temperatures (control and warmed) (n = 3). The leaf-age cohorts were young and old. Three young leaves and three old leaves were sampled from each tree in each of the 12 WTCs and thus constituted sub-samples for each cohort and tree. Carotenoid and chlorophyll pigment data (μg/gfw) and proportions (%) were presented in terms of the treatment mean ± standard error (n = 3).
The experimental design was a split-plot with temperature (1 degree of freedom; d.f.), and heatwave (1 d.f.) applied in factorial combination to individual tree chambers as the whole plot factor in a completely randomised design. Tree chamber constituted a random factor. Using analysis of variance (ANOVA), temperature and heatwave effects were tested against the whole-plot error term (Tree [temperature, heatwave], 8 d.f.). Leaf-age (young and old) constituted the nested sub-plot factor.
The main effect of leaf age (1 d.f.) and interactive effects of leaf age with temperature
(i.e. leaf age x temperature) and heatwave (i.e. leaf age x heatwave) treatments were analysed using the sub-plot error term (Tree x Leaf age [temperature, heatwave], 8 d.f.). The Two-ANOVA with Holm-Sidak post-hoc comparison was performed to compare pigment content between and across the treatments.
3.3 Results
3.3.1 Leaf maturation and long-term warming does not affect zeaxanthin content or the xanthophyll de-epoxidation state I first assessed the impact and interaction of leaf aging (young and old) and long-term warming (+3oC) on carotenoid and chlorophyll content in leaves from trees grown in the WTCs. As expected, older leaves had a significantly higher level of both carotenoid and chlorophyll pigments compared to young leaves (Figure 3.1).
82
However, zeaxanthin content was similar in both young and old leaves, while the proportion was decreased in old leaves from both ambient and warmed treatments
(Figure 3.1 C, F). In young leaves, long-term warming had no significant effect on the level of carotenoids except a marginal increase in neoxanthin proportion in both leaf types (Figure 3.1 L). In old leaves, warming increased both content and proportion of lutein and neoxanthin (Figure 3.1 G, J, I, L) and that of chlorophyll b (Figure 3.1 N), while other pigments remained unchanged. Also, the xanthophyll de-epoxidation state
(DEPS) was unaffected by leaf age or long-term warming (Table 3.1). The significant increase in both carotenoid and chlorophyll content in old leaves was an obvious observation. However, there was no interactive response of leaf age and long-term- warming, demonstrating a resilience of photosynthetic pigment pool in both young and old leaves in response to +3 oC warming (Table 3.1).
83
Figure 3.1 The effects of prolonged warming on carotenoid and chlorophyll content in Eucalyptus parramattensis leaves.
The absolute content and proportion of carotenoids and chlorophylls in young and old leaves from the trees grown under ambient and warm (+3oC). Figures represent the data from an experiment on Eucalyptus trees grown in whole-tree chambers in the field. Plots represent sample means and error bars display standard error (n=3). Letter codes in the plots indicate the level of statistical variation (p<0.05) in the respective pigment within leaf types across the ambient and warmed temperature as determined by Two-Way ANOVA adopting Holm-Sidak post-hoc multiple comparisons.
84
3.3.2 Extreme heatwave enhanced zeaxanthin content and xanthophyll de- epoxidation state Next, I examined carotenoid and chlorophyll contents in both young and old leaves from the E. parramattensis grown under ambient and warmed (+3 oC) conditions that were exposed to heatwave (>43 oC) for four consecutive days.
Interestingly, the level of photosynthetic pigments in both young and old leaves displayed similar responses to heatwave (Figure 3.2 and 3.3). In both leaf types from both treatments (ambient and warming), the absolute content and proportion of zeaxanthin were increased in response to heatwave (Figure 3.2 C, F and Figure 3.3 C,
F). The heatwave-induced increase in zeaxanthin content was not significant in old leaves from ambient plants (Figure 3.3 C, F), which could be an artefact occurred due to the differences in leaf-age and/or due to the change in xanthophyll cycle pigment during a more extended period of time taken for leaf sample collection and preservation in liquid nitrogen.
There was significant enrichment in antheraxanthin content and proportion in heatwave exposed leaves (Figure 3.2 B, E and Figure 3.3 B, E). In the old leaves from warmed plants, violaxanthin content and proportion both were significantly decreased in response to heatwave with a corresponding increase in antheraxanthin and zeaxanthin content (Figure 3.3 A-F). The proportion, but not content, of lutein, β- carotene, and neoxanthin were significantly reduced in response to the heatwave in young leaves from the warmed treatment (Figure 3.2 J, K, L). The reduction in both content and proportion of lutein, β-carotene, and neoxanthin was evident in heatwave exposed old leaves from the pre-warmed trees (Figure 3.3 G-L). Heatwave triggered the zeaxanthin enrichment (1.5 - 2.5 fold increase) in leaves from both ambient and warming treatments (Figure 3.2 C, F; Figure 3.3 C, F; and Figure 3.4 C, F) with the concurrent reduction in violaxanthin, which was more pronounced in leaves from prolonged warming history (Figure 3.2 A, D; Figure 3.3 A, D), that indicates a 85 possibility of heatwave-induced de-epoxidation of violaxanthin enriching zeaxanthin.
Like prolonged warming, heatwave did not show interactive impacts on carotenoid or chlorophyll content in any leaf types (young or old) from any treatments (ambient or warming) (Table 3.1). Both chlorophyll a and b contents were unchanged in heatwave exposed leaves; however, chlorophyll a/b ratio was increased in old leaves from the warming treatment. Finally, I examined the xanthophyll de-epoxidation state in response to heatwave exposure in different leaf types from the trees grown under ambient and long-term warming environments. The de-epoxidation state was significantly enhanced by 1.2 to 1.4-fold during the heatwave (Table 3). These results demonstrated that heatwave exposure increased not only zeaxanthin content but also the xanthophyll de-epoxidation state during natural midday solar irradiation.
86
Figure 3.2 The effects of an extreme heatwave on carotenoid and chlorophyll content in the old leaves of Eucalyptus parramattensis.
The absolute content and proportion of carotenoid and chlorophyll content in old leaves from the trees grown under ambient and warm (+3oC) exposed to an extreme heatwave (>43oC) for four consecutive days. Figures represent data from an experiment on Eucalyptus trees grown in whole-tree chambers in the field. Plots represent sample means and error bars display standard error (n=3). Letter codes in the plots indicate the level of statistical variation (p<0.05) in the respective pigment in old leaves from control and heatwave exposed plants grown in ambient and warmed temperature as determined by Two-Way ANOVA adopting Holm-Sidak post-hoc multiple comparisons.
87
Figure 3.3 The effects of an extreme heatwave on carotenoid and chlorophyll content in Eucalyptus parramattensis leaves.
The absolute content and proportion of carotenoid and chlorophyll content in young leaves from the trees grown under ambient and warm (+3oC) temperature conditions exposed to an extreme heatwave (>43oC) for four consecutive days. Figures represent the data from an experiment on Eucalyptus trees grown in whole-tree chambers in the field. Plots represent sample means and error bars display standard error (n=3). Letter codes in the plots indicate the level of statistical variation (p<0.05) in the respective pigment in young leaves from control and heatwave exposed plants grown in ambient and warmed temperature as determined by Two-Way ANOVA adopting Holm-Sidak post-hoc multiple comparisons.
88
Figure 3.4 The effects of an extreme heatwave on carotenoid and chlorophyll content in Eucalyptus parramattensis leaves.
A heatwave ratio (heatwave/control) was calculated for two leaf types (young and old) from trees grown under two temperature treatments (ambient and warm). Change in both content and proportions of respective pigments are presented. Figures represent data from an experiment on E. parramattensis trees grown in whole-tree chambers in the field. Plots represent sample means and error bars display standard error (n=3).
89
Table 3.1 Probability values for the effect of long-term warming and an extreme heatwave on carotenoid and chlorophyll content in young and old leaves of Eucalyptus parramattensis.
Tot Tot Chl Environmental interactions Neo Vio Ant Lut Zea β-car Car DEPS Chl a Chl b Chl a/b Warming 0.277 0.573 0.669 0.270 0.324 0.975 0.975 0.201 0.346 0.536 0.352 0.387 Heatwave 0.464 0.246 0.073 0.481 0.002 0.532 0.532 0.003 0.537 0.666 0.687 0.158 Warming x Heatwave 0.291 0.771 0.858 0.272 0.663 0.230 0.230 0.680 0.846 0.278 0.658 0.336 Leaf age 0.000 0.002 0.001 0.000 0.073 0.000 0.000 0.576 0.000 0.000 0.000 0.695 Warming x Leaf age 0.345 0.808 0.512 0.081 0.787 0.988 0.988 0.973 0.869 0.496 0.884 0.148 Heatwave x Leaf age 0.634 0.817 0.413 0.966 0.126 0.149 0.149 0.576 0.468 0.954 0.570 0.446 Warming x Heatwave x Leaf age 0.759 0.227 0.695 0.777 0.506 0.887 0.887 0.318 0.779 0.612 0.685 0.526 Notes: Neo; Neoxanthin, Vio; Violaxanthin, Ant; Antheraxanthin, Lut; Lutein, Zea; Zeaxanthin, β-car; β-carotene, Tot Car; Total carotenoids, DEPS; De-epoxidation state (Ant+Zea/Vio+Ant+Zea), Tot Chl; Total Chlorophylls. Statistical analysis by a split-plot ANOVA followed with post-hoc Tukey comparison. Significant (p<0.05) values are boldfaced.
90
3.4 Discussion
The warmed ambient temperature scenarios predicted in the future could have species-specific impacts on the level of foliar carotenoid pigments in plants. The level of the foliar carotenoid pool can vary as of the developmental state and functional integrity of leaves, for example, the level of the photosynthetic pigment pool was significantly higher in young leaves compared to the old leaves of Arabidopsis
(Stessman et al., 2002; Dhami et al., 2018). Contrasting to Arabidopsis, the significantly higher level of carotenoid and chlorophyll pigments in the old leaves of
E. parramattensis (Figure 3.1, Table 1) was consistent with a previous report revealing an increase in chlorophyll content during the aging of foliar tissues in
Eucalyptus species (Datt, 1998).
In plants, multiple short-term exposures to high temperature can be beneficial to enhance thermal tolerance against subsequent high-temperature events. For example, multiple encounters to higher temperature increased cellular antioxidant capacity in wheat leaves and, therefore, plants became more tolerant to subsequent severe heat stress demonstrating heat-stress priming of thermal tolerance (Wang et al., 2014). It was previously observed that the level of photosynthetic pigments did not change in response to short-term heat treatment (Buchner et al., 2015). However, prolonged and higher fluctuations in air temperature can influence photosynthetic pigment metabolism in leaves, thereby facilitating thermal acclimation of pigment pools
(Lawanson et al., 1978; Tran and Raymundo, 1999; Logan et al., 2010). The fact that the prolonged warming (+3 oC) did not significantly affect carotenoid, or chlorophyll content in E. parramattensis leaves (Table 1) was consistent with Drake et al., (2018) in that the leaf physiological parameters such as dark-adapted variable fluorescence relative to maximal fluorescence (Fv/Fm), and net photosynthesis were unaffected by
91
+3 °C warming. Therefore, prolonged warming by +3 °C appears unlikely to affect carotenoid accumulation in E. parramattensis leaves.
In E. parramattensis, extreme heatwave (>43oC peak temperature) exposure for four consecutive days did not cause crown damage or growth reductions, although there were some leaf browning symptoms that affected about 1.1 % of the leaf area of heatwave exposed trees compared with 0.3 % for control trees (Drake et al., 2018).
Heatwave reduced the midday crown net photosynthesis to approximately zero, yet transpiration persisted, thereby maintaining canopy cooling and leaf thermal tolerance within the limits of leaf function (Drake et al., 2018). In addition, the significant increase in the zeaxanthin content and xanthophyll de-epoxidation state in Eucalyptus foliar tissues in response to the 4-day prolonged heatwave event (Table 3.1) implicates a role of xanthophyll de-epoxidation facilitating thermal tolerance in leaves. This is supported by a significant increase in zeaxanthin and antheraxanthin content, coupled with a decrease in violaxanthin composition (Figure 3.2, 3.3). In concert, heat stress triggered de-epoxidation leading to the zeaxanthin enrichment in trees and shrubs such as Quercus pubescens (Haldimann et al., 2008), Buxus sempervirens (Hormaetxe et al., 2007), and Rhododendron ferrugineum, Senecio incanus and Ranunculus glacialis (Buchner et al., 2015). Also, zeaxanthin enrichment was evident in response to heat stress in Zea mays (Lawanson et al., 1978), Solanum tuberosum (Havaux et al., 1996), Arabidopsis thaliana (Davison et al., 2002), and
Oryza sativa (Yin et al., 2010), which implicates xanthophyll de-epoxidation a pivotal strategy to cope with high temperature stress. The Eucalyptus trees subjected to four days of an extreme heatwave may have benefited from the enhanced xanthophyll de- epoxidation state by neutralising both heat and light-induced oxidative stress in chloroplasts. Nevertheless, pre-warming (+3 °C) did not affect the xanthophyll pool,
92 neither improved the heat stress acclimation response in leaves from the trees subjected to a heatwave.
There are strong connections between the photoprotection of photosystems, particularly PSII, and high irradiation-induced acidification of thylakoid lumen that stabilises thylakoid membrane and PSII reaction centres (Kirchhoff et al., 2011;
Tikhonov, 2013). It is reported that the acidification of the thylakoid lumen can activate violaxanthin de-epoxidase, and, hence, the xanthophyll cycle (Havaux and
Niyogi, 1999). The enhanced xanthophyll de-epoxidation state appears to be one important factor contributing to neutralise the light and heat-induced oxidative stress in Eucalyptus leaves during heatwave exposure. Different ROS scavenging mechanisms are likely to exist maintaining leaf physiology during heat stress, however, higher zeaxanthin levels could help to protect the thylakoid membranes from lipid peroxidation, as zeaxanthin can act as a free compound in the thylakoids attenuating oxidative stress (Havaux et al., 2007) or bound to LHC proteins (Niyogi,
1999). The heatwave not only affected the composition of xanthophyll cycle pigments
(zeaxanthin, violaxanthin and antheraxanthin) but also slightly reduced neoxanthin, lutein and -carotene. The reduction in the level of -carotene can support enhanced hydroxylation to enrich zeaxanthin, as only the reduction in violaxanthin due to de- epoxidation cannot account for the higher level of zeaxanthin and antheraxanthin accumulation. Alternatively, heat stress could have enhanced the oxidation of foliar carotenoids leading to the production of apocarotenoids, the signalling molecules, regulating heat stress responses, which needs further exploration. The zeaxanthin enrichment, however, could be the key strategy to protect thylakoid membrane integrity and chloroplasts functions during an extreme heatwave event.
93
The intensity of light and temperature can have interactive effects in maintaining photo-protection and thermal acclimation (Yin et al., 2010). Higher light intensity can induce de-epoxidation of violaxanthin, leading to a reduction in violaxanthin content (Niyogi, 1999). For example, xanthophyll de-epoxidation activity was reported to be higher in Rannunculus glacialis leaves subjected to 38 °C temperatures under intense irradiation (Streb et al., 2003). In our experiment, the higher xanthophyll de-epoxidation state exemplified by the accumulation of both antheraxanthin and zeaxanthin in Eucalyptus leaves occurred under normal solar irradiance, highlighting that a heat stress event can induce changes in the xanthophyll cycle. Our findings are in concert with previous results where rice (Yin et al., 2010) and Eucalyptus (Roden and Ball, 1996; Logan et al., 2010) grown under controlled lighting environments with additional heat stress enhanced the xanthophyll de- epoxidation state. The xanthophyll cycle has been reported to be activated upon heat stress in the dark conditions, although to a much lesser extent (Fernandez-Marin et al.,
2010; Fernandez-Marin et al., 2011). Likewise, the de-epoxidation of violaxanthin can be induced in response to heat stress event under lower irradiation, which was evident in wheat seedlings (Ilik et al., 2010). The increased xanthophyll de-epoxidation leading to a higher accumulation of zeaxanthin (Figure 3.5) appears to be the widespread mechanism by which leaves from the trees exposed to heat-stress events can protect their photosynthetic apparatus. The accumulation of zeaxanthin as a free compound in thylakoids could serve a double role as an antioxidant and thermal stabiliser of membranes, thereby facilitating leaf thermal acclimation during heatwave events.
In summary, four consecutive days of extreme heatwave event applied to
Eucalyptus trees in the field, in WTCs under full-sun conditions, enhanced xanthophyll de-epoxidation, therefore, increased zeaxanthin accumulation in both
94 young and mature leaves (Figure 3.5). Eucalyptus trees grown under warmed (+3 oC) conditions did not significantly affect the photosynthetic pigment pool, and neither affected the carotenoid levels in response to the heatwave event. An extreme heatwave can enhance zeaxanthin content by rapid de-epoxidation of violaxanthin and antheraxanthin and/or hydroxylation of β-carotene protecting chloroplasts and leaf functions. Eucalyptus leaves appear well adapted to utilise carotenoid-dependent photoprotective and antioxidant strategies to withstand high-intensity heatwaves expected in future climate scenarios.
Figure 3.5 A simplified scheme illustrating the de-epoxidation of violaxanthin and antheraxanthin enriching zeaxanthin in Eucalyptus leaves during the heatwave exposure.
White arrows indicate the direction of carotenogenesis under ambient conditions. A higher xanthophyll de-epoxidation state induced by a continuous heatwave (orange arrows) can help to dissipate excess electrons to minimise photoinhibition and prevent photo-oxidation in field trees exposed to sunlight. Zeaxanthin accumulates to the greatest extent during a heatwave as indicated by boldfaced fonts.
………. ……….
95
Short-term exposure to cold decreases carotenoid content in young leaves of Arabidopsis
96
Abstract
Cold affect plant development and performance, both positively and negatively, in a genotype-specific manner. Winter annual plants like Arabidopsis require a prolonged cold exposure (> 4 weeks) to facilitate flowering in early spring, an epigenetic process called vernalization. Severe cold exposure (<10 oC) increases oxidative stress with the concomitant reduction in meristem activity, cell cycle progression, and photosynthesis that eventually regulates the developmental progress in plants. Carotenoids are the vital antioxidants and precursors for the biosynthesis of phytohormones, abscisic acid and strigolactones, that are involved in cold-stress signalling and plant acclimation responses. Despite considerable knowledge regarding the cold stress responses of plants, the impact of short- and long-term cold exposure on carotenogenesis during leaf development remains unclear. Here, I demonstrate how short and prolonged cold exposure (7-10 oC) affects carotenoid content in young
(rapidly expanding) and old (mature) leaf types from Arabidopsis. In young leaves, short-term exposure to cold decreased the level of all foliar carotenoids, whereas that of old leaves was unchanged. Likewise, chlorophyll content decreased substantially in young leaves, but not old leaves, upon cold exposure. In contrast, the young leaves emerged during cold exposure retained a significantly higher level of carotenoid and chlorophyll compared to the respective old leaves, the trend was similar as in the plants grown under ambient growth condition. The level of photosynthetic pigment content in young leaves was highly responsive to a sudden drop in temperature. I reason that the developmental state of chloroplasts can determine the degree of plasticity; hence, young leaves can be more plastic to enable rapid changes in pigment composition in response to a short and severe cold exposure.
97
4.1 Introduction
The low-temperature conditions (cold) can influence plant functions at the cellular and physiological level, hence affect both developmental programming and performance (Chinnusamy et al., 2007; Wingler and Hennessy, 2016). Although there is no clear demarcation on the temperature range defining cold, for experimental convenience, cold conditions can be roughly categorised as moderate cold (10-15 oC), severe cold (5-10 oC), freezing cold (0-5 oC), and extreme cold (<0 oC) that impose different effects on the plant response. Usually, low temperatures (<5 oC) can cease cell cycle progression (Rymen et al., 2007) and apical meristem activity (de Jonge et al., 2016), thereby delaying plant development in roots (Schenker et al., 2014) and leaves (Nagelmuller et al., 2016). Extreme cold (below 0 oC) can disrupt both structure and function of cells, such as freezing-induced dehydration, which often results in osmotic dysfunction and physical injury to the plasma membrane (Uemura et al., 2006). The level of cold stress tolerance is determined by several biophysical and biochemical adaptive measures in plants that vary in a species-specific manner
(Korner, 2016; Wisniewski et al., 2018). In many winter annual plants, cold exposure is a requirement to accomplish various biological processes. For example, the cold
(~4 oC) exposure of young seedlings for 4-6 weeks is essential to trigger early spring flowering in winter-annual accessions of Arabidopsis, an epigenetically regulated phenomenon called vernalisation (Michaels et al., 2004). The severity of cold-induced impacts, however, depends on the degree of coldness, the duration of cold exposure, and the cold tolerance of plants.
Leaves can alter physiological processes instantly in response to the temperature fluctuations; therefore, inducing a wide array of changes at both molecular and biochemical level (Seo et al., 2009; Janska et al., 2010; Knight and Knight, 2012). A non-freezing cold such as 5-10 oC (chilling) reduces the rate of photosynthesis (Allen 98 and Ort, 2001; Savitch et al., 2001; Paredes and Quiles, 2015). Cold exposure immediately triggers soluble sugar accumulation, which regulates membrane fluidity and stabilises the cellular functions (Wanner and Junttila, 1999; Nagele et al., 2012;
Tarkowski and Van den Ende, 2015). Exogenous application of abscisic acid demonstrated promising effects improving cold tolerance in many plants such as
Arabidopsis (Lang et al., 1994), rice seedlings (Shinkawa et al., 2013), and chickpea
(Bakht et al., 2013). The concurrent increase in the level of sucrose and abscisic acid in leaves enable plant tolerance against cold. However, an increase in the level of soluble sugars can negatively impact carotenogenesis, which has been evident from the reduction in both carotenoid and chlorophyll content in spinach(Krapp et al.,
1991) and tomato (Mortain-Bertrand et al., 2008) leaves grown with an external application of glucose. Also, cold exposure increases oxidative stress, particularly enhancing hydrogen peroxide (H2O2) accumulation and lipid peroxidation (Zhou et al., 2006; Abdel Kader et al., 2018). Carotenoids and other antioxidant metabolites such as anthocyanins can help to neutralise cold-induced oxidative stressors (Harvaux and Kloppstech, 2001); however, the regulation of carotenogenesis during cold exposure is poorly studied.
Cold exposure can affect carotenoid composition in plants. In maize, cold exposure (10/8 oC) decreased the β-carotene with the corresponding increase in the level of xanthophyll cycle carotenoids, whereas lutein and neoxanthin content was unchanged (Haldimann, 1997). Cold exposure triggers the de-epoxidation of violaxanthin, leading to an increase in zeaxanthin in chilling-sensitive genotypes of maize, whereas chilling tolerant genotypes accumulate a high level of violaxanthin
(Haldimann, 1997; Haldimann, 1999). In kale and spinach leaves, lutein content decreased, and β-carotene increased, when exposed to a 10 oC growth environment
(Lefsrud et al., 2005). Also, an increase in lutein content by overexpressing
99
LYCOPENE EPSILON CYCLASE (LCYE) was correlated with the higher activities of superoxide dismutase and peroxidase and less H2O2 production and malondialdehyde
(MDA) ameliorating the chilling-induced oxidative stress in Arabidopsis leaves (Song et al., 2016). Previous research has revealed the variable impacts of cold exposure on individual carotenoids, which needs in-depth studies to inculcate the prevailing uncertainties.
Under high light intensity, Arabidopsis leaves from WT and npq1 mutants exposed to 10 oC for 5-10 days showed an increase in xanthophyll content, while β- carotene content was unchanged (Harvaux and Kloppstech, 2001). The npq1 mutants lack violaxanthin de-epoxidase activity; therefore, disrupted non-photochemical quenching (NPQ) and are highly sensitive to photoinhibition. However, both WT and npq1 mutant can acclimate prolonged exposure to cold (10-12 days) independent of the xanthophyll cycle (Harvaux and Kloppstech, 2001). The enhanced cold tolerance can be attributable to the increased level of carotenoids. However, the impact of short and prolonged cold exposure on carotenoid content and composition is unclear. Here,
I demonstrate that short, but not long-term, cold exposure affects carotenoid content and relative proportions in younger leaves of Arabidopsis. Young expanding leaves undergoing rapid cell and plastid division have greater plasticity to modify photosynthetic pigment content in response to short-term cold exposure.
4.2 Materials and methods
4.2.1 Germplasm and plant growth conditions The A. thaliana (ecotype Col-0) and crtiso (ccr2) (Park et al., 2002) in Col-0 background have used this study. The Climatron Star700 growth cabinets
(Thermoline Scientific, Australia) and/or walk-in plant growth facility were used to grow plants under controlled environmental conditions. Arabidopsis seeds were sown on moistened soil (Debco Seed Raising and Superior germinating mix, Scotts 100
Australia) provided with 3 % Osmocote, a slow-releasing fertiliser supplement,
(Garden City Plastics Australia) using 30- or 20-Cell Kwikpot trays (Garden City
Plastics, Australia). Arabidopsis seeds were stratified for three days at 4 oC in the dark condition before transferring to the standard growth conditions. The photoperiod, light intensity, and temperature conditions were 16/8 h (light/dark), 130-150 µmol m-2 sec-1
(cool fluorescent lamps) and 22/18 oC (day/night), respectively, except when stated otherwise. The Arabidopsis plants were thinned after one week of germination, and a single healthy plant was maintained in each cell. Plants were watered as required, usually once a week; however, all trays were uniformly watered two days before leaf sample collection for carotenoid measurement. Arabidopsis trays were rotated frequently to minimise the position effect. Arabidopsis seedlings were exposed to non-freezing cold (10/7 oC day/night) for prolonged exposure or 7 oC with continuous light for short-term exposure, both at the normal light intensity (130-150 µmol m-2 sec-1). For prolonged cold exposure, juvenile seedlings (7 DAS) were transferred to cold and kept for 3-5 weeks, and leaf tissues were collected as required. Each experiment was repeated at least twice to minimise the experimental variation, except as stated otherwise.
4.2.2 Carotenoid measurement The young and old leaf tissues (20-50 mg/sample) were collected during the middle of the photoperiod (within 7-9 h of illumination) or as indicated, and at least four biological replicates were maintained for each sample. Leaf tissues were snap- frozen in liquid nitrogen and stored in -80 oC until pigment extraction. For pigment extraction, frozen plant tissues were milled in TissueLyser® (QIAGEN) for two minutes at 20 Hz speed using stainless steel beads (~3 mm in diameter) in 2 ml clear microtubes. The finely powdered leaf tissues were extracted with 1 ml extraction buffer containing acetone and ethyl acetate (60:40 v/v) with 0.1 % butylated
101 hydroxytoluene (BHT, w/v). Extraction mixture was vortexed for a minute, and 0.8 ml milliQ water was added to separate the pigments by phase separation. The microtubes were gently inverted for three times avoiding vigorous shaking and centrifuged at 15000 rpm for 5 minutes at 4 oC. The upper pigmented ethyl acetate phase was collected in a new microtube and centrifuged for five minutes, as before.
The 200 μl supernatant was then collected in a clean vial and stored at 4 oC until analysed by HPLC.
The 20 μl of the freshly prepared ethyl acetate extracts were analysed using
HPLC (Agilent 1260 Infinity) equipped with YMC-C30 (250 x 4.6 mm, S-5 μm) column and Diode Array Detector (DAD) detector. A 35-minute reverse phase HPLC method was used to separate carotenoids, according to Alba et al. (2005) with minor modifications. In brief, the initial five-minute isocratic run of 100 % solvent A
(methanol: triethylamine, 1000:1 v/v) was followed by a 20-minute ramp to 100 % solvent B (methyl tert-butyl ether) and a two-minute isocratic run of 100 % solvent B afterwards. All three steps were maintained at the solvent flow rate of 1 ml/minute.
Finally, the column was equilibrated for 8-minutes using 100 % solvent A at the flow rate of 1.5 ml/minute. The other conditions were as explained in Dhami et al. (2018).
In brief, the column temperature was maintained at 23 oC, and autosampler temperature was set to 7 oC, illumination was turned off, and the 50 μl extract loaded inserts were kept in brown vials. The DAD signals were recorded at 440 nm, and individual pigments were identified by comparing retention time and absorption spectra with the published literature. The pigment concentration was calculated in terms of microgram per gram fresh weight of tissue (µg/gfw) by integrating peak area with the standard curve as described in previous chapters (Chapter 2) in agreeance of
Pogson et al. (1996) and Cuttriss et al. (2007).
102
4.2.3 Data analysis and illustrations The means of dependent variables were compared within the treatment groups and across the genotypes. Two-Way ANOVA was used to assess the impact of cold treatment on the level of foliar carotenoids. The Holm-Sidak post-hoc multiple comparisons were performed to determine the interaction within and across the test groups in response to the treatment levels. Data processing and analyses were performed using MS Excel and Sigmaplot14.
4.3 Results
4.3.1 Foliar carotenoid profile remains unchanged in prolonged cold exposed leaves In chapter 2, I demonstrated that both carotenoid and chlorophyll contents were significantly higher in young leaves and were further increased by growing plants under elevated CO2. Here, firstly, I assessed if a prolonged exposure of Arabidopsis seedlings to a non-freezing cold (10/7 oC, day/night) would affect carotenoid content and composition in recently emerged leaves. Arabidopsis seedlings grown under normal growth conditions (long photoperiod 16/8 h day/night length, 22/18 oC day/night temperature, and 130-150 µmol m-2 sec-1 light intensity, and 60 % relative humidity) were transferred to cold for four weeks (10/7 oC day/night temperature with other conditions unchanged) on the 7th day after stratification. As the WT leaves do not accumulate antheraxanthin and zeaxanthin in a detectable amount under normal growth conditions, I used the crtiso mutant, which has an altered carotenoid profile and can accumulate all major foliar carotenoids, including antheraxanthin and zeaxanthin. In addition, crtiso leaves accumulate cis-carotenes when grown under an extended period of darkness (i.e. shorter photoperiod) and display alterations in chloroplast development (Cazzonelli et al., 2019), hence, crtiso was used to assess impacts of the cold exposure on foliar carotenoids.
103
Under long photoperiod and 22 oC temperature, Arabidopsis plants began to bolt 4 weeks after stratification, whereas plants exposed to the cold for four weeks showed a delay in development yet bolted approximately three weeks after removal from the cold. As the level of foliar carotenoids vary in a leaf-age dependent manner
(Chapter 1), comparing leaf tissues from 5-week old plants exposed to cold conditions for four consecutive weeks with leaves from plants grown under normal growth conditions (22/18 oC, day/night) was not justifiable to discern the real effects of prolonged cold on the level of carotenoids. Therefore, as a reference, carotenoid profiles were quantified in young and old rosette leaves from the 3-week-old plants before the onset of bolting (Figure 4.1). The reference plants grown at ambient temperature were of a similar developmental stage, based on the number of leaves (9-
11 leaves), to that of the prolonged cold treated plants (Figure 4.1); therefore, rationally comparable.
Figure 4.1 Arabidopsis plants grown under ambient and prolonged cold conditions.
A) Three-week-old plants grown under 22/18 oC day/night temperature. B) Prolonged (four weeks) cold (10/7 oC day/night) exposed plants. Other growth conditions were similar for both sets of plants such as long photoperiod (16/8 h light/dark), 60 % humidity, and 130-150 µmol m-2 sec-1 light intensity. For cold treatment, 1-week old (7 days after stratification) seedlings were transferred to cold conditions. In concert with the previous findings (Chapter 1), the level of foliar carotenoids except for neoxanthin was significantly higher in young leaves compared to that of
104 old leaves from WT grown under ambient growth conditions (Figure 4.2 A-E). Unlike other carotenoids, a similar level of neoxanthin content in young and old leaves of
WT was surprising. The proportions of lutein, violaxanthin, and antheraxanthin were significantly higher (Figure 4.2 G, I, K), but that of β-carotene and neoxanthin was lower in young leaves (Figure 4.2 H, J,). Zeaxanthin was absent in either of the leaf types from WT. In crtiso mutant leaves, lutein content was decreased (Figure 4.2 A), while the level of violaxanthin, antheraxanthin, and zeaxanthin content were increased in both leaf types, compared to WT (Figure 4.2 C, E, F). The level of neoxanthin remained unchanged in both leaf types of both WT and crtiso (Figure 4.2 D). Unlike the substantially lower level of foliar carotenoids in older leaves from WT, the decline in carotenoids during leaf aging was less apparent for some carotenoids in crtiso mutant leaves. For example, lutein, violaxanthin, and neoxanthin content was similar in both young and old leaves (Figure 4.2 A, C, D), whereas the level of antheraxanthin and zeaxanthin was higher in young leaves (Figure 4.2 E, F) and β- carotene content was higher in old leaves (Figure 4.2 B). The relative proportions of individual carotenoids were also altered in crtiso leaves, such as the lutein proportion was reduced to 13-20 % compared to 50-55 % in WT (Figure 4.2 G). The proportion of β-carotene, violaxanthin, and antheraxanthin was remarkably increased in both leaf types of crtiso (Figure 4.2 H, I, K), whereas neoxanthin proportion was unchanged
(Figure 4.2 J) compared to WT.
Unlike WT, lutein proportion was decreased in young leaves of crtiso compared to old leaves (Figure 4.2 G). The proportions of β-carotene, violaxanthin, and neoxanthin were higher in old leaves (Figure 4.2 H-J). The antheraxanthin and zeaxanthin proportions were increased in young leaves compared to old leaves
(Figure 4.2 K, L). The altered content and proportion of α- and β-carotenoids in both young and old leaves of crtiso implicate a crucial role for CRTISO in regulating
105 carotenoid biosynthetic pathway flux between the α- and β-branches. The leaf-age associated variation in some carotenoids, but not others, and altered effects on their composition indicate that the loss-in CRTISO function can perturb carotenogenesis and/or plastid development in young leaves. Chapter 5 elaborates the possible mechanisms of leaf-age dependent variation in the foliar carotenoid and chlorophyll content.
106
Figure 4.2 Foliar carotenoid content and composition in Arabidopsis grown under normal growth conditions.
A) Lutein content, B) β-carotene content, C) Violaxanthin content, D) Neoxanthin content, E) Antheraxanthin content, F) Zeaxanthin content, G) Lutein proportion, H) β-carotene proportion, I) Violaxanthin proportion, J) Neoxanthin proportion, K) Antheraxanthin proportion, and L) Zeaxanthin proportion. Arabidopsis plants were grown under normal growth conditions (long photoperiod (16/8 h day/night), 22/18oC day/night temperature, and 130-150 µmol m-2 sec-1 light intensity). Foliar carotenoids were measured in the tissues from young and old leaves of 3-week old plants. Individual carotenoid proportions are percentages of the total carotenoid content. Plots represent the mean values with the standard error of means (n=5). Letter codes in plots indicate the level of statistical variation (p<0.05) in carotenoid content within leaf types across the genotypes as determined by the Two-Way ANOVA with Holm-Sidak post-hoc multiple comparisons. WT, wild type; crtiso is a mutant in CAROTENOID ISOMERASE. 107
To discern if long-term cold exposure affected carotenogenesis in different aged leaf types, I compared absolute quantity and proportions of foliar carotenoids in both young and old leaves from WT and crtiso plants that were exposed to prolonged cold
(10/7 oC day/night) for 4-weeks. As described above, it was difficult to establish appropriate control set of plants under ambient temperatures due to the delay in growth during cold exposure. Also, there was significant experimental variation in foliar pigment content among the leaves of different age. Therefore, the foliar carotenoid contents and proportions in the cold-exposed plants are discussed independently (Figure 4.3) and correlating with the general trend of foliar pigments from leaves from plants grown under ambient growth conditions (Figure 4.2).
The level of all foliar carotenoids in the cold-exposed (4-week long cold) WT plants was significantly higher in young leaves compared to old leaves, whereas antheraxanthin and zeaxanthin were not detected (Figure 4.3 A-D). The proportion of lutein was higher, whereas that of β-carotene and neoxanthin was lower in young leaves compared to old leaves (Figure 4.3 G, H, J). Interestingly, the violaxanthin proportion was similar in both young and old leaves (Figure 4.3 I), unlike the plants grown under ambient temperature (Figure 4.2 I). As revealed previously (Park et al.,
2002), the level of lutein and neoxanthin was significantly reduced, whereas that of xanthophyll cycle carotenoids (violaxanthin, antheraxanthin, and zeaxanthin) increased substantially in both leaf types of crtiso, compared to WT (Figure 4.2 A-F).
There was a significant reduction in β-carotene content in young leaves compared to the young leaves of WT, whereas that in old leaves was similar to WT. Unlike WT, lutein, β-carotene, and violaxanthin contents were similar in both young and old leaves (Figure 4.3 A-C), whereas antheraxanthin and zeaxanthin contents were significantly higher and that of neoxanthin was lower in young leaves from the cold- exposed crtiso plants (Figure 4.2 D-F). The proportion of individual carotenoids
108 relative to the total carotenoid content was typically different in crtiso compared to
WT. As expected, the lutein proportion was substantially reduced and was similar in both young and old leaves (Figure 4.3 G). The proportions of β-carotene and violaxanthin were increased in both leaf types of crtiso compared to WT (Figure 4.3
H, I). Neoxanthin proportion was reduced in young leaves of crtiso, whereas it was similar to WT in old leaves (Figure 4.3 J). In both crtiso and WT, there was an apparent variability in absolute quantity with subtle differences in relative proportions of carotenoids between the leaves from cold-exposed and ambient temperature grown plants (compare Figure 4.2 and 4.3). In cold-exposed plants, lutein proportion was significantly higher in old leaves from the crtiso plants grown under normal temperature, whereas it was similar in both leaf types in the cold treated plants
(Compare Figure 4.2 G and Figure 4.3 G). Likewise, violaxanthin proportion was significantly higher in the young leaves of ambient temperature grown crtiso plants, whereas the trend was reversed in cold-treated plants (compare Figure 4.2 I and
Figure 4.3 I). In WT, violaxanthin proportion was significantly higher in young leaves from the plants grown under normal temperature, whereas it was similar in both leaf types from the cold-treated plants (compare Figure 4.2 I and Figure 4.3 I).
The one-to-one comparison of the individual carotenoid proportions between control (normal temperature) and cold exposed WT plants indicates an increase in neoxanthin proportion in both leaf types from the cold-treated plants (compare Figure
4.2 J and Figure 4.3 J). The increase in neoxanthin proportion might be utilised to support abscisic acid production during cold exposure. However, the decrease in neoxanthin proportion in the young leaves of cold exposed crtiso (compare Figure 4.2
J and Figure 4.3 J) was contrasting to the cold-induced increase in neoxanthin proportion in WT. An increase in violaxanthin proportion in old leaves and antheraxanthin in cold exposed crtiso plants (compare Figure 4.2 I, K and Figure 4.3
109
I, K) indicates the increased flux towards violaxanthin biosynthesis plausibly to enhance abscisic acid in the downstream.
As highlighted earlier, the apparent variability in absolute quantity and proportion may be due to an experimental anomaly during plant growth or carotenoid extraction and quantification. However, the general trend of absolute quantity and proportions in young and old leaves was similar in both experiments. Like the normal temperature-grown plants, the substantially higher level of carotenoid content in young leaves compared to the old leaves of the prolonged cold-exposed plants
(compare Figure 4.2 and Figure 4.3) demonstrates that prolonged cold exposure can enable the acclimation of leaves and negate any changes in pigment composition.
Therefore, prolonged cold exposure did not appear to significantly affect carotenoid content or composition in young or old leaf types.
110
Figure 4.3 Foliar carotenoid content and composition in prolong cold exposed plants.
A) Lutein content, B) β-carotene content, C) Violaxanthin content, D) Neoxanthin content, E) Antheraxanthin content, F) Zeaxanthin content, G) Lutein proportion, H) β-carotene proportion, I) Violaxanthin proportion, J) Neoxanthin proportion, K) Antheraxanthin proportion, and L) Zeaxanthin proportion. One-week old seedlings grown under long photoperiod (16/8 h day/night) and 22oC temperature were transferred to cold (10/7 oC day/night) same long photoperiod. Carotenoids were measured in young and old leaves from 4-week long cold exposure. Individual carotenoid proportions are percentages of the total carotenoid content. Plots represent the mean values with the standard error of means (n=5). Letter codes in plots indicate the level of statistical variation (p<0.05) in carotenoid content within leaf types across the genotypes as determined by Two-Way ANOVA with Holm-Sidak post-hoc multiple comparisons. WT, wild type; crtiso is mutant in CAROTENOID ISOMERASE.
111
4.3.2 Shorter exposure to cold decreased foliar carotenoid content in young leaves The effect of sudden and short-term exposure to a severe, but non-freezing, low temperature on carotenogenesis during leaf development has yet to be reported. Here,
I assessed if a sudden exposure to a short-term cold (10 oC / 7 oC, day/night) affected the carotenoid content and relative proportions in the recently emerged young leaves of Arabidopsis. Firstly, Arabidopsis plants were grown under normal growth conditions (22 oC/18 oC day/night, long photoperiod (16/8 h, day/night) for 14 days after stratification (DAS), and subsequently transferred to cold (10 oC/7 oC)for 5-days.
All other growth conditions were similar to the normal growth conditions, except for the low temperature. The foliar carotenoids were measured in the leaf tissues collected from young leaf#3 at five different time points such as on the 14th day
(before transferring to cold) (Day0), after 24 h (Day1) and 5-days (Day 5) of cold exposure, and 24 h (rDay1) and 5-days (rDay5) after recovery from the cold. Leaf samples thus collected represent the leaf aging as the 3rd leaves on 14 DAS were 4-5 days old after emergence (Day0 samples), and rDay5 leaves were 11 days older than
Day0 leaves; therefore, can manifest the effect of both cold exposure and leaf aging.
The carotenoid content and relative proportions both changed as the leaf aging progress and in response to a sudden decrease in temperature. In control plants, as the leaf-age increased, the level of all carotenoids was significantly decreased in leaf samples collected on the 6th and 11th day (rDay1 and rDay5) 11th compared to that of the 1st day (Day0) (Figure 4.4 A, C, E, D). Interestingly, the level of all carotenoids was significantly decreased within 24 h of cold exposure and remained unchanged afterwards, until the fifth day of recovery, except a significant increase in β-carotene
(Figure 4.4 A, C, E, G). The β-carotene content was increased after recovery from cold (Figure 4.4 C). The relative proportion of lutein was increased after cold exposure, which was decreased after recovery (rDay1 and 5). In contrast, proportions 112 of β-branch carotenoids, particularly β-carotene and neoxanthin were decreased after cold for 5-days. On day 5, the β-carotene proportion was significantly increased in control leaves compared to the day0 or day1 leaves, whereas that of cold exposed leaves was decreased. After recovery from the cold, the β-carotene proportion was gradually increased and become equivalent to that of leaves from the control plants on the 5th day of recovery (Figure 4.4 D). Likewise, violaxanthin proportion was decreased after 24 h cold exposure; however, increased to the level of control leaves after 5 days cold exposure and recovery (Figure 4.4 F). The significant increase in the relative proportion of lutein after cold exposure, which was pronounced on the 5th day of cold treatment, with the simultaneous decrease in the proportion of β-carotene implicates the changes in pathway flux during the cold exposure. Collectively, cold treatment triggered the reduction in the level of all foliar carotenoids and altered the relative proportions demonstrating a pronounced impact on carotenogenesis.
113
Figure 4.4 Foliar carotenoid content and composition in leaves exposed to short-term non- freezing cold.
A) Lutein content, B) Lutein proportion, C) β-Carotene content, D) β-Carotene proportion, E) Violaxanthin content, F) Violaxanthin proportion, G) Neoxanthin content, H) Neoxanthin proportion. Arabidopsis plants were grown under normal growth conditions (22/18 oC day/night, long photoperiod (16/8 h, day/night) for 14 days before cold exposure. Individual 114 carotenoid proportions are percentages of total carotenoid content. Plots represent the mean values with the standard error of means (n=5). Letter codes in plots indicate the level of statistical variation (p<0.05) in carotenoid content within leaf types across the genotypes as determined by Two-Way ANOVA with Holm-Sidak post-hoc multiple comparisons. rDay; recovery day. The substantial decrease in carotenoid content in young leaf tissues within the first 24 h of cold exposure (Figure 4.4) prompted me to examine if both young
(recently emerged) and old leaves demonstrated similar effects of cold exposure. I exposed three-week-old Arabidopsis plants grown under normal growth conditions
(as before) to 7 oC for 24 hours. This time, plants were continuously illuminated to minimise the light-dark cycle induced interference on the foliar carotenoid pool. The level of all carotenoids was substantially higher in young leaves compared to the old leaves from the 22 oC grown plants, whereas intriguingly, the level of all foliar carotenoids was substantially decreased in the young leaves harvested after 24 h cold exposure (Figure 4.5 A-E). In contrast, carotenoid content in old leaves was unchanged except a significant decrease in violaxanthin (Figure 4.5 A-E). The cold exposure significantly increased the proportion of lutein and decreased violaxanthin in both young and old leaves (Figure 4.5 F and H). Neoxanthin proportion was increased in old leaves only, whereas the β-carotene proportion was unchanged in both leaves
(Figure 4.5 G and I). Collectively, the cold exposure decreased carotenoid content of young leaves to the level similar or lower of the old leaves.
Interestingly, chlorophyll content in young leaves was also decreased while that of old leaves was unchanged in the cold exposed plants (Figure 4.5 J, K, L).
Chlorophyll a/b ratio was significantly increased in young leaves, whereas that of the old leaves was decreased after 24 h cold exposure (Figure 4.5 M). Like Chl a/b ratio, ratio of the total chlorophyll and total carotenoid content (Chl/Car) were significantly increased in young leaves, and that in old leaves remained unchanged (Figure 4.5 N).
The substantial change in the content and proportions of both carotenoids and chlorophylls in young leaves in response to cold exposure indicates higher plasticity 115 for photosynthetic pigment levels to change rapidly in response to severe cold exposure. Indeed, old leaves were stably resilient to a sudden decrease in temperature, revealing something intrinsically different in how they respond to severe cold exposure.
Figure 4.5 Changes in carotenoid and chlorophyll content and proportion in Arabidopsis leaves in response to short-term cold exposure.
A) Lutein content, B) β-carotene content, C) Violaxanthin content, D) Neoxanthin content, E) Total carotenoid content, F) Lutein proportion, G) β-carotene proportion, H) Violaxanthin proportion, I) Neoxanthin proportion, J) Chlorophyll a content, K) Chlorophyll b content, L) Total chlorophyll content, M) Chlorophyll a/b ratio, N) Total chlorophyll/Total carotenoid ratio. Carotenoids and chlorophylls in the tissues from young and old leaves of 3-week-old plants exposed to the cold (7 oC) for 24 h under continuous light. Carotenoid proportions are the percentages of individual carotenoid to the total carotenoid content. Plots represent the mean values with the standard error of means (n=5). Letter codes in plots indicate the level of
116 statistical variation (p<0.05) in carotenoid content within leaf types across the genotypes as determined by Two-Way ANOVA with Holm-Sidak post-hoc multiple comparisons. 4.4 Discussion
The fluctuation in ambient temperature can alter leaf biochemistry and physiology; therefore, affecting the plant’s performance to acclimate to environmental stress. In leaves, exposure to a low temperature triggers H2O2 accumulation and lipid peroxidation with the concurrent reduction in the activity of antioxidative enzymes including catalase, peroxidase, and ascorbate peroxidase, which increase oxidative stress (Zhou et al., 2006; Abdel Kader et al., 2018). Previous studies by (Haldimann,
1997) and (Haldimann, 1998) revealed a correlation between changes in carotenoid content and composition and cold tolerance in maize plants exposed to 14-10 oC in combination with the high light intensity. An increase in the level of xanthophyll cycle carotenoids was observed in maize leaves (Haldimann, 1997) and Arabidopsis leaves (Harvaux and Kloppstech, 2001) exposed to 10 oC temperature. These above pieces of evidence demonstrate a potential function for xanthophylls to enhance cold tolerance in plants.
In Arabidopsis, the higher level of foliar carotenoids in young leaves compared to old leaves (Figure 4.2, 4.3, 4.4, and 4.5) was in concert with the previous studies
(Stessman et al., 2002; Dhami et al., 2018). The reduction in both content and proportion of lutein with a concomitant increase in β-carotenoids in both young and old leaves of crtiso (Figure 4.2 and 4.3) was as also in concert with the previous findings (Park et al., 2002). Whilst both absolute quantity and proportion of lutein were similar in young and old leaves, the leaf-age related differences in both quantity and proportions of other carotenoids including antheraxanthin and zeaxanthin in crtiso leaves (Figure 4.2 and 4.3) demonstrated the differential regulation of carotenogenesis during leaf development, as in WT, which is further elaborated in chapter 5. The similar trends in absolute quantity and proportions of most carotenoids in young and 117 old leaves from the plants (both WT and crtiso) grown under ambient (22/18 oC day/night) and prolonged cold (10/7 oC day/night) temperature demonstrated the functional stability of carotenoid profile in Arabidopsis leaves, i.e. high and low carotenoid content in young and old leaves.
An increase in the level of xanthophylls in response to cold exposure was evident in plants such as maize (Haldimann, 1998) and Arabidopsis (Harvaux and
Kloppstech, 2001). Both Haldimann (1998) and Harvaux and Kloppstech (2001) applied high light intensity in a combination of low temperature (10-14 oC); hence, changes in the carotenoid profile do not reflect the real effect of cold. Instead, it demonstrates the high light intensity-induced de-epoxidation of violaxanthin, leading to the non-photochemical quenching and photoprotection as evident in previous studies (Jahns and Holzwarth, 2012; van Oort et al., 2018). It was intriguing that a sudden cold-exposure substantially decreased (~50 %) the level of all foliar carotenoids within 24 h in young leaves which were emerged under ambient (22/18 oC day/night) temperature and suddenly exposed to the cold (Figure 4.4 and 4.5).
While the significant decrease in both content and proportion of violaxanthin indicates the de-epoxidation of violaxanthin under cold, neither prolonged or short- term cold exposure increased zeaxanthin levels to a detectable level in WT
Arabidopsis (Figure 4.3, 4.4, 4.5). Growing Arabidopsis or maize plants under high light intensity demonstrated the de-epoxidation of violaxanthin leading to increase in zeaxanthin during cold exposure (Haldimann, 1999; Harvaux and Kloppstech, 2001), although high light intensity induced effects cannot be eluded. The considerable increase in the proportion of violaxanthin in old leaves of crtiso from the prolonged cold treated plants can be the real effect of cold (compare Figures 4.2 I and 4.3 I), which needs further investigation. Collectively, an instant decrease in carotenoid content of young leaves in response to cold exposure (Figure 4.4 and 4.5) implicates
118 massive regulatory changes occurring in carotenogenesis during low-temperature exposure.
The significantly higher level of carotenoids in the young leaves compared to old leaves that were emerged during cold treatment was intriguing (Figure 4.3), which demonstrated that the prolonged exposure to cold could trigger cold acclimation and resume carotenogenesis. These findings correspond with the previous work of
Harvaux and Kloppstech (2001), where they revealed the restoration of photosystem
II activity after 10 days or longer exposure of Arabidopsis to cold conditions. I revealed that young leaves of the ambient temperature grown plants were unable to retain the higher levels of photosynthetic pigments against a sudden decrease in temperature (Figure 4.4, 4.5). These data demonstrate the high plasticity of young leaves affecting carotenogenesis in response to cold exposure. In contrast, old leaves can retain the normal level of all foliar carotenoids regardless of the decrease in temperature (Figure 4.5), therefore, displaying a high degree resilience in maintaining the level of the carotenoid pool.
A concurrent decrease in carotenoid and chlorophyll content in the young leaves exposed to cold (Figure 4.4) indicates a common factor controlling pigment biosynthesis, storage, and, hence, plastid development during cold exposure. It is likely that factors affecting chloroplast structure and/or density can affect the level of photosynthetic pigments in young, but not old Arabidopsis leaves. The young leaves of Arabidopsis comprise relatively smaller cells with smaller chloroplasts having poorly developed thylakoid network (Gugel and Soll, 2017); therefore, they have a lower capacity to sequester carotenoids on an individual plastid basis. However, the high density of small cells per unit area of fresh weight can result in a higher overall density of chloroplasts, therefore, increasing the overall capacity to sequester more
119 carotenoids. In contrast, the number of chloroplasts is higher in fully expanded cells from the old leaves, and the chloroplast size is larger, having a fully developed thylakoid network (Gugel and Soll, 2017). The larger cells, due to the large central vacuole which occupies the most of the cell volume (Rojo et al., 2001; Kruger and
Schumacher, 2018), in mature leaves would result in a lower cell and chloroplast density on a leaf area or fresh weight basis, and hence the lower level of pigments per unit tissue. Collectively, the density and developmental state of chloroplasts as well as cells can impact the threshold level of photosynthetic pigments in leaves, which is explored further in Chapter 5 and discussed thoroughly in chapter 6.
An intriguing finding was the rapid decrease in both carotenoid and chlorophyll content in young leaves, that emerged under normal growth conditions, after cold exposure. While it needs further investigation, one plausible scenario could be the cold-induced inhibition of cell and chloroplast division and development, which occur in young leaves, therefore, leading to an instant decrease in both chlorophyll and carotenoid content. Secondly, as the carotenoid pool was quite stable in response to cold exposure in old leaves, the fully developed thylakoid network can stably accommodate carotenoids in membranes, whereas, insufficient thylakoid membranes can make young chloroplasts less favourable to accommodate higher levels of pigments. An alternate scenario could be guided by the cold-induced alteration in metabolic efficiency of plastidial biosynthetic pathways, including both carotenoid and chlorophyll. As the younger tissues are metabolically more active compared to older tissues (Stessman et al., 2002), young leaves could have a higher abundance of isoprenoid precursors or higher metabolite flux into carotenoid and chlorophyll biosynthetic pathways leading to a production of a substantially higher level of photosynthetic pigments. A sudden decrease in temperature could reduce the precursor pool or decelerate metabolic pathways. Nevertheless, the regulatory
120 network that allows young leaves to accumulate higher levels of carotenoids and chlorophylls, and that quickly reduces pigment pools in response to a severe cold exposure is an exciting finding and further explored in chapter 5.
………. ……….
121
Developmental state of chloroplast determines the foliar plasticity to maintain carotenoid content in Arabidopsis leaves In addition to the major focus on revealing a mechanism that regulates carotenoid homeostasis in Arabidopsis leaves in an age-related manner, I co-authored an original research paper, “A carotenoid-derived signal functions in parallel to deetiolated 1 to regulate etioplast and chloroplast development in response to altered photoperiods”. In this paper, I contributed to generating WT-154 (det1-154) lines (by crossing ccr2-154 with WT), hypocotyl measurement, and carotenoid profiling and data analysis of the same and manuscript revision. (Abstract; in Annex II).
122
Abstract
Leaves undergo several structural and functional changes as they progress through maturity into a stage of senescence. Photosynthetically functional leaves usually accumulate six major carotenoids (lutein, β-carotene, violaxanthin, neoxanthin, zeaxanthin, and antheraxanthin) that facilitate light-harvesting and provide photoprotection. The level of each carotenoid needs to be tightly controlled in leaves during developmental changes and in response to changing environmental conditions. Here, I investigated changes in carotenoid content and composition during Arabidopsis leaf maturation before the onset of senescence. In wild type plants, lutein, β-carotene, violaxanthin, neoxanthin and chlorophyll content was about 70 %, 40 %, 115 %, and 25 % higher respectively in young leaves when compared to older leaves. I demonstrate that the decline in pigments in old leaves was not due to the leaf developmental phase transition, as a typical age-dependent decrease in carotenoid content was revealed in the leaves of SQUAMOSA PROMOTER BINDING PROTEIN LIKE 15 (SPL15) mutant and MICRORNA 156B overexpression (35S::MIR156B) lines that affect leaf phase transitions. I demonstrate that the decline in carotenoids was not due to the enzymatic degradation, as the single and double ccd mutants did not affect the age-related reduction in foliar carotenoid content in aging leaves. Next, I tested the effect of carotenoid biosynthetic pathway mutant and overexpression lines. The overexpression of PHYTOENE SYNTHASE (PSY), which is rate-limiting for carotenogenesis, did not affect carotenoid content in young or old leaf tissues revealing a factor other than biosynthesis enabled the higher pigment accumulation in younger leaves. The loss of CAROTENOID ISOMERASE (CRTISO) function in crtiso (ccr2) plants reduced nearly 80 % lutein content in both leaf types, whereas β- carotene content decreased in young leaves but increased in older leaves compared to the respective leaves from the WT. The xanthophyll cycle carotenoids were substantially enriched in both leaf types of crtiso, and all demonstrated age-related decline revealing the role of CRTISO in regulating metabolite flux into α and β- branches of the carotenoid pathway. The age-related decline was demolished for lutein and β-carotene and that for total carotenoids and chlorophylls was decreased to 10-20 %, while the level of xanthophyll cycle carotenoids was substantially higher in young leaves. This could indicate that a cis-carotene or a cis-carotene-derived apocarotenoid produced in crtiso leaf tissues can perturb carotenogenesis and chloroplast biogenesis and development.
123
I next, demonstrated that a short period of dark and cold exposure could reduce both carotenoid and chlorophyll content in young, but not older leaves. The chemical inhibition of PHYTOENE DESATURASE activity using norflurazon also decreased the carotenoid and chlorophyll content in young leaf tissues, yet did not affect pigment levels in older leaves. Norflurazon forced a 3-fold higher accumulation of phytoene in younger leaves compared to older, regardless of the carotenoid pathway mutants tested. This revealed that young leaves that undergo more frequent cell and chloroplast division, as well as expansion, have a higher capacity to accumulate more carotenoids and chlorophylls. The combined effect of norflurazon with cold or dark exposure reduced and inhibited phytoene biosynthesis respectively in both leaf tissues. The higher level of phytoene in young leaves demonstrated a higher rate of carotenoid biosynthesis. However, the reduction in pigment levels in younger leaves exposed to cold, darkness and norflurazon indicate that the higher density of cells and chloroplasts accompanied by the rapid chloroplast biogenesis and development can be the major factor underpinning the higher levels of pigments observed in young leaves of Arabidopsis. Collectively, I describe a mechanism whereby the darkness and cold exposure could trigger retrograde (as of norflurazon) and apocarotenoid (as of crtiso) signals that can regulate biogenesis and operational control of chloroplasts, more so in younger leaf tissues, fine-tuning photosynthetic pigment homeostasis and acclimation to the prevailing environmental conditions.
124
5.1 Introduction
Leaves display several structural and functional identities during maturation.
The primordial leaf cells undergo a rapid division followed by a gradual expansion in size increasing leaf area, therefore, enhance light harvesting and carbon acquisition
(Gonzalez et al., 2012). The total protein content, rate of photosynthesis, and the level of chlorophyll content are higher in recently emerged (young) leaves of Arabidopsis compared to that of the mature leaves (Stessman et al., 2002; Ishihara et al., 2015).
The younger leaves of Arabidopsis were more tolerant to excessive light stress compared to the mature ones (Bielczynski et al., 2017; D'Alessandro et al., 2018), which indicates the higher photoprotective capacity. Earlier, we demonstrated that young leaves of Arabidopsis had a higher level of carotenoids compared to the old leaves (Dhami et al., 2018) indicating a higher antioxidant capacity, therefore, the higher photoprotective ability of young leaves. The excessive oxidation production of
β-carotene to produce β-cyclocitral activates the photoprotective pathways in chloroplasts during high light stress (Ramel et al., 2012), highlighting a crucial role of carotenoids to orchestrate developmental and environmental changes in leaves.
The photosynthetically functional leaves comprise lutein, β-carotene, violaxanthin, and neoxanthin, that are tightly integrated with chlorophyll pigments in the thylakoid antennae, and collectively contribute to harvesting light energy
(Grudzinski et al., 2001; Liguori et al., 2015; Qin et al., 2015; Mazor et al., 2017).
Antheraxanthin and zeaxanthin are the components of the xanthophyll cycle and often accumulated in response to heat and light stress where they facilitate non photochemical quencing (NPQ) and protect light harvesting complexes (LHCs) in leaves (Ruban, 2016). However, the composition and content of foliar carotenoids can vary in the environmental-dependent manner, being tightly controlled to match the
125 functional state of a leaf and the prevailing environmental conditions (Nisar et al.,
2015).
Foliar carotenoids are synthesised and sequestered in structurally and functionally different types of plastids such as etioplasts and chloroplasts in the dark- grown leaves and photosynthetic leaves, respectively (Cazzonelli and Pogson, 2010).
The proplastids, that differentiate early in the shoot apical meristems (SAMs), are the progenitors of all types of plastids (Charuvi et al., 2012), while tissue-specific developmental signals and environmental conditions determine the biogenesis of different plastid types and their operation control (Jarvis and Lopez-Juez, 2013;
Osteryoung and Pyke, 2014). In leaves, plastids display a distinct developmental transition from a proplastid to etioplast to chloroplast (during dark to light transitions) or proplastid to chloroplast (in light), and chloroplast to gerontoplast (during leaf senescence), and each of them represent a specific functional stage of the leaf (Jarvis and Lopez-Juez, 2013; Sun et al., 2018). Etioplasts of the dark-grown seedlings mainly accumulate lutein and violaxanthin with the traces of β-carotene and neoxanthin, as observed during the seed germination (Rodriguez-Villalon et al.,
2009). However, light exposure can alter both content and proportions of foliar carotenoids concurrently transforming etioplasts into photosynthetically functional chloroplasts (Arsovski et al., 2012).
Plant energy organelles such as chloroplasts serve as environmental sensors and generate reactive oxygen species (ROS), singlet oxygen, and metabolic signalling molecules when exposed to stress conditions; therefore, can alter molecular and physiological processes and cellular functions. In leaves, chloroplasts produce retrograde signals that can be transported to the nucleus and control the expression of photosynthesis associated nuclear genes (PhANGs) and protein levels (Chan et al.,
126
2016; de Souza et al., 2017). The tetrapyrrole pathway intermediates are considered as the retrograde signals affecting nuclear gene expression. For example, norflurazon can induce accumulation of Mg-protoporphyrin IX (Mg-ProtoIX), heme and/or ROS in chloroplasts repressing the expression of PhANGs (Strand et al., 2003; Moulin et al.,
2008; Zhang et al., 2011). Likewise, heme and billin have been demonstrated to have roles in regulating the nuclear gene expression in algae such as Chlamydomonas reinhardtii (von Gromoff et al., 2008; Duanmu et al., 2013). Besides, chloroplast localised carotenoids themselves and/or their oxidative derivatives, mainly apocarotenoids, can also be involved in retrograde control of nuclear gene expression and leaf development (Ramel et al., 2012; Avendano-Vazquez et al., 2014).
Massive changes in density, size, and ultrastructure of chloroplasts can occur during leaf expansion concurrently modulating the chloroplast associated metabolic activities, including carotenoid metabolism (Table 1.1) (Gonzalez et al., 2012). In leaves, chloroplast differentiation and development is intricately associated with the light availability and pigment biosynthesis, both carotenoids and chlorophylls (Jarvis and Lopez-Juez, 2013). The fully differentiated chloroplasts of a mature leaf comprise a highly ordered thylakoid network with a maximum number of grana stacks and thylakoid lamellae, whereas younger leaves have fewer grana stacks with poorly developed thylakoids and undifferentiated lamellae in Arabidopsis (Gugel and Soll,
2017) and maize (Kutík et al., 1999). In general, older leaves comprise larger cells accommodating a higher number of larger sized chloroplasts compared to younger leaves, which should give them a higher capacity to store carotenoids. It is also reasonable that a younger leaf undergoing rapid structural and functional changes needs to be fine-tuned as a carbon sink and adapt to the prevailing environmental conditions to maintain pigment homeostasis and photosynthesis.
127
The loss in carotenoid isomerase function, such as in crtiso mutants, accumulates cis-carotenes (neurosporene and tetra-cis-lycopene) in dark-grown or light deprived photosynthetic tissues, which are linked to the perturbation of prolamellar body (PLB) formation in etioplasts, consequently delaying chloroplast development and photomorphogenesis during de-etiolation (Park et al., 2002; Cuttriss et al., 2007; Cazzonelli et al., 2019). Unlike crtiso, dark-grown cotyledons of ziso mutants accumulate 9,15,9’-tri-cis-ζ-carotene (Chen et al., 2010) and produce a majority of the normal PLBs. Interestingly, the dark-grown cotyledons of ziso crtiso double mutants can resume PLBs and chloroplast development indicating a crucial role of neurosporene and/or tetra-cis-lycopene as substrate(s) generating apocarotenoid(s) that signal to control plastid development (Cazzonelli et al., 2019).
The de novo accumulation of cis-carotenes is reported in both wild type and mutants of many plants, perhaps in a tissue-specific manner such as 15- cis-phytoene and
15,9’-di-cis-phytofluene can be found in the fruits of wild type Apricot and tomato
(Mapelli-Brahm et al., 2017; Shemesh et al., 2017). However, only a few reports demonstrate the signatures of the biological functions of cis-carotenes (Alagoz et al.,
2018). Given that the light can mediate cis-carotene isomerisation in leaves lacking
ZISO and CRTISO enzyme activity, it seems plausible that the functional development of both leaf and plastid can be tightly linked to the level of cis-carotenes and/or cis-carotene derived signalling metabolites. However, photoisomerisation cannot restore the wild type-like carotenoid profile in the light-exposed leaves from crtiso (Park et al., 2002; Cazzonelli et al., 2009). As such, CRTISO is likely to have a function in controlling the chloroplast development as well as carotenoid abundance and composition during leaf maturation.
The continuous turnover of carotenoids via enzymatic and non-enzymatic oxidation (Beisel et al., 2010; Beisel et al., 2011) is finely tuned to leaf development
128 and environmental conditions (Ramel et al., 2012; Havaux, 2014; Schaub et al.,
2018). The enzymatic oxidation is the principal route of carotenoid turnover in plants.
Among the functionally characterized CAROTENOID CLEAVAGE
DIOXYGENASE (CCD) and 9-CIS-EPOXYCAROTENOID DIOXYGENASE
(NCED) enzymes, the plastoglobuli localized CCD4 specifically oxidise β-carotene contributing a rapid carotenoid turnover, particularly during the leaf senescence, as evident in Arabidopsis (Gonzalez-Jorge et al., 2013; Rottet et al., 2016), rapeseed
(Zhang et al., 2015), and potato (Bruno et al., 2015). Based upon the functions that
CCD4 and CCD1 have on carotenoid degradation and apocarotenoid production during leaf senescence, it seems reasonable to hypothesise both enzymes may also play a role in controlling carotenoid levels during the early stages of leaf maturation.
Besides, the abundance of isoprenoid precursors particularly isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP), produced via 2-C- methyl-D-erythritol 4-phosphate (MEP) pathway, determines the metabolite flux into the carotenoid biosynthesis (Lois et al., 2000; Rodriguez-Concepcion et al., 2001).
For example, exogenous feeding of 1-deoxy-D-xylulose (DX) accelerated fruit ripening with a significant increase in the lycopene content in tomato (Lois et al.,
2000). Likewise, overexpression of 1-deoxy-D-xylulose-5-phosphate synthase (DXS) enhanced the production of carotenoids in carrot (Simpson et al., 2016) and
Corynebacterium glutamicum (Heider et al., 2014) confirming a vital role of the precursor supply in carotenogenesis. Also, the cellular glucose level negatively affects the MEP pathway precursor abundance as well as the level of carotenoid and chlorophyll contents in leaves. For example, an increase in glucose level decreased the MEP pathway precursors and carotenoid, and chlorophyll contents in spinach
(Krapp et al., 1991) and tomato (Mortain-Bertrand et al., 2008) leaves. It was previously shown that the constitutive expression of ISOPRENE SYNTHASE (ISPS)
129 gene from the grey poplar (Populus × canescent) in Arabidopsis enhanced the level of dimethylallyl diphosphate (DMADP) and isoprene emission in young leaves compared to old, however, carotenoid and chlorophyll content was unchanged between WT and transgenic lines (Loivamaki et al., 2007). Also, the level of DMAPP demonstrates light-dependent increase reaching to 2-3-fold higher in the noon in
Quercus robur leaves (Bruggemann and Schnitzler, 2002). The isoprenoid production could also be rate-limiting for carotenogenesis during leaf development; however, the regulation of isoprenoid substrate supply into the carotenoid biosynthetic pathway during leaf maturation remains unclear.
In addition to the chloroplast development and carotenoid biosynthesis and degradation, leaves display the characteristic developmental phase identities such as embryonic (cotyledons), juvenile, and adult phases and all leaves are unique in morphology and molecular signatures that can affect carotenogenesis. The leaves of all phases are supposed to finetune the optimum level of carotenoids corresponding to the functional stage of a leaf and ambient environmental conditions. A group of
SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) family transcription factors together with miR156 and miR172 control the juvenile to adult and vegetative to reproductive phase transition as observed in Arabidopsis (Jung et al., 2011; Xu et al., 2016; Nguyen et al., 2017). Nguyen et al. (2017) demonstrated the high and low transcript abundance of miR156 and SPL15, respectively in juvenile phase leaves, and vice versa in the adult phase leaves. Interestingly, suppression of SPL15 expression via overexpression of microRNA156b (miR156b) disrupted the leaf developmental phase transition and enhanced the carotenoid content in the seeds of Arabidopsis (Wei et al., 2012) and Brassica napus (Wei et al., 2010), which indicates a possible link between leaf vegetative phase identity and carotenoid metabolism. It is unclear
130 whether the developmental phase of leaf affects the age-related decline in carotenogenesis.
The functional changes in chloroplasts during leaf development and tissue- and plastid-specific accumulation of carotenoids unveils a challenge to decipher how carotenoid homeostasis can be fine-tuned to leaf developmental transitions and environmental change. In leaves, i) density and ultrastructure of the chloroplast, ii) efficiency of the rate-limiting enzymes, iii) rate of enzymatic and non-enzymatic degradation and iv) availability isoprenoid precursors for phytoene biosynthesis are the main components likely to determine the carotenoid homeostasis. In Chapter 2, I demonstrated that the level of carotenoids was significantly higher in young leaves compared to old (Dhami et al., 2018). This chapter explored how the level of foliar carotenoids changes in response to intrinsic developmental cues and environmental perturbations (extended periods of darkness and non-freezing cold) that impact photosynthesis and plastid biogenesis. A series of experiments with wild type, mutants, and overexpression genotypes of Arabidopsis revealed that young leaves can synthesise and/or accumulate a higher level of carotenoids and chlorophylls compared to old leaves. The experiments were, however, limited to explore the role of carotenoid biosynthetic and degradation pathways along with the leaf vegetative phase transition regulatory network to determine carotenoid homeostasis in
Arabidopsis leaves in response to environmental changes.
5.2 Materials and methods
5.2.1 Germplasm, source and screening The wild type (WT) and a wide array of mutant and transgenic lines of
Arabidopsis thaliana (ecotype Col-0) were used in this study. The mutants and transgenic lines with altered carotenogenesis regulatory genes were selected from the published work as indicated, and seeds were obtained from the respective labs and/or 131
Arabidopsis Biological Resource Centre (ABRC), Ohio State University. The seeds of ziso (z-iso) (Chen et al., 2010), crtiso (ccr2) (Park et al., 2002), lut2 (Pogson et al.,
1998), ccd1(ccd1-1); ccd4 (SALK097984C); ccd7(max3-11); ccd1 ccd4; ccd1 ccd7 and ccd4 ccd7 (Rivers, 2017), crtiso::CrtI-OE; pds::CrtI-OE and crtiso pds::CrtI-OE
(Watkins, 2013), sdg8(ccr1) (Cazzonelli et al., 2009), CRTISO-OE (Cazzonelli et al.,
2010), and PSY-OE (Maass et al., 2009) were obtained from the Barry Pogson’s Lab
(Australian National University). CCD4-OE#2 and CCD4-OE#4 (Rottet et al., 2016) seeds were obtained from the Felix Kessler’s lab (University of Neuchatel,
Switzerland). npq2, lut2 npq2 and aba4 npq1 lut2 (Ware et al., 2016) seeds were obtained from the Luca Dall′Osto’s lab (University of Verona, Italy). spl9-4, spl15-1, and spl9-4 spl15-1 (Nguyen et al., 2017) seeds were obtained from the David
Mccurdy’s lab (University of Newcastle, Australia). Seeds of miR156b-OE (sk156)
(Wei et al., 2012) were obtained from the Abdelali Hannoufa’s lab (Agriculture and
Agri-Food Canada). Seeds of spl15-3 (CS856815), fib4 (SALK_122950C) and hpe1
(SALK_092951C) were obtained from ABRC.
The mutant and transgenic lines used in this study were homozygous as described in the respective literature and verified seed stock was obtained from the respective labs or ABRC. In the case of heterozygous spl15-3, segregation screening was conducted for three subsequent generations using BASTA, and homozygous lines were selected. Also, a characteristic phenotype or carotenoid profile was verified for other germplasm. In brief, ziso and crtiso lines displayed a delay in seedling greening and accumulation of cis-carotenes in dark-grown cotyledons, and crtiso leaves had reduced lutein. The lut2 plants had a normal WT-like phenotype; however, leaves were devoid of lutein with increased violaxanthin content. ccd1, ccd4, ccd7, ccd1 ccd4, ccd1 ccd7, and ccd4 ccd7 lines were confirmed in Pogson’s lab as described in
Rivers (2017) and same seed stock was used in this study. The crtiso::CrtI, pds::CrtI,
132 and crtiso pds::CrtI lines were generated and validated in the Pogson’s lab as described in Watkins (2013) and same parental seed stock was used in this study after confirming BASTA sensitivity. The sdg8 plants had early flowering branched phenotype as described in Cazzonelli et al. (2009). The CRTISO-OE were verified by spraying BASTA as described in Cazzonelli et al. (2010). The PSY-OE lines were verified by growing seeds on MS-hygromycin pates as described in Maass et al.
(2009). The CCD4-OE#2 and CCD4-OE#4 were confirmed by BASTA as described in Rottet et al. (2016). The phenotypes of miR156a-OE, spl15_m, spl15_n,
AS1::spl15_m, AS1::spl15_n were confirmed as described in Wei et al. (2012).
35S::miR156a and 35S::MIM156 phenotypes were validated as of Wu and Poethig
(2006) and Franco-Zorrilla et al. (2007) respectively. The npq2, lut2 npq2, and aba4 npq1 lut2 lines were confirmed by HPLC as described in Ware et al. (2016). The fib4 and hpe1 lines were verified by growing them on MS-kanamycin plates.
5.2.2 Plant growth conditions Arabidopsis plants were grown in growth cabinets (Climatron Star700,
Thermoline Scientific, Australia) or walk-in room with the controlled growth conditions. The Debco Seed Raising and Superior germinating mix (Scotts Australia) provided with 3% Osmocote, a slow-release fertiliser supplement, (Garden City
Plastics Australia) was used to grow plants in 30-Cell Kwikpot trays (Cell dimensions: 50x50x60 mm, Cell volume: 100 ml, Garden City Plastics, Australia).
Arabidopsis seeds were sown on the moistened soil mix and stratified for three days at
4 oC under dark condition before transferring to the normal growth conditions. The photoperiod, light intensity, and temperature conditions were 16/8 hrs (L/D), 130-150
µ mol m-2 sec-1 (cool fluorescent lamps) and 22/18 oC (D/N) respectively except stated otherwise. The Arabidopsis plants were thinned after one week of germination, and a single healthy plant was maintained in each cell. Plants were watered as required,
133 usually once in a week; however, all trays were uniformly watered two days before the sample collection to minimise the possible effect of water content on the test parameters. Each experiment was conducted at least twice to minimise the experimental variations and assure reproducibility.
5.2.3 Leaf tissue collection Arabidopsis rosette leaves of different developmental stages were analysed for the content and composition of carotenoids. The fresh and healthy leaf tissues (20-50 mg/sample) were collected during the middle of the photoperiod (within 7 - 9 hours of daily illumination) unless stated otherwise. The ontogeny-based numbering of rosette leaves was adopted to identify the leaf position, i.e. the first emerged true leaf was numbered as #1, and subsequent leaves were numbered serially, as has described in previous methods (Boyes et al., 2001; Granier et al., 2002). Every biological sample comprised the same leaf, such as leaf #3, from 3-7 plants and at least four biological replicates were maintained for each sample each treatment. The leaf tissues were snap-frozen in liquid nitrogen and stored in -80 oC until analysis.
5.2.4 Seedling greening assay The seedling greening assay was conducted in Murashige and Skoog (MS) artificial culture media (Caisson Laboratories) supplemented with 1 ml/L Gamborg’s vitamins (Sigma-Aldrich) and 0.6% Phytagel (Sigma-Aldrich) without sucrose. For
D15 treatment, 30 mg D15 (an aryl-C3N hydroxamic acid analog) was dissolved in 1 ml ethanol and added to a litre of MS media, whereas, ethanol (1 ml/L media) was added to the control set. Arabidopsis seeds were surface sterilised by dipping them in commercial bleach (4 % sodium hypochlorite) for five minutes with brief vortexing followed by a five-minute hold in 80 % ethanol. Subsequently, the seeds were washed at least four times with sterilised water. The surface sterilised seeds were spread on
MS plates and stratified at 4 oC for 72 hours under dark condition.The stratified plates
134 were transferred into the growth cabinet and temperature was maintained at 22 oC.Plates were kept under the dark condition for five subsequent days to grow etiolated seedlings. On the day five, dark-grown seedlings were transferred to light with 16/8 h (L/D) photoperiod, ~130 µmol m-2 sec-1 light intensity (fluorescent lamps) and 22/18 oC (D/N) temperature except stated otherwise. The dark to light shift was made at the beginning of the photoperiod to maintain full photoperiod cycle from day one. The cotyledons from the dark-grown seedlings were collected on the 5th day, before transferring plates to the light (day0 samples). The greening cotyledon samples were collected at different time points (day 1 to day 17) as indicated in the results section. During sample collection, one MS plate was considered as one biological replicate, and at least four replicates were maintained for each time point each treatment. The cotyledon tissues were snap-frozen in the liquid nitrogen and stored in
-80 oC until the pigment extraction.
5.2.5 Norflurazon assay The three-week-old soil-grown Arabidopsis plants were used for a whole rosette norflurazon incubation bioassay. Arabidopsis plants were kept in the dark for five hours or as indicated otherwise before transferring to the norflurazon incubation media. 10 ml of norflurazon solution (selected concentrations; 5, 10, 20, 50, and 100
μM) or MilliQ water was poured in a petridish containing a four-folded Kimwipe paper (Figure 5.8 B). The dark-adapted rosettes were detached from the rootstock keeping a small (~5 mm) hypocotyl portion intact and transferred to the petridish keeping the tip of the hypocotyl touched the moistened paper. Three to four plants were kept in each plate, covered with the petridish lid, and incubated for 24 hours or as indicated under continuous light or dark with variable temperature regimes. At the end of the incubation period, young and old leaf tissues were harvested. The dark- incubated leaf tissues were collected under green light. At least four biological
135 replicates for each sample and treatment were maintained ensuring the same leaf from
3-4 plants. All tissues were snap-frozen and stored at -80 oC until the pigment extraction.
5.2.6 Pigment extraction Pigment extraction was performed as described in Dhami et al. (2018). In brief, frozen plant tissues were milled in TissueLyser® (QIAGEN) for two minutes at 20
Hz speed using stainless steel beads (~3 mm diameter) in 2 ml clear microtubes.
Finely powdered leaf tissues were extracted with 1 ml extraction buffer containing acetone and ethyl acetate (60:40 v/v) with 0.1 % butylated hydroxytoluene (BHT, w/v). Extraction mixture was vortexed for a minute and 0.8 ml milliQ water was added to separate the pigments by the phase separation. Microtubes were gently inverted for three times avoiding vigorous shaking and centrifuged at 15000 rpm for 5 minutes at 4 oC. The upper pigmented ethyl acetate phase was collected in a new microtube and centrifuged for five minutes as before. Finally, 200 μl supernatant was collected in a clean vial and stored at 4 oC until analysis by HPLC.
5.2.7 Pigment measurement The 20 μl freshly prepared ethyl acetate extracts were analysed using HPLC
(Agilent 1260 Infinity) equipped with YMC-C30 (250 x 4.6mm, S-5 μm) column and
Diode Array Detector (DAD) detector. A 35-minute reverse phase HPLC method was used to separate carotenoids, according to Alba et al. (2005) with minor modifications. In brief, the initial five-minute was an isocratic run of 100 % solvent A
(methanol: triethylamine, 1000:1 v/v) which was followed by a 20-minute ramp to
100 % solvent B (methyl tert-butyl ether) and a two-minute isocratic run of 100 % solvent B afterwards. All three steps were maintained at the solvent flow rate of 1 ml/minute. Finally, the column was equilibrated for 8-minutes using 100 % solvent A at the flow rate of 1.5 ml/minute. The column temperature was maintained at 23 oC,
136 and autosampler temperature was set to 7 oC, illumination was turned off, and the 50
μl extract loaded inserts were kept in brown vials. The DAD signals were recorded at
440 nm, 340 nm, and 286 nm and carotenoid species were identified by retention time, fine spectral structure and the ratios of maximum absorption peaks.
The DAD signals were recorded at 440 nm (286 nm for phytoene), and carotenoid species were identified by retention time, spectral structure and the ratios of maximum absorption peaks. The absolute quantities of carotenoids in micrograms
(µg) of carotenoids per gram fresh weight (gfw) was derived by integrating the peak area to a standard curve value, as previously described (Pogson et al., 1996). Slope values used for converting peak area into µg/gfw leaf tissue include; neoxanthin
(8.787E-05), violaxanthin (7.986E-05), lutein (9.498E-05; also used for antheraxanthin and zeaxanthin), -carotene (9.22E-05), chlorophyll b (2.849E-04) and chlorophyll a (2.74E-04). The phytoene contend was presented in terms of peak area per mg of fresh tissue. The carotenoid profile was presented as the absolute content
(µg/gfw) or peak area (for phytoene) and percentage of a specific carotenoid content relative to the total carotenoid pool.
5.2.8 Arabidopsis transcriptome database search The pilot survey of Arabidopsis leaf age-dependent expression profile of carotenogenesis regulatory genes was conducted with the data retrieved from an open- access web-based database (http://travadb.org/), which contains RNA-seq based high- resolution developmental transcriptome developed by Klepikova et al. (2016). This database presents the gene expression profile of 79 different organs, including the 3rd leaf of A. thaliana rosette representing different developmental stages. Transcriptome data was generated using high-throughput transcriptome sequencing and database is customised to provide differential gene expression across the organs and developmental stages. The transcript abundance of the genes involved in the MEP 137 pathway, carotenoid biosynthesis, carotenoid degradation, and leaf phase regulatory pathways was compared in young and old leaf (3rd leaf), and the differential expression was presented in terms of fold change.
5.2.9 Primer design qRT PCR primers (Annex I) were designed online unless specified otherwise, by using Primer3Plus (http://primer3plus.com/cgi-bin/dev/primer3plus.cgi) and primer quality parameters were further confirmed by using an online IDT primer analyser
(http://sg.idtdna.com/calc/analyzer). Also, the primer sequence blast was performed against Arabidopsis thaliana using NCBI blastn facility (https://blast.ncbi.nlm.nih.gov) to confirm the primer alignment specificity.
5.2.10 Gene expression profiling by quantitative real-time PCR The snap-frozen leaf tissues (~50-100 mg) collected in 2 ml vials comprising stainless steel beads (3 mm diameter) were milled by TissueLyser® (QIAGEN) for two minutes at 20 Hz. RNA was extracted from the finely powdered frozen leaf tissues using SpectrumTM Plant Total RNA Kit (Sigma) with on-column DNase digestion according to the manufacturer’s protocol. 2 μg total RNA with Anchored
Oligo(dt)18 primer was used in a 20 μl reaction for the first-strand cDNA synthesis according to the instructions of Transcriptor First Strand cDNA Synthesis Kit
(Roche). Next, 1 ml of 1/10 diluted cDNA PCR mix was used along with 5 μl
LightCycler® 480 SYBR Green I Master (Roche), and 1 μl of each (forward and reverse) primer (2 μM) in a 10 μl reaction in the LightCycler® 480 Multiwell Plate
384 system (according to manufacturer’s protocol) to quantify the relative transcript abundance of the target genes. Three biological replicates of each leaf type were tested with the three technical replicates of each biological sample. The relative transcript abundance of the target genes in young and old leaves was determined, in
138 reference to Protein Phosphatase 2A gene (Czechowski et al., 2005) by using Livak
(2-∆∆CT) method (Schmittgen and Livak, 2008).
5.2.11 Data analysis The means of the carotenoid, chlorophyll, and gene expression data were compared in leaves and cotyledons of different age and position across a wide range of mutants and overexpression lines. Also, the pigment content and composition in different leaf types were compared across the different mutants in response to the environmental treatments. Being the high level of pigment content in young leaves, the relative decrease in the foliar carotenoids and chlorophylls was determined in old leaves, compared to the young, under the treatment conditions. Also, the effect of mutation or overexpression of a gene and environmental treatment on the foliar carotenoid and chlorophyll content was compared in young and old leaves. The results presented here are the mean values with the standard errors of means (SEM).
Student t-test and One- or Two-Way ANOVA were carried out, where appropriate.
Holm-Sidak post-hoc multiple comparisons were performed to determine the interaction within and across the test groups in response to the treatment levels. The data processing and analysis were performed by using MS Excel and Sigmaplot14.
5.3 Results
I previously demonstrated, in chapter 1, that carotenoid content was substantially higher (>60 %) in the recently emerged young leaves of Arabidopsis
(Dhami et al., 2018). This chapter demonstrates what effects mutant and overexpression lines that alter leaf developmental phase and carotenoid biosynthesis, composition, degradation and/or regulation have on carotenogenesis during
Arabidopsis leaf development. Here, I compared gene transcript abundance and carotenoid content between young and old leaves from WT, mutants, and gene overexpression lines. I explored how environmental conditions (e.g. extended 139 darkness and short-term cold) and a herbicide norflurazon (chemical inhibitor of carotenoid biosynthesis) can reduce the foliar carotenoid content in young leaves but not in old leaves. In addition, the differential abundance of individual carotenoids, as well as chlorophylls in young and old leaves, enabled to elucidate carotenoid homeostasis linking developmental state of leaf and/or chloroplast and environmental conditions.
5.3.1 Some genes involved in carotenoid metabolism regulatory pathways are differentially expressed in young and old leaves The carotenoid biosynthetic pathway is dynamically synchronised with intrinsic developmental changes, both spatially and temporally. The substantial variation in the level of carotenoids in young and old leaves of Arabidopsis, as revealed in chapter 2
(Dhami et al., 2018), prompted a deeper exploration into the transcriptome profiles of the genes involved in the carotenoid biosynthesis and degradation and carotenoid metabolism regulatory pathways. I expected a strong correlation between transcript abundance of the carotenogenesis regulatory genes and carotenoid content in young and old leaves of Arabidopsis. Surprisingly, Arabidopsis leaf-age dependent transcriptome database (Klepikova et al., 2016) showed the similar transcript abundance of the key regulatory genes of the 2-C-methyl-D-erythritol 4-phosphate
(MEP) and carotenoid biosynthesis pathways during the leaf aging, for example, 1-
DEOXY D-XYLULOSE-5 PHOSPHATE SYNTHASE (DXS), 4-HYDROXY-3-
METHYLBUT-2-ENYL DIPHOSPHATE REDUCTASE (HDR), PHYTOENE
SYNTHASE (PSY), and CAROTENOID ISOMERASE (CRTISO) (Figure 5.1 A-B).
However, the transcript abundance of the MEP pathway genes, that are involved in the supply of geranylgeranyl diphosphate (GGPP) into carotenogenesis, particularly
GGPP SYNTHASE 11 (GGPPS11) (Ruiz-Sola et al., 2016), was lower in the old leaves indicating a possibility of the reduced GGPP supply in mature leaves. In contrast, the transcript level of GGPP SYNTHASE 12 (GGPPS12), GGPPS12 interact 140 with GGPPS11 to channel GGPP substrate toward the terpene biosynthesis (Chen et al., 2015), was higher in older leaves, which indicates that the level of substrate for carotenoid biosynthesis can be altered during Arabidopsis leaf aging.
Likewise, several genes involved in the carotenoid biosynthesis, such as ζ-
CAROTENE ISOMERASE (ZISO), LYCOPENE ε-CYCLASE (LCYE), LYCOPENE β-
CYCLASE (LCYB), and α-CAROTENOID HYDROXYLASE 1 (BCH1) had lower expression levels in older leaves corroborating with the general decline in the level of carotenoids in older leaves. Interestingly, of the four CAROTENOID CLEAVAGE
DIOXYGENASE (CCD) and five 9-CIS-EPOXYCAROTENOID DIOXYGENASE
(NCED) enzymes involved in carotenoid degradation, the transcript abundance of
CAROTENOID CLEAVAGE DIOXYGENASE 1 (CCD1), CAROTENOID CLEAVAGE
DIOXYGENASE 4 (CCD4) and 9-CIS-EPOXYCAROTENOID DIOXYGENASE 3
(NCED3) was substantially higher in older leaves (Figure 5.1 B), which indicates a possibility of a higher rate of carotenoid turnover in older leaves. I also analysed the relative expression levels of SQUAMOSA PROMOTER BINDING PROTEIN LIKE
(SPL) family transcription factors (SPL2, SPL3, SPL4, SPL5, SPL6, SPL9, SPL10,
SPL11, SPL13, and SPL15), and microRNAs (miR156a, miR156b, miR172a, miR172b) that regulate the leaf developmental phase transition and carotenogenesis.
Among the SPLs, the expression levels of SPL2, SPL4, and SPL10 were higher, and that of SPL9 and SPL15 was substantially lower in old leaves compared to young leaves (Figure 5.1 C). Likewise, the miR172a transcript abundance was higher in older leaves, and that of miR156a, miR156b, and miR172b was unchanged in both leaf types (Figure 5.1 C). The differential expression level of SPL2, SPL4, SPL10, SPL9,
SPL15, and miR172a indicated a potential role of leaf developmental phases, both vegetative (embryonic, juvenile and adult) and reproductive, in regulating the carotenogenesis in leaves.
141
Next, I quantified the relative expression levels of the selected genes involved in the MEP pathway, carotenoid biosynthesis and degradation pathways, and the leaf developmental phase regulatory pathways in both young and old leaves (leaf#3 from
14- and 24-days old plants), which were normalised using the same amount of RNA and internal house-keeping gene PROTEIN PHOSPHATASE 2A (PP2A). In agreement with the gene expression profile revealed in the transcriptome database
(Klepikova et al., 2016), the transcript levels of the key regulatory genes particularly
DXS, HDR, PSY, and CRTISO were unchanged in young and old leaves (Figure 5.1
D). Moreover, the transcript level of GGPPS11 was decreased marginally but significantly (p=0.01) whereas GGPPS12 increased by 4-fold in old leaves (Figure
5.1 D) indicating the alteration in GGPP substrate flow into carotenogenesis during the leaf maturation. Also, compared to young leaves, the transcript levels of LCYE was significantly decreased (p<0.005) with the corresponding increase of LCYB
(p<0.001) in old leaves (Figure 5.1 D). This could reveal a role for LCYE and LCYB in regulating pathway flux between the α- and β-branch carotenoids in an age- dependent manner. The xanthophyll cycle regulatory genes ZEP and VDE were also unchanged in young and old leaves. However, in concert with (Klepikova et al.,
2016), the transcript abundance of CCD1 and CCD4 was 2- and 13-fold higher in old leaves (Figure 5.1 D) indicating an enhanced carotenoid turnover in older leaves.
Finally, the transcript abundance of SPL15 was reduced by 4-fold in old leaves
(Figure 5.1 D) indicating that the change in the developmental phase could affect the level of foliar carotenoids. Taken together, there were obvious changes in the transcript abundance of the key regulatory genes such as GGPPS12, CCD4, and
SPL15 that could link isoprenoid substrate supply to carotenoid biosynthesis, enzymatic degradation of carotenoids, and leaf developmental phase identity
142 respectively to an altered level of carotenoid content in young and old leaves of
Arabidopsis.
Figure 5.1 Age-dependent expression profile of carotenoid metabolism regulatory pathway genes in Arabidopsis rosette leaves.
(A) 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway, (B) Carotenoid biosynthesis and degradation pathways, and (C) Leaf developmental phase regulatory genes in the third leaf of Arabidopsis rosette. The read count data retrieved from the transcriptome database (http://travadb.org). The transcript abundance in mature (old) leaves at the stage of anthesis of the first flower is presented relative to the young leaf (leaf size 5 mm long). The fold change values were obtained from the transcriptome database hence no error bars or significance provided in figures A, B, and C. (D) Relative transcript abundance of the selected genes in young and old (the third leaf from 14- and 24-day old plants) as revealed by quantitative real- time polymerase chain reaction (qRT PCR). Relative expression levels were normalised to the PROTEIN PHOSPHATASE 2A (PP2A, housekeeper gene. qRT PCR data represent the mean values of three biological replicates, each comprising three technical replicates. In figure D, error bars represent the standard error of means (n=3) of biological replicates. The transcript abundance in figure D represents one of the two independent experiments. The asterisk marks in figure D represent One-Way ANOVA scores, where differences between young and old leaves were statistically significant at p< 0.01 (**), and <0.001 (***). 143
5.3.2 Age-related decline in foliar carotenoid content is independent of leaf developmental phase Arabidopsis leaves display the distinct morphological, functional as well as molecular signatures, referred to as the developmental phase identities, in embryonic
(cotyledons), juvenile (early emerged), and adult (lately emerged) phase leaves
(Poethig, 1997; Xu et al., 2016; Nguyen et al., 2017). In chapter 2, I demonstrated that young leaves of Arabidopsis accumulated the high level of carotenoids regardless of the leaf developmental phases (Dhami et al., 2018), however, the mechanism controlling the age-dependent decline of the foliar carotenoids was unexplored. Here,
I utilised a suite of mutants and overexpression lines, particularly spl and miR156-OE that affect leaf developmental phase transition, to verify if leaf vegetative phase identity alters the level of carotenoid accumulation in leaves. In agreement with the possible role of SPL15 and miR156 in regulating carotenogenesis, the substantially high level of SPL15 transcripts in young leaves (Figure 5.1) corresponding to the higher level of carotenoids compared to old leaves (Dhami et al., 2018) was intriguing. However, like WT, all the tested vegetative phase regulatory spl mutants
(spl9-4, spl15-1, spl15-3, and spl9-4 spl15-1) and miR156-OE lines showed a 60-90
% higher foliar carotenoid content in young leaves compared to old (Figure 5.2).
Taken together, spl mutants and miR156-OE lines that affect leaf developmental phase identify and carotenoid levels in seeds appeared to have no obvious effect on the age-dependent decline in foliar carotenoid content in Arabidopsis leaves.
144
Figure 5.2 Carotenoid content in the young and old leaves of developmental phase regulatory pathway altered lines.
(A) Lutein (B) β-carotene (C) Violaxanthin (D) Neoxanthin, (E) Total carotenoids, and (F) Relative difference (%) in total carotenoid content in young leaves compared to old leaves. The early emerged (leaf#3, old) and recently emerged leaves (leaf#11-13, young) of the long photoperiod (16/8 h, light/dark) grown plants were collected from the 3-week (21 DAS) old plants and carotenoid content was measured using HPLC. Plots represent the mean values with the standard error of means (n=5) from a representative dataset of the two independent 145 experimental repetitions. Letter codes in the plots indicate the level of statistical variation (p<0.05) in the respective test parameters within leaves and across the tested germplasm as determined by Two-Way ANOVA (A-E) and One-Way ANOVA (F) adopting Holm-Sidak post-hoc multiple comparisons. 5.3.3 Carotenoid degradation does not cause an age-dependent decline in foliar carotenoid content Enzymatic oxidation is the primary route of carotenoid turnover and apocarotenoid production in plants. Among the functionally characterised
CAROTENOID CLEAVAGE DIOXYGENASES (CCDs) and 9-CIS-
EPOXYCAROTENOID DIOXYGENASE (NCEDs), the plastoglobuli localised
CCD4 mainly contributes to carotenoid turnover in the senescing leaves and seeds
(Harrison and Bugg, 2014). The substantially higher level of CCD4 transcripts in old leaves (Figure 5.1 and 5.4) and a distinct function of CCD4 in degrading carotenoids during leaf senescence prompted me to explore the level of carotenoids in young and old leaves of single and double ccd mutants to validate the involvement of CCDs, if any, in decreasing the foliar carotenoid content in an age-dependent manner.
It was surprising to see young leaves of the mutants such as ccd1, ccd4, ccd7, ccd1 ccd4, ccd1 ccd7, and ccd4 ccd7 contained a significantly higher (>50%) individual and total carotenoid content when compared to old leaves of the respective lines (Figure 5.3). Also, the level of the total as well as individual carotenoid in the leaves from a constitutive CCD4 overexpression (CCD4-OE) plants was higher in young leaves and decreased during leaf maturation, as in WT (Figure 5.3). Likewise, as plastoglobuli are the sites of CCD4 function and enzymatic degradation of carotenoids, therefore, I tested FIBRILLIN 4 (FIB4) mutants (fib4), which are impaired in plastoglobuli development, to explore if CCD and/or plastoglobuli development affect carotenogenesis during leaf maturation. Like other genotypes, fib4 plants also demonstrated a typical age-dependent decline in foliar carotenoids (Figure
5.3). There were minor changes in individual carotenoid content across the mutant
146 lines, compared to WT; however, the difference was not significant in terms of the total carotenoid content. These data do not support any obvious role for CCDs in controlling the age-dependent decline in foliar carotenoid content during leaf maturation, at least, before the onset of senescence.
Figure 5.3 Carotenoid content in the young and old leaves of the carotenoid degradation pathway regulatory lines.
(A) Lutein (B) β-carotene (C) Violaxanthin (D) Neoxanthin, (E) Total carotenoids, (F) Relative difference (%) in total carotenoid content in young leaves compared to old leaves (young/old). The first pair of rosette leaves (leaf 1-2) of the long photoperiod (16/8 h, light/dark) grown plants were collected on the 11 DAS (young) and 23 DAS (Old). Plots represent the mean values with the standard error of means from a representative dataset of the two experimental repetitions. Letter codes in the plots indicate the level of statistical
147 variation (p<0.05) in the respective test parameters within leaf types across the germplasm as determined by Two-Way ANOVA and One-Way ANOVA (Figure F) adopting Holm-Sidak post-hoc multiple comparisons. I next tested what effect the D15 (an aryl-C3N hydroxamic acid analog), a chemical inhibitor of CCD activity, would have on the age-dependent decrease in carotenoid content typically observed during leaf development. D15 did not affect the age-dependent changes in carotenoid content, both individual and total, during cotyledon maturation (Figure 5.4). As expected, carotenoid content of cotyledons was gradually increased following the de-etiolation, under 16-hour daily light exposure, which was peaked around the day 9, but steadily declined afterwards regardless of the
D15 treatment (Figure 5.4). Despite previous reports showing that the D15 enhanced carotenoid content in root tissues by 2-fold (Van Norman et al., 2014), the carotenoid levels remained relatively unchanged in maturing cotyledons compared to control
(Figure 5.4).
It should be noted that there were subtle changes in a few individual carotenoids at the selected time points in the D15 treated seedling tissues; however, this can be an artefact of sampling. Collectively, the age-dependent decrease in the foliar carotenoid content observed in Arabidopsis leaves was not dependent upon any single or double ccd mutation combination, and D15 treatment ruled out CCD redundancy as a contributing factor. Hence, CCD activity does not appear to have a function in age- related decline of the carotenoid content during the leaf maturation regardless of the substantial increase in CCD4 transcript abundance in old leaves.
148
Figure 5.4 Carotenoid content in the greening cotyledons in response to D15.
(A) Lutein (B) β-carotene (C) Violaxanthin (D) Neoxanthin, (E) Total carotenoids. Arabidopsis seedlings were grown on MS basal medium with or without 30 μg/L D15 under dark for 5 DAS. Dark-grown seedlings were transferred to the light (16/8 h, light/dark)) on the 5th DAS, marked as the 0 day after light exposure. The pair of cotyledons were collected from 5-19 days after light exposure, and carotenoid content was measured. Plots represent the mean values with the standard error of means (n=4) from a representative dataset of the two independent experimental repetitions. Letter codes in the plots indicate the level of statistical variation (p<0.05) in the respective test parameters within leaf types across the test groups as determined by Two-Way ANOVA adopting Holm-Sidak post-hoc multiple comparisons.
149
5.3.4 Carotenoid isomerase mutant impairs carotenoid accumulation in a leaf- age dependent manner I next investigated what effect enhancing carotenogenesis by PSY- overexpression and altering carotenoid isomerisation by impairing ZISO and CRTISO function and CRTISO-overexpression would have on the carotenoid profile in young and old leaves of Arabidopsis. In agreement with the leaf phase and carotenoid degradation regulatory mutants, the level of total carotenoids was significantly decreased in the old leaves of the carotenoid biosynthetic pathway mutants (Figure
5.5). Although there were significant differences in younger leaves across the genotypes, that can be genotype-dependent, old leaves had a similar level of carotenoids across the genotypes (Figure 5.5). The overexpression of PSY did not affect total or individual carotenoid content in any leaf types, except a slight reduction in neoxanthin in older leaves (Figure 5.5 D), which corroborated the previous findings that demonstrated similar carotenoid content in the leaves from PSY-OE and WT
(Maass et al., 2009). The total carotenoid content was significantly reduced in younger leaves of ziso and crtiso mutants when compared to WT (p=0.008 and 0.001 respectively) (Figure 5.5 G,), but that of old leaves was unchanged (Figure 5.5 F, H).
These findings were consistent with previous studies that demonstrated a reduction in the total carotenoid content in dark-grown tissues of ziso (zic1-1)(Chen et al., 2010) and crtiso (ccr2) (Park et al., 2002).
In crtiso leaves, individual carotenoid contents varied drastically in both young and old leaves compared to the respective leaves from WT (Figure 5.5). The lutein content was reduced by nearly 80 % and 60 % in young and old leaves, respectively, of crtiso compared to the respective leaves of WT (Figure 5.5 A, G, H). The level of
β-carotene was similar in young leaves of both crtiso and WT, whereas old leaves of crtiso had a significantly higher level (~20 %, p=0.04) of β-carotene (Figure 5.5 B, G,
H). Intriguingly, unlike other genotypes including WT, the level of lutein and β- 150 carotene were similar in both young and old leaves of crtiso (Figure 5.5 A, and B).
Other pigments such as violaxanthin, neoxanthin, antheraxanthin and zeaxanthin displayed an age-dependent decline as WT (Figure 5.5 C, D, E). There was an increase (80 % to 125 %) in violaxanthin and decrease in neoxanthin (20 % to 30 %) content in both leaf types of crtiso mutants (Figure 5.5 C, D, G, H). Antheraxanthin and zeaxanthin accumulate in trace levels or not detected in WT leaves; however, both were significantly enriched in crtiso leaves, more so in young leaves compared to old (Figure 5.5 E). As expected, overexpression of CRTISO (CRTISO-OE) restored the level of all foliar carotenoids in both leaf types to the level of WT, including the absence of antheraxanthin and zeaxanthin (Figure 5.5), which implicates a stringent requirement of CRTISO activity in determining the foliar carotenoid profile. The substantial decrease in α-chain carotenoid (lutein) and concurrent increase in β-chain carotenoids (β-carotene, zeaxanthin, antheraxanthin, and violaxanthin) content in crtiso leaves, compared to WT, highlights an essential role of CRTISO in regulating pathway flux into α- and β-branches (Figure 5.1 D).
The leaves from ziso accumulated significantly reduced level of lutein, β- carotene, and violaxanthin in young leaves compared to WT, yet did not affect their levels in older leaves (Figure 5.5 B, G, H). Like WT, antheraxanthin and zeaxanthin were not detectable in ziso leaves under normal growth conditions. These data support the fact that the loss of ZISO function can impair individual carotenoid content in the leaf-age dependent manner. Both CRTISO and ZISO can alter pathway flux through
α- and β-branch carotenoids, perhaps in an age-dependent manner. The perturbations that affect lutein and/or β-carotene can alter the age-related decline in foliar carotenoids as observed during the leaf development. Although CRTISO and ZISO drive key enzymatic steps changing foliar carotenoid content, both steps can also be enabled by light exposure. Collectively, the above data demonstrate the critical roles
151 of carotenoid isomerases in maintaining the functional state of α- and β-carotenoids during leaf development.
Figure 5.5 Carotenoid content in the young and old leaves of carotenoid biosynthetic pathway regulatory lines.
152
(A) Lutein, (B) β-carotene, (C) Violaxanthin, (D) Neoxanthin, (E) Antheraxanthin and Zeaxanthin in crtiso leaves, (F) Total carotenoids, (G) Relative content of carotenoids in young leaves of mutant and overexpression lines compared to WT (H). The relative content of carotenoids in old leaves of mutant and overexpression lines compared to WT. The leaf#3 samples were collected from the soil-grown plants on the 14th (young) and 29th (old) day after stratification (DAS). Plots represent the mean values with the standard error of means (n=4) from a representative dataset of multiple experimental repetitions. Letter codes and asterisk marks in the plots indicate the level of statistical variation (letters p<0.05 and *** p<0.001) in the respective test parameters within leaf types across the germplasm as determined by Two- Way ANOVA adopting Holm-Sidak post-hoc multiple comparisons. ziso and crtiso are loss of function mutants in ζ-CAROTENE ISOMERASE and CAROTENOID ISOMERASE respectively. PSY-OE and CRTISO-OE lines are 35S::AtPSY line#23 (Maass et al., 2009) and 35S::AtCRTISO (Cazzonelli et al., 2010). Lut; Lutein, β-car; β-carotene, Vio; Violaxanthin, Neo; Neoxanthin, Ant; Antheraxanthin, Zea; Zeaxanthin, Tot Car; Total carotenoids. To further explore the mechanism of the carotenoid isomerisation on carotenoid accumulation during leaf maturation, I analysed Arabidopsis WT and mutant (crtiso and pds) transgenic lines harbouring a bacterial PHYTOENE DESATURASE (CrtI) gene from Pantoea agglomerans. The bacterial CrtI gene allows a bypass from phytoene to lycopene without a need for any cis-carotene isomerisation and, as such, can facilitate xanthophyll biosynthesis without endogenous PDS or CRTISO activity
(Fraser et al., 1992). I used CrtI-OE transgenic lines that were previously generated in pds mutant (CS16064) background (pds::CrtI#26) and was subsequently crossed to crtiso mutant (ccr2.1) enabling the generation of crtiso::CrtI-OE and pds crtiso::CrtI-
OE lines (Watkins, 2013). The overexpression of CrtI in crtiso mutant background did not resume carotenoid profile to WT (Figure 5.6 G). A similar (28-38%) decline in total carotenoid content was observed during leaf maturation in both crtiso and crtiso::CrtI-OE, which was considerably less than the reduction observed (~55 %) in
WT (Figure 5.6 H). However, CrtI-OE displayed the variable impacts at the level of individual carotenoids in the absence of crtiso.
CrtI-OE caused a subtle, yet the significantly higher accumulation of lutein
(Figure 5.6 A), while the level of β-branch carotenoids such as β-carotene, antheraxanthin and zeaxanthin content was decreased in young leaves of crtiso::CrtI-
OE compared to crtiso (Figure 5.3 A, B, E, F). As a consequence, there was a greater
153 reduction in total carotenoids in old leaves of crtiso::CrtI-OE relative to WT and crtiso (Figure 5.6 G, H). Indeed, the total, as well as specific carotenoid content, displayed a typical age-dependent decline in old leaves except β-carotene and antheraxanthin in crtiso::CrtI-OE. The pds::CrtI-OE lines also showed the reduced carotenoid content compared to WT and a typical decline in total and individual carotenoid content during leaf maturation (Figure 5.3). Compared to WT, the decrease was significant for lutein in both young and old leaves, and neoxanthin content was reduced in young leaves only (Figure 5.6 A, D). The absolute level of lutein was reduced in pds::CrtI-OE, which was in agreement with the previous studies in tomato
(Romer et al., 2000) and Arabidopsis (Galzerano et al., 2014).
In contrast, β-carotene content was similar as WT and violaxanthin levels were significantly increased in both young and old leaves in pds::CrtI-OE compared to WT
(Figure 4.6 B, C). Whilst the overexpression of CrtI in crtiso and pds background
(crtiso::CrtI and pds::CrtI) was unable to restore the WT-like carotenoid profile in any of the leaf types, curiously, the pds::CrtI crtiso lines showed an enhanced level of total carotenoids that mimicked WT level (Figure 5.6 G, H). The crtiso effect was completely abolished for antheraxanthin and zeaxanthin in the old leaves of pds::CrtI crtiso, as none of antheraxanthin or zeaxanthin accumulated in old leaves (Figure 4.6
F). Indeed, like crtiso, lutein and β-carotene contents were significantly lower and higher respectively in young leaves of pds::CrtI crtiso compared to WT (Figure 5.6
A, B), regardless of the WT-like difference in the total carotenoid content between young and old leaves (Figure 5.6 H). These data substantiate the role of CRTISO in regulating carotenoid pathway flux into α- and β-branches of the carotenoid biosynthetic pathway. The fact that the loss of CRTISO function impairs PLB formation and chloroplast development leading to a reduced level of carotenoids, a substantially higher level of carotenoid content in young leaves could be linked to
154 active biogenesis of chloroplast and higher cell density in young leaves compared to older leaves that have fully developed chloroplasts. Nevertheless, how CRTISO orchestrates the developmental and environmental signals to finetune pathway flux through to α- and β-branches of the carotenoid biosynthetic pathway is open to discovery.
Figure 5.6 Carotenoid content in the young and old leaves of CrtI overexpression lines.
(A) Lutein (B) β-carotene (C) Violaxanthin (D) Neoxanthin, (E) Antheraxanthin, (F) Zeaxanthin (G) Total carotenoids, and (H) Relative increase in total carotenoid content in 155 young leaves compared to old leaves. The early emerged (leaf#2-3, old) and recently emerged leaves (leaf#11-13, young) were collected from the three-week-old plants. Plots represent the mean values with the standard error of means (n=5) from a representative dataset of the two experimental repetitions. Letter codes in the plots indicate the level of statistical variation (p<0.05) in the respective test parameters within leaf types across the germplasm as determined by Two-Way ANOVA and One-Way ANOVA (in Figure H) adopting Holm- Sidak post-hoc multiple comparisons. pds and crtiso are loss of function mutants in PHYTOENE DESATURASE and CAROTENOID ISOMERASE respectively. CrtI is a bacterial PHYTOENE DESATURASE from Pantoea agglomerans used to generate CrtI overexpression transgenic lines in pds (CS16064) and crtiso (ccr2) backgrounds as described in Watkins (2013). 5.3.5 Age-related decline in foliar carotenoids is independent to changes in lutein or other xanthophyll carotenoids The similar level of lutein, although reduced in comparison to WT, with enriched violaxanthin and zeaxanthin in both young and old leaves of crtiso indicated a possibility of lutein biosynthesis determining the age-dependent homeostasis of the foliar carotenoids (Figure 5.6). I, therefore, tested if mutant lines lacking and/or accumulating one or more xanthophylls (e.g. lutein, zeaxanthin, violaxanthin) demonstrate a typical age-related decline in carotenoid content during leaf development. Firstly, I showed that lutein did not affect the age-dependent decrease in the foliar carotenoids. The lutein deficient 2 mutants (lut2), which lacked lutein, but had higher violaxanthin levels, normal β-carotene content, and reduced neoxanthin in both leaf types, still displayed, like WT, a significant reduction in individual as well as total carotenoid content in old leaves (Figure 5.7). Likewise, the leaves from lut2 npq2 double mutant (accumulate only zeaxanthin and β-carotene) and the aba4 npq1 lut2 triple mutant (accumulate only β-carotene and violaxanthin) demonstrated that changes in xanthophyll content do not affect the age-dependent decrease in the foliar carotenoids as observed in older leaves from WT (Figure 5.7). Intriguingly, high zeaxanthin accumulating lines, such as npq2 (=aba1.3) and lut2 npq2, accumulated a substantially higher (60 % and 20 %, respectively) total carotenoid content in young leaves compared to WT, whereas that in old leaves were rather similar as WT (Figure
5.7). Taken together, the decline in the level of foliar carotenoids during leaf ageing did not link to the xanthophyll, including lutein, biosynthesis and/or accumulation. 156
Figure 5.7 Carotenoid content in the young and old leaves of the xanthophyll biosynthetic pathway mutant lines.
(A) Lutein (B) β-carotene (C) Violaxanthin (D) Neoxanthin, (E) Zeaxanthin, and (F) Total carotenoids. The leaf#3 samples of the soil-grown plants were collected on the 13 DAS (young) and 24 DAS (Old). Plots represent the mean values with the standard error of means (n=4) from a representative dataset of two experimental repetitions. Letter codes in the plots indicate the level of statistical variation (p<0.05) in the respective test parameters within leaf types across the germplasm as determined by Two-Way ANOVA adopting Holm-Sidak post- hoc multiple comparisons. npq2, aba4, and lut2 were mutants in NONPHOTOCHEMICAL QUENCHING 2, ABSCISIC ACID DEFICIENT 4, LUTEIN DEFICIENT 2 genes respectively.
157
5.3.6 Young leaves have a greater capacity to accumulate phytoene The fact that the loss-in CRTISO function was able to perturb age-related difference in lutein content and caused phytoene accumulation in younger leaves from crtiso, prompted to explore how perturbing cis-carotene biosynthesis would impact carotenoid levels in aging leaves. I hypothesised that younger leaves could have a higher isoprenoid substrate availability for carotenoid biosynthesis when compared to older leaves. I also questioned whether the differences in the state of cell division during leaf aging could account for accumulating a differential level of carotenoids in young and old leaves. For example, rapid cell division and chloroplast biogenesis in younger leaves could lead to an overall higher density of cells and chloroplasts; therefore, higher the level of carotenoid content. I utilized a herbicide norflurazon, a potent inhibitor of PDS activity that causes phytoene to accumulate (Figure 5.8 A) in plastids (Devlin et al., 1976; Di Baccio et al., 2002), to explore the level of phytoene accumulation in both young and old leaves in WT and the carotenoid biosynthesis regulatory mutants.
I firstly optimised the norflurazon bioassay for Arabidopsis leaves and rosettes
(Figure 5.8 B), to quantify and correlate phytoene accumulation with other foliar carotenoids in different leaf types. I tested various concentrations of norflurazon (1, 5,
10, 50, and 100 μM) and incubation times (1, 2, 4, 8, 20, and 24 hours) on phytoene and phytofluene accumulation in both young (immature; leaf 1-2) and old (mature; leaf 9-11) leaf types (Figure 5.8 B). All concentrations of norflurazon caused phytoene to accumulate in both leaf types (Figure 5.8 C), albeit at different amounts during 1-24 hours incubation time (Figure 5.8 E). A small quantity of phytofluene was detected in young leaves at lower concentrations of norflurazon, which was declined as the increase in norflurazon concentration and diminished after 50 μM
(Figure 5.8 D) indicating a complete inhibition of phytoene desaturation at a step
158 before phytofluene production. Among the five concentrations tested, 50 μM or higher concentration of norflurazon accumulated the maximum level of phytoene but not phytofluene, in both leaf types (Figure 5.8 C) demonstrating a complete cease of
PDS activity at 50 μM or higher concentration of norflurazon. As such, applying norflurazon to whole rosettes could provide a unique system to explore chloroplast biogenesis and turnover as well as plastid capacity to synthesise and accumulate carotenoids in different leaf types. I next optimised the duration for the rosette incubation using 50 μM norflurazon and aimed to determine what effect the incubation time might have on phytoene accumulation in different leaf types. The detectable level of phytoene was accumulated in both leaf types within four hours of norflurazon incubation, indicating a rapid inhibition of PDS activity (Figure 5.8 E).
The phytoene could accumulate at earlier time points; however, these levels were below the detection of our HPLC quantification method. After 4-hours of incubation, there was a steady increase in phytoene accumulation, as the incubation time increased, in both leaf types; however, the difference between young and old leaves was nearly similar (2-3 fold) at all time points (Figure 5.8 E, F). The consistently higher level of phytoene accumulation in younger leaves in all concentrations of norflurazon (Figure 5.8 C) and at all incubation time points (Figure 5.8 E, F) agreed with the higher level of carotenoid biosynthesis in young leaves (Figure 5.2 and 5.3).
Norflurazon could have perturbed the carotenogenesis concomitantly impairing chloroplast biogenesis as evidenced by the visual bleaching occurred at the bases of young leaves after 24 h of norflurazon incubation that was not seen in older leaves.
The rate of chloroplast turnover in older leaves could be considerably slower, as evidenced by the longer time they took developing bleached sectors. Like other carotenoids, a higher phytoene content in young leaves indicates that young leaves comprising a higher density of continuously dividing cells can be more efficient,
159 compared to old leaves, in synthesising and/or accumulating carotenoids.
Collectively, these proofs implicate that younger leaves can have a higher plastid density due to the greater cell density accompanied by the higher rate of plastid biogenesis that overall can synthesise and/or accumulate carotenoids to a greater extent compared to the old leaves. Alternatively, a higher isoprenoid substrate availability in young leaves could also cause a biosynthesis of phytoene to a greater extent compared to older leaves.
160
Figure 5.8 Optimization of the norflurazon bioassay using Arabidopsis whole rosette.
(A) Carotene biosynthetic pathway highlighting the steps of norflurazon inhibition. (B) A typical set up of the entire rosette norflurazon treatment. (C) Phytoene and (D) phytofluene content after 24 h incubation of Arabidopsis rosettes in different concentrations of norflurazon., (E) Phytoene content in response to norflurazon treatment (50 μM) at the different incubation time points, and (F) Difference in phytoene content in young leaves (%) compared to old leaves at the different incubation time points. The three weeks old 161
Arabidopsis rosettes were treated with different concentration (0-100 μM) of norflurazon for the different incubation times (1-24 hours), as indicated. Arabidopsis trays were kept in the dark for 4-5 hours before transferring Arabidopsis plants to the norflurazon. Norflurazon treatment was conducted under continuous light (130-150 µmol m-2 sec-1, cool fluorescent lamps) at 22 oC. The early emerged leaves (leaf 1-2; old) and recently emerged leaves (leaf 9- 11, young) samples from the norflurazon treated plants were collected after different incubation time points (as indicated), and carotenoid content was measured using HPLC. Plots represent the mean values with the standard error of means (n=4 (C, D), 3 (E)) from a representative dataset of at least two independent experimental repetitions. Letter codes indicate the level of statistical variation (p<0.05) in carotenoid content within and across the test groups determined by Two-Way ANOVA, except One-Way ANOVA for Figure D and F adopting Holm-Sidak post-hoc multiple comparisons. 5.3.7 Carotenoid isomerase mutants enhance phytoene accumulation in young leaf tissues As young leaves accumulated substantially higher levels of phytoene in response to norflurazon-induced inhibition of PDS activity (Figure 5.8), I questioned if the carotenoid isomerase mutants (ziso and crtiso), the young leaves of which already accumulate a detectable amount of phytoene, would accumulate more phytoene in response to norflurazon treatment. The norflurazon treated rosette leaves from ziso, crtiso, and lut2 mutants all accumulated more than 3-fold higher phytoene content in young leaves compared to older leaves (Figure 5.9 A, C). Surprisingly, ziso and crtiso plants significantly enhanced phytoene accumulation in young leaves by 90
% and 60 % respectively and nearly 50 % higher in old leaves compared to WT
(Figure 5.9 A). However, due to the proportionate enrichment of phytoene content in both leaf types, the difference between young and old leaves of all genotypes was similar (Figure 5.9 C). Like WT, an equivalent level of phytoene accumulation in response to norflurazon in ziso and crtiso leaves reinforces the fact that the young leaves can have a higher substrate availability to synthesise carotenoids to a greater extent. Alternatively, as stated earlier, a higher cell and chloroplast density could provide an additive increase in phytoene as well as downstream carotenoid content in young leaves compared to old leaves, which demands a more in-depth exploration into the cytology of young and mature leaves.
162
Next, I tested phytoene accumulation in PSY overexpression transgenic lines expecting the accumulation of more phytoene in both leaf types if PSY activity is rate-limiting, therefore, result in the different level of carotenoids in young and old leaves. Also, constitutive overexpression of PSY would demolish the leaf-age related trend in phytoene accumulation in response to norflurazon, given that PSY-OE enhanced phytoene accumulation in dark-grown calli (Schaub et al., 2018) and loss- of-function in PSY activity was shown to feedback reducing isoprenoid precursor supply into the carotenoid biosynthetic pathway (Rodriguez-Villalon et al., 2009).
However, phytoene levels were significantly enriched in young leaves from both WT and PSY-OE lines relative to older leaves of the respective genotypes (Figure 5.9 A).
Curiously, PSY-OE did not enhance phytoene levels compared to that of WT in none of the leaf types and age-related decrease in phytoene content in old leaves persisted
(Figure 5.9 A). Hence, PSY activity is not a determinant of an age-related decline in foliar carotenoid levels in Arabidopsis leaves.
There are pieces of evidence demonstrating that cis-carotene and/or β-carotene derived apocarotenoids could feedback as the signalling molecules to regulate isoprenoid precursor flux into the carotenoid biosynthetic pathway (Hou et al., 2016;
Alagoz et al., 2018). Therefore, I next quantified the phytoene levels in young and old leaves of ccd4, ccd7, and ccd4 ccd7 mutants, as well as CCD4-OE lines that all can perturb the enzymatic generation of apocarotenoids, hence, expected to alter the age- related decline in phytoene accumulation in norflurazon treated rosette leaves. In agreement with the age-dependent variation in phytoene level in WT leaves, all ccd mutant and CCD4-OE lines accumulated 4-6-fold higher phytoene levels in young leaves (Figure 5.9 B, D). The ccd4, ccd7, and ccd4 ccd7 mutants showed a significantly lower accumulation of phytoene content in young leaves compared to
WT, whereas old leaves had the same level of phytoene content across the genotypes
163 and fold differences between young and old leaves was not significantly different to
WT (Figure 5.9 D). These data can rule out a function for enzymatic oxidation derived apocarotenoids in foliar tissues that, I speculated to, control plastid biogenesis and/or isoprenoid substrate supply into the carotenoid biosynthetic pathway during leaf maturation.
Figure 5.9 Phytoene accumulation in young and old leaves of Arabidopsis in response to norflurazon treatment.
(A) Carotenoid biosynthetic pathway altered genotypes, (B) Carotenoid degradation pathway altered mutant lines, (C) Difference in phytoene accumulation in carotenoid biosynthetic pathway altered genotypes, and (D) Difference in phytoene accumulation in carotenoid degradation pathway altered genotypes. The three-week-old long photoperiod (16/8 h, light/dark, 22/18 oC temperature) grown Arabidopsis rosettes were treated with 50 μM norflurazon for 24 hours at 22 oC under continuous light. Arabidopsis trays were kept in the dark for 5 hours before transferring plants to norflurazon. The early emerged (leaf 1-2, old) and recently emerged leaf (leaf 9-11, young) samples from the norflurazon treated plants were collected after 24 hours, and carotenoid content was measured using HPLC. Plots represent the mean values with the standard error of means (n=4) from a representative dataset of the two independent experimental repetitions. Letter codes indicate the level of statistical variation (p<0.05) in carotenoid content within and across the test groups determined by Two- Way ANOVA (Figure A and B) and One-Way ANOVA (Figure C and D) adopting Holm- Sidak post-hoc multiple comparisons.
164
5.3.8 Norflurazon treatment reduced carotenoid content in young leaves The continuous turnover of the downstream carotenoids such as β-carotene
(Beisel et al., 2011) is likely to reduce the carotenoid pool rapidly as norflurazon completely blocks PDS activity and the biosynthesis of downstream carotenoids. To explore the effect of norflurazon on the downstream carotenoids, I quantified the level of the most abundant foliar carotenoids following the norflurazon treatment of
Arabidopsis rosettes. It is interesting to note that the level of lutein, β-carotene, violaxanthin as well as the total carotenoids was significantly decreased in young leaves after 20 h or longer incubation in norflurazon while neoxanthin remained unchanged (Figure 5.10 A-E). Unlike lutein, β-carotene and violaxanthin contents were significantly lower in young leaves compared to that of the old leaves after 24 h incubation in norflurazon. In contrast, the level of all foliar carotenoids or total carotenoids in older leaves remained unaffected by norflurazon treatment (Figure 5.10
A-E). The difference in the total carotenoid content between young and old leaves was significantly decreased after 20 h incubation in norflurazon where both young and old leaves had a similar level of total carotenoids (Figure 5.10 F). However, the difference becomes negative after 24 h incubation as the carotenoid content was continuously reduced in young leaves and that of old leaves remained unaffected
(Figure 5.10 E).
The rapid decrease in individual and total carotenoid content in young leaves following norflurazon treatment and the lack of change in the carotenoid content in old leaves reinforces the critical differences in the state of plastid differentiation and turnover in aging leaves. The lack of change in carotenoid content in older leaves highlights a slower chloroplast turnover in mature cells, and that norflurazon plausibly did not affect the intact chloroplasts to the same extent to those undergoing rapid differentiation of thylakoids in young leaves. Also, the reduction in β-carotene and
165 violaxanthin after 24 h was intriguing, which indicates that these pigments are more susceptible to degradation during chloroplast turnover. Collectively, the dramatic decrease in carotenoids in young leaves following norflurazon treatment highlights that the immature cells undergoing rapid division and plastid biogenesis are the most sensitive to changes in carotenoid levels.
166
Figure 5.10 Carotenoid content in the young and old leaves of the norflurazon treated plants after different incubation time points.
(A) Lutein, (B) β-carotene (C) Violaxanthin, (D) Neoxanthin, (E) Total carotenoids, and (F) Relative change (%) in total carotenoid content in young leaves compared to old leaves. Arabidopsis trays were kept in the dark for 4-5 hours before transferring Arabidopsis plants to the norflurazon plates. Norflurazon treatment was conducted under continuous light at 22 oC. The early emerged (leaf 1-2, old) and recently emerged leaf (leaf 9-11, young) samples from the norflurazon treated plants were collected after different incubation time points (as indicated) and carotenoid content was measured using HPLC. Plots represent the mean values with the standard error of means (n=3) from a representative dataset of the two independent experimental repetitions. Letter codes indicate the level of statistical variation (p<0.05) in 167 carotenoid content within and across the test groups determined by Two-Way ANOVA (A-E) and One-Way ANOVA (F) adopting Holm-Sidak post-hoc multiple comparisons. Next, I investigated what effect norflurazon treatment would have in the foliar carotenoid content of ziso and crtiso, mutants that impair cis-carotene isomerase activity, and PSY overexpressing lines. In agreement with earlier results, norflurazon treatment reduced the level of all carotenoids in both leaf types, however, that of young leaves was drastically reduced to the level of old leaves or even below (Figure
5.11). Both leaf types from WT, ziso, lut2, and PSY-OE rosettes treated with norflurazon showed no significant difference in total carotenoid content, except for crtiso, which reduced the total carotenoid content nearly 20% in younger leaves compared to older (Figure 5.11 G, H). Indeed, individual carotenoids demonstrated a different degree of reduction after 24 h norflurazon treatment. Lutein content was reduced to the level of old leaves in WT, ziso, and PSY-OE, whereas that of crtiso was significantly lower in young leaves (Figure 5.11 A). In old leaves too, β-carotene content was reduced considerably, but to a lesser extent, compared to young leaves
(Figure 5.11 B). Unlike lutein, β-carotene content was drastically reduced below the level of old leaves in young leaves regardless of the genotypes (Figure 5.11 B) indicating a rapid degradation of β-carotene. Likewise, violaxanthin, which is enriched in crtiso and lut2 leaves (Figure 5.5 C and5.7 C), showed a more significant reduction in young leaves of all genotypes (Figure 4.11 C). The neoxanthin content was also decreased to the level of old leaves in norflurazon treated plants (Figure 5.11
D). As expected, antheraxanthin and zeaxanthin were present in crtiso and lut2 leaves.
However, the presence of zeaxanthin in both leaf types of WT, ziso, and PSY-OE and antheraxanthin in both leaf types of ziso, and PSY-OE was unexpected.
The accumulation of zeaxanthin and antheraxanthin in all genotypes including
WT-control, which are usually not detected in Arabidopsis WT plants under non- stress conditions (Figure 5.5), indicates as if norflurazon treated plants triggered 168 stress-responsive pathways too, plausibly drought-responsive or wounding due to the removal of rootstock from the rosette. Intriguingly, norflurazon treatment was ineffective in reducing both zeaxanthin and antheraxanthin levels, and all genotypes demonstrated a typically higher level of both xanthophylls in young leaves (Figure
5.11 E, F). Collectively, these data reinforce that norflurazon treatment reduces the foliar carotenoid content, specifically β-carotene and violaxanthin in young leaves, which undergo rapid cell division and plastid biogenesis. The significant reduction in
β-carotene in younger leaves highlights a higher turnover rate for β-carotene in young dividing cells. The older leaves were rather resilient, compared to young, to changes in carotenoid content after exposure to norflurazon.
169
Figure 5.11 Norflurazon induced changes in foliar carotenoid content in the carotenoid pathway altered genotypes.
(A) Lutein, (B) β-carotene (C) Violaxanthin, (D) Neoxanthin, (E) Antheraxanthin, (F) Zeaxanthin, (G) Total carotenoids, and (H) Difference (%) in total carotenoid content in young leaves compared to old leaves from the norflurazon treated plants. Arabidopsis trays were kept in the dark for 4-5 hours before transferring Arabidopsis plants to the norflurazon plates. Norflurazon treatment was conducted under continuous light at 22 oC. The early
170 emerged (leaf 1-2, old) and recently emerged leaf (leaf 9-11, young) samples from the norflurazon treated plants were collected after 24 hrs incubation, and carotenoid content was measured using HPLC. Plots represent the mean values with the standard error of means (n=4) from a representative dataset of the two independent experimental repetitions. Letter codes indicate the level of statistical variation (p<0.05) in carotenoid content within and across the test groups determined by Two-Way ANOVA and One-Way ANOVA (Figure H) adopting Holm-Sidak post-hoc multiple comparisons. 5.3.9 Darkness and temperature fluctuations alter both phytoene and downstream carotenoid accumulation in young leaves Light and temperature are the critical environmental conditions affecting carotenogenesis. Exposure to low temperature and extended darkness can affect plastid biogenesis, chloroplast differentiation, and chloroplast size (Possingham,
1980). In this connection, I aimed to examine if extended dark period and different temperatures (cold and warm) would prevent the norflurazon induced phytoene accumulation in young and old leaves of Arabidopsis. Interestingly, phytoene accumulation was not reported in none of the leaves from the norflurazon treated
Arabidopsis rosettes incubated under continuous darkness, which was contrasting to the continuous light-exposed plants that demonstrated a typical leaf-age related variation in foliar phytoene levels after norflurazon treatment (Figure 5.12 A).
Absence of phytoene in the dark incubated Arabidopsis leaves demonstrated a shutdown of the carotenoid biosynthesis in leaves during darkness. This was in concert with the absence of phytoene accumulation in the norflurazon treated
Capsicum annum leaves incubated under dark condition (Simkin et al., 2003). In photosynthetic tissues, localisation of active PSY occurs in thylakoids under light exposure while remaining inactive in the absence light (Welsch et al., 2000), which corroborates the absence of phytoene in the dark exposed norflurazon treated
Arabidopsis leaves (Figure 5.12 A). In contrast, it is intriguing that non- photosynthetic tissues can continue phytoene biosynthesis during darkness such as etiolated seedlings and seed-derived calli (Welsch et al., 2000), which confirms the tissue-specific regulation of PSY activity and carotenogenesis in the absence of light.
171
I next asked what effects the higher and lower temperature would have on phytoene accumulation in Arabidopsis leaves under continuous light. Interestingly, a higher temperature (32 oC as opposed to 22 oC) significantly increased phytoene levels in both leaf types, yet an age-dependent decline in phytoene was still apparent in older leaves (Figure 5.12 B). In contrast, incubation of rosettes at 7 oC for 24 hours decreased the phytoene accumulation by 3- to 6-fold in both leaf types compared to leaves from the rosettes incubated at22 oC (Figure 5.12 C). Taken together, phytoene biosynthesis appears tightly linked to environmental factors such as darkness and temperature fluctuation that can plausibly impair plastid biogenesis and/or differentiation. The transcription of PSY was not rate-limiting in the phytoene biosynthesis and carotenogenesis in response to the developmental and environmental cues in leaves (Figure 5.9 and 5.11). Alternatively, isoprenoid substrate supply into the carotenoid pathway could also be affected by these environmental factors which would limit phytoene biosynthesis in both leaf types, and it is open to discovery.
Figure 5.12 Phytoene content in the young and old leaves of Arabidopsis treated with norflurazon under different temperature and light conditions.
(A) Effect of warmer temperature (32 oC) on phytoene accumulation, (B) Effect of non- freezing cold (7 oC) on phytoene accumulation, and (C) Effect of dark condition on phytoene accumulation. The three-week-old long photoperiod (16/8h, light/dark, 22/18 oC temperature) grown Arabidopsis rosettes were treated with norflurazon (50 μM) for 24 hours at 22 oC (NFZ-22) or 32 oC (NFZ-32) or 7 oC (NFZ-7) under continuous light or dark (as indicated). The milliQ water was added in control sets such as H2O-22, H2O-32, H2O-7, and H2O-Light. Arabidopsis trays were kept in the dark for 5 hours before transferring plants to norflurazon plates. For norflurazon treatment under darkness, dark-adapted plants were transferred to norflurazon plates under the green light. The early emerged (leaf 1-2, old) and recently emerged leaf (leaf 9-11, young) samples were collected after 24 hours, and carotenoid content
172 was measured using HPLC. Plots represent the mean values with the standard error of means (n=4) from a representative dataset of the two independent experimental repetitions. Letter codes in plots indicate the level of statistical difference (p<0.05) in carotenoid content within leaf types across the treatment groups as determined by Two-Way ANOVA with Holm-Sidak post-hoc multiple comparisons. Next, I examined how the exposure to the extended darkness and different temperature conditions can affect the levels of foliar carotenoids in rosette leaves.
Strikingly, the level of all individual and total carotenoids in young leaves was decreased to the levels similar or below old leaves after dark and cold exposure for 24 hours (Figure 5.13 A, C), mimicking the trend caused by norflurazon treatment
(Figure 5.13 D). Perhaps β-carotene is susceptible to a higher rate of degradation, the levels of β-carotene in young leaves from the rosettes exposed to darkness, cold, and norflurazon treatments were significantly reduced to the level equal or lower to the old leaves (Figure 5.13 A, C, D). The violaxanthin content in young leaves was decreased below the level of old leaves from the norflurazon treated plants but not in the extended darkness and cold exposed plants (Figure 5.13 A, C, D). In old leaves, the levels of lutein and neoxanthin remained unchanged in dark exposed plants, whereas that of β-carotene and violaxanthin and, therefore, total carotenoid content decreased significantly compared to the light-exposed plants (Figure 5.13 A). The level of violaxanthin content was also reduced in old leaves of the continuous dark and cold exposed plants compared to the light, and 22 oC exposed plants, respectively
(Figure 5.13 A, C). The warmer temperature such as 32 oC is hugely stressing for
Arabidopsis growth, however, did not have any effect on individual or total carotenoid content in any leaf type (Figure 5.13 B) despite nearly 60 % increase in phytoene accumulation in both young and old leaves compared to 22 oC exposed plants (Figure 5.12 B).
While the level of all individual carotenoids in young leaves of darkness, cold, and norflurazon treated plants was reduced substantially, the differential level of
173 reduction in young and old leaves demonstrates the stochastic response of carotenoids toward environmental perturbations. Also, the dramatic changes in carotenoid content in young leaves relative to a subtle or no change in older leaves exposed to darkness and cold indicates an active link between the developmental state of leaves and chloroplasts, therefore, carotenoid biosynthesis. These data corroborate the findings above showing that norflurazon can impair plastid biogenesis in the rapidly dividing cells in younger leaves as compared to more mature cells that can maintain a steady- state of carotenoid pool in older leaves. Perhaps the regulation of carotenogenesis in response to the extended darkness, cold, and norflurazon, particularly in young leaves, can follow similar or different mechanisms, which needs further exploration.
174
Figure 5.13 Carotenoid content in young and old leaves of Arabidopsis exposed to different temperature and light conditions.
(A) dark, (B) 32 oC, (C) 7 oC, and (D) norflurazon. The three-week-old long photoperiod (16/8 h, light/dark, 22/18 oC temperature) grown Arabidopsis rosettes were detached from the 175 rootstock and transferred to the Petridish containing a moistened paper (10 ml milliQ water or norflurazon (50 μM)/plate). Five petridishes each comprising 3-4 rosettes were transferred to 22 oC (control) or 32 oC or 8 oC under continuous light for 24 hours, and another set was transferred to the continuous dark at 22 oC. Arabidopsis trays were kept in the dark for 5 hours before transferring plants to the petridishes. After 24 hours, early emerged (leaf 1-2, old) and recently emerged leaf (leaf 9-11, young) samples were collected from all test groups and carotenoid content was measured using HPLC. Plots represent the mean values with the standard error of means (n=4) from a representative dataset of the two independent experimental repetitions. Letter codes in plots indicate the level of statistical variation (p<0.05) in carotenoid content within leaf types across the treatment groups as determined by Two-Way ANOVA with Holm-Sidak post-hoc multiple comparisons. 5.3.10 Dark and cold treatment alters carotenoid composition The wild type Arabidopsis leaves usually comprise approximately 45-50 % lutein, 20-25 % β-carotene, 10-15 % neoxanthin and 10-15 % violaxanthin when grown under stress-free environmental conditions (Pogson et al., 1996; Ruiz-Sola and
Rodriguez-Concepcion, 2012). In agreeance with previous studies (Pogson et al.,
1996), the proportions of lutein, β-carotene, violaxanthin, and neoxanthin were nearly
50 %, 28 %, 13 %, and 9 % respectively in old leaves under normal growth conditions
(Figure 5.14 A-D, control panels). However, there were significant differences in the proportions of foliar carotenoids in younger leaves compared to old leaves. The proportions of lutein and violaxanthin were significantly higher (~54 % and ~15 %), whereas β-carotene proportion was as low as 20 % in young leaves and neoxanthin proportion remain unchanged in both leaf types (Figure 5.14 A-D, control panels).
The reduction in lutein proportion with a concomitant increase in β-carotene proportion in old leaves compared to young leaves indicated an age-dependent re- direction of pathway flux from the α- to β-branch carotenoid biosynthesis corroborating the significant increase and decrease in LCYB and LCYE expression respectively, in aging leaves (Figure 5.1 D).
Next, I explored how an extended period of darkness (up to 24 h), alteration in temperature (warm; 32 oC, cold; 7 oC), and norflurazon treatment would affect the foliar carotenoid composition relative to the control leaves incubated under ambient growth conditions. Interestingly, lutein and β-carotene proportions were increased and 176 decreased, respectively, in both leaf types in response to continuous darkness for 24 h compared to the constant (24 h) light exposed leaves (Figure 5.14 A). There was a subtle reduction in violaxanthin proportion in old leaves, whereas that in the young leaves and neoxanthin proportion in both leaf types was unchanged under dark exposure (Figure 5.14 A). A warmer temperature (32 oC) did not affect the relative proportions of all four carotenoids regardless of the leaf type (Figure 5.14 B).
However, cold treatment (7 oC) substantially decreased the proportion of violaxanthin with the corresponding increase in lutein proportion in both leaf types (Figure 5.14
C). However, β-carotene and neoxanthin proportions were unchanged in both leaf types under cold exposure (Figure 5.14 C). These data demonstrate the variable impact of environmental perturbation on the different carotenoid species.
Finally, I investigated how inhibiting phytoene desaturase activity using norflurazon treatment would affect the proportion of foliar carotenoids in both leaf types. Like darkness and cold, lutein and neoxanthin proportions were increased in norflurazon exposed young leaves, whereas both were unchanged in old leaves
(Figure 5.14 D). In contrast, the β-carotene proportion in both leaf types and violaxanthin in young leaves was significantly decreased (Figure 5.14 D).
Norflurazon had the greatest impact in affecting foliar carotenoid composition in younger leaf tissues, which agrees with the previous observations (Figure 5.13).
Collectively, older leaves can maintain a steady-state level of plastid turnover and pigments in response to environmental changes demonstrating that young leaves are amenable to fine-tune carotenoid homeostasis when exposed to environmental conditions that perturb plastid development.
177
Figure 5.14 Proportions of the major foliar carotenoids in young and old leaves of Arabidopsis exposed to the different conditions of light, temperature and norflurazon.
(A) dark, (B) 32 oC, (C) 7 oC, and (D) norflurazon. The three-week-old long photoperiod (16/8 h, light/dark, 22/18 oC temperature) grown Arabidopsis rosettes were detached from the rootstock and transferred to the petridish containing a kimwipe paper moistened with 10ml water or norflurazon (50 μM)/plate. Five petridishes each comprising 3-4 rosettes were 178 transferred to 22 oC (control) or 32 oC or 7 oC under continuous light for 24 hours, and another set was transferred to the continuous dark at 22 oC. Arabidopsis trays were kept in the dark for 5 hours before transferring plants to the petridishes. Norflurazon treatment was conducted in continuous light. After 24 hours, early emerged (leaf 1-2, old) and recently emerged leaf (leaf 9-11, young) samples were collected from all test groups, and carotenoid content was measured using HPLC. Plots represent the mean values with the standard error of means (n=4) from a representative dataset of the two independent experimental repetitions. Letter codes in plots indicate the level of statistical variation (p<0.05) in carotenoid content within leaf types across the treatment groups as determined by Two-Way ANOVA with Holm-Sidak post-hoc multiple comparisons. 5.3.11 Chlorophyll content declines similar to carotenoids during leaf maturation Changes in carotenoid content are usually closely coordinated with the chlorophyll content as both pigments are tightly integrated into photosystems within thylakoids and packaged in a balanced ratio in chloroplasts. I firstly quantified the changes in chlorophyll content in mutants that impair carotenoid biosynthesis. Like carotenoids, the level of total chlorophyll, Chl a, and Chl b decreased significantly in older leaves from WT and most of the mutants (Figure 5.15 A-D). In contrast, younger leaves of crtiso displayed the significantly reduced chlorophyll content, which was similar to that of older leaves of both crtiso and WT (Figure 5.15 A-D).
The decreased level of chlorophyll content in young leaves of crtiso resembled the changes in total carotenoid content during leaf maturation (Figure 5.5). Like carotenoids, overexpression of CRTISO enhanced chlorophyll content in young leaves, whereas that of old leaves was unaffected (Figure 5.15 A-C). While the loss in
ZISO function (ziso) did not impact chlorophyll content in young or old leaf types, the percentage reduction in chlorophyll content during leaf maturation was marginally lower, keeping in agreement with previous observations where ziso caused a slight decline in the carotenoid content in younger leaves (Figure 5.3). Like carotenoids, overexpression of PSY did not affect the chlorophyll content regardless of the leaf type (Figure 5.15 A-C). The reduction in the level of chlorophyll pool in old leaves compared to young leaves indicates a common factor governing the level of both carotenoids and chlorophylls in Arabidopsis leaves.
179
I next quantified the changes in chlorophyll a/b (Chl a/b) and chlorophyll/carotenoid (Chl/Car) ratios in both young and old leaves of mutants that impair carotenoid biosynthesis to interrogate the level of pigments with the functional state of leaves. Like WT, both Chl a/b and Chl/Car ratios were higher in older leaves, regardless of the mutant background, despite the reduced levels of both chlorophylls during leaf maturation in crtiso plants (Figure 5.15 D, E, F). Interestingly, Chl/Car ratio was significantly increased in the young leaves of crtiso compared to WT, whereas remained unchanged in old leaves (Figure 5.15 F). Overall, the reduced level of chlorophyll content in fully expanded leaves follows an identical trend to that of carotenoids across the different genotypes. Therefore, a common factor controlling chloroplast development could impact both carotenoid and chlorophyll accumulation simultaneously during leaf aging.
180
Figure 5.15 Chlorophyll content in young and old leaves of carotenoid biosynthetic pathway impaired and overexpression lines of Arabidopsis.
(A) Chlorophyll a content, (B) Chlorophyll b content, (C) Total chlorophyll content, (D) Difference in chlorophyll content (%) in young leaves compared to old leaves (E) Chlorophyll a/b ratio, and (F) Total chlorophyll / Total carotenoid ratio. The leaf#3 samples were collected on day 14 (young) and day 29 (Old) after stratification (DAS), and chlorophyll content was measured using HPLC. Plots represent the mean values with the standard error of means (n=4) from a representative dataset of the two independent experimental repetitions. Letter codes in plots indicate the level of statistical variation (p<0.05) in the respective test parameter within leaf types across the germplasm as determined by Two-Way ANOVA adopting Holm-Sidak post-hoc multiple comparisons. ziso and crtiso are loss of function mutants in ζ-CAROTENE ISOMERASE and CAROTENOID ISOMERASE respectively. PSY- OE and CRTISO-OE lines are 35S::AtPSY line#23 (Maass et al., 2009) and 35S::AtCRTISO (Cazzonelli et al., 2010). Tot chl, Total chlorophyll content; Tot car, Total carotenoid content; chl a, chlorophyll a; chl b, chlorophyll b. 181
5.3.12 Environmental factors alter chlorophyll content as carotenoids during leaf maturation I reasoned that if chlorophyll and carotenoid content changed in WT and carotenoid mutants correspondingly, different environmental treatments could have similar effects on the chlorophyll content and functional relationship between chlorophyll and carotenoid ratios. To test this, I quantified chlorophyll contents in both young and old leaves from the Arabidopsis rosettes exposed to extended dark, temperature variation (warm and cold) as well as norflurazon treatment. Like carotenoids, dark, cold, and norflurazon treatments decreased both Chl a and b content, therefore, total chlorophyll content in young leaves to the levels as old leaves
(Figure 5.16 A, C, D). The warm temperature (32 oC) caused a subtle yet significant decrease in the level of chlorophyll content in young leaves; however, the effect was lower than in dark, cold, and norflurazon (Figure 5.16 B). As observed in carotenoids, both Chl a and b content of the old leaves was unaffected regardless of the treatment conditions (Figure 5.16 A-D). Interestingly, unlike the light-grown plants, Chl a/b ratio of dark exposed plants was similar in both young and old leaves indicating a pronounced effect of the darkness in regulating photosynthetic pigment homeostasis in leaves. Like normally grown plants, relatively lower Chl a/b ratio in young leaves was unaffected in cold, warm, and norflurazon treated leaves (Figure 5.16 B-D). In summary, environmental perturbation affected the chlorophyll content as of carotenoids, indicating that cold, darkness, and norflurazon can affect plastid biogenesis in young leaves undergoing cell division and expansion.
182
Figure 5.16 Chlorophyll content in young and old leaves of Arabidopsis exposed to different light and temperature conditions and norflurazon.
(A) dark, (B) 32 oC, (C) 7 oC, and (D) norflurazon. The three-week-old long photoperiod (16/8 h, light/dark, 22/18 oC temperature) grown Arabidopsis rosettes were detached from the
183 rootstock and transferred to the petridish containing a kimwipe paper moistened with 10 ml water or norflurazon (50 μM)/plate. The soil-grown intact plants were kept in the dark for 5 hours before transferring rosettes to the perishes. The dark-adapted plants were transferred to the petridishes under the green light conditions. Five petridishes each comprising 3-4 rosettes were transferred to 22 oC or 32 oC or 7 oC under continuous light for 24 hours, and another set was transferred to the continuous dark at 22 oC. Norflurazon treatment was conducted under continuous light at 22 oC. After 24 hours, early emerged leaf (leaf 1-2, old) and recently emerged leaf (leaf 9-11, young) samples were collected from all test groups. Carotenoid and chlorophyll content was measured using HPLC. The chlorophyll concentration was determined in terms of microgram per gram fresh weight (μg/gfw) of the leaf tissue. Plots represent the mean values with the standard error of means (n=4) from a representative dataset of the two independent experimental repetitions. Letter codes in plots indicate the level of statistical variation (p<0.05) in the respective test parameters within leaf types across the treatment groups as determined by Two-Way ANOVA adopting Holm-Sidak post-hoc multiple comparisons. I next examined whether Chl/Car ratios in young and old leaves were different in Arabidopsis plants exposed to short-term environmental perturbations.
Interestingly, Arabidopsis plants exposed to continuous light, dark, 32 oC, and 7 oC for 24 hours demonstrated the age-dependent changes in Chl/Car ratios. Under 22 oC temperature and constant light for 24 hours, the ratio of total Chl/Car was similar in both young and old leaf types (Figure 5.17 B, C, D) except significantly higher
Chl/Car ratio in the old leaves from one of the experimental replicates (Figure 5.17
A). At the level of individual carotenoids, Chl/Lut and Chl/Vio ratios were significantly lower (Figure 5.17 A-D), whereas Chl/β-car ratio was higher in young leaves and Chl/Neo ratio was similar in both leaf types under normal conditions
(Figure 5.17 A-D). Like Chl a/b ratio, the differential Chl/Car ratios in young and old leaves indicate the state of leaf maturity altering the functional homeostasis of both chlorophyll and carotenoid pool in leaves.
The exposure of Arabidopsis rosettes to continuous darkness, high and low temperature, and norflurazon demonstrated that the ratio of total and individual carotenoids, relative to the total chlorophyll content, was significantly changed in young, but not older, leaves. In the darkness, cold, and norflurazon exposed plants, the ratios of all four carotenoids to the total chlorophyll content were increased in young leaves in comparison to the control plants exposed to the continuous light and 184
22 oC temperature (Figure 5.17 A, C, D). Among others, norflurazon caused the most pronounced increase in the ratios of all four carotenoids (Figure 5.17 D). In contrast, all carotenoids to chlorophyll ratios were decreased in the young leaves of high temperature exposed plants, which was corresponding to the decrease in chlorophyll content, but unchanged carotenoid content (Figure 5.17 B). Strikingly, all Chl/Car ratios were unaffected in old leaves regardless of the environmental treatments
(Figure 5.17 A-D) except a significant increase in Chl/Vio ratio in the cold exposed old leaves (Figure 5.17 C). Taken together, both carotenoid and chlorophyll contents, ratios and composition followed a similar trend in young leaves in response to environmental and chemical perturbations. Old leaves appeared more resilient in maintaining both carotenoid and chlorophyll composition and ratios, indicating that the state of chloroplast development is likely to play a crucial role in determining the overall pigment levels in foliar tissues during leaf maturation in Arabidopsis.
185
Figure 5.17 Carotenoid to total chlorophyll ratio in response to leaf age and environmental treatments.
(A) dark, (B) 32 oC temperature, (C) 7 oC temperature, and (D) norflurazon. The three-week- old long photoperiod (16/8 h, light/dark, 22/18 oC temperature) grown Arabidopsis rosettes were detached from the rootstock and transferred to the petridish containing a kimwipe paper 186 moistened with 10 ml water or norflurazon (50 μM)/plate. The soil-grown intact plants were kept in the dark for 5 hours before transferring rosettes to the petridishes. The dark-adapted plants were transferred to the petridishes under the green light conditions. Five petridishes each comprising 3-4 rosettes were transferred to 22 oC or 32 oC or 7 oC under continuous light for 24 hours and another set was transferred to the continuous dark at 22 oC. Norflurazon treatment was conducted under continuous light at 22 oC. After 24 hours, early emerged leaf (leaf 1-2, old) and recently emerged leaf (leaf 9-11, young) samples were collected from all test groups. Carotenoid and chlorophyll content was measured using HPLC and ratios were calculated. Plots represent the mean values with the standard error of means (n=4) from a representative dataset of the two independent experimental repetitions. Letter codes in plots indicate the level of statistical variation (p<0.05) in the respective test parameters within leaf types across the treatment groups as determined by Two-Way ANOVA adopting Holm-Sidak post-hoc multiple comparisons. Chl; Chlorophyll, Car; Carotenoid, Lut; Lutein, β-car; β- carotene, Vio; Violaxanthin, Neo; Neoxanthin. 5.4 Discussion
Leaf development accommodates a plethora of structural and functional changes at the cellular, physiological, and morphological level. In Arabidopsis, many developmental attributes of leaves are controlled at the level of vegetative phase such as leaf morphology (Boyes et al., 2001), emergence of abaxial trichomes (Kerstetter and Poethig, 1998; Poethig, 2013), and the structure of phloem parenchyma cell walls
(Tsukaya et al., 2000; Nguyen et al., 2017). Arabidopsis leaves change their phase identity as the plants grow. Seedlings emerge with cotyledons (embryonic leaves), which subsequently produce the true leaves forming a rosette. The first two pairs of rosette leaves are, usually, considered as the juvenile leaves, which are round in shape with long petiole and lack abaxial trichomes. The following 1-2 pairs of leaves represent the transition phase, and later-emerged rosette leaves are adult phase leaves, which are elongated in shape with abaxial trichomes (Poethig, 1997; Nguyen et al.,
2017). Strikingly, all leaves retain ontogenic phase identities throughout their lifespan regardless of a wide range of developmental changes from young through maturation to the senescence (Nguyen et al., 2017). During the leaf development, many notable changes occur at cellular and subcellular level regardless of the leaf phase such as the rapid cell division in recently emerged and younger leaves progresses with an extensive cell expansion leading to the leaf maturation. Accompanying cellular
187 changes are the differentiation and development of chloroplasts such that the mature chloroplasts in a mature leaf become conspicuously larger and comprise fully developed thylakoid network (Gonzalez et al., 2012; Gugel and Soll, 2017). While pieces of evidence available linking chlorophyll biosynthesis and plastid development, the control over carotenoid homeostasis during leaf development remains unclear.
In leaves, carotenogenesis is tightly associated with the biogenesis, differentiation, turnover, and operational control of chloroplasts. There are intrinsic developmental and external environmental cues that can affect chloroplast development and functions, including pigment biosynthesis and accumulation during leaf development (Rudowska et al., 2012; Jarvis and Lopez-Juez, 2013). For example, leaf senescence triggers chloroplast disintegration, decreases chlorophyll content, and alters the composition of photosynthetic complex consequently decreasing the photosynthetic efficiency of the leaf (Matile et al., 1999; Lim et al., 2007; Nath et al.,
2013).
The foliar carotenoid content needs to be well balanced during cell division and plastid biogenesis to ensure an optimum composition that maintains a steady-state of photosynthesis in leaves until the onset of senescence (Biswal, 1995). The carotenoid content has been shown to decrease with the onset of leaf senescence, as observed in tobacco (Whitfield and Rowan, 1974), which is mostly due to the disintegration of chloroplasts (Lim et al., 2007) and enzymatic oxidation of carotenoids (Rottet et al.,
2016). In concert with Stessman et al. (2002), I observed, in Chapter 2, surprisingly high level of foliar carotenoids (>60%) in recently emerged younger leaves, which was declined during leaf maturation (Dhami et al., 2018). This data opened the
188 questions regarding what processes might control carotenoid homeostasis orchestrating the leaf developmental changes and environmental perturbations.
I performed molecular and metabolic analysis using a wide array of carotenoid genetic mutants, overexpression lines, and chemical inhibitors of carotenogenesis to unveil the mechanism that underpinned the accumulation of strikingly higher level of foliar carotenoids in young leaves and gradual decline during leaf maturation. I undertook the following scenarios into consideration to interrogate the carotenoid profile from the different genotypes and in response to environmental and chemical perturbations. i) how does the difference in plastid structure, size, and density in immature and mature cell types affect photosynthetic pigment biosynthesis and accumulation in leaves? ii) how can younger leaves comprising poorly developed chloroplasts synthesise and/or accumulate high levels of carotenoids and vice versa in older leaves? iii) how do leaf developmental phase (ontogenic) identities impact foliar carotenoid pool during leaf maturation? iv) how do carotenoid biosynthesis and degradation pathways equilibrate to maintain the functional state of carotenoid pool in young and mature leaves? v) what impacts do apocarotenoid and retrograde signals impose to chloroplast differentiation and disintegration during leaf maturation? vi) are there differences in chloroplast operational control between young and old leaves impacting photosynthetic pigment homeostasis? vii) are their differences in isoprenoid substrate supply into the carotenoid pathway altering steady-state thresholds of foliar carotenoid pool in young and old leaf types. The following sections address the likelihood of above scenarios in the context of how mutants and overexpression lines together with the chemical and environmental treatments, individually or in a concert, finetune the content, ratios, and composition of both carotenoid and chlorophyll in Arabidopsis leaves undergoing a series of structural and functional changes during maturation.
189
5.4.1 Leaf developmental phase identities do not affect the foliar carotenoid content The morphometrics and molecular biology of leaf vegetative phase transition have been rigorously studied in Arabidopsis revealing some miRNAs and SPL transcription factors which control juvenile to adult and vegetative to reproductive phase transitions (Xu et al., 2016; Guo et al., 2017). Interestingly, miRNA156 has been shown to not only control leaf vegetative phase transition by guiding the regulation of SPL15, but increased carotenoid content in the seeds of miRNA156 overexpressing Arabidopsis (Wei et al., 2012) and B. napus (Wei et al., 2010). The molecular mechanism for miR156 and SPL transcription factors in guiding the regulation of carotenogenesis remain unknown. In chapter 2, I demonstrated that cotyledon, juvenile, and adult phase leaves had higher carotenoid content when they were younger, however, among the different phase leaves, carotenoid content was higher in the youngest adult phase leaves compared to the youngest cotyledons or juvenile leaves (Dhami et al., 2018), indicating that the developmental phase identity could affect carotenoid accumulation in Arabidopsis leaves. Here, I revealed that even though there was a 4-14-fold higher transcript abundance of SPL15 in young leaves compared to old (Figure 5.1 C-D), the loss-in-function of spl15 did not affect foliar carotenoid content. Similarly, overexpression of miR156, which would be expected to reduce the SPL15 protein levels, showed a typical age-dependent decrease in carotenoid content in old leaves (Figure 5.2). Likewise, the decline in carotenoid content in fully expanded leaves was unaffected in spl15 mutant or miR156 overexpression lines that control leaf vegetative phase development. As such, changes in leaf developmental phase identities do not appear to play a role in controlling foliar carotenoid content during Arabidopsis leaf development.
190
5.4.2 Enzymatic degradation is not responsible for declining carotenoid content in older leaves The enzymatic and non-enzymatic degradation of various carotenoids produces a wide array of apocarotenoids that perform many novel biological functions in plants including developmental programming and environmental stress acclimation (Beltran and Stange, 2016; Hou et al., 2016). The enzymatic oxidation of β-carotene is the main route of carotenoid turnover in plants (Beisel et al., 2011), whereas the linear chain carotenes such as phytoene, phytofluene, and prolycopene and xanthophylls are relatively stable against oxidative cleavage (Harrison and Bugg, 2014; Schaub et al.,
2018). Among the known CCDs and NCEDs, CCD4 is a major negative regulator of
β-carotene content (Gonzalez-Jorge et al., 2013). Also, the number and size of plastoglobuli, which are the sites of CCD4 localisation and carotenoid degradation, are much larger in older leaves (Brocard et al., 2017) favouring carotenoid degradation as observed in the senescing leaves of Arabidopsis (Rottet et al., 2016).
The seed-derived callii of ccd1 and ccd4 accumulated a higher level of carotenoids than WT (Schaub et al., 2018) implicating the absence of enzymatic degradation of carotenoids. In agreement with the above evidence, the substantially higher transcript abundance of CCD4 (13-24 fold) and CCD1 (~2-fold in the older leaves (Figure 5.1
C-D) indicated that a higher rate of enzymatic degradation of carotenoids may be responsible for the decline in the foliar carotenoid levels during leaf maturation.
However, analysis of carotenoid content in single and double mutants of CCD1,
CCD4, and CCD7, as well as CCD4-OE plants, also demonstrated the age-dependent decline in all foliar carotenoids (Figure 5.3) confirming the fact that the age-related decline in carotenoid content in Arabidopsis leaves was independent of the CCD driven enzymatic cleavage. Also, plastoglobuli (PG) are the sites of CCD4 activity; therefore, the degradation of carotenoids (Rottet et al., 2016). However, a substantially higher level of carotenoids in young leaves of fib4 mutant, which is
191 impaired in plastoglobuli development (Figure 5.3), substantiate that the age- dependent decrease in foliar carotenoid content was independent of PG and CCD4. To rule out any redundancy among the multiple CCDs, I utilised D15 as a chemical inhibitor of CCD activity (Van Norman et al., 2014) to compare pigment levels in young and old cotyledons from the Arabidopsis seedlings treated with D15. The carotenoid content was substantially decreased in D15 treated cotyledons during maturation (Figure 5.4), corroborating the age-related decline in carotenoid content in leaves, hence, confirmed that the age-dependent decrease in carotenoid content was independent of CCD activity. The substantially higher CCD transcript levels in older leaves, compared to young, indicates the alternative functions of CCD4 in carotenoid turnover and apocarotenoid generation during the leaf maturation which needs further exploration.
5.4.3 Carotenoid and chlorophyll content are co-regulated during leaf maturation In plants, carotenoid biosynthesis is independent of the light availability as many carotenoids can accumulate in the non-photosynthetic tissues such as dark- grown cotyledons, fruits and roots (Rodriguez-Villalon et al., 2009). In leaves, light availability together with plant’s developmental transitions makes the carotenoid profile more diverse exhibiting a wide array of structural and conformational modifications (Fuentes et al., 2012). In contrast, light availability explicitly affects chlorophyll biosynthesis and chloroplast development as chlorophylls absorb and transform light energy into chemical energy-generating ATP and NADPH during photosynthesis (Croce and van Amerongen, 2014). The optimisation of chlorophyll pool can improve photosynthetic efficiency of leaves as evidenced in Arabidopsis (Jin et al., 2016). However, like carotenoids, age-dependent decrease in chlorophyll content (Figure 5.15 and 5.16) corroborates the previous reports demonstrating lower pigment pool in old leaves (Stessman et al., 2002; Stettler et al., 2009). The 192 concurrent reduction in the level of carotenoids and chlorophylls in the norflurazon treated young leaves (Figure 5.11 and 5.15) indicates a similar strategy controlling the biosynthesis of both carotenoids and chlorophylls. Likewise, similar effect of darkness and, warm and cold conditions on the level of both carotenoids and chlorophylls of young leaves (Figure 5.13, 5.15, and 5.16) substantiate that a common mechanism underpinning the decline in pigment content in older leaves.
The change in chlorophyll status, particularly Chl a/b ratio is an empirical measure conventionally used to determine the photosynthetic efficiency in response to the fluctuation in light intensity (Dale and Causton, 1992). The higher Chl a/b ratio corresponds with higher photosynthetic efficiency, as observed in Arabidopsis leaves
(Jin et al., 2016). However, higher Chl a/b ratio in old leaves (Figure 5.15) was contrasting to the predictions made by Jin et al. (2016) as the mature leaves of
Arabidopsis were photosynthetically less efficient than young leaves as revealed by
Stessman et al. (2002). Instead, higher Chl a/b ratio is much convincing indicator of the leaf level nitrogen limitation or N-translocation during the leaf maturation
(Kitajima and Hogan, 2003). It is obscure how the fully expanded (older) leaves achieve optimum photosynthetic efficiency as they comprise much lower chlorophyll and carotenoid content than young leaves, which needs further experimentation.
In contemporary research, the ratio of total chlorophyll and carotenoid content
(Chl/Car) has been increasingly utilised to predict the pigment dynamics and photosynthetic activity at the leaf or stand scale particularly in the evergreen trees
(Gamon et al., 2016). In conifers, for example, the Chl/Car ratio and photosynthetic rate both decreased synchronously during winter and recovered in summer indicating the usefulness of Chl/Car ratio to oversee pigment dynamics and photosynthetic activity in response to environmental alterations (Gamon et al., 2016). In young
193 leaves of Arabidopsis, Stessman et al. (2002) demonstrated the higher rate of photosynthesis corresponding to the high pigment and protein content in comparison to the old leaves. However, lower values of Chl/Car as well as Chl/Neo, Chl/Vio, and
Chl/Lut in young leaves of Arabidopsis as observed in this study (Figure 5.17) are, again, contrasting to the assumptions made by Gamon et al. (2016). Also, the similar
Chl/β-car ratio in young and old leaves (Figure 5.17) indicates the stochastic functional interaction of individual carotenoids and chlorophylls, perhaps in the leaf- age dependent manner. Likewise, the pronounced increase in Chl/Car ratio (total and individual) in young leaves, but not the old leaves, in response to norflurazon treatment (Figure 5.17) highlights the leaf age-dependent functional strategies to maintain the pigment homeostasis. The differential effect of darkness, cold and warm temperature, and norflurazon treatment on the Chl/Car ratios of young and old leaves
(Figure 5.17) substantiates the leaf-age dependent strategies regulating both carotenoid and chlorophyll pool in Arabidopsis leaves. Collectively, the concurrent reduction in both carotenoid and chlorophyll content in old leaves reveals that the cell and/or chloroplast density and developmental stages are likely to underpin the physiological requirements to accumulate the optimum amount of photosynthetic pigments, which needs to explore further.
5.4.4 CRTISO regulates a cis-carotene derived apocarotenoid signal that affects chloroplast development in young leaf tissues PSY is an evolutionarily conserved enzyme commencing carotenogenesis in all carotenogenic organisms (Dogbo et al., 1988; Han et al., 2015). The fact that the overexpression of PSY increased carotenoid content in seed-derived calli (Alvarez et al., 2016) and roots (Maass et al., 2009) of Arabidopsis, but not in leaves (Figure 5.5), demonstrated the tissue-specific regulation of PSY. As Arabidopsis genome comprises a single PSY gene, the tissue-specific regulation of PSY and, therefore, carotenogenesis can be regulated at the level of transcription (Maass et al., 2009; 194
Sugiyama et al., 2017), translation (Alvarez et al., 2016), and post-translation (Zhou et al., 2015; Ruiz-Sola et al., 2016). Also, The functional interactions of PSY and other regulatory proteins such as OR, GGPPS11, and Clp proteases can affect stability and efficiency of PSY (Zhou et al., 2015; Ruiz-Sola et al., 2016; Welsch et al., 2018). The similar level of PSY transcripts in both young and old leaves (Figure 5.1) and the same level of foliar carotenoids in young or old leaves of WT and PSY-OE (Figure
5.5) revealed that the age-related changes in the foliar carotenoid pool is independent of PSY transcription and/or PSY protein level.
The structural development of chloroplast plays a crucial role in compartmentalisation and functional activation of carotenogenesis regulatory enzymes as well as carotenoid accumulation within chloroplasts. Most importantly,
PSY localisation and activation occurs in thylakoid membranes and plastoglobuli
(Shumskaya et al., 2012). Also, light availability causes profound impacts on PSY localisation and activity such as the functionally inactive PSY accumulates in PLBs in etioplasts, and light exposure activates and relocates PSY to thylakoid membranes commencing carotenogenesis (Welsch et al., 2000). The substantially higher level of carotenoid and chlorophyll content in young leaves, regardless of the carotenoid metabolic pathway impaired mutants and overexpression lines (Figure 5.3 and 5.5), suggests chloroplasts from the actively dividing and expanding cells of young leaves can favour carotenogenesis and/or carotenoid accumulation compared to the fully developed chloroplasts from the fully expanded cells in the mature leaves.
Lutein and β-carotene are the major antenna carotenoids accounting for nearly
50 % and 25 % respectively, and both displayed age-dependent decrease as the leaves become older in the plants grown under normal environmental and genetic conditions.
Interestingly, etiolated seedlings, as well as the young leaves and floral buds of the
195 short photoperiod grown crtiso plants, accumulate cis-carotenes and both produce impaired PLBs perturbing plastid biogenesis (Park et al., 2002; Cazzonelli et al.,
2019). However, light exposure facilitates the photoisomerisation of tetra-cis- lycopene into all-trans-lycopene and restores both carotenogenesis and plastid development (Park et al., 2002). The similar or even higher level of phytoene accumulation in norflurazon treated crtiso leaves compared to the respective leaves from WT (Figure 5.9) demonstrates the regular supply of isoprenoid precursors and
PSY activity in crtiso leaves under light exposure. As the light exposure restores PLB formation and chloroplasts development in crtiso leaves (Park et al., 2002), restoration of WT-like carotenoid profile in crtiso leaves can be expected in long photoperiod-grown crtiso plants, at least in the mature leaves. In agreement with the photoisomerisation, the level of total carotenoid was restored to that of WT in old leaves of crtiso, however, the level of individual carotenoids mainly lutein was not restored (Figure 5.4).
Whilst traces of phytoene were observed in the young leaf tissues of long photoperiod grown crtiso plants, nearly 80 % and 60 % reduction in lutein content in young and old leaves respectively of crtiso, compared to WT, (Figure 5.5 and 5.6) suggests that photoisomerisation can restore PLB formation and chloroplast functioning but not the lutein biosynthesis. In old leaves, restoration of WT-like total carotenoid content, regardless of the reduced lutein, was compensated by the corresponding enrichment in β-chain carotenoids including β-carotene, zeaxanthin, antheraxanthin, and violaxanthin (Figure 5.5 and 5.6) implicating the metabolite flux shift into the β-branch of carotenoid biosynthesis attaining physiologically functional state of chloroplasts in mature leaves, under light exposed conditions. Intriguingly, unlike old leaves, young leaves of crtiso were functionally ineffective to resume either total or specific carotenoid content to the level of young leaves of WT (Figure
196
5.5 and 5.6). The substantially reduced but similar lutein content and marginally increased but same β-carotene content in both young and old leaves of crtiso supports the hypothesis that the change in carotenoid profile in crtiso leaves is independent of the ultrastructural changes or biogenesis of chloroplasts. Instead, these data reinforce the evolutionarily conserved function of CRTISO regulating carotenoid pathway flux into α- and β-carotenoids maintaining carotenoid homeostasis in photosynthetic tissues.
Downstream of CRTISO, the moderately higher transcript abundance of LCYE and LCYB in young and old leaves, respectively, (Figure 5.1 D) indicates that the differential rate of cyclisation of all-trans-lycopene into α- and β-carotenoids could affect the pathway flux in an age-related manner. Interestingly, the downregulation of
LCYE transcription in crtiso leaves coincides the reduction in the lutein content
(Cazzonelli et al., 2019). However, decrease in foliar carotenoids, both total and individual, in the old leaves from the mutants lacking lutein such as lut2, lut2 npq2, and aba4 npq1 lut2 (Figure 5.7) implicates the insufficient role of LCYE or xanthophyll pool determining the age-related changes in foliar carotenoid content.
Exploring what down-regulates the LCYE expression and lutein accumulation in light- grown crtiso leaves can provide the next level explanation to why photoisomerisation of tetra-cis-lycopene into all-trans-lycopene within the fully functional chloroplasts is unable to restore WT-like lutein level. Also, in WT, reduced LCYE and increased
LCYB transcripts in old leaves alludes the reduction and increase in lutein and β- carotene proportion in the old leaves (Figure 5.14). The inverse change in lutein and
β-carotene ratios in young and old leaves indicates the pathway flux shift toward β- carotenoids in old leaves potentially favouring the carotenoid turnover and apocarotenoid production, which needs further exploration.
197
The altered carotenoid profile in crtiso leaves provided the substantial evidence of carotenoid pathway flux shift into α- and β-branch carotenoid biosynthesis in both young and old leaves, however, a factor that controls the high and low level of carotenoid accumulation in young and old leaves, respectively, was still unclear.
Therefore, I asked whether the bacterial CAROTENOID ISOMERASE (CrtI) overexpression that bypasses the cis-carotene biosynthesis steps (Romer et al., 2000), can restore a WT-like carotenoid profile in crtiso background. However, a typical age-related decline in the level of carotenoids in CrtI overexpressing transgenic lines
(Figure 5.6) provided additional insights that the cis-carotene biosynthetic pathway including CRTISO are no longer responsible for regulating the age-dependent changes in foliar carotenoid pool. Nonetheless, a similar trend in the level of both carotenoid and chlorophyll in crtiso leaves implicates the developmental state of chloroplasts determines the foliar carotenoid pool during leaf maturation.
5.4.5 Young leaves synthesise a substantially higher level of phytoene The availability of isoprenoid precursors mainly GGPP produced via MEP pathway and active PSY are the prerequisites that determine the fate of carotenoid biosynthesis (Lois et al., 2000; Rodriguez-Concepcion et al., 2001). The protein- protein interaction of PSY and GGPPS11 strictly controls the allocation of GGPP toward the phytoene biosynthesis (Ruiz-Sola et al., 2016). Increase in IPP and
DMAPP by overexpressing DXS enhanced the carotenoid content in tomato (Lois et al., 2000; Rodriguez-Concepcion et al., 2001), carrot (Simpson et al., 2016), and
Corynebacterium glutamicum (Heider et al., 2014). Likewise, overexpression of a sweet potato GGPP synthase gene (IbGGPPS) in Arabidopsis increased the foliar carotenoid content (Chen et al., 2015). GGPPS11 also interacts with GGPPS12 controlling metabolite flux toward the terpenoid biosynthesis (Chen et al., 2015).
Interestingly, impairing GGPPS11, but not GGPPS12, reduced the carotenoid content
198 in Arabidopsis leaves (Chen et al., 2015) indicating GGPPS12 a less likely candidate affecting carotenoid biosynthesis. However, Chen and co-workers found that
GGPPS12 specifically interact with GGPPS11 facilitating monoterpene biosynthesis, particularly during flowering (Aharoni et al., 2003; Chen et al., 2003). Although
Arabidopsis leaves produce a little of terpenoids (Huang et al., 2010; Blanch et al.,
2015), higher transcript level (~5-fold) of GGPPS12 in old leaves (Figure 5.1) indicates a possibility of precursor channelling toward terpene biosynthesis, therefore, limiting the precursor availability for carotenoid biosynthesis as the leaves become older, which needs further exploration.
The isoprenoid substrate availability and PSY activity strictly control the rate of phytoene biosynthesis (Rodriguez-Villalon et al., 2009). The substantially higher (~3- fold) amount of phytoene accumulation in young leaves of WT Arabidopsis, in response to norflurazon treatment (Figure 5.9 C), revealed the enhanced biosynthesis of carotenoids in young leaves. Again, a similar level of phytoene accumulation in young or old leaves of WT and PSY-OE (Figure 5.9 A, C) confirmed that PSY transcription or PSY protein level does not affect carotenogenesis in an age-dependent manner in Arabidopsis leaves. Also, higher level of phytoene accumulation in the young leaves of ziso, crtiso, lut2, ccd4, ccd7, ccd4 ccd7, and CCD4-OE lines compared to the old leaves of the respective lines (Figure 5.9 A-D) disqualified all the speculations, which suggest carotenoid biosynthetic or enzymatic oxidation pathways as the potential modulators of carotenoid homeostasis during the Arabidopsis leaf maturation. Indeed, nearly 90 % and 60 % higher level of phytoene accumulation in young leaves of ziso and crtiso, respectively, compared to WT (Figure 5.9 A) was intriguing, which indicates a feedback upregulation of phytoene biosynthesis plausibly intended to compensate the perturbation in the pathway immediately after
PSY, which needs further exploration. Collectively, the higher level of phytoene
199 accumulation in young leaves in response to norflurazon treatment, regardless of the genetic background, demonstrates that young leaves of Arabidopsis, which comprise a high density of actively dividing cells and chloroplasts, are much efficient system for carotenoid biosynthesis and accumulation.
5.4.6 Plastid development in young leaves is highly sensitive to cold, darkness, and norflurazon In leaves, the carotenoid profile can be instantly finetuned to endure environmental alterations such as fluctuations in light (Couso et al., 2012) and temperature (Dumas et al., 2003) regimes. Intriguingly, a rapid decrease in the level of foliar carotenoids and chlorophylls of young leaves to the level of old leaves in the dark, cold, and norflurazon exposed plants (Figure 5.14) indicated the strong effect of environmental conditions altering chloroplast development and photosynthetic pigment biosynthesis and/or accumulation in an age-dependent manner. Despite lower phytoene and carotenoid levels, older leaves were highly resilient in maintaining the threshold level of the carotenoid pool, regardless of the darkness, cold, and norflurazon treatment. The mechanism of leaf-age dependent homeostasis of foliar carotenoids are unclear; however, a plausible scenario is that the darkness, cold, and norflurazon all can negatively affect chloroplast biogenesis in young leaves; therefore, both carotenoid and chlorophyll content was reduced. Alternatively, the downsizing of isoprenoid precursor pool or reduction in the precursor flux into the carotenoid biosynthesis in response to the darkness, cold, and norflurazon exposed leaves can limit the carotenogenesis in young and poorly developed chloroplasts.
In addition, some studies reported the functional modification of carotenoids such as glycosylation as observed in saffron (Li et al., 1999), cyanobacteria
(Mohamed et al., 2005; Graham and Bryant, 2009), bacteria (Takaichi et al., 1995), and actinomycetes (Richter et al., 2015). The glycosylated carotenoids are essential in
200 maintaining cell wall structures and thylakoid organisation as observed in a cyanobacterium Synechocystis (Mohamed et al., 2005). In young leaves, there is a possibility that the less developed thylakoid network in the incipient chloroplasts provide a less favourable environment to sequester the free carotenoids favouring a rapid glycosylation and/or esterification of carotenoids (Minguez-Mosquera and
Hornero-Mendez, 1994; Bunea et al., 2015) and apocarotenoids (Latari et al., 2015).
Taken together, it is plausible that darkness, cold, and norflurazon can hinder plastid biogenesis and ultrastructural development instantly in young leaves, in similar or different ways, affecting both biosynthesis and accumulation of both carotenoids and chlorophylls.
5.4.7 Young leaves provide a new model tissue to hunt for intracellular signals that control plastid biogenesis and carotenoid metabolism The dedicated pathways of carotenoid and chlorophyll biosynthesis are independent of each other; however, both rely on the availability of isoprenoid precursors and chloroplast development and functioning (Keller et al., 1998; Wang et al., 2014; Li et al., 2016; Simpson et al., 2016). Intriguingly, the level of both carotenoids and chlorophylls demonstrated a concurrent reduction during the leaf maturation (Figure 5.13 and 5.16) indicating a common factor that can control the level of both pigments. Light is essential for chloroplast biogenesis and chlorophyll biosynthesis in leaves but not for the carotenoid biosynthesis (Sun et al., 2018). Also, as observed in etiolated seedlings of crtiso, accumulation of cis-carotenes and/or cis- carotene derived apocarotenoids can regulate nuclear gene expression, therefore, chloroplast and leaf development (Avendano-Vazquez et al., 2014; Alagoz et al.,
2018). For example, the external application of β-cyclocitral, a common apocarotenoid derived from β-carotene, induces reprogramming of environmental stress-responsive genes and enhance photoprotection against high light stress (Ramel et al., 2012). In agreement with Park et al. (2002), substantial decrease in the level of 201 lutein with the corresponding increase in β-branch carotenoids (β-carotene, violaxanthin, antheraxanthin, and zeaxanthin) in crtiso leaves (Figure 5.5) indicates a crucial role of CRTISO in regulating pathway flux into the biosynthesis of α- and β- branch carotenoids. Also, accumulation of cis-carotenes that impair PLB formation in etiolated seedlings and the young leaves from the short photoperiod grown crtiso plants demonstrated a crucial role of CRTISO in plastid development and, therefore, biosynthesis and accumulation of both carotenoids and chlorophylls (Cazzonelli et al.,
2019).
The substantially higher level of carotenoid and chlorophyll content in young leaves and their sharp decrease during leaf maturation in a wide range of mutants and overexpression lines, with altered carotenogenesis, (Figure 5.2, 5.3, 5.5, and 5.6) was intriguing, which indicates different strategies regulating the level of foliar pigments in young and old leaves. Also, concurrent decrease in both carotenoid and chlorophyll content in young leaves, but not in old, in response to darkness, cold, and norflurazon treatment highlights that all three conditions may trigger same or different regulatory processes but hindering chloroplast development and pigment homeostasis in young leaves. In concert with Simkin et al. (2003), absence of phytoene accumulation in norflurazon-treated Arabidopsis leaves under darkness (Figure 5.12) demonstrates the light-dependent regulation of PSY and carotenogenesis in leaves. Complying with the norflurazon-induced inhibition of phytoene desaturation, therefore, phytoene accumulation (Figure 5.9), decrease in the level of other foliar carotenoids in response to the norflurazon treatment was expected, perhaps, in both leaf types. Interestingly, cold exposure neither blocks PSY (unlike darkness) nor PDS (unlike norflurazon) yet decreased the pigment level in young leaves, not old, as observed in the darkness and norflurazon exposed plants (Figure 5.13 C), which indicates that the developmental
202 state of chloroplast can influence the level of both carotenoids and chlorophylls in leaves.
The foliar pigment content generally corresponds with the cell and chloroplast densities in leaves such as higher cell and chloroplast density per unit area can result in higher chlorophyll content. The cell and chloroplast size and density are the significant structural changes that occur during leaf expansion, and both affect photosynthetic pigment biosynthesis and accumulation (Table 1.1). Previous studies demonstrated the presence of smaller cells with a high cell density and low chloroplast density per cell in young leaves and vice versa in the older leaves such as in Spinach (Possingham and Saurer, 1969). In Arabidopsis, the fully expanded cells of mature leaves comprise nearly 7-times more chloroplasts (~70) per cell than in young leaves (Stettler et al., 2009) and mature chloroplasts are substantially larger (Stettler et al., 2009; Gugel and Soll, 2017). However, being extensively expanded, the cell density is much lower in older leaves. Also, it is interesting to mention that the larger chloroplasts such as in arc12 mutants of Arabidopsis were photosynthetically less efficient and comprised the regular pigment pool (Xiong et al., 2017) indicating no role of the larger size of chloroplasts in determining photosynthetic efficiency and photosynthetic pigment pool.
The higher cell and chloroplast density is a plausible reason behind the higher pigment content in young leaves. In agreement with Stessman et al. (2002), the higher rate of photosynthesis and a higher level of proteins, and pigments corroborates with the higher cell density in young leaves as observed during the Arabidopsis leaf expansion (Gugel and Soll, 2017). This scenario also complies with the increase in cell density, enhancing the photosynthetic capacity of leaves (Lehmeier et al., 2017).
In Arabidopsis, the low cell density mutant (lcd) plants exhibit low palisade cell
203 density and reduced chlorophyll content with a pale green leaf phenotype (Barth and
Conklin, 2003). Whereas, gibberellin deficient mutants (ga1-3) with high cell and chloroplast densities accumulate significantly higher level of chlorophylls (Jiang et al., 2012). Complying with the above facts, it is reasonable that the quantitative functional attributes of leaf tissues, including photosynthetic pigments can represent the number of cells taken under examination. In unit tissue basis, higher cell density could result into higher chloroplast density, and, therefore, higher level of photosynthetic pigments, the additive effect, which is evident in young leaves compared to older leaves comprising fewer but larger cells per unit leaf tissue. The chloroplast density per unit leaf tissue could reach far higher values in young leaves due to the higher cell density, despite fewer chloroplasts per cell. Older leaves that comprise fewer but larger cells with more chloroplasts per cell may have overall lower chloroplast capacity per unit leaf tissue. The higher chloroplast density can enhance photosynthetic efficiency regardless of the chloroplast size as revealed in
Arabidopsis (Xiong et al., 2017), which support the hypothesis that young leaves can maintain high cell and chloroplast density, therefore, higher level of pigments per unit leaf tissue. Indeed, each cell and chloroplast can accommodate a limited number of chloroplasts and a threshold amount of pigments respectively, hence the pigment content in leaf tissue can be the function of the total number of cells and chloroplasts and the pigment content per chloroplast. Therefore, it is reasonable that the additive effect of the greater number of cells and chloroplasts (higher density) can result into the higher level of pigment content in young leaves and vice versa in the old leaves.
The development of a central vacuole is the most significant change occurring in a cell during leaf maturation that can occupy up to 90 % of the cell volume in mature leaves (Noguchi and Hayashi, 2014; Kruger and Schumacher, 2018). The vacuoles are not directly relevant to the carotenoid and chlorophyll biosynthesis, as
204 both are plastidial pigments, except an increase in cell size leading to a dilution effect.
The possibility of a dilution effect, due to the large vacuole, leading to a reduction in the level of carotenoids and chlorophylls in mature leaves has been negated by the higher level of both carotenoids and chlorophylls in the dry tissues from the young leaves compared to the old leaves of Arabidopsis (Dhami et al., 2018). The autophagocytosis of carotenoid-rich lipid droplets into vacuole was revealed in aging aeciospores of fungi, Puccinia distincta (Weber and Davoli, 2002). The size of the central vacuole may or may not have a role in determining the level of photosynthetic pigment content in plants, which demands a rigorous cellular and subcellular studies.
In young expanding leaves, dark exposure decreases cell density due to enhanced leaf expansion (Pantin et al., 2011), while cold exposure arrests leaf expansion favouring a little or no change in cell density (Rymen et al., 2007).
However, a decrease in carotenoid and chlorophyll content of the young leaves under both dark and cold conditions (Figure 5.13 and 5.16) is contrasting to the additive effect. Also, the differential patterns of the transcript abundance of carotenogenesis regulatory genes in young and old leaves (Figure 5.1) contrasts the hypothesis of an additive effect. If the cell-density dependent additive effect exists at the level of protein and pigment content in young leaves, the gene transcript abundance should also be higher in young leaves, regardless of the gene. Whatever the case can be, the determination of cell density and functional threshold of the pigment content in chloroplasts from both young and old leaves will shed light on the photosynthetic pigment homeostasis and functional efficiency of leaves.
In chloroplasts, GGPP is a common substrate for the biosynthesis of chlorophyll, carotenoids, and other plastidial metabolites such as plastoquinones, tocopherols, and gibberellins (Vranova et al., 2013). During chlorophyll biosynthesis,
205
GERANYLGERANYL DIPHOSPHATE REDUCTASE (CHLP) reduces GGPP into phytyl pyrophosphate and later esterifies with Clide generating phytyl chlorophyll or directly reduces GGPP into phytyl chlorophyll (Keller et al., 1998; Wang et al., 2014).
On the other hand, PSY catalyses the condensation of two GGPP molecules generating phytoene, which commences carotenogenesis (Dogbo et al., 1988; Schledz et al., 1996). Interestingly, the higher level of isoprenoid precursors particularly dimethylallyl diphosphate (DMADP) and isoprene emission was observed in the younger leaves of Arabidopsis that were constitutively transformed with the isoprene synthase gene from grey poplar (Populus × canescens (Loivamaki et al., 2007). The substantially higher (3-fold) accumulation of phytoene in young leaves of
Arabidopsis, regardless of the genetic background (Figure 5.8 and 5.9) and environmental conditions (Figure 5.12), indicates higher precursor availability and/or flux into the carotenoid biosynthesis in young leaves. However, the mechanism that controls precursor partitioning into the different competing pathways within chloroplasts during the leaf development needs further exploration.
The norflurazon, darkness and cold treatment stop or reduce photosynthesis
(Allen and Ort, 2001; Jung, 2004; Stitt and Zeeman, 2012), therefore, potentially reduces the metabolic precursor pool including isoprenoids. In contrary, CO2 enrichment increases the rate of photosynthesis as well as the level of carotenoids
(Dhami et al., 2018) and chlorophylls (Takatani et al., 2014) implicating metabolic precursor pool affecting photosynthetic pigment pool in leaves. The decrease in the level of both carotenoids and chlorophylls in young leaves in response to norflurazon, dark and cold treatment indicates that a common substrate, plausibly the GGPP or other isoprenoids, may become limited under the treatment conditions as all three treatment factors impair photosynthesis. Given that the GGPP is a substrate utilised for the synthesis of both carotenoids and chlorophylls, the leaf-age dependent change
206 in the level of both pigments corresponds with the modulation of isoprenoid precursor pool or the precursor flux into the respective pathways to maintain photosynthetic pigment homeostasis in leaves. Indeed, how short exposure (24 hours) of norflurazon, darkness, and cold can affect cell and plastid density, chloroplast ultrastructure, isoprenoid pool and, therefore, the pigment content, particularly in young leaves, needs further exploration.
The molecular regulatory networks of carotenoid biosynthesis, degradation and sequestration are rigorously studied in many plants including Arabidopsis (Ruiz-Sola and Rodriguez-Concepcion, 2012), maize (Liu et al., 2018), carrot (Rodriguez-
Concepcion and Stange, 2013), and tomato (Enfissi et al., 2017). In plants, plastid localized carotenoids themselves and their oxidative derivatives involve in a wide array of biological phenomena including retrograde signalling (Ramel et al., 2012;
Avendano-Vazquez et al., 2014), photomorphogenesis (Park et al., 2002), photosynthesis (Holt et al., 2005; Domonkos et al., 2013), photoprotection
(Magdaong and Blankenship, 2018), root and shoot branching (Gomez-Roldan et al.,
2008; Kapulnik and Koltai, 2014), and stress acclimation (Havaux, 2014). It is noteworthy to mention that the glycosylated carotenoids are essential in maintaining cell wall structure and thylakoid organisation as observed in a cyanobacterium
Synechocystis (Mohamed et al., 2005). The functional modification of carotenoids such as glycosylation is observed in different carotenogenic organisms including saffron (Li et al., 1999), cyanobacteria (Mohamed et al., 2005; Graham and Bryant,
2009), bacteria (Takaichi et al., 1995), and actinomycetes (Richter et al., 2015).
Arabidopsis leaves accumulate apocarotenoid glycosides with unknown functions
(Latari et al., 2015) indicating a potential role of glycosylation in maintaining tissue- specific homeostasis of carotenoids. The rapid decrease in carotenoid content of young leaves after dark, cold, and norflurazon exposure (Figure 5.10, 5.11), therefore,
207 indicates the possibility of functional modification of carotenoids such as glycosylation or similar phenomenon, reducing the proportion of free carotenoids.
Despite a preliminary report on the role of carotenoid glycosides in the cell wall and thylakoid organisation in cyanobacteria (Mohamed et al., 2005), glycosylation of carotenoids and apocarotenoids and the role of glycosylated carotenoids in cell and chloroplast functioning during leaf development is open to exploring in higher plants including Arabidopsis.
The concentration of soluble sugars can affect photosynthetic pigment pool in leaves. For example, external feeding of glucose downregulated the MEP pathway and decreased both carotenoid and chlorophyll contents in spinach (Krapp et al.,
1991) and tomato (Mortain-Bertrand et al., 2008) leaves. In Arabidopsis, a higher level of soluble sugar content, mainly glucose, in old leaves corresponds with the reduced level of carotenoid and chlorophylls (Stessman et al., 2002) suggesting negative feedback of glucose to photosynthetic pigment pool in old leaves. Under dark conditions, breakdown of the daytime transitory starch produces glucose and maltose in the chloroplast, and both are translocated to the cytoplasm, where they synthesise sucrose (Ruan, 2014). Complying with the negative feedback of glucose, the decrease in carotenoid and chlorophyll content in the young leaves of Arabidopsis during dark exposure (Figure 5.13 and 5.16) implicates the potential role of glucose and/or maltose in diurnal regulation of carotenogenesis. Likewise, cold exposure downregulates the rate of photosynthesis (Allen and Ort, 2001) but enhances the accumulation of soluble sugars (Zeng et al., 2011; Tarkowski and Van den Ende,
2015). It is plausible that the state of soluble sugars within chloroplasts and/or cytoplasm can modulate isoprenoid production as well as photosynthetic pigment pool in leaves. The MEP pathway, particularly the production of deoxyxylulose 5- phosphate (DX), has shown the critical regulatory role in both carotenoid and
208 chlorophyll biosynthesis as the DX feeding and overexpression of DXS both enhanced carotenoid accumulation (Lois et al., 2000; Simpson et al., 2016). Also, the production of hexose sugars in chloroplasts accompanied by the reduction in carotenoid content during dark conditions demonstrates the possibility of carotenoid glycosylation in young leaves to facilitate cell wall and thylakoid organisation as observed in Synechocystis (Mohamed et al., 2005). Indeed, the impacts of soluble sugars in the MEP pathway and photosynthetic pigments homeostasis in young (sink) and old (source) leaves needs further exploration.
In young leaves of Arabidopsis, the higher level of carotenoids and chlorophylls was positively correlated with the higher protein level (Stessman et al., 2002). Here, I revealed that the lower level of foliar carotenoids in older leaves was independent of the transcript abundance of the genes involved in carotenoid biosynthetic or degradation pathways (Figure 5.1 A-D). A sharp decrease in the level of foliar carotenoids of young leaves to the level of old leaves in response to norflurazon treatment in the carotenoid biosynthetic and degradation pathway perturbed mutants
(Figure 5.9, 5.11) and overexpression lines substantiate the fact that the age- dependent decline of foliar carotenoid content is independent of biosynthesis and degradation. Neither the genes determining the vegetative phase regulatory attributes of a leaf affected the foliar carotenoid pool (Figure 5.2). It is reasonable to emphasise that the higher abundance of isoprenoid precursors or precursor allocation toward carotenoid biosynthesis can synthesise a higher level of phytoene and downstream carotenoids in young leaves and vice versa in old leaves. Also, different level of soluble sugars in young and old leaves can feedback biosynthesis of both carotenoids and chlorophylls. However, age-dependent regulation of isoprenoid and soluble sugar abundance needs further research to unveil the correlation between photosynthetic functions and pigment homeostasis during leaf development.
209
Finally, among all the scenarios discussed above, the higher cell density in young leaves compared to the old leaves is the most convincing explanation justifying the substantially higher level of carotenoid and chlorophyll content. The determination of cell and chloroplast density and functional threshold of the pigment content in chloroplasts of both young and old leaves could shed light on the photosynthetic pigment homeostasis and functional efficiency of leaves. Darkness, cold, and norflurazon may affect the carotenoid pool of young leaves similar to that of the age-dependent decline of carotenoids, or the cases may be different, which is open to discovery. While the leaf-age, darkness, cold, and norflurazon concurrently declined the level of both carotenoid and chlorophyll in young leaves, the discovery of a signalling metabolite and/or a molecular mechanism that regulates photosynthetic pigment pool during leaf development will bring new insights to improve photosynthetic efficiency and carotenoid enrichment in food and horticultural crops.
Indeed, the high plasticity of young leaves altering pigment pool in response to environmental conditions, whereas old leaves were highly resilient in maintaining the threshold level of pigments regardless of environmental conditions, demonstrates the applicability of young leaves as a model system to hunt retrograde signalling, chloroplast development, and pigment homeostasis in plants.
………. ……….
210
General discussion
211
This chapter summarises the research undertaken for the thesis and highlights the key findings addressing the objectives. The results outlined in this thesis demonstrate the substantially higher capacity of young leaves to accumulate foliar pigments and, which is amenably changing instantly in response to environmental conditions. The level of both carotenoids and chlorophylls in mature leaves, however, can be resilient to environmental changes. This chapter also includes the clarification on the validity of the methods used to generate data. Besides, the limitations of the study, that constrained the interpretation of the data in a way or another, and directions for the future research have been highlighted.
6.1 Leaf-age and environmental conditions can alter the level of photosynthetic pigments
In higher plants, leaves are the principal organs that facilitate light harvesting and carbon fixation during photosynthesis, providing both sources and sinks for organic matter during the plant development (Tsukaya, 2013). Chloroplasts are the cellular organelles in leaves, which facilitate biosynthesis and sequestration of chlorophyll and carotenoid pigments enabling photosynthesis and photoprotection, respectively. The level and composition of photosynthetic pigments are tightly maintained within a functionally balanced state that helps to confer an optimum photosynthetic efficiency during leaf development (Ritz et al., 2000; Tripathy and
Pattanayak, 2012). To achieve the functional state, the biosynthesis, sequestration, and degradation of carotenoids and chlorophylls are tuned to the stage of a chloroplast as well as leaf development. The recently emerged leaves comprise smaller and rapidly dividing cells with relatively smaller and developing chloroplasts that harbour only a few grana stacks, whereas mature leaves contain fully expanded cells containing larger and many more chloroplasts per cell, with well-developed thylakoid grana stacks (Figure 6.1) (Gugel and Soll, 2017). Another key developmental
212 difference is that the rapid division and expansion of cells take place in young leaves and so the chloroplast division and expansion, while fully expanded cells from the old leaves do not divide and maintain the threshold population of chloroplasts (Pyke,
2010; Jarvis and Lopez-Juez, 2013). In contrast, the rapid disintegration of chloroplasts leads to a concurrent degradation of both carotenoids and chlorophylls in senescing leaves (Biswal, 1995; Ghosh et al., 2001). The factors that control chloroplast division and structural development can alter the foliar pigment pool, depending upon the functional state of a leaf. As such, the developmental stage of a leaf governs the overall plant physiology and development depending upon its age.
Figure 6.1 Schematic diagrams showing structural differences in the cells from young and mature leaves.
Figures highlight differences in the size and number of cells, vacuoles, chloroplasts, and thylakoids in the cells from young (A) and mature (B) leaves. N; Nucleus, V; Vacuole, C; Chloroplast, M; Mitochondria.
The plant energy organelles such as chloroplasts help to sense environmental cues and communicate with other organelles through chlorophyll, and carotenoid
213 derived signalling metabolites. Changes in the environmental conditions trigger the generation of intracellular signals that control chloroplast development (biogenesis and ultrastructure differentiation), division, and operational control depending upon the developmental stage of cell and/or tissue (Pogson et al., 2015). The state of chloroplast development affects the level of photosynthetic pigment pool (both carotenoids and chlorophylls) and vice versa, which is also tuned to the environmental growth conditions. The non-photosynthetic etioplasts within the cells of dark-grown cotyledons lack chlorophylls, yet accumulate significant amounts of carotenoids lutein and violaxanthin and traces of β-carotene and neoxanthin (Pogson and Albrecht,
2011). During de-etiolation (photomorphogenesis), light exposure triggers the differentiation of chloroplasts and thylakoids concurrently enhancing both carotenoid and chlorophyll biosynthesis to establish photosynthesis. Carotenoids are essential for chloroplast development and function, as evident from the fact that the norflurazon- induced inhibition of PDS activity accumulating phytoene, therefore, perturb both development and function of chloroplasts and carotenogenesis (Vecchia et al., 2001).
The loss of function of either of PSY, PDS, ZDS, CRTISO, LCYB can impair chloroplast development and/or functions (Cazzonelli and Pogson, 2010; Nisar et al.,
2015). Carotenoid derived metabolites orchestrate both intrinsic developmental and external environmental cues to determine functional efficiency, most importantly, photosynthesis (Ritz et al., 2000; Domonkos et al., 2013). For example, besides phytoene accumulation, norflurazon treatment impairs chlorophyll biosynthesis accumulating Mg-protoporphyrin IX (Mg-ProtoIX), a chlorophyll precursor, that alters the expression of photosynthesis associated genes (PhANGs) and inhibit plastid biogenesis (Strand et al., 2003; Zhang et al., 2011). There is evidence implicating the roles for cis-carotenes and/or cis-carotene-derived apocarotenoids in regulating both chloroplast and leaf development (Alagoz, 2018). For example, the accumulation of
214 phytofluene and ζ-carotene was linked to the changes in nuclear gene expression and impairment in leaf-blade differentiation in the zds/clb5 mutant plants (Avendano-
Vazquez et al., 2014). Also, extended exposure to darkness generates a neurosporene derived apocarotenoid signal in crtiso mutant that post-transcriptionally controls proteins levels and plastid development in leaf tissues (Cazzonelli et al., 2019). The physiological roles for chlorophyll and carotenoid derived signals in controlling plastid development have emerged, yet how the leaf-age and, hence, the developmental stage of chloroplast underpins these signalling processes remain unclear and become the focus of my dissertation.
This dissertation unveils how changes in atmospheric carbon dioxide, temperature, and light affect carotenoid homeostasis during leaf development.
Previous studies in A. thaliana and B. napus such as Stessman et al. (2002) and Ghosh et al. (2001) respectively, revealed a substantially higher level of foliar pigments, both carotenoids and chlorophylls, in recently emerged young leaves compared to old leaves. These alterations in the level of carotenoids and chlorophylls occurred in a leaf-age related manner. The decline in pigments during leaf aging raised questions; i) why and how can young leaves contain a higher level of foliar pigments? ii) does substrate supply, biosynthesis, storage, or degradation define the age-related decline in carotenoids? iii) why are carotenoids and chlorophylls synchronously controlled in different leaf types? iv) what are the cellular and chloroplast developmental stages in young and old leaves that can account for changes in pigment content? v) what are the links to the carotenoid storage capacity of chloroplasts that alter during the progression of leaves from young to mature and senesced stages of development? and, vi) which leaf types are more plastic to have their pigment pool altered in response to environmental changes? My investigations have used a combination of chemical inhibitor assays and genetic mutant lines to uncouple the mechanism(s) underpinning
215 the decline in pigments associated with leaf age and the impact of environmental change.
I hypothesised that CO2 enrichment would enhance pigment content because an increase in atmospheric CO2 can improve the rate of photosynthesis and biomass production (Ainsworth and Rogers, 2007; Andresen et al., 2017). However, the literature yielded conflicting messages showing higher, lower, or no change in pigment content in response to CO2 enrichment in different plants (Table 2.1). So, I questioned if the age of the leaf might have an impact on the discrepancies in the literature. Besides, I expected that heatwave (>43 oC air temperature) would modify the content and composition of xanthophyll cycle pigments in leaves but was not able to determine from the literature if leaf age would affect the foliar carotenoid content and composition in response to high temperatures. I also hypothesised that exposure to a severe cold (7-10 oC) would reduce the level of photosynthetic pigments corroborating the reduction in photosynthetic rate (Allen and Ort, 2001) and increase in the level of soluble sugars (Tarkowski and Van den Ende, 2015) in chloroplasts during cold exposure, although differential cellular acclimation strategies in young and old leaves might negate these effects. I was surprised to find younger leaves displaying greater plasticity than older leaves to modify carotenoid content in response to elevated CO2, cold exposure, extended darkness, and norflurazon treatments, while both carotenoid and chlorophyll content was unchanged in old leaves.
Younger leaves of Arabidopsis are more efficient in tolerating excessive light stress compared to mature leaves (Bielczynski et al., 2017; D'Alessandro et al., 2018), which is correlated with the enhanced oxidation of β-carotene to produce β-cyclocitral that triggers photoprotective pathways (Ramel et al., 2012). I explored environmental
216 and genetic factors that affected carotenogenesis during Arabidopsis leaf maturation before the onset of senescence. I have discovered that the higher carotenoid and chlorophyll content in younger leaves was most likely due to a greater cell density and hence higher plastid capacity (Figure 6.1 A). The younger leaves were most responsive to the environmental change due to the higher rate of chloroplast division and/or structural development in rapidly dividing cells. The young leaves, thus, provide an in-planta model system to decipher how environmental signals and chemical inhibitors can control chloroplast development, intracellular signalling and, hence, carotenoid biosynthesis.
6.2 Leaf-age related decline in carotenoid content is independent of the leaf developmental phase transition
In Arabidopsis, rosette leaves undergo a developmental phase transition from the juvenile to adult phase as the plant matures. The leaf developmental phase transition from juvenile to adult phase involves characteristic changes in leaf morphology and cellular structures such as change in leaf shape from round to elongated, absence of abaxial trichomes to emergence of the same, and extensive wall ingrowth deposition in phloem parenchyma cells in juvenile and absence of the same in adult phase leaves (Poethig, 1997; Xu et al., 2016; Nguyen et al., 2017). Leaf phase characteristics persist throughout the life span of the respective leaves, and there are several SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) family transcription factors and microRNAs (miR156 and miR172) that control the developmental phase transition in leaves (Jung et al., 2011; Xu et al., 2016; Nguyen et al., 2017). Most importantly, the transition from juvenile to adult phase corresponds with the gradual decrease in miR156 and a concurrent increase in miR172 and SPL15 transcript abundance (Nguyen et al., 2017). Previous studies revealed that the overexpression of miR156b, which suppresses SPL15 transcription in leaves, had
217 increased the level of carotenoids in Arabidopsis and B. napus seeds, but not in leaves
(Wei et al., 2010; Wei et al., 2012). The mechanism by which miR156b and/or SPL15 affected carotenogenesis differentially in seed and leaf tissues was not demonstrated.
The relatively similar level of carotenoids in young or old leaves from spl mutants and miR156b overexpression lines relative to WT and a significantly higher level of carotenoid content (~60 %) in young leaves (Figure 5.2), confirmed that the leaf developmental phase identity does not affect carotenoid content in leaves. While miR156 specifically targets SPL9 and SPL15, there could be redundancy among SPL transcription factors that can negate any change in carotenogenesis during leaf development, which is open to exploring further. Alternatively, the targets of SPL transcription factors may not prevalent in leaves, like that in seeds. Nonetheless,
SPL9, SPL15, and miR156b did not appear to regulate carotenoid biosynthesis during
Arabidopsis leaf development. Therefore, regardless of leaf phase identity, younger leaves contain a higher carotenoid content compared to older leaves in Arabidopsis.
6.3 Enzymatic oxidation of carotenoids is not responsible for declining carotenoid content during leaf aging
Carotenoid turnover continuously occurs in leaves via both enzymatic and non- enzymatic oxidation (Beisel et al., 2010; Schaub et al., 2018). A higher rate of carotenoid degradation can decrease the level of carotenoids in senescing leaves
(Biswal, 1995; Rottet et al., 2016). The CCD4 expression increased in senescing leaves such as in Arabidopsis (Rottet et al., 2016), and ccd4 mutants showed an enhanced β-carotene content in Arabidopsis seeds (Gonzalez-Jorge et al., 2013). The higher transcript levels of CCD4 in old leaves (14-fold; Figure 5.1) might implicate a higher rate of carotenoid degradation, which could be the one possible explanation for the decline in carotenoids during leaf aging. However, the older leaves that I analysed here were not senescing and, like WT, the level of all foliar carotenoids declined in
218 old leaves from ccd4 mutant and CCD4 overexpression genotypes (Figure 5.3).
Similarly, young leaves from ccd1 and ccd7 mutants (both single and double) displayed a significantly higher carotenoid content compared to older leaves (Figure
5.3). Furthermore, chemical inhibition of CCD activity in seedlings grown in artificial
MS media supplemented with D15 (CCD inhibitor) did not stop the age-related decrease in foliar carotenoid content (Figure 5.4). These data confirmed that enzymatic degradation had little or no role in controlling the age-related decline in foliar carotenoid content, at least, before the onset of senescence (Figure 5.3).
Collectively, the substantially higher level of carotenoids in the young leaves from
WT and mutants affecting carotenoid cleavage activity confirmed that the decline in carotenoids during leaf aging was independent of enzymatic oxidation.
6.4 Developmental state of chloroplasts determines the level of photosynthetic pigments in leaves
In leaves, norflurazon treatment disrupts the thylakoid network, affecting biogenesis, differentiation, and/or operational control of chloroplast, thereby, perturbing chlorophyll and carotenoid biosynthesis and accumulation; hence leaf tissues appear bleached (Vecchia et al., 2001; Park and Jung, 2017). Norflurazon can trigger a transient burst of a chlorophyll precursor Mg-protoporphyrin IX
(MgProtoIX) in chloroplasts that can alter the expression of nuclear genes controlling the functions in chloroplasts (Strand et al., 2003; Moulin et al., 2008; Zhang et al.,
2011). In norflurazon treated plants, accumulation of substantially higher and lower phytoene content in young and old leaves from WT and mutant genotypes (ziso, crtiso, lut2 and PSY-OE) (Figure 5.9) appeared to be related to the stage of the cell and chloroplast development, which changes as the leaf tissues become old. Given that phytoene accumulated in both young and old leaves within the similar incubation period in response to norflurazon treatment, albeit to a lesser extent in older leaves
219
(Figure 5.8), it clarifies the uniform distribution of norflurazon throughout the different aged leaf tissues. The accumulation of significantly higher level of phytoene in young leaves in response to norflurazon (Figure 5.9) corresponds with the higher level of foliar carotenoids in the same leaves (Figure 5.6), therefore demonstrated the higher capacity of young leaves synthesising and/or accumulating carotenoids.
Like carotenoids, chlorophyll content was also decreased in the leaf-age dependent manner (Figure 5.5 and 5.15) suggesting the developmental and/or functional state of chloroplasts, that changes over the leaf maturation, can regulate both carotenoid and chlorophyll pools during leaf development. In both WT and mutant genotypes (ziso, crtiso, lut2 and PSY-OE), a concurrent reduction in both carotenoid (Figure 5.11) and chlorophyll (Figure 5.16) content in young, but not old, leaves from the norflurazon treated plants revealed that the regulatory signal is most prevalent in young leaf tissues that comprise cells and chloroplasts undergoing rapid division and/or expansion. The stability of carotenoid and chlorophyll content in old leaves after norflurazon treatment reinforces that either the regulatory signal cannot be generated in older leaves or younger leaves have greater plasticity to modify cell and/or chloroplast development as they are rapidly dividing and/or expanding. This is in part supported by observations of the signs of bleaching in younger, but not in older leaves following the more extended periods of exposure to norflurazon. In norflurazon treated plants, a sharp decrease in the level of both carotenoids and chlorophylls in younger leaves reveals a visible effect of norflurazon on chloroplast development in rapidly dividing and/or expanding cells in leaves. The precise mechanism of how norflurazon impacts chloroplast development in dividing and expanding cells and, therefore, biosynthesis and accumulation of photosynthetic pigments remain less clear. It seems likely that the norflurazon treatment can generate a retrograde signal triggering inhibition of chloroplast division and/or thylakoid development in the
220 newly divided cells and/or chloroplasts from young leaves can lead to an overall decrease in pigment content per unit tissue, that cannot happen in older leaves which comprise fully developed chloroplasts.
The loss of CRTISO function also generates an intracellular signal that can perturb carotenoid and chlorophyll accumulation in younger leaves. For example, crtiso tissues accumulate cis-carotenes and block prolamellar body formation in etioplasts from the dark-grown cotyledons (Park et al., 2002). Likewise, crtiso leaves, particularly young ones, accumulate cis-carotenes under extended periods of darkness
(shorter photoperiods) that is linked to an impaired chloroplast development and function manifesting as a virescent phenotype (Cazzonelli et al., 2019). The impaired plastid development was attributed to a cis-carotene derived apocarotenoid signal that post-transcriptionally controlled PIF3 and HY5 protein levels, thereby regulating the nuclear genes to control chloroplast development and functions (Cazzonelli et al.,
2019). Photoisomerisation can reduce cis-carotene levels and restore plastid development and leaf greening under long photoperiods. However, the total carotenoid content was decreased in younger leaves of crtiso, compared to WT, which was further declined during leaf aging to levels like that of older leaves of WT, albeit there was a much lower reduction (Figure 5.5 and 5.6). I attributed this to a considerable increase in antheraxanthin and zeaxanthin in younger leaves, coupled with an increase in β-carotene and no change in lutein during the leaf aging process.
CRTISO can differentially perturb the age-related decline in individual carotenoid pigments, resulting in an altered flux between the α- and β-branches (Figure 5.5 and
5.6). A similar level of β-carotene in both young and old leaves from the ziso and crtiso mutants (Figure 5.5 B) reinforced the fact that cis-carotene isomerases are essential to maintain the optimum level of individual α- and β-carotenoids during leaf maturation.
221
ZISO and CRTISO control the accumulation of cis-carotenes and/or a cis- carotene derived apocarotenoid signal that can control plastid development. The similar levels of lutein and β-carotene in young and old leaves of crtiso provide strong evidence that CRTISO can regulate the production of cis-carotene derived apocarotenoid signal altering the pathway flux into α- and β-branches of carotenoid biosynthesis. This fact reinforces that the carotenogenic signals are most effective in controlling chloroplast development in younger leaves. Intriguingly, other β-branch carotenoids such as zeaxanthin, antheraxanthin, violaxanthin and neoxanthin all displayed a typical age-related decline (Figure 5.5, 5.6, and 5.11). The altered carotenoid profile in conjunction with the downregulation of LCYE expression in the absence of CRTISO function in crtiso leaves can best explain the role of CRTISO in regulating the metabolite flux into α- and β-branches of the carotenoid biosynthetic pathway (Cuttriss et al., 2007).
The SDG8 dependent differential expression of CRTISO and shoot meristem activity demonstrated the epigenetic regulation of CRTISO, therefore carotenogenesis in Arabidopsis (Cazzonelli et al., 2009; Cazzonelli et al., 2009). Indeed, why would the levels of lutein and β-carotene be similar in both young and old leaves of crtiso
(Figure 5.5 A, B), while that of other foliar carotenoids (Figure 5.5 C, D, E) including phytoene (Figure 5.9) was substantially higher in young leaves? The mechanism by which CRTISO controls metabolite flux through the pathway via regulating LCYE expression is enigmatic and a topic of further investigation. In summary, CRTISO has a crucial function in controlling a cis-carotene derived apocarotenoid signal that regulates the metabolite flux into α- and β-branches of the carotenoid biosynthetic pathway and chloroplast development.
222
It was intriguing that, like carotenoids, chlorophyll content was also decreased in leaf-age dependent manner specifically only in the crtiso mutant (Figure 5.5 and
5.15). Therefore, like norflurazon, crtiso can generate a carotenogenic signal that affects plastid development and, hence, both carotenoid and chlorophyll content during leaf development. A concurrent reduction in the level of both carotenoids and chlorophylls in young, but not old, leaves from crtiso indicated that impaired state of chloroplast development and/or division in young leaves of crtiso could affect the level of photosynthetic pigments. However, the accumulation of nearly 3-fold higher phytoene content in young leaves of crtiso and ziso compared to the respective old leaves from norflurazon treated plants was intriguing, given that norflurazon should repress the generation of a cis-carotene derived apocarotenoid signals that are supposed to enhance biosynthesis and/or accumulation of carotenoids in young leaves
(Figure 5.9). The levels of phytoene in crtiso and ziso were higher than WT indicating that the norflurazon-induced signal had an additive effect on increasing isoprenoid precursor flux into the carotenoid biosynthetic pathway in young leaves, but not in older leaves. The fact that PSY-OE had no effect on phytoene accumulation following norflurazon treatment (Figure 5.9) neither on the level of downstream carotenoids
(Figure 5.5) demonstrated that the leaf-age related decline in foliar pigment content was no longer controlled by PSY activity, which is often considered to be the rate- limiting step in carotenoid biosynthesis. There are apparent differences in the state of plastid development between young and old leaves (Gugel and Soll, 2017).
Collectively, in leaves, the developmental and/or functional state of chloroplasts and the availability isoprenoid precursors could govern the photosynthetic pigment pool in an age-dependent manner.
223
6.5 Young leaves have a high degree of plasticity to alter carotenoid content and composition to suit the prevailing environment
In leaves, the carotenoid pool is generally assumed to be stable with a continuous synthesis and degradation of carotenoids, that indicates the distinct acclimatory strategies controlling their turnover in response to the changing environmental conditions (Beisel et al., 2010). Carotenoid metabolism in leaves can respond instantly to the environmental changes facilitating the functional homeostasis.
The xanthophyll cycle carotenoids are crucial in protecting photosystems from the oxidative stress induced by environmental conditions such as exposure to excessive light and high/low temperature can trigger de-epoxidation of violaxanthin enhancing zeaxanthin accumulation that neutralises oxidative stress in chloroplasts (Varkonyi et al., 2002; Magyar et al., 2013; Sacharz et al., 2017). The loss of function in one or more core xanthophyll biosynthetic pathway genes, such as single-gene mutants lut2 and npq2, double mutant npq2 lut2, and triple mutant aba4 npq1 lut2 did not alter the age-related decline in total or individual foliar carotenoid content (Figure 5.7). Like
WT, the substantially higher level of carotenoids in young leaves from the mutants affecting xanthophyll content implicates that the decline in carotenoid content during leaf aging is independent of xanthophyll biosynthesis.
Curiously, unlike other carotenoids, the level of antheraxanthin and zeaxanthin remained higher in young leaves compared to older leaves from the norflurazon treated plants revealing a differential impact of norflurazon on the state of the xanthophyll cycle (Figure 5.11). Why the level of antheraxanthin and zeaxanthin was higher in young leaves and remained unchanged in response to norflurazon, despite the substantial accumulation of phytoene in both young and old leaf types remain unclear. One possibility is that as zeaxanthin has the higher antioxidant capacity
(Havaux et al., 2007), norflurazon induced oxidative stress can trigger de-epoxidation
224 of violaxanthin enriching both antheraxanthin and zeaxanthin to neutralise oxidative stress, which requires further validation. Arabidopsis leaves undergo a systemic maturation; however, the responsiveness of carotenogenesis in young and old leaves to altered CO2, temperature, and light conditions was mostly unexplored. Here, I applied environmental treatments that affect developmental, physiological, and biochemical attributes of leaves and revealed that carotenogenesis is highly plastic in young leaves, while old leaves were resilient to maintain the optimum carotenoid pool in response to the environmental perturbations.
The substantially higher level of phytoene along with all foliar carotenoids and chlorophylls in young leaves compared to old demonstrated that the developmental stage of chloroplasts could influence the level of photosynthetic pigment pool. The differential effects of herbicide norflurazon (that disrupts thylakoid network and inhibits carotenogenesis) and mutants ziso and crtiso (that impair chloroplast development) on the level of photosynthetic pigments in young leaves raised a question whether young leaves would be more responsive to environmental change and modify their pigment content to suit the prevailing conditions. Interestingly, younger leaves of Arabidopsis are more tolerant to environmental stress such as high light intensity (Bielczynski et al., 2017; D'Alessandro et al., 2018), which indicates the differential photoprotective capacity in young and old leaves. Under excessive light stress, β-carotene is degraded, producing β-cyclocitral that induces activation of photoprotective pathways (Ramel et al., 2012). Here, I have demonstrated that the individual pigment levels can fluctuate in response to environmental change, especially in younger leaves. A rigorous assessment of the effects of various environmental treatments in both young and old leaf types demonstrated that the metabolism of the most individual carotenoids in young leaves is amenable to change, while only the xanthophyll cycle pigments are responsive to the environmental
225 change in older leaves. The resilient nature of older leaves and higher plasticity of younger leaves in maintaining the optimum pool of carotenoids and chlorophylls highlights why plant foliar tissues have different stress acclimation responses. These responses appear to be underpinned by the stage of cell and chloroplast development, more so than the substrate supply, biosynthesis, regulation and/or degradation of carotenoids.
The impact of elevated CO2 on foliar pigment levels was not discernible from the literature because of the prevalent discrepancies (Table 2.1). Under elevated CO2, the level of photosynthetic pigments in older mature leaves of Arabidopsis did not change, even though there was a significant increase (~60 %) in the rate of photosynthesis (Dhami et al., 2018). The concentration of atmospheric CO2 can affect photosynthetic traits such as elevated CO2 has been shown to increase the rate of photosynthesis, carbohydrate biosynthesis, and biomass accumulation (Ellsworth et al., 2004; Andresen et al., 2017). Indeed, Arabidopsis plants I exposed to elevated
CO2 showed a significant increase in biomass, which was consistent with previously published reports, and highlighted the fertilisation effect of CO2 enrichment (Dhami et al., 2018). Also, elevated CO2 can increase the number and size of chloroplasts concomitantly enhancing the biosynthesis of plastidial metabolites including precursors of carotenoid biosynthesis (Griffin et al., 2001; Wang et al., 2004; Teng et al., 2006; Li et al., 2013). However, in my experiments, the level of both carotenoids and chlorophylls was unchanged in fully expanded leaves in response to elevated
CO2. Although the recently emerged, younger leaves from elevated CO2 grown plants did show an increase in the level of both carotenoids and chlorophylls (Figure 6.1 H,
L). This data demonstrated that young tissues are amenable to utilise an excess of CO2 to synthesise and store excess photosynthetic pigments, plausibly, by enhancing cell and/or chloroplast density (Figure 6.1 D) or may improve the supply of substrates for
226 isoprenoid biosynthesis (Dhami et al., 2018). While the mechanism by which elevated
CO2 can affect pigment biosynthesis only in younger foliar tissues in Arabidopsis requires further research, my results highlight how young leaves are more plastic to adjust photosynthetic pigment pool to suit the level of atmospheric CO2.
In plants, cold exposure can have severe effects on chloroplast development and function (Jarvis and Lopez-Juez, 2013; Pogson et al., 2015; Liu et al., 2018). Cold exposure, such as 4-10 oC reduces the rate of photosynthesis and delays developmental programming in plants (Allen and Ort, 2001; Savitch et al., 2001;
Paredes and Quiles, 2015). Cold triggers accumulation of reactive oxygen species
(ROS), including hydrogen peroxide, which negatively impacts chloroplast structure and functions (Zhou et al., 2006; Abdel Kader et al., 2018). ROS can damage the chloroplast membranes, including thylakoids, and also trigger stress response altering the expression of nuclear genes changing chloroplast functions (Liu et al., 2018).
Carotenoids are potent antioxidants that protect chloroplast integrity and function in foliar tissues exposed to environmental stress, including a severe cold.
Cold exposure has been shown to increase soluble sugar content in foliar tissues facilitating a cold stress acclimation (Nagele et al., 2012; Bakht et al., 2013; Ruan,
2014). However, soluble sugars are negative regulators of carotenogenesis. The reduced level of carotenoid and chlorophylls correlated with a higher level of glucose in old leaves of Arabidopsis (Stessman et al., 2002). Also, application of glucose decreased both carotenoid and chlorophyll contents in spinach (Krapp et al., 1991) and tomato (Mortain-Bertrand et al., 2008) leaves, which highlights a noticeable decrease in carotenoid content in the leaves from the cold exposed plants.
Here, I revealed that young leaves were highly plastic in reducing both carotenoid and chlorophyll content in response to short-term cold exposure, while
227 both were unchanged in old leaves (Figure 4.5). A substantial decrease in the level of phytoene in both young and old leaves from the Arabidopsis plants exposed to norflurazon under cold condition (7 oC) compared to the respective leaves from 22 oC grown plants demonstrated a negative impact of cold on carotenogenesis (Figure
5.12). It was intriguing that a short period of severe cold exposure had a negative effect, previously unknown, on carotenoid and chlorophyll accumulation in young leaves in a manner resembling the impact of norflurazon or extended darkness (Figure
5.13, 5.16, and 6.1). However, a typical age-related decline in pigments persisted under a prolonged period of severe cold (Figure 4.3) demonstrating a cold acclimation response and restoration of cell and chloroplast development resembling the leaves from ambient grown plants. These findings highlight that sudden exposure of plants to cold for a short time can impact chloroplast development, similar to exposure to extended darkness or norflurazon, while leaves can acclimate to prolonged cold exposure.
Cold exposure can impair leaf growth and cell cycle progression as evident in maize (Rymen et al., 2007). It seems plausible that sudden exposure to a cold can impair cell division and expansion, as well as chloroplast development, in young leaves of Arabidopsis subsequently limiting photosynthetic pigment biosynthesis and accumulation (Figure 6.1 E). The apparent reduction in phytoene content in both young and old leaves after cold exposure (Figure 5.12) could implicate negative feedback from cold-induced soluble sugars in controlling carotenogenesis. There could be an additive effect of cold-induced limitation of precursor supply and enhancing the degradation of foliar carotenoids regardless of the leaf types, which is open for discovery.
228
The light availability is one major factor affecting chloroplast development and carotenogenesis, whereas the impact of extended periods of darkness on the foliar carotenoid and chlorophyll content is poorly explored. Photosynthesis related metabolic pathways are activated in the light and generally deactivated in the dark
(Jacquot, 2018). Indeed, my experiments revealed that darkness extended to 24 hours reduced the level of both carotenoids and chlorophylls in young leaves (Figure 5.13 and 5.16). The level of both pigments was unchanged in dark-exposed old leaves, indicating differential regulation of carotenogenesis in young and old leaves in response to the darkness (Figure 6.1 J, N). The effect of darkness on pigment content in young leaves was identical to that observed for norflurazon and severe cold. The simultaneous reduction in carotenoids and chlorophyll content in young, but not old, leaves indicated the state of chloroplast division and development; therefore, the level of photosynthetic pigment can be directly affected during extended dark conditions.
Dark exposure could trigger a reduction in the number and/or size of chloroplasts as previously shown in Arabidopsis leaves (Figure 6.1 F) (Keech et al., 2007). During night cycles, plastids within cells from recently emerged leaf tissues appear to be under structural differentiation; that is the transition from etioplast to chloroplast or proplastid to chloroplast and vice versa (Philippar et al., 2007; Sakamoto et al., 2008).
So, extended darkness could systematically perturb plastid biogenesis and chloroplast development, therefore, affecting pigment homeostasis, which needs further investigation.
The absence of phytoene accumulation in both young and old leaves from the norflurazon treated plants exposed to darkness (Figure 5.12) showed that the darkness imposed an additional effect on carotenoid biosynthesis and/or plastid development.
A similar finding showing no phytoene accumulation was reported in Capsicum annuum tissues exposed to darkness and norflurazon, and treated tissues also showed
229 the downregulated of transcription in PSY (Simkin et al., 2003). The light-dependent regulation of PSY transcription and/or PSY activity in photosynthetic tissues is well- reported and extended periods of darkness can reduce PSY protein levels as evident in callus tissue (Maass et al., 2009). Therefore, prolonged periods of darkness might affect PSY protein levels and functional interactions along with plastid development, the mechanisms of which await further discovery.
There are clear distinctions between young and old leaves, both structurally and functionally (Table 1.1, Figure 6.2). Young leaves comprise relatively small, immature, expanding and rapidly dividing cells with proplastids and partially developed chloroplasts more so at the base, while the fully expanded cells of older leaves contain numerous (7 times more) and larger chloroplasts (Kutík et al., 1999;
Stettler et al., 2009; Gonzalez et al., 2012; Gugel and Soll, 2017). The high density of actively dividing cells in young leaf tissues can result in a cumulative high density of chloroplasts providing a higher capacity to accumulate photosynthetic pigments in young leaves, relative to old leaves, which comprise more giant cells conferring lower cell density and, therefore, lower chloroplast capacity per unit fresh weight (Figure
6.1). The apparent changes in the level of foliar pigments in young leaves demonstrated that the state of the cell and/or chloroplast development and density per unit leaf tissue could primarily maintain the level of photosynthetic pigments in
Arabidopsis leaves (Figure 6.2 D, E, F, and G).
A significant change in the level of both carotenoid and chlorophyll in young leaves in response to eCO2, cold, dark, and norflurazon demonstrates a higher degree of plasticity for younger leaves to modulate photosynthetic pigment homeostasis in response to environmental change. In contrast, old leaves are highly resilient in maintaining a threshold level of pigments regardless of the levels of CO2, cold, and
230 darkness. This can explain why mature leaves are often referred to as having a stable pool of carotenoids and chlorophylls, while young leaves are highly amenable to change, with greater plasticity, to acclimate to their surrounding environment.
Figure 6.2 Illustration of the age-dependent response of photosynthetic pigments to environmental changes in Arabidopsis leaves. 231
(A) A three-week-old long day grown Arabidopsis plant with a graphical representation of high and low chloroplast density (representing high and low cell density respectively) in young and old leaves respectively. Overlaid lines within circular shapes (chloroplasts) represent thylakoid lamellae (2 in young vs 4 in old). (B) Carotenoid and (C) Chlorophyll content in young and old leaves of the three-week-old long day grown Arabidopsis plants. The asterisk marks (***) represent paired t-test (p≤0.001). (D) Graphical illustration of the impact of elevated CO2 on chloroplasts displaying a higher number of chloroplasts in young leaves compared to the same leaves from control (A). (E), (F), and (G) Illustration of the impact of cold, dark, and norflurazon respectively on chloroplasts in young and old leaves. The absence of lamellar structures in the chloroplasts in young leaves represents disruption or negative impact on thylakoids. The similar size and lamellar structures in the chloroplasts from old leaves in (A), (D), (E), (F), and (G) represent chloroplasts unaffected from the respective environmental conditions. (H), (I), (J), and (K) total carotenoid content in young and old leaves from three-week-old plants exposed to elevated carbon dioxide (eCO2, 800 ppm), non-freezing cold (7 oC), dark, and norflurazon respectively. (L), (M), (N), and (O) total chlorophyll content in young and old leaves from three-week-old plants exposed to eCO2, non-freezing cold (7 oC), dark, and norflurazon respectively. Plots represent the mean values with the standard error of means (n=4-5). Figures H-O are also included in the respective sections in chapter 5. Letter codes in plots indicate the level of statistical variation (p<0.05) in the respective test parameters within leaf types across the treatment groups as determined by Two-Way ANOVA adopting Holm-Sidak post-hoc multiple comparisons. Neo, Neoxanthin; Vio, Violaxanthin; Lut, Lutein; β-car, β-carotene; Tot car, Total carotenoids; Chl a, Chlorophyll a; Chl b, Chlorophyll b; Tot chl, Total chlorophylls. 6.6 Leaves are highly plastic to alter the xanthophyll cycle facilitating thermal tolerance in response to an extreme heatwave
High-temperature tolerance is a crucial feature of plants to survive the extreme heatwaves that are predicted to increase in intensity, frequency, and duration subsequently increasing the risks of plant mortality globally (O'Sullivan et al., 2017).
High-temperature stress triggers H2O2 production, consequently enhancing the lipid peroxidation that disrupts membrane structures and functions, often causing lethal consequences (Huve et al., 2011). On the other hand, plants acquire the inherent capacity to cope with high-temperature stress within the range of functional tolerance
(Hasanuzzaman et al., 2013; Asthir, 2015). In leaves, carotenoids are the vital antioxidant pigments that facilitate neutralisation of oxidative stress and heat tolerance, especially under higher irradiances. For example, high light intensity triggers de-epoxidation of violaxanthin, enhancing zeaxanthin accumulation that neutralises photooxidative stress in chloroplasts (Magyar et al., 2013). Xanthophyll cycle carotenoids are critically essential to handle high-temperature stress mainly an increase in zeaxanthin favours thermal energy dissipation, which is a primary adaptive 232 strategy that plants adapt to neutralise excess electrons from photo-oxidative stress in leaves (Demmig-Adams and Adams, 1996; Havaux et al., 2004; Jahns and Holzwarth,
2012). Nonetheless, photoprotective capacity and plasticity of leaves of different developmental stages (young and old) to high-temperature stress is not apparent in the literature.
In previous work, Drake et al. (2018) demonstrated that the exposure to a heatwave (>43 oC) triggered the thermal tolerance in Eucalyptus parramattensis leaves maintaining leaf functions, despite reduced photosynthesis during mid-day, and the capacity of thermal tolerance was unaffected by the prolonged pre-warming at +3 oC. In chapter 3, I demonstrated differential levels of carotenoid pool in young and old leaves from Eucalyptus trees under ambient, warming, and heatwave conditions. In contrast to Arabidopsis, young leaves of Eucalyptus had lower carotenoid content compared to old; however, both leaf types displayed a similar effect to long-term warming as well as an extreme heatwave. In agreement with Drake et al. (2018), leaves from the plants grown under long-term warming (+3 oC) showed no significant change in net photosynthesis and nor did they alter their carotenoid pool in comparison to ambient grown trees (Table 3.1). However, four consecutive days of a heatwave caused an increase in zeaxanthin content up to 2.5-fold in both young and old leaves (Figure 3.1) demonstrating a critical role for zeaxanthin in providing thermal tolerance in all leaf types that can help to maintain thylakoid membrane stability and the functional homeostasis of photosynthetic apparatus (Latowski et al.,
2002; Strzałka et al., 2003; Havaux et al., 2007). A plausible reason for the preferential accumulation of zeaxanthin under heat stress could be the higher antioxidant capacity of zeaxanthin compared to other carotenoids (Havaux et al.,
2007), which helps to neutralise oxidative stress during heat stress. In agreement, inhibition of photosynthesis (Drake et al., 2018) and increase in zeaxanthin pool in
233 leaves exposed to an experimental heatwave (Figure 3.1) demonstrated a physiological strategy that can reduce heat-induced oxidative stress and maintain lipid membrane stability in Eucalyptus leaves.
The experimental heat-wave was applied for four consecutive full sunshine days during the natural long-day irradiance (Australian Spring-Summer) under field conditions (Drake et al., 2018); therefore, it was not possible to discern the absolute impacts of heat stress on the dynamics of xanthophyll cycle. The mid-day increase in zeaxanthin and decrease in violaxanthin levels can partly reflect a mid-day light acclimation response (Pascal et al., 2005). To uncouple this, examining pigment content during a day-night cycle would enable to determine the effect to heatwave alone on the xanthophyll cycle. The future experiments that investigate interactive effects of heatwave and light intensity on the level of foliar carotenoids, particularly xanthophyll cycle pigments and the activity of xanthophyll cycle regulatory proteins, are desirable that could uncouple how plants can modulate xanthophyll cycle to protect photosystems and avoid heat-induced oxidative stress.
6.7 Young leaves of Arabidopsis can be an efficient in-planta model system to explore plastid development and plastidial metabolism
The versatile functions of carotenoids as well as their cleavage products in photosynthesis, photoprotection, plastid development, root/shoot development, and stress acclimation put carotenoids and carotenoid metabolism at the forefront of plant research (Esteban et al., 2015; Wurtzel, 2019). In plants, carotenoid homeostasis in both photosynthetic and non-photosynthetic tissues requires tight regulation in biosynthesis, accumulation and degradation at the different stages of plant development and in response to short- and long-term environmental changes
(Cazzonelli and Pogson, 2010; Llorente, 2016). A suite of carotenoid biosynthetic pathway mutants and transgenic lines have demonstrated the characteristic
234 phenotypes with the tissue-specific regulation of carotenoid metabolism in many plants, including Arabidopsis (Tian, 2015). The dynamic roles of carotenoids and carotenoid derived metabolites in plant development as well as the non-replaceable nutritional, and medicinal significance of many carotenoids reiterates the need for innovations in carotenoid biology research.
Here, I revealed that, compared to the old leaves, the young leaves of
Arabidopsis comprise a significantly higher level of foliar carotenoids, and the environmental changes can impact the level of foliar carotenoid content in a leaf-age dependent manner. The substantially higher level of carotenoids in young leaves, compared to the old leaves, despite perturbations in biosynthetic and degradation pathways, demonstrated that the cell and/or chloroplast densities in the leaves are likely to play a crucial role in determining the carotenoid pool in leaves. The high plasticity and resilience of young and old leaves, respectively, in altering the level of both carotenoids and chlorophylls in response to darkness, cold, and norflurazon exposure implies that the state of chloroplast development could be a factor underpinning photosynthetic pigment homeostasis in Arabidopsis leaves. The availability of excessive isoprenoid precursor pool in actively dividing cells from the young leaves, compared to the fully expanded and non-dividing cells from the old leaves, could be another reason for the higher pigment content in young leaves, and vice versa in old leaves. The exploration of the biosynthesis of isoprenoid precursors and the regulation of precursor channelling into photosynthetic pigment biosynthetic pathways was not within the scope of this dissertation, which requires a more in-depth investigation to disclose the metabolomic changes in the chloroplasts during
Arabidopsis leaf development. Discovery of the molecular network that imparts young leaves to accumulate a substantially high level of carotenoids and chlorophylls
235 will add a new toolbox to improve photosynthetic efficiency and carotenoid enrichment in food and horticultural crops.
The fruits, roots, etiolated tissues, and in vitro induced callus are well-studied model tissues to interrogate the biosynthesis, degradation, and sequestration of carotenoids in different plastid types. However, considering the results discussed in this dissertation, the younger leaves of Arabidopsis, which accumulate a significantly higher level of photosynthetic pigments, are more responsive to environmental change, plausibly, due to the higher rate of plastid biogenesis and division in rapidly dividing cells. Young leaves, thus, can provide a better in-planta model system to decipher how developmental and environmental signals affect plastid development, signalling, and carotenoid biosynthesis during Arabidopsis leaf development.
6.8 Clarifications, Limitations, and Recommendations
6.8.1 Leaf samples (Fresh vs Dried) During the leaf maturation, the concentration of pigments could change over time corresponding to the changes in cell size, cell density, leaf area, and leaf thickness, causing a dilution effect. Also, the differences chloroplast size and density, and ultrastructural changes in chloroplast can affect the level of pigment biosynthesis and accumulation. Carotenoid profiling and quantification in leaf tissues from a wide range of Arabidopsis genotypes (wild type, mutants, and overexpression lines) exposed to different treatment conditions was the main strategy adopted to achieve the research objectives of this study. I followed tissue biomass (fresh and dry weight) based approach for carotenoid quantification, as the tissue weight is a commonly used unbiased unit of tissue sampling for carotenoid analysis in a variety of plant tissues
(Pogson et al., 1996; Amorim-Carrilho et al., 2014). The dry tissue samples could preclude the carotenoid dilution effect on the carotenoid concentration in the leaves of different ages from various genotypes that can vary in cell size, leaf thickness and, 236 hence, water content. I compared pigment profile in both fresh and dry tissues to ascertain appropriate tissues for the subsequent analysis and revealed a similar trend in the content and relative proportions of foliar carotenoids (Figure 6.2).
The level of the four major carotenoids was significantly higher in young leaves in both dry and fresh samples (Figure 6.2 A-D) suggesting a less likely impact of water content affecting the concentration of carotenoids in young and old leaves.
Also, the trend of β-carotene and violaxanthin proportions were similar in both tissue types (Figure 6.2 F, G). However, as leaf samples were dried at 40 oC, we could see a substantial reduction in both content and ratio of violaxanthin, in old leaf samples,
(Figure 6.2 C, G) and similar proportions of lutein and neoxanthin in both young and old leaf samples (Figure 6.2 E, H). The reduction of violaxanthin was compensated with the accumulation of zeaxanthin content implicating high-temperature induced de-epoxidation of violaxanthin. The drying remarkably altered carotenoid profile, although an age-dependent trend in carotenoid content was persisted; high content in young leaves, therefore, I analysed carotenoids in fresh leaf tissues in the subsequent experiments. It is desirable to determine carotenoid content in an individual cell and chloroplast from young and old leaves to interpret carotenoid content in reference to the tissue weight and/or leaf area to ascertain the temporal changes in the functional state of carotenoids during leaf maturation.
237
Figure 6.3 Foliar carotenoids in fresh and dry tissues of Arabidopsis leaves.
Leaf samples were collected from the four-week-old long day grown Arabidopsis plants. Young leaves represent the recently emerged unexpanded leaves (leaf # 10 or newer, leaf length <5 mm) and old leaves were the leaf number 3-4 of a rosette. Leaf samples were pooled from 2-5 plants. For drying, leaf samples were kept in a drying oven at 40 oC for 24 hours. Plots represent the mean values with the standard error of means (n=5). The proportions were determined relative to the total carotenoid content. The letter codes in plots indicate the level of statistical variation (p<0.05) in the respective test parameters within leaf types across the tissue types as determined by Two-Way ANOVA adopting Holm-Sidak post- hoc multiple comparisons.
6.8.2 Quantification of carotenoids and chlorophylls The conversion of the HPLC peak area of the major foliar carotenoids into
g/gfw or g/gdw was derived by integrating the peak area to a standard curve value, as previously described (Pogson et al., 1996). The standard values used for converting peak area into µg/gfw leaf tissue include; neoxanthin (8.787E-05), violaxanthin
(7.986E-05), lutein (9.498E-05; also used for antheraxanthin and zeaxanthin), - carotene (9.22E-05), chlorophyll b (2.849E-04) and chlorophyll a (2.74E-04). These standard curve values have been used in several subsequent studies with wider
238 acceptance, for example (Cuttriss et al., 2007; Cazzonelli et al., 2009; Van Norman et al., 2014), and adopted for carotenoid quantification in this study.
I generated the standard curve for β-carotene (Figure 6.3) to compare coefficient values (6.5179E-05) with the coefficients from the Pogson Lab (9.2200E-
05), and both coefficient values result into a nearly similar level of β-carotene. The development of new standard curves of all carotenoids, including cis-trans isomers, was not feasible due to scarcity of analytical standards and high cost. As the coefficients from Pogsons Lab were available for all major foliar carotenoids and chlorophylls, I adopted (with permission) for the pigment quantification. However, development of standardised coefficients for quantification of carotenoids, including cis-carotenes and phytoene, is desirable for the accurate quantification of carotenoids in a wide range of plant tissues.
Figure 6.4 Calibration curve of β-Carotene.
β-Carotene dilutions were made in ethyl acetate, and 10 µL solution of each concentration was injected in HPLC. The HPLC reverse phase solvent gradients were similar as explained in the methodology section of Chapter 2.
239
6.8.3 Future directions The research projects undertaken in this thesis were intended to uncover the mechanism of how the developmental phase transition and age of a leaf can affect biosynthesis and degradation of carotenoids in response to the elevated atmospheric
CO2 and temperature fluctuations. A considerably higher level of carotenoids in young leaves from wild type and a wide range of mutants and overexpression lines, that can alter carotenoid biosynthesis, degradation, and leaf developmental phase transition (Chapter 2, 4 and 5), indicated that the carotenoid homeostasis during leaf maturation is regulated beyond the biosynthesis and degradation of carotenoids.
Neither the altered leaf developmental phase transition affected the level of foliar carotenoids. The differential level of carotenoids in young and mature leaves was also revealed in the dry tissues (Chapter 2) indicating a less likely impact of cell size; therefore, cell water content-related changes in determining the level of foliar carotenoid content. However, a similar trend of both carotenoids and chlorophylls in young and old leaves indicated that the differential regulation of MEP pathway in the upstream and/or structural and functional differences in cell and chloroplast from young and mature leaves could have direct control over the level of foliar pigment, which is open to future discovery.
Despite a substantially high quantity of both carotenoids and chlorophylls, young leaves showed higher plasticity to alter the level of both pigments in response to elevated CO2 (Chapter 2), temperature fluctuation, and norflurazon treatment
(Chapter 4 and 5) indicating the differential patterns of pigment homeostasis in young and old leaves. Contrastingly, the level of foliar pigments was highly resilient with environmental changes in mature leaves (Chapter 2, 4 and 5). The results interpreted in this thesis reflect the molecular aspects of carotenoid metabolism in leaves; however, limitations of data from the ultrastructural changes in cell and chloroplast
240 preclude establishing a mechanism of carotenoid homeostasis during leaf maturation.
The future research is desirable to map the regulation of isoprenoid precursor biosynthesis and precursor flux into the carotenoid biosynthetic pathway during leaf maturation. Besides, the determination of leaf anatomy and ultrastructure of cells and chloroplasts from young and mature leaves could ascertain mechanistic interactions of foliar carotenoid homeostasis. Finally, quantification of carotenoids and chlorophylls in individual chloroplast and/or mesophyll cell from the leaves of different maturity level and genotypes could reveal the functional state of foliar pigments during leaf maturation and in response to the environmental perturbations, which is open to exploring.
………. ……….
241
References
Abdel-Aal el SM, Young JC, Rabalski I, Hucl P, Fregeau-Reid J (2007) Identification and quantification of seed carotenoids in selected wheat species. J Agric Food Chem 55: 787-794 Abdel Kader DZ, Saleh AAH, Elmeleigy SA, Dosoky NS (2018) Chilling-induced oxidative stress and polyamines regulatory role in two wheat varieties. J Taibah Univ Sci 5: 14-24 Aharoni A, Giri AP, Deuerlein S, Griepink F, de Kogel WJ, Verstappen FW, Verhoeven HA, Jongsma MA, Schwab W, Bouwmeester HJ (2003) Terpenoid metabolism in wild-type and transgenic Arabidopsis plants. Plant Cell 15: 2866-2884 Ainsworth EA, Rogers A (2007) The response of photosynthesis and stomatal
conductance to rising [CO2]: mechanisms and environmental interactions. Plant Cell Environ 30: 258-270 Al-Babili S, Bouwmeester HJ (2015) Strigolactones, a novel carotenoid-derived plant hormone. Annu Rev Plant Biol 66: 161-186 Alagoz Y, Nayak P, Dhami N, Cazzonelli CI (2018) cis-carotene biosynthesis, evolution and regulation in plants: The emergence of novel signaling metabolites. Arch Biochem Biophys 654: 172-184 Alba R, Payton P, Fei Z, McQuinn R, Debbie P, Martin GB, Tanksley SD, Giovannoni JJ (2005) Transcriptome and selected metabolite analyses reveal multiple points of ethylene control during tomato fruit development. Plant Cell 17: 2954-2965 Allen DJ, Ort DR (2001) Impacts of chilling temperatures on photosynthesis in warm-climate plants. Trends Plant Sci 6: 36-42 Altincicek B, Kovacs JL, Gerardo NM (2012) Horizontally transferred fungal carotenoid genes in the two-spotted spider mite Tetranychus urticae. Biol Lett 8: 253-257 Alvarez D, Voss B, Maass D, Wust F, Schaub P, Beyer P, Welsch R (2016) Carotenogenesis is regulated by 5'UTR-mediated translation of Phytoene synthase splice variants. Plant Physiol 172: 2314-2326 Aman R, Schieber A, Carle R (2005) Effects of heating and illumination on trans- cis isomerization and degradation of beta-carotene and lutein in isolated spinach chloroplasts. J Agric Food Chem 53: 9512-9518
242
Amorim-Carrilho KT, Cepeda A, Fente C, Regal P (2014) Review of methods for analysis of carotenoids. Trac-Trend Anal Chem 56: 49-73 Ampomah-Dwamena C, Driedonks N, Lewis D, Shumskaya M, Chen X, Wurtzel ET, Espley RV, Allan AC (2015) The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content. BMC Plant Biol 15: 185 Andresen LC, Yuan N, Seibert R, Moser G, Kammann CI, Luterbacher J, Erbs M, Muller C (2017) Biomass responses in a temperate European grassland
through 17 years of elevated CO2. Glob Chang Biol: 1-11 Arango J, Beltrán J, Nuñez J, Chavarriaga P (2016) Evidence of epigenetic mechanisms affecting carotenoids. In C Stange, ed, Carotenoids in Nature: Biosynthesis, Regulation and Function. Springer International Publishing, Cham, pp 295-307 Arsovski AA, Galstyan A, Guseman JM, Nemhauser JL (2012) Photomorphogenesis. Arabidopsis Book 10: e0147 Asthir B (2015) Mechanisms of heat tolerance in crop plants. Biol Plant 59: 620-628 Atkin OK, Tjoelker MG (2003) Thermal acclimation and the dynamic response of plant respiration to temperature. Trends Plant Sci 8: 343-351 Augustynska D, Jemiola-Rzeminska M, Burda K, Strzalka K (2015) Influence of polar and nonpolar carotenoids on structural and adhesive properties of model membranes. Chem Biol Interact 239: 19-25 Avendano-Vazquez AO, Cordoba E, Llamas E, San Roman C, Nisar N, De la Torre S, Ramos-Vega M, Gutierrez-Nava MD, Cazzonelli CI, Pogson BJ, Leon P (2014) An uncharacterized apocarotenoid-derived signal generated in zeta-Carotene desaturase mutants regulates leaf development and the expression of chloroplast and nuclear genes in Arabidopsis. Plant Cell 26: 2524-2537 Bae HH, Sicher R (2004) Changes of soluble protein expression and leaf metabolite levels in Arabidopsis thaliana grown in elevated atmospheric carbon dioxide. Field Crop Res 90: 61-73 Bai C, Capell T, Berman J, Medina V, Sandmann G, Christou P, Zhu C (2016) Bottlenecks in carotenoid biosynthesis and accumulation in rice endosperm are influenced by the precursor-product balance. Plant Biotechnol J 14: 195-205 Bakht J, Bano A, Shafi M, Dominy P (2013) Effect of abscisic acid applications on cold tolerance in chickpea (Cicer arietinum L.). Eur J Agron 44: 10-21
243
Balevicius V, Jr., Fox KF, Bricker WP, Jurinovich S, Prandi IG, Mennucci B, Duffy CDP (2017) Fine control of chlorophyll-carotenoid interactions defines the functionality of light-harvesting proteins in plants. Sci Rep 7: 13956 Banerjee A, Sharkey TD (2014) Methylerythritol 4-phosphate (MEP) pathway metabolic regulation. Nat Prod Rep 31: 1043-1055 Baranski R, Cazzonelli CI (2016) Carotenoid biosynthesis and regulation in plants. In Carotenoids. John Wiley & Sons, Ltd, pp 159-189 Barth C, Conklin PL (2003) The lower cell density of leaf parenchyma in the Arabidopsis thaliana mutant lcd1-1 is associated with increased sensitivity to ozone and virulent Pseudomonas syringae. Plant J 35: 206-218 Bartley GE, Scolnik PA (1995) Plant carotenoids: pigments for photoprotection, visual attraction, and human health. Plant Cell 7: 1027-1038 Beisel KG, Jahnke S, Hofmann D, Koppchen S, Schurr U, Matsubara S (2010) Continuous turnover of carotenes and chlorophyll a in mature leaves of 14 Arabidopsis revealed by CO2 pulse-chase labeling. Plant Physiol 152: 2188- 2199 Beisel KG, Schurr U, Matsubara S (2011) Altered turnover of beta-carotene and Chl a in Arabidopsis leaves treated with lincomycin or norflurazon. Plant Cell Physiol 52: 1193-1203 Beltran J, Kloss B, Hosler JP, Geng J, Liu A, Modi A, Dawson JH, Sono M, Shumskaya M, Ampomah-Dwamena C, Love JD, Wurtzel ET (2015) Control of carotenoid biosynthesis through a heme-based cis-trans isomerase. Nat Chem Biol 11: 598-605 Beltran JC, Stange C (2016) Apocarotenoids: A new carotenoid-derived pathway. Subcell Biochem 79: 239-272 Bielczynski LW, Lacki MK, Hoefnagels I, Gambin A, Croce R (2017) Leaf and plant age affects photosynthetic performance and photoprotective capacity. Plant Physiol 175: 1634-1648 Biswal B (1995) Carotenoid catabolism during leaf senescence and its control by light. J Photoch Photobio B 30: 3-13 Biswal B, Mohapatra PK, Biswal UC, Raval MK (2012) Leaf senescence and transformation of chloroplasts to gerontoplasts. In JJ Eaton-Rye, BC Tripathy, TD Sharkey, eds, Photosynthesis: Plastid Biology, Energy Conversion and Carbon Assimilation. Springer Netherlands, Dordrecht, pp 217-230
244
Blanch JS, Penuelas J, Llusia J, Sardans J, Owen SM (2015) Differences in photosynthesis and terpene content in leaves and roots of wild-type and transgenic Arabidopsis thaliana plants. Russ J Plant Physl 62: 823-829 Bode S, Quentmeier CC, Liao PN, Hafi N, Barros T, Wilk L, Bittner F, Walla PJ (2009) On the regulation of photosynthesis by excitonic interactions between carotenoids and chlorophylls. Proc Natl Acad Sci U S A 106: 12311-12316 Boskovic-Rakocevic L, Pavlovic R, Zdravkovic J, Zdravkovic M, Pavlovic N, Djuric M (2012) Effect of nitrogen fertilization on carrot quality. Afr J Agric Res 7: 2884-2900 Bou-Torrent J, Toledo-Ortiz G, Ortiz-Alcaide M, Cifuentes-Esquivel N, Halliday KJ, Martinez-Garcia JF, Rodriguez-Concepcion M (2015) Regulation of carotenoid biosynthesis by shade relies on specific subsets of antagonistic transcription factors and cofactors. Plant Physiol 169: 1584-1594 Bouvier F, Isner JC, Dogbo O, Camara B (2005) Oxidative tailoring of carotenoids: a prospect towards novel functions in plants. Trends Plant Sci 10: 187-194 Boyes DC, Zayed AM, Ascenzi R, McCaskill AJ, Hoffman NE, Davis KR, Gorlach J (2001) Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants. Plant Cell 13: 1499- 1510 Braunwald T, Schwemmlein L, Graeff-Honninger S, French WT, Hernandez R, Holmes WE, Claupein W (2013) Effect of different C/N ratios on carotenoid and lipid production by Rhodotorula glutinis. Appl Microbiol Biotechnol 97: 6581-6588 Brausemann A, Gemmecker S, Koschmieder J, Ghisla S, Beyer P, Einsle O (2017) Structure of phytoene desaturase provides insights into herbicide binding and reaction mechanisms involved in carotene desaturation. Structure 25: 1222- 1232 e1223 Brazaityte A, Sakalauskiene S, Samuoliene G, Jankauskiene J, Virsile A, Novickovas A, Sirtautas R, Miliauskiene J, Vastakaite V, Dabasinskas L, Duchovskis P (2015) The effects of LED illumination spectra and intensity on carotenoid content in Brassicaceae microgreens. Food Chem 173: 600-606 Britton G (2008) Functions of intact carotenoids. In G Britton, S Liaaen-Jensen, H Pfander, eds, Carotenoids. Birkhäuser Basel, Basel, pp 189-212
245
Britton G, Liaaen-Jensen S, Pfander H (2004) Carotenoids: Handbook. Birkhäuser Verlag, Basel Britton G, Liaaen-Jensen S, Pfander H, eds (2008) Carotenoids: Natural functions, Vol 4 Brocard L, Immel F, Coulon D, Esnay N, Tuphile K, Pascal S, Claverol S, Fouillen L, Bessoule JJ, Brehelin C (2017) Proteomic analysis of lipid droplets from Arabidopsis aging leaves brings new insight into their biogenesis and functions. Front Plant Sci 8: 894 Brown CR, Edwards CG, Yang CP, Dean BB (1993) Orange flesh trait in potato - inheritance and carotenoid content. J Am Soc Hortic Sci 118: 145-150 Bruggemann N, Schnitzler JP (2002) Diurnal variation of dimethylallyl diphosphate concentrations in oak (Quercus robur) leaves. Physiol Plant 115: 190-196 Bruno M, Beyer P, Al-Babili S (2015) The potato carotenoid cleavage dioxygenase 4 catalyzes a single cleavage of beta-ionone ring-containing carotenes and non- epoxidated xanthophylls. Arch Biochem Biophys 572: 126-133 Bruno M, Hofmann M, Vermathen M, Alder A, Beyer P, Al-Babili S (2014) On the substrate- and stereospecificity of the plant carotenoid cleavage dioxygenase 7. FEBS Lett 588: 1802-1807 Buchner O, Stoll M, Karadar M, Kranner I, Neuner G (2015) Application of heat stress in situ demonstrates a protective role of irradiation on photosynthetic performance in alpine plants. Plant Cell Environ 38: 812-826 Bukhov NG, Kopecky J, Pfündel EE, Klughammer C, Heber U (2001) A few molecules of zeaxanthin per reaction centre of photosystem II permit effective thermal dissipation of light energy in photosystem II of a poikilohydric moss. Planta 212: 739-748 Bundy JG, Davey MP, Viant MR (2008) Environmental metabolomics: a critical review and future perspectives. Metabolomics 5: 3-21 Bunea A, Socaciu C, Pintea A (2015) Xanthophyll esters in fruits and vegetables. Not Bot Horti Agrobot Cluj Napoca 42: 310-324 Cao H, Wang J, Dong X, Han Y, Ma Q, Ding Y, Zhao F, Zhang J, Chen H, Xu Q, Xu J, Deng X (2015) Carotenoid accumulation affects redox status, starch metabolism, and flavonoid/anthocyanin accumulation in citrus. BMC Plant Biol 15: 27 Carol P, Kuntz M (2001) A plastid terminal oxidase comes to light: implications for carotenoid biosynthesis and chlororespiration. Trends Plant Sci 6: 31-36 246
Casal JJ (2013) Photoreceptor signaling networks in plant responses to shade. Annu Rev Plant Biol 64: 403-427
Castro JC, Dohleman FG, Bernacchi CJ, Long SP (2009) Elevated CO2 significantly delays reproductive development of soybean under Free-Air Concentration Enrichment (FACE). J Exp Bot 60: 2945-2951 Cazzonelli CI (2011) Carotenoids in nature: insights from plants and beyond. Funct Plant Biol 38: 833-847 Cazzonelli CI, Cuttriss AJ, Cossetto SB, Pye W, Crisp P, Whelan J, Finnegan EJ, Turnbull C, Pogson BJ (2009) Regulation of carotenoid composition and shoot branching in Arabidopsis by a chromatin modifying histone methyltransferase, SDG8. Plant Cell 21: 39-53 Cazzonelli CI, Hou X, Alagoz Y, Rivers J, Dhami N, Lee J, Marri S, Pogson BJ (2019) A cis-carotene derived apocarotenoid regulates etioplast and chloroplast development. bioRxiv: 528331 Cazzonelli CI, Pogson BJ (2010) Source to sink: regulation of carotenoid biosynthesis in plants. Trends Plant Sci 15: 266-274 Cazzonelli CI, Roberts AC, Carmody ME, Pogson BJ (2010) Transcriptional control of SET DOMAIN GROUP 8 and CAROTENOID ISOMERASE during Arabidopsis development. Mol Plant 3: 174-191 Cazzonelli CI, Yin K, Pogson BJ (2009) Potential implications for epigenetic regulation of carotenoid biosynthesis during root and shoot development. Plant Signal Behav 4: 339-341 Chalker-Scott L (1999) Environmental significance of anthocyanins in plant stress responses. Photochem Photobiol 70: 1-9 Chan KX, Phua SY, Crisp P, McQuinn R, Pogson BJ (2016) Learning the languages of the chloroplast: retrograde signaling and beyond. Annu Rev Plant Biol 67: 25-53 Charuvi D, Kiss V, Nevo R, Shimoni E, Adam Z, Reich Z (2012) Gain and loss of photosynthetic membranes during plastid differentiation in the shoot apex of Arabidopsis. Plant Cell 24: 1143-1157 Chater C, Peng K, Movahedi M, Dunn JA, Walker HJ, Liang YK, McLachlan DH, Casson S, Isner JC, Wilson I, Neill SJ, Hedrich R, Gray JE,
Hetherington AM (2015) Elevated CO2-induced responses in stomata require ABA and ABA signaling. Curr Biol 25: 2709-2716
247
Chater CC, Oliver J, Casson S, Gray JE (2014) Putting the brakes on: abscisic acid as a central environmental regulator of stomatal development. New Phytol 202: 376-391 Chayut N, Yuan H, Ohali S, Meir A, Sa'ar U, Tzuri G, Zheng Y, Mazourek M, Gepstein S, Zhou X, Portnoy V, Lewinsohn E, Schaffer AA, Katzir N, Fei Z, Welsch R, Li L, Burger J, Tadmor Y (2017) Distinct mechanisms of the ORANGE protein in controlling carotenoid flux. Plant Physiol 173: 376-389
Chen B, Zou D, Ma J (2015) Interactive effects of elevated CO2 and nitrogen– phosphorus supply on the physiological properties of Pyropia haitanensis (Bangiales, Rhodophyta). J Appl Phycol 28: 1235-1243 Chen F, Tholl D, D'Auria JC, Farooq A, Pichersky E, Gershenzon J (2003) Biosynthesis and emission of terpenoid volatiles from Arabidopsis flowers. Plant Cell 15: 481-494 Chen H, Zuo X, Shao H, Fan S, Ma J, Zhang D, Zhao C, Yan X, Liu X, Han M (2018) Genome-wide analysis of carotenoid cleavage oxygenase genes and their responses to various phytohormones and abiotic stresses in apple (Malus domestica). Plant Physiol Biochem 123: 81-93 Chen M, Chory J, Fankhauser C (2004) Light signal transduction in higher plants. Annu Rev Genet 38: 87-117 Chen Q, Fan D, Wang G (2015) Heteromeric geranyl(geranyl) diphosphate synthase is involved in monoterpene biosynthesis in Arabidopsis flowers. Mol Plant 8: 1434-1437 Chen W, He S, Liu D, Patil GB, Zhai H, Wang F, Stephenson TJ, Wang Y, Wang B, Valliyodan B, Nguyen HT, Liu Q (2015) A sweetpotato geranylgeranyl pyrophosphate synthase gene, IbGGPS, increases carotenoid content and enhances osmotic stress tolerance in Arabidopsis thaliana. PLoS One 10: e0137623 Chen Y, Li F, Wurtzel ET (2010) Isolation and characterization of the Z-ISO gene encoding a missing component of carotenoid biosynthesis in plants. Plant Physiol 153: 66-79 Cheng SH, Moore B, Seemann JR (1998) Effects of short- and long-term elevated
CO2 on the expression of ribulose-1,5-bisphosphate carboxylase/oxygenase genes and carbohydrate accumulation in leaves of Arabidopsis thaliana (L.) Heynh. Plant Physiol 116: 715-723
248
Chinnasamy S, Ramakrishnan B, Bhatnagar A, Das KC (2009) Biomass production potential of a wastewater alga Chlorella vulgaris ARC 1 under
elevated levels of CO2 and temperature. Int J Mol Sci 10: 518-532 Chinnusamy V, Zhu J, Zhu JK (2007) Cold stress regulation of gene expression in plants. Trends Plant Sci 12: 444-451 Ciais P, Reichstein M, Viovy N, Granier A, Ogee J, Allard V, Aubinet M, Buchmann N, Bernhofer C, Carrara A, Chevallier F, De Noblet N, Friend AD, Friedlingstein P, Grunwald T, Heinesch B, Keronen P, Knohl A, Krinner G, Loustau D, Manca G, Matteucci G, Miglietta F, Ourcival JM, Papale D, Pilegaard K, Rambal S, Seufert G, Soussana JF, Sanz MJ, Schulze ED, Vesala T, Valentini R (2005) Europe-wide reduction in primary productivity caused by the heat and drought in 2003. Nature 437: 529-533 Cobbs C, Heath J, Stireman JO, 3rd, Abbot P (2013) Carotenoids in unexpected places: gall midges, lateral gene transfer, and carotenoid biosynthesis in animals. Mol Phylogenet Evol 68: 221-228 Cogdell RJ, Howard TD, Bittl R, Schlodder E, Geisenheimer I, Lubitz W (2000) How carotenoids protect bacterial photosynthesis. Philos Trans R Soc Lond B Biol Sci 355: 1345-1349 Cookson SJ, Radziejwoski A, Granier C (2006) Cell and leaf size plasticity in Arabidopsis: what is the role of endoreduplication? Plant Cell Environ 29: 1273-1283 Cordoba E, Salmi M, Leon P (2009) Unravelling the regulatory mechanisms that modulate the MEP pathway in higher plants. J Exp Bot 60: 2933-2943 Couso I, Vila M, Vigara J, Cordero BF, Vargas MÁ, Rodríguez H, León R (2012) Synthesis of carotenoids and regulation of the carotenoid biosynthesis pathway in response to high light stress in the unicellular microalga Chlamydomonas reinhardtii. Eur J Phycol 47: 223-232 Covington MF, Maloof JN, Straume M, Kay SA, Harmer SL (2008) Global transcriptome analysis reveals circadian regulation of key pathways in plant growth and development. Genome Biol 9: R130 Cowan T, Purich A, Perkins S, Pezza A, Boschat G, Sadler K (2014) More frequent, longer, and hotter heat waves for Australia in the twenty-first century. J Climate 27: 5851-5871 Croce R, Muller MG, Bassi R, Holzwarth AR (2001) Carotenoid-to-chlorophyll energy transfer in recombinant major light-harvesting complex (LHCII) of 249
higher plants. I. Femtosecond transient absorption measurements. Biophys J 80: 901-915 Croce R, van Amerongen H (2014) Natural strategies for photosynthetic light harvesting. Nat Chem Biol 10: 492-501 Cruz R, Baptista P, Cunha S, Pereira JA, Casal S (2012) Carotenoids of lettuce (Lactuca sativa L.) grown on soil enriched with spent coffee grounds. Molecules 17: 1535-1547 Cuttriss AJ, Chubb AC, Alawady A, Grimm B, Pogson BJ (2007) Regulation of lutein biosynthesis and prolamellar body formation in Arabidopsis. Funct Plant Biol 34: 663-672 Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR (2005) Genome- wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol 139: 5-17 D'Alessandro S, Ksas B, Havaux M (2018) Decoding beta-cyclocitral-mediated retrograde signaling reveals the role of a detoxification response in plant tolerance to photooxidative stress. Plant Cell 30: 2495-2511 Dahmen-Ben Moussa I, Chtourou H, Karray F, Sayadi S, Dhouib A (2017) Nitrogen or phosphorus repletion strategies for enhancing lipid or carotenoid production from Tetraselmis marina. Bioresour Technol 238: 325-332 Dale MP, Causton DR (1992) Use of the chlorophyll a/b ratio as a bioassay for the light environment of a plant. Funct Ecol 6: 190-196 Dannehl D, Schuch I, Rocksch T, Huyskens-Keil S, Schmidt U, Rojano-Aguilar A (2012) Climate conditions in a closed greenhouse affect plant growth and secondary plant compounds of tomatoes (Solanum lycopersicum L.). In, Ed 952. International Society for Horticultural Science (ISHS), Leuven, Belgium, pp 515-522 Datt B (1998) Remote sensing of chlorophyll a, chlorophyll b, chlorophyll a+b, and total carotenoid content in Eucalyptus leaves. Remote Sens Environ 66: 111- 121 Davison PA, Hunter CN, Horton P (2002) Overexpression of beta-carotene hydroxylase enhances stress tolerance in Arabidopsis. Nature 418: 203-206 de Jonge J, Kodde J, Severing EI, Bonnema G, Angenent GC, Immink RG, Groot SP (2016) Low temperature affects stem cell maintenance in Brassica oleracea seedlings. Front Plant Sci 7: 800
250 de Souza A, Wang JZ, Dehesh K (2017) Retrograde signals: Integrators of interorganellar communication and orchestrators of plant development. Annu Rev Plant Biol 68: 85-108 de Vos RCH, Hall RD, Moing A (2011) Metabolomics of a model fruit: Tomato. In Annual Plant Reviews Volume 43. Wiley-Blackwell, pp 109-155 Decker EL, Alder A, Hunn S, Ferguson J, Lehtonen MT, Scheler B, Kerres KL, Wiedemann G, Safavi-Rizi V, Nordzieke S, Balakrishna A, Baz L, Avalos J, Valkonen JPT, Reski R, Al-Babili S (2017) Strigolactone biosynthesis is evolutionarily conserved, regulated by phosphate starvation and contributes to resistance against phytopathogenic fungi in a moss, Physcomitrella patens. New Phytol 216: 455-468 Delker C, Sonntag L, James GV, Janitza P, Ibanez C, Ziermann H, Peterson T, Denk K, Mull S, Ziegler J, Davis SJ, Schneeberger K, Quint M (2014) The DET1-COP1-HY5 pathway constitutes a multipurpose signaling module regulating plant photomorphogenesis and thermomorphogenesis. Cell Rep 9: 1983-1989 Demmig-Adams B, Adams WW (1996) The role of xanthophyll cycle carotenoids in the protection of photosynthesis. Trends Plant Sci 1: 21-26 Demmig-Adams B, Koh S-C, Cohu CM, Muller O, Stewart JJ, Adams WW (2014) Non-photochemical fluorescence quenching in contrasting plant species and environments. In B Demmig-Adams, G Garab, W Adams Iii, Govindjee, eds, Non-photochemical quenching and energy dissipation in plants, algae and cyanobacteria. Springer Netherlands, Dordrecht, pp 531-552 Denev ID, Yahubyan GT, Minkov IN, Sundqvist C (2005) Organization of protochlorophyllide oxidoreductase in prolamellar bodies isolated from etiolated carotenoid-deficient wheat leaves as revealed by fluorescence probes. Biochim Biophys Acta 1716: 97-103 Devlin RM, Kisiel MJ, Karczmarczyk SJ (1976) Chlorophyll production and chloroplast development in norflurazon-treated plants. Weed Res 16: 125-& Dhami N, Tissue DT, Cazzonelli CI (2018) Leaf-age dependent response of
carotenoid accumulation to elevated CO2 in Arabidopsis. Arch Biochem Biophys 647: 67-75 Di Baccio D, Quartacci MF, Vecchia FD, La Rocca N, Rascio N, Navari-Izzo F (2002) Bleaching herbicide effects on plastids of dark-grown plants: lipid
251
composition of etioplasts in amitrole and norflurazon-treated barley leaves. J Exp Bot 53: 1857-1865 Dogbo O, Laferriere A, D'Harlingue A, Camara B (1988) Carotenoid biosynthesis: Isolation and characterization of a bifunctional enzyme catalyzing the synthesis of phytoene. Proc Natl Acad Sci U S A 85: 7054-7058 Domonkos I, Kis M, Gombos Z, Ughy B (2013) Carotenoids, versatile components of oxygenic photosynthesis. Prog Lipid Res 52: 539-561 Dong H, Deng Y, Mu J, Lu Q, Wang Y, Xu Y, Chu C, Chong K, Lu C, Zuo J (2007) The Arabidopsis Spontaneous Cell Death1 gene, encoding a zeta- carotene desaturase essential for carotenoid biosynthesis, is involved in chloroplast development, photoprotection and retrograde signalling. Cell Res 17: 458-470 Dong T, Park Y, Hwang I (2015) Abscisic acid: biosynthesis, inactivation, homoeostasis and signalling. Essays Biochem 58: 29-48 Drake JE, Tjoelker MG, Varhammar A, Medlyn BE, Reich PB, Leigh A, Pfautsch S, Blackman CJ, Lopez R, Aspinwall MJ, Crous KY, Duursma RA, Kumarathunge D, De Kauwe MG, Jiang M, Nicotra AB, Tissue DT, Choat B, Atkin OK, Barton CVM (2018) Trees tolerate an extreme heatwave via sustained transpirational cooling and increased leaf thermal tolerance. Glob Chang Biol 24: 2390-2402 Duanmu D, Casero D, Dent RM, Gallaher S, Yang W, Rockwell NC, Martin SS, Pellegrini M, Niyogi KK, Merchant SS, Grossman AR, Lagarias JC (2013) Retrograde bilin signaling enables Chlamydomonas greening and phototrophic survival. Proc Natl Acad Sci U S A 110: 3621-3626 Dumas Y, Dadomo M, Di Lucca G, Grolier P (2003) Effects of environmental factors and agricultural techniques on antioxidantcontent of tomatoes. J Sci Food Agric 83: 369-382 Echavarri-Erasun C, Johnson EA (2002) Fungal carotenoids. In GG Khachatourians, DK Arora, eds, Agriculture and Food Production, Vol 2. Elsevier, pp 45-85 Egea I, Bian W, Barsan C, Jauneau A, Pech JC, Latche A, Li Z, Chervin C (2011) Chloroplast to chromoplast transition in tomato fruit: spectral confocal microscopy analyses of carotenoids and chlorophylls in isolated plastids and time-lapse recording on intact live tissue. Ann Bot 108: 291-297
252
Ellsworth DS, Reich PB, Naumburg ES, Koch GW, Kubiske ME, Smith SD (2004) Photosynthesis, carboxylation and leaf nitrogen responses of 16 species
to elevated pCO2 across four free-air CO2 enrichment experiments in forest, grassland and desert. Glob Chang Biol 10: 2121-2138 Enfissi EM, Nogueira M, Bramley PM, Fraser PD (2017) The regulation of carotenoid formation in tomato fruit. Plant J 89: 774-788 Esteban R, Barrutia O, Artetxe U, Fernandez-Marin B, Hernandez A, Garcia- Plazaola JI (2015) Internal and external factors affecting photosynthetic pigment composition in plants: a meta-analytical approach. New Phytol 206: 268-280 Esteban R, Moran JF, Becerril JM, Garcia-Plazaola JI (2015) Versatility of carotenoids: An integrated view on diversity, evolution, functional roles and environmental interactions. Environ Exp Bot 119: 63-75 Fachet M, Flassig RJ, Rihko-Struckmann LK, Sundmacher K (2017) Carotenoid production process using green microalgae of the Dunaliella genus: Model- based analysis of interspecies variability. Ind Eng Chem Res 56: 12888-12898 Fanciullino AL, Bidel LP, Urban L (2014) Carotenoid responses to environmental stimuli: integrating redox and carbon controls into a fruit model. Plant Cell Environ 37: 273-289 Fantini E, Falcone G, Frusciante S, Giliberto L, Giuliano G (2013) Dissection of tomato lycopene biosynthesis through virus-induced gene silencing. Plant Physiol 163: 986-998 Fernandez-Marin B, Becerril JM, Garcia-Plazaola JI (2010) Unravelling the roles of desiccation-induced xanthophyll cycle activity in darkness: a case study in Lobaria pulmonaria. Planta 231: 1335-1342 Fernandez-Marin B, Miguez F, Becerril JM, Garcia-Plazaola JI (2011) Activation of violaxanthin cycle in darkness is a common response to different abiotic stresses: a case study in Pelvetia canaliculata. BMC Plant Biol 11: 181 Finkelstein R (2013) Abscisic acid synthesis and response. Arabidopsis Book 11: e0166 Florian A, Timm S, Nikoloski Z, Tohge T, Bauwe H, Araujo WL, Fernie AR (2014) Analysis of metabolic alterations in Arabidopsis following changes in the carbon dioxide and oxygen partial pressures. J Integr Plant Biol 56: 941-959
253
Fowler S, Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14: 1675-1690 Foyer CH, Bloom AJ, Queval G, Noctor G (2009) Photorespiratory metabolism: genes, mutants, energetics, and redox signaling. Annu Rev Plant Biol 60: 455- 484 Franco-Zorrilla JM, Valli A, Todesco M, Mateos I, Puga MI, Rubio-Somoza I, Leyva A, Weigel D, Garcia JA, Paz-Ares J (2007) Target mimicry provides a new mechanism for regulation of microRNA activity. Nat Genet 39: 1033-1037 Frank D, Reichstein M, Bahn M, Thonicke K, Frank D, Mahecha MD, Smith P, van der Velde M, Vicca S, Babst F, Beer C, Buchmann N, Canadell JG, Ciais P, Cramer W, Ibrom A, Miglietta F, Poulter B, Rammig A, Seneviratne SI, Walz A, Wattenbach M, Zavala MA, Zscheischler J (2015) Effects of climate extremes on the terrestrial carbon cycle: concepts, processes and potential future impacts. Glob Chang Biol 21: 2861-2880 Fraser PD, Misawa N, Linden H, Yamano S, Kobayashi K, Sandmann G (1992) Expression in Escherichia coli, purification, and reactivation of the recombinant Erwinia uredovora phytoene desaturase. J Biol Chem 267: 19891-19895 Frey-Wyssling A, Schwegler F (1965) Ultrastructure of the chromoplasts in the carrot root. J Ultrastruct Res 13: 543-559 Frusciante S, Diretto G, Bruno M, Ferrante P, Pietrella M, Prado-Cabrero A, Rubio-Moraga A, Beyer P, Gomez-Gomez L, Al-Babili S, Giuliano G (2014) Novel carotenoid cleavage dioxygenase catalyzes the first dedicated step in saffron crocin biosynthesis. Proc Natl Acad Sci U S A 111: 12246-12251 Fuentes P, Pizarro L, Moreno JC, Handford M, Rodriguez-Concepcion M, Stange C (2012) Light-dependent changes in plastid differentiation influence carotenoid gene expression and accumulation in carrot roots. Plant Mol Biol 79: 47-59 Furubayashi M, Ikezumi M, Takaichi S, Maoka T, Hemmi H, Ogawa T, Saito K, Tobias AV, Umeno D (2015) A highly selective biosynthetic pathway to non- natural C50 carotenoids assembled from moderately selective enzymes. Nat Commun 6: 7534 Galzerano D, Feilke K, Schaub P, Beyer P, Krieger-Liszkay A (2014) Effect of constitutive expression of bacterial phytoene desaturase CRTI on photosynthetic
254
electron transport in Arabidopsis thaliana. Biochim Biophys Acta 1837: 345- 353 Gamon JA, Huemmrich KF, Wong CY, Ensminger I, Garrity S, Hollinger DY, Noormets A, Penuelas J (2016) A remotely sensed pigment index reveals photosynthetic phenology in evergreen conifers. Proc Natl Acad Sci U S A 113: 13087-13092 Gao H, Xu J, Liu X, Liu B, Deng X (2011) Light effect on carotenoids production and expression of carotenogenesis genes in citrus callus of four genotypes. Acta Physiol Plant 33: 2485-2492 Garbayo I, Vilchez C, Nava-Saucedo JE, Barbotin JN (2003) Nitrogen, carbon and light-mediated regulation studies of carotenoid biosynthesis in immobilized mycelia of Gibberella fujikuroi. Enzyme Microb Tech 33: 629-634 García-Plazaola JI, Esteban R, Hormaetxe K, Fernández-Marín B, Becerril JM (2008) Photoprotective responses of Mediterranean and Atlantic trees to the extreme heat-wave of summer 2003 in Southwestern Europe. Trees 22: 385-392 Ghirardo A, Wright LP, Bi Z, Rosenkranz M, Pulido P, Rodriguez-Concepcion M, Niinemets U, Bruggemann N, Gershenzon J, Schnitzler JP (2014) Metabolic flux analysis of plastidic isoprenoid biosynthesis in poplar leaves emitting and nonemitting isoprene. Plant Physiol 165: 37-51 Ghosh S, Mahoney SR, Penterman JN, Peirson D, Dumbroff EB (2001) Ultrastructural and biochemical changes in chloroplasts during Brassica napus senescence. Plant Physiol Biochem 39: 777-784 Giorio G, Stigliani AL, D'Ambrosio C (2008) Phytoene synthase genes in tomato (Solanum lycopersicum L.) - new data on the structures, the deduced amino acid sequences and the expression patterns. FEBS J 275: 527-535 Golczyk H, Greiner S, Wanner G, Weihe A, Bock R, Borner T, Herrmann RG (2014) Chloroplast DNA in mature and senescing leaves: a reappraisal. Plant Cell 26: 847-854 Golldack D, Li C, Mohan H, Probst N (2014) Tolerance to drought and salt stress in plants: Unraveling the signaling networks. Front Plant Sci 5: 1-10 Gomez-Roldan V, Fermas S, Brewer PB, Puech-Pages V, Dun EA, Pillot JP, Letisse F, Matusova R, Danoun S, Portais JC, Bouwmeester H, Becard G, Beveridge CA, Rameau C, Rochange SF (2008) Strigolactone inhibition of shoot branching. Nature 455: 189-194
255
Gonzalez-Jorge S, Ha SH, Magallanes-Lundback M, Gilliland LU, Zhou A, Lipka AE, Nguyen YN, Angelovici R, Lin H, Cepela J, Little H, Buell CR, Gore MA, Dellapenna D (2013) Carotenoid cleavage dioxygenase4 is a negative regulator of beta-carotene content in Arabidopsis seeds. Plant Cell 25: 4812-4826 Gonzalez-Perez S, Gutierrez J, Garcia-Garcia F, Osuna D, Dopazo J, Lorenzo O, Revuelta JL, Arellano JB (2011) Early transcriptional defense responses in Arabidopsis cell suspension culture under high-light conditions. Plant Physiol 156: 1439-1456 Gonzalez N, De Bodt S, Sulpice R, Jikumaru Y, Chae E, Dhondt S, Van Daele T, De Milde L, Weigel D, Kamiya Y, Stitt M, Beemster GT, Inze D (2010) Increased leaf size: different means to an end. Plant Physiol 153: 1261-1279 Gonzalez N, Vanhaeren H, Inze D (2012) Leaf size control: complex coordination of cell division and expansion. Trends Plant Sci 17: 332-340 Goodwin TW (1980) Carotenoids in seed-bearing plants—photosynthetic tissues. In The Biochemistry of the Carotenoids. Springer Netherlands, pp 96-142 Goufo P, Pereira J, Figueiredo N, Oliveira MBPP, Carranca C, Rosa EAS,
Trindade H (2014) Effect of elevated carbon dioxide (CO2) on phenolic acids, flavonoids, tocopherols, tocotrienols, gamma-oryzanol and antioxidant capacities of rice (Oryza sativa L.). J Cereal Sci 59: 15-24 Graham JE, Bryant DA (2009) The biosynthetic pathway for myxol-2' fucoside (myxoxanthophyll) in the cyanobacterium Synechococcus sp. strain PCC 7002. J Bacteriol 191: 3292-3300 Granier C, Massonnet C, Turc O, Muller B, Chenu K, Tardieu F (2002) Individual leaf development in Arabidopsis thaliana: a stable thermal-time- based programme. Ann Bot 89: 595-604 Grbic M, Van Leeuwen T, Clark RM, Rombauts S, Rouze P, Grbic V, Osborne EJ, Dermauw W, Ngoc PC, Ortego F, Hernandez-Crespo P, Diaz I, Martinez M, Navajas M, Sucena E, Magalhaes S, Nagy L, Pace RM, Djuranovic S, Smagghe G, Iga M, Christiaens O, Veenstra JA, Ewer J, Villalobos RM, Hutter JL, Hudson SD, Velez M, Yi SV, Zeng J, Pires- daSilva A, Roch F, Cazaux M, Navarro M, Zhurov V, Acevedo G, Bjelica A, Fawcett JA, Bonnet E, Martens C, Baele G, Wissler L, Sanchez- Rodriguez A, Tirry L, Blais C, Demeestere K, Henz SR, Gregory TR, Mathieu J, Verdon L, Farinelli L, Schmutz J, Lindquist E, Feyereisen R, 256
Van de Peer Y (2011) The genome of Tetranychus urticae reveals herbivorous pest adaptations. Nature 479: 487-492 Griffin KL, Anderson OR, Gastrich MD, Lewis JD, Lin G, Schuster W, Seemann JR, Tissue DT, Turnbull MH, Whitehead D (2001) Plant growth in
elevated CO2 alters mitochondrial number and chloroplast fine structure. Proc Natl Acad Sci U S A 98: 2473-2478 Grudzinski W, Matula M, Sielewiesiuk J, Kernen P, Krupa Z, Gruszecki WI (2001) Effect of 13-cis violaxanthin on organization of light harvesting complex II in monomolecular layers. Biochim Biophys Acta 1503: 291-302 Grudzinski W, Nierzwicki L, Welc R, Reszczynska E, Luchowski R, Czub J, Gruszecki WI (2017) Localization and orientation of xanthophylls in a lipid bilayer. Sci Rep 7: 9619 Gruszecki WI, Strzalka K (2005) Carotenoids as modulators of lipid membrane physical properties. Biochim Biophys Acta 1740: 108-115 Gruszecki WI, Strzaŀka K (1991) Does the xanthophyll cycle take part in the regulation of fluidity of the thylakoid membrane? Biochim Biophys Acta 1060: 310-314 Gugel IL, Soll J (2017) Chloroplast differentiation in the growing leaves of Arabidopsis thaliana. Protoplasma 254: 1857-1866 Guo C, Xu Y, Shi M, Lai Y, Wu X, Wang H, Zhu Z, Poethig RS, Wu G (2017) Repression of miR156 by miR159 regulates the timing of the juvenile-to-adult transition in Arabidopsis. Plant Cell 29: 1293-1304 Ha CV, Leyva-Gonzalez MA, Osakabe Y, Tran UT, Nishiyama R, Watanabe Y, Tanaka M, Seki M, Yamaguchi S, Dong NV, Yamaguchi-Shinozaki K, Shinozaki K, Herrera-Estrella L, Tran LS (2014) Positive regulatory role of strigolactone in plant responses to drought and salt stress. Proc Natl Acad Sci U S A 111: 851-856 Hadden WL, Watkins RH, Levy LW, Regalado E, Rivadeneira DM, van Breemen RB, Schwartz SJ (1999) Carotenoid composition of marigold (Tagetes erecta) flower extract used as nutritional supplement. J Agric Food Chem 47: 4189-4194
Hager HA, Ryan GD, Kovacs HM, Newman JA (2016) Effects of elevated CO2 on photosynthetic traits of native and invasive C3 and C4 grasses. BMC Ecol 16: 28
257
Haldimann P (1997) Chilling-induced changes to carotenoid composition, photosynthesis and the maximum quantum yield of photosystem II photochemistry in two maize genotypes differing in tolerance to low temperature. J Plant Physiol 151: 610-619 Haldimann P (1998) Low growth temperature-induced changes to pigment composition and photosynthesis in Zea mays genotypes differing in chilling sensitivity. Plant Cell Environ 21: 200-208 Haldimann P (1999) How do changes in temperature during growth affect leaf pigment composition and photosynthesis in Zea mays genotypes differing in sensitivity to low temperature? J Exp Bot 50: 543-550 Haldimann P, Galle A, Feller U (2008) Impact of an exceptionally hot dry summer on photosynthetic traits in oak (Quercus pubescens) leaves. Tree Physiol 28: 785-795 Han Y, Zheng QS, Wei YP, Chen J, Liu R, Wan HJ (2015) In silico identification and analysis of phytoene synthase genes in plants. Genet Mol Res 14: 9412- 9422 Harada J, Nagashima KV, Takaichi S, Misawa N, Matsuura K, Shimada K (2001) Phytoene desaturase, CrtI, of the purple photosynthetic bacterium, Rubrivivax gelatinosus, produces both neurosporene and lycopene. Plant Cell Physiol 42: 1112-1118 Harris WM, Spurr AR (1969) Chromoplasts of tomato fruits .I. Ultrastructure of low-pigment and high-beta mutants . Carotene analyses. Am J Bot 56: 369-& Harrison PJ, Bugg TD (2014) Enzymology of the carotenoid cleavage dioxygenases: reaction mechanisms, inhibition and biochemical roles. Arch Biochem Biophys 544: 105-111 Harvaux M, Kloppstech K (2001) The protective functions of carotenoid and flavonoid pigments against excess visible radiation at chilling temperature investigated in Arabidopsis npq and tt mutants. Planta 213: 953-966 Hasanuzzaman M, Nahar K, Alam MM, Roychowdhury R, Fujita M (2013) Physiological, biochemical, and molecular mechanisms of heat stress tolerance in plants. Int J Mol Sci 14: 9643-9684 Havaux M (1998) Carotenoids as membrane stabilizers in chloroplasts. Trends Plant Sci 3: 147-151 Havaux M (2014) Carotenoid oxidation products as stress signals in plants. Plant J 79: 597-606 258
Havaux M, Dall'osto L, Bassi R (2007) Zeaxanthin has enhanced antioxidant capacity with respect to all other xanthophylls in Arabidopsis leaves and functions independent of binding to PSII antennae. Plant Physiol 145: 1506- 1520 Havaux M, Dall'Osto L, Cuine S, Giuliano G, Bassi R (2004) The effect of zeaxanthin as the only xanthophyll on the structure and function of the photosynthetic apparatus in Arabidopsis thaliana. J Biol Chem 279: 13878- 13888 Havaux M, Niyogi KK (1999) The violaxanthin cycle protects plants from photooxidative damage by more than one mechanism. Proc Natl Acad Sci U S A 96: 8762-8767 Havaux M, Tardy F, Ravenel J, Chanu D, Parot P (1996) Thylakoid membrane stability to heat stress studied by flash spectroscopic measurements of the electrochromic shift in intact potato leaves: influence of the xanthophyll content. Plant Cell Environ 19: 1359-1368 Heider SA, Wolf N, Hofemeier A, Peters-Wendisch P, Wendisch VF (2014) Optimization of the IPP precursor supply for the production of lycopene, decaprenoxanthin and astaxanthin by Corynebacterium glutamicum. Front Bioeng Biotechnol 2: 28 Hernandez V, Hellin P, Fenoll J, Flores P (2015) Increased temperature produces changes in the bioactive composition of tomato, depending on its developmental stage. J Agric Food Chem 63: 2378-2382 Hikosaka K, Terashima I, Katoh S (1994) Effects of leaf age, nitrogen nutrition and photon flux-density on the distribution of nitrogen among leaves of a vine (Ipomoea-tricolor-cav) grown horizontally to avoid mutual shading of leaves. Oecologia 97: 451-457 Holeski LM, Hillstrom ML, Whitham TG, Lindroth RL (2012) Relative importance of genetic, ontogenetic, induction, and seasonal variation in producing a multivariate defense phenotype in a foundation tree species. Oecologia 170: 695-707 Holleboom CP, Walla PJ (2014) The back and forth of energy transfer between carotenoids and chlorophylls and its role in the regulation of light harvesting. Photosynth Res 119: 215-221
259
Holt NE, Zigmantas D, Valkunas L, Li XP, Niyogi KK, Fleming GR (2005) Carotenoid cation formation and the regulation of photosynthetic light harvesting. Science 307: 433-436 Hormaetxe K, Becerril JM, Hernandez A, Esteban R, Garcia-Plazaola JI (2007) Plasticity of photoprotective mechanisms of Buxus sempervirens L. leaves in response to extreme temperatures. Plant Biol (Stuttg) 9: 59-68 Hou X, Rivers J, Leon P, McQuinn RP, Pogson BJ (2016) Synthesis and function of apocarotenoid signals in plants. Trends Plant Sci 21: 792-803 Houpis JL, Surano KA, Cowles S, Shinn JH (1988) Chlorophyll and carotenoid concentrations in two varieties of Pinus ponderosa seedlings subjected to long- term elevated carbon dioxide. Tree Physiol 4: 187-193 Howitt CA, Pogson BJ (2006) Carotenoid accumulation and function in seeds and non-green tissues. Plant Cell Environ 29: 435-445 Huang M, Abel C, Sohrabi R, Petri J, Haupt I, Cosimano J, Gershenzon J, Tholl D (2010) Variation of herbivore-induced volatile terpenes among Arabidopsis ecotypes depends on allelic differences and subcellular targeting of two terpene synthases, TPS02 and TPS03. Plant Physiol 153: 1293-1310 Hussain A, Larsson H, Kuktaite R, Olsson ME, Johansson E (2015) Carotenoid content in organically produced wheat: Relevance for human nutritional health on consumption. Int J Environ Res Public Health 12: 14068-14083 Huve K, Bichele I, Rasulov B, Niinemets U (2011) When it is too hot for photosynthesis: heat-induced instability of photosynthesis in relation to
respiratory burst, cell permeability changes and H2O2 formation. Plant Cell Environ 34: 113-126 Ibrahim MH, Jaafar HZ, Karimi E, Ghasemzadeh A (2014) Allocation of secondary metabolites, photosynthetic capacity, and antioxidant activity of
Kacip Fatimah (Labisia pumila Benth) in response to CO2 and light intensity. ScientificWorldJournal 2014: 360290 Ilik P, Kotabova E, Spundova M, Novak O, Kana R, Strzalka K (2010) Low- light-induced violaxanthin de-epoxidation in shortly preheated leaves: uncoupling from Delta pH-dependent nonphotochemical quenching. Photochem Photobiol 86: 722-726 Isaacson T, Ohad I, Beyer P, Hirschberg J (2004) Analysis in vitro of the enzyme CRTISO establishes a poly-cis-carotenoid biosynthesis pathway in plants. Plant Physiol 136: 4246-4255 260
Ishihara H, Obata T, Sulpice R, Fernie AR, Stitt M (2015) Quantifying protein 13 synthesis and degradation in Arabidopsis by dynamic CO2 labeling and analysis of enrichment in individual amino acids in their free pools and in protein. Plant Physiol 168: 74-93 Islam SN, Nusrat T, Begum P, Ahsan M (2016) Carotenoids and beta-carotene in orange fleshed sweet potato: A possible solution to vitamin A deficiency. Food Chem 199: 628-631 Jacquot JP (2018) Dark deactivation of chloroplast enzymes finally comes to light. Proc Natl Acad Sci U S A 115: 9334-9335 Jahns P, Holzwarth AR (2012) The role of the xanthophyll cycle and of lutein in photoprotection of photosystem II. Biochim Biophys Acta 1817: 182-193 Janska A, Marsik P, Zelenkova S, Ovesna J (2010) Cold stress and acclimation - what is important for metabolic adjustment? Plant Biol (Stuttg) 12: 395-405 Jarvis P, Lopez-Juez E (2013) Biogenesis and homeostasis of chloroplasts and other plastids. Nat Rev Mol Cell Biol 14: 787-802 Je SM, Woo SY, Lee SH, Kwak MJ, Lee TY, Kim SH (2017) Combined effect of
elevated CO2 concentration and drought on the photosynthetic apparatus and leaf morphology traits in seedlings of yellow poplar. Ecol Res 33: 403-412 Jiang CZ, Rodermel SR (1995) Regulation of photosynthesis during leaf development in rbcs antisense DNA mutants of tobacco. Plant Physiol 107: 215- 224 Jiang X, Li H, Wang T, Peng C, Wang H, Wu H, Wang X (2012) Gibberellin indirectly promotes chloroplast biogenesis as a means to maintain the chloroplast population of expanded cells. Plant J 72: 768-780 Jin B, Wang L, Wang J, Jiang KZ, Wang Y, Jiang XX, Ni CY, Wang YL, Teng NJ (2011) The effect of experimental warming on leaf functional traits, leaf structure and leaf biochemistry in Arabidopsis thaliana. BMC Plant Biol 11: 35 Jin H, Li M, Duan S, Fu M, Dong X, Liu B, Feng D, Wang J, Wang HB (2016) Optimization of light-harvesting pigment improves photosynthetic efficiency. Plant Physiol 172: 1720-1731 Jin J, Tang C, Sale P (2015) The impact of elevated carbon dioxide on the phosphorus nutrition of plants: a review. Ann Bot 116: 987-999 Johansson H, Jones HJ, Foreman J, Hemsted JR, Stewart K, Grima R, Halliday KJ (2014) Arabidopsis cell expansion is controlled by a photothermal switch. Nat Commun 5: 4848 261
Jung JH, Seo PJ, Kang SK, Park CM (2011) miR172 signals are incorporated into the miR156 signaling pathway at the SPL3/4/5 genes in Arabidopsis developmental transitions. Plant Mol Biol 76: 35-45 Jung S (2004) Effect of chlorophyll reduction in Arabidopsis thaliana by methyl jasmonate or norflurazon on antioxidant systems. Plant Physiol Biochem 42: 225-231 Kambakam S, Bhattacharjee U, Petrich J, Rodermel S (2016) PTOX mediates novel pathways of electron transport in etioplasts of Arabidopsis. Mol Plant 9: 1240-1259 Kang J, Yim S, Choi H, Kim A, Lee KP, Lopez-Molina L, Martinoia E, Lee Y (2015) Abscisic acid transporters cooperate to control seed germination. Nat Commun 6: 8113 Kapulnik Y, Delaux PM, Resnick N, Mayzlish-Gati E, Wininger S, Bhattacharya C, Sejalon-Delmas N, Combier JP, Becard G, Belausov E, Beeckman T, Dor E, Hershenhorn J, Koltai H (2011) Strigolactones affect lateral root formation and root-hair elongation in Arabidopsis. Planta 233: 209-216 Kapulnik Y, Koltai H (2014) Strigolactone involvement in root development, response to abiotic stress, and interactions with the biotic soil environment. Plant Physiol 166: 560-569
Karowe DN, Grubb C (2011) Elevated CO2 increases constitutive phenolics and trichomes, but decreases inducibility of phenolics in Brassica rapa (Brassicaceae). J Chem Ecol 37: 1332-1340 Karrer P (1934) The chemistry of vitamins A and C. Chem Rev 14: 17-30 Kato MC, Hikosaka K, Hirotsu N, Makino A, Hirose T (2003) The excess light energy that is neither utilized in photosynthesis nor dissipated by photoprotective mechanisms determines the rate of photoinactivation in photosystem II. Plant Cell Physiol 44: 318-325 Keech O, Pesquet E, Ahad A, Askne A, Nordvall D, Vodnala SM, Tuominen H, Hurry V, Dizengremel P, Gardestrom P (2007) The different fates of mitochondria and chloroplasts during dark-induced senescence in Arabidopsis leaves. Plant Cell Environ 30: 1523-1534 Keller Y, Bouvier F, d'Harlingue A, Camara B (1998) Metabolic compartmentation of plastid prenyllipid biosynthesis-evidence for the involvement of a multifunctional geranylgeranyl reductase. Eur J Biochem 251: 413-417 262
Kerstetter RA, Poethig RS (1998) The specification of leaf identity during shoot development. Annu Rev Cell Dev Biol 14: 373-398 Kim JE, Rensing KH, Douglas CJ, Cheng KM (2010) Chromoplasts ultrastructure and estimated carotene content in root secondary phloem of different carrot varieties. Planta 231: 549-558 Kim SG, Yon F, Gaquerel E, Gulati J, Baldwin IT (2011) Tissue specific diurnal rhythms of metabolites and their regulation during herbivore attack in a native tobacco, Nicotiana attenuata. PLoS One 6: e26214 Kim SH, Kim YH, Ahn YO, Ahn MJ, Jeong JC, Lee HS, Kwak SS (2013) Downregulation of the lycopene epsilon-cyclase gene increases carotenoid synthesis via the beta-branch-specific pathway and enhances salt-stress tolerance in sweetpotato transgenic calli. Physiol Plant 147: 432-442 Kirchhoff H, Hall C, Wood M, Herbstova M, Tsabari O, Nevo R, Charuvi D, Shimoni E, Reich Z (2011) Dynamic control of protein diffusion within the granal thylakoid lumen. Proc Natl Acad Sci U S A 108: 20248-20253 Kitajima K, Hogan KP (2003) Increases of chlorophyll a/b ratios during acclimation of tropical woody seedlings to nitrogen limitation and high light. Plant Cell Environ 26: 857-865 Klassen JL (2010) Phylogenetic and evolutionary patterns in microbial carotenoid biosynthesis are revealed by comparative genomics. PLoS One 5: e11257 Klepikova AV, Kasianov AS, Gerasimov ES, Logacheva MD, Penin AA (2016) A high resolution map of the Arabidopsis thaliana developmental transcriptome based on RNA-seq profiling. Plant J 88: 1058-1070 Kliebenstein DJ (2004) Secondary metabolites and plant/environment interactions: a view through Arabidopsis thaliana tinged glasses. Plant Cell Environ 27: 675- 684 Knight MR, Knight H (2012) Low-temperature perception leading to gene expression and cold tolerance in higher plants. New Phytol 195: 737-751 Kooij TAW, Kok LJD, Stulen I (1999) Biomass production and carbohydrate
content of Arabidopsis thaliana at atmospheric CO2 concentrations from 390 to 1680 μl l-1. Plant Biol (Stuttg) 1: 482-486 Kopsell DA, Kopsell DE, Curran-Celentano J (2007) Carotenoid pigments in kale are influenced by nitrogen concentration and form. J Sci Food Agr 87: 900-907
263
Kopsell DA, Pantanizopoulos NI, Sams CE, Kopsell DE (2012) Shoot tissue pigment levels increase in ‘Florida Broadleaf’ mustard (Brassica juncea L.) microgreens following high light treatment. Sci Hortic-Amsterdam 140: 96-99 Korner C (2016) Plant adaptation to cold climates. F1000Res 5: F1000 Faculty Rev- 2769 Koschmieder J, Fehling-Kaschek M, Schaub P, Ghisla S, Brausemann A, Timmer J, Beyer P (2017) Plant-type phytoene desaturase: Functional evaluation of structural implications. PLoS One 12: e0187628 Krapp A, Quick WP, Stitt M (1991) Ribulose-1,5-bisphosphate carboxylase- oxygenase, other Calvin-cycle enzymes, and chlorophyll decrease when glucose is supplied to mature spinach leaves via the transpiration stream. Planta 186: 58- 69 Kruger F, Schumacher K (2018) Pumping up the volume - vacuole biogenesis in Arabidopsis thaliana. Semin Cell Dev Biol 80: 106-112
Kumari S, Agrawal M, Tiwari S (2013) Impact of elevated CO2 and elevated O3 on Beta vulgaris L.: pigments, metabolites, antioxidants, growth and yield. Environ Pollut 174: 279-288 Kupisz K, Sujak A, Patyra M, Trebacz K, Gruszecki WI (2008) Can membrane- bound carotenoid pigment zeaxanthin carry out a transmembrane proton transfer? Biochim Biophys Acta 1778: 2334-2340 Kusama Y, Inoue S, Jimbo H, Takaichi S, Sonoike K, Hihara Y, Nishiyama Y (2015) Zeaxanthin and echinenone protect the repair of photosystem ii from inhibition by singlet oxygen in Synechocystis sp. PCC 6803. Plant Cell Physiol 56: 906-916 Kutík J, Kočova M, Holá D, Körnerová M (1999) The development of chloroplast ultrastructure and Hill reaction activity during leaf ontogeny in different maize (Zea mays L.) genotypes. Photosynthetica 36: 497-507 Lamberts L, Delcour JA (2008) Carotenoids in raw and parboiled brown and milled rice. J Agric Food Chem 56: 11914-11919 Lamers PP, Janssen M, De Vos RC, Bino RJ, Wijffels RH (2012) Carotenoid and fatty acid metabolism in nitrogen-starved Dunaliella salina, a unicellular green microalga. J Biotechnol 162: 21-27 Lamers PP, van de Laak CC, Kaasenbrood PS, Lorier J, Janssen M, De Vos RC, Bino RJ, Wijffels RH (2010) Carotenoid and fatty acid metabolism in light- stressed Dunaliella salina. Biotechnol Bioeng 106: 638-648 264
Lang V, Mantyla E, Welin B, Sundberg B, Palva ET (1994) Alterations in water status, endogenous abscisic acid content, and expression of rab18 gene during the development of freezing tolerance in Arabidopsis thaliana. Plant Physiol 104: 1341-1349 Latari K, Wust F, Hubner M, Schaub P, Beisel KG, Matsubara S, Beyer P, Welsch R (2015) Tissue-specific apocarotenoid glycosylation contributes to carotenoid homeostasis in Arabidopsis leaves. Plant Physiol 168: 1550-1562 Latowski D, Kruk J, Burda K, Skrzynecka-Jaskier M, Kostecka-Gugala A, Strzalka K (2002) Kinetics of violaxanthin de-epoxidation by violaxanthin de- epoxidase, a xanthophyll cycle enzyme, is regulated by membrane fluidity in model lipid bilayers. Eur J Biochem 269: 4656-4665 Lawanson AO, Fanimokun VO, Adelusi SA (1978) Heat-induced quantitative changes in carotenoids and protochlorophyll precursors in Zea mays. Z Pflanzenphysiol 86: 423-431 Lefsrud MG, Kopsell DA, Kopsell DE (2007) Nitrogen levels influence biomass, elemental accumulations, and pigment concentrations in spinach. J Plant Nutr 30: 171-185 Lefsrud MG, Kopsell DA, Kopsell DE, Curran-Celentano J (2005) Air temperature affects biomass and carotenoid pigment accumulation in kale and spinach grown in a controlled environment. HortScience 40: 2026-2030 Lehmeier C, Pajor R, Lundgren MR, Mathers A, Sloan J, Bauch M, Mitchell A, Bellasio C, Green A, Bouyer D, Schnittger A, Sturrock C, Osborne CP, Rolfe S, Mooney S, Fleming AJ (2017) Cell density and airspace patterning in the leaf can be manipulated to increase leaf photosynthetic capacity. Plant J 92: 981-994 Li DX, Liu HL, Qiao YZ, Wang YN, Dong BD, Cai ZM, Shi CH, Liu YY, Li X, Liu MY (2013) Physiological regulation of soybean (Glycine max L. Merr.)
growth in response to drought under elevated CO2. J Food Agric Environ 11: 649-654 Li F, Vallabhaneni R, Wurtzel ET (2008) PSY3, a new member of the phytoene synthase gene family conserved in the Poaceae and regulator of abiotic stress- induced root carotenogenesis. Plant Physiol 146: 1333-1345 Li F, Vallabhaneni R, Yu J, Rocheford T, Wurtzel ET (2008) The maize phytoene synthase gene family: overlapping roles for carotenogenesis in endosperm,
265
photomorphogenesis, and thermal stress tolerance. Plant Physiol 147: 1334- 1346 Li L, Yuan H (2013) Chromoplast biogenesis and carotenoid accumulation. Arch Biochem Biophys 539: 102-109 Li L, Yuan H, Zeng Y, Xu Q (2016) Plastids and carotenoid accumulation. Subcell Biochem 79: 273-293 Li N, Lin G, Kwan YW, Min ZD (1999) Simultaneous quantification of five major biologically active ingredients of saffron by high-performance liquid chromatography. J Chromatogr A 849: 349-355 Li P, Ainsworth EA, Leakey AD, Ulanov A, Lozovaya V, Ort DR, Bohnert HJ (2008) Arabidopsis transcript and metabolite profiles: ecotype-specific
responses to open-air elevated CO2. Plant Cell Environ 31: 1673-1687 Li P, Sioson A, Mane SP, Ulanov A, Grothaus G, Heath LS, Murali TM, Bohnert HJ, Grene R (2006) Response diversity of Arabidopsis thaliana ecotypes in
elevated CO2 in the field. Plant Mol Biol 62: 593-609 Li R, Kang C, Song X, Yu L, Liu D, He S, Zhai H, Liu Q (2017) A zeta-carotene desaturase gene, IbZDS, increases beta-carotene and lutein contents and enhances salt tolerance in transgenic sweetpotato. Plant Sci 262: 39-51 Li X, Zhang G, Sun B, Zhang S, Zhang Y, Liao Y, Zhou Y, Xia X, Shi K, Yu J (2013) Stimulated leaf dark respiration in tomato in an elevated carbon dioxide atmosphere. Sci Rep 3: 3433 Li Z, Ahn TK, Avenson TJ, Ballottari M, Cruz JA, Kramer DM, Bassi R, Fleming GR, Keasling JD, Niyogi KK (2009) Lutein accumulation in the absence of zeaxanthin restores nonphotochemical quenching in the Arabidopsis thaliana npq1 mutant. Plant Cell 21: 1798-1812 Liang C, Zhao F, Wei W, Wen Z, Qin S (2006) Carotenoid biosynthesis in cyanobacteria: structural and evolutionary scenarios based on comparative genomics. Int J Biol Sci 2: 197-207 Liguori N, Periole X, Marrink SJ, Croce R (2015) From light-harvesting to photoprotection: structural basis of the dynamic switch of the major antenna complex of plants (LHCII). Sci Rep 5: 15661 Lim PO, Kim HJ, Nam HG (2007) Leaf senescence. Annu Rev Plant Biol 58: 115- 136 Lin YS, Medlyn BE, Ellsworth DS (2012) Temperature responses of leaf net photosynthesis: the role of component processes. Tree Physiol 32: 219-231 266
Liu C, Zou D (2015) Responses of elevated CO2 on photosynthesis and nitrogen metabolism in Ulva lactuca (Chlorophyta) at different temperature levels. Mar Biol Res 11: 1043-1052 Liu H, Mao J, Yan S, Yu Y, Xie L, Hu JG, Li T, Abbasi AM, Guo X, Liu RH (2018) Evaluation of carotenoid biosynthesis, accumulation and antioxidant activities in sweetcorn (Zea mays L.) during kernel development. Int J Food Sci Tech 53: 381-388 Liu J, Feng L, Li J, He Z (2015) Genetic and epigenetic control of plant heat responses. Front Plant Sci 6: 267 Liu L, Shao Z, Zhang M, Wang Q (2015) Regulation of carotenoid metabolism in tomato. Mol Plant 8: 28-39 Liu R, How-Kit A, Stammitti L, Teyssier E, Rolin D, Mortain-Bertrand A, Halle S, Liu M, Kong J, Wu C, Degraeve-Guibault C, Chapman NH, Maucourt M, Hodgman TC, Tost J, Bouzayen M, Hong Y, Seymour GB, Giovannoni JJ, Gallusci P (2015) A DEMETER-like DNA demethylase governs tomato fruit ripening. Proc Natl Acad Sci U S A 112: 10804-10809 Liu X, Zhou Y, Xiao J, Bao F (2018) Effects of chilling on the structure, function and development of chloroplasts. Front Plant Sci 9: 1715 Llorente B (2016) Regulation of carotenoid biosynthesis in photosynthetic organs. In C Stange, ed, Carotenoids in Nature: Biosynthesis, Regulation and Function. Springer International Publishing, Cham, pp 141-160 Llorente B, Martinez-Garcia JF, Stange C, Rodriguez-Concepcion M (2017) Illuminating colors: regulation of carotenoid biosynthesis and accumulation by light. Curr Opin Plant Biol 37: 49-55 Lobato AKS, Gonçalves-Vidigal MC, Vidigal Filho PS, Andrade CAB, Kvitschal MV, Bonato CM (2010) Relationships between leaf pigments and photosynthesis in common bean plants infected by anthracnose. New Zeal J Crop Hort 38: 29-37 Logan BA, Combs A, Myers K, Kent R, Stanley L, Tissue DT (2009) Seasonal response of photosynthetic electron transport and energy dissipation in the
eighth year of exposure to elevated atmospheric CO2 (FACE) in Pinus taeda (loblolly pine). Tree Physiol 29: 789-797 Logan BA, Grace SC, Adams Iii WW, Demmig-Adams B (1998) Seasonal differences in xanthophyll cycle characteristics and antioxidants in Mahonia repens growing in different light environments. Oecologia 116: 9-17 267
Logan BA, Hricko CR, Lewis JD, Ghannoum O, Phillips NG, Smith R, Conroy
JP, Tissue DT (2010) Examination of pre-industrial and future CO2 reveals the
temperature-dependent CO2 sensitivity of light energy partitioning at PSII in eucalypts. Funct Plant Biol 37: 1041-1049 Lois LM, Rodriguez-Concepcion M, Gallego F, Campos N, Boronat A (2000) Carotenoid biosynthesis during tomato fruit development: regulatory role of 1- deoxy-D-xylulose 5-phosphate synthase. Plant J 22: 503-513 Loivamaki M, Gilmer F, Fischbach RJ, Sorgel C, Bachl A, Walter A, Schnitzler JP (2007) Arabidopsis, a model to study biological functions of isoprene emission? Plant Physiol 144: 1066-1078
Loladze I (2002) Rising atmospheric CO2 and human nutrition: toward globally imbalanced plant stoichiometry? Trends Ecol Evol 17: 457-461 Lopez-Emparan A, Quezada-Martinez D, Zuniga-Bustos M, Cifuentes V, Iniguez-Luy F, Federico ML (2014) Functional analysis of the Brassica napus L. phytoene synthase (PSY) gene family. PLoS One 9: e114878 Lopez-Raez JA, Fernandez I, Garcia JM, Berrio E, Bonfante P, Walter MH, Pozo MJ (2015) Differential spatio-temporal expression of carotenoid cleavage dioxygenases regulates apocarotenoid fluxes during AM symbiosis. Plant Sci 230: 59-69 Lopez-Raez JA, Kohlen W, Charnikhova T, Mulder P, Undas AK, Sergeant MJ, Verstappen F, Bugg TD, Thompson AJ, Ruyter-Spira C, Bouwmeester H (2010) Does abscisic acid affect strigolactone biosynthesis? New Phytol 187: 343-354 Lopez AB, Van Eck J, Conlin BJ, Paolillo DJ, O'Neill J, Li L (2008) Effect of the cauliflower Or transgene on carotenoid accumulation and chromoplast formation in transgenic potato tubers. J Exp Bot 59: 213-223 Lu S, Van Eck J, Zhou X, Lopez AB, O'Halloran DM, Cosman KM, Conlin BJ, Paolillo DJ, Garvin DF, Vrebalov J, Kochian LV, Kupper H, Earle ED, Cao J, Li L (2006) The cauliflower Or gene encodes a DnaJ cysteine-rich domain-containing protein that mediates high levels of beta-carotene accumulation. Plant Cell 18: 3594-3605 Lv S, Zhang Y, Li C, Liu Z, Yang N, Pan L, Wu J, Wang J, Yang J, Lv Y, Zhang Y, Jiang W, She X, Wang G (2018) Strigolactone-triggered stomatal closure requires hydrogen peroxide synthesis and nitric oxide production in an abscisic acid-independent manner. New Phytol 217: 290-304 268
Maass D, Arango J, Wust F, Beyer P, Welsch R (2009) Carotenoid crystal formation in Arabidopsis and carrot roots caused by increased phytoene synthase protein levels. PLoS One 4: e6373 Magdaong NCM, Blankenship RE (2018) Photoprotective, excited-state quenching mechanisms in diverse photosynthetic organisms. J Biol Chem 293: 5018-5025 Magyar A, Bowman MK, Molnar P, Kispert L (2013) Neutral carotenoid radicals in photoprotection of wild-type Arabidopsis thaliana. J Phys Chem B 117: 2239-2246 Mapelli-Brahm P, Corte-Real J, Melendez-Martinez AJ, Bohn T (2017) Bioaccessibility of phytoene and phytofluene is superior to other carotenoids from selected fruit and vegetable juices. Food Chem 229: 304-311 Marin N, Morales F, Lodeiros C, Tamigneaux E (1998) Effect of nitrate concentration on growth and pigment synthesis of Dunaliella salina cultivated under low illumination and preadapted to different salinities. J Appl Phycol 10: 405-411
Marty C, BassiriRad H (2014) Seed germination and rising atmospheric CO2 concentration: a meta-analysis of parental and direct effects. New Phytol 202: 401-414 Matile P, Hortensteiner S, Thomas H (1999) Chlorophyll Degradation. Annu Rev Plant Physiol Plant Mol Biol 50: 67-95 Mayfield SP, Nelson T, Taylor WC (1986) The fate of chloroplast proteins during photooxidation in carotenoid-deficient maize leaves. Plant Physiol 82: 760-764 Mazor Y, Borovikova A, Caspy I, Nelson N (2017) Structure of the plant photosystem I supercomplex at 2.6 A resolution. Nat Plants 3: 17014 McQuinn RP, Wong B, Giovannoni JJ (2018) AtPDS overexpression in tomato: exposing unique patterns of carotenoid self-regulation and an alternative strategy for the enhancement of fruit carotenoid content. Plant Biotechnol J 16: 482-494 Meier S, Tzfadia O, Vallabhaneni R, Gehring C, Wurtzel ET (2011) A transcriptional analysis of carotenoid, chlorophyll and plastidial isoprenoid biosynthesis genes during development and osmotic stress responses in Arabidopsis thaliana. BMC Syst Biol 5: 77 Melaragno JE, Mehrotra B, Coleman AW (1993) Relationship between endopolyploidy and cell size in epidermal tissue of Arabidopsis. Plant Cell 5: 1661-1668 269
Michaels SD, Bezerra IC, Amasino RM (2004) FRIGIDA-related genes are required for the winter-annual habit in Arabidopsis. Proc Natl Acad Sci U S A 101: 3281-3285 Milanowska J, Gruszecki WI (2005) Heat-induced and light-induced isomerization of the xanthophyll pigment zeaxanthin. J Photochem Photobiol B 80: 178-186 Miliauskienė J, Sakalauskienė S, Lazauskas S, Povilaitis V, Brazaitytė A, Duchovskis P (2016) The competition between winter rape (C3) and maize (C4) plants in response to elevated carbon dioxide and temperature, and drought stress. Zemdirbyste-Agriculture 103: 21-28 Minguez-Mosquera MI, Hornero-Mendez D (1994) Changes in carotenoid esterification during the fruit ripening of Capsicum annuum Cv. Bola. J Agric Food Chem 42: 640-644 Mishra S, Heckathorn SA, Barua D, Wang D, Joshi P, Hamilton Iii EW, Frantz
J (2008) Interactive effects of elevated CO2 and ozone on leaf thermotolerance in field-grown Glycine max. J Integr Plant Biol 50: 1396-1405
Misra BB, Chen SX (2015) Advances in understanding CO2 responsive plant metabolomes in the era of climate change. Metabolomics 11: 1478-1491 Mochizuki N, Tanaka R, Tanaka A, Masuda T, Nagatani A (2008) The steady- state level of Mg-protoporphyrin IX is not a determinant of plastid-to-nucleus signaling in Arabidopsis. Proc Natl Acad Sci U S A 105: 15184-15189 Mohamed HE, van de Meene AM, Roberson RW, Vermaas WF (2005) Myxoxanthophyll is required for normal cell wall structure and thylakoid organization in the cyanobacterium Synechocystis sp. strain PCC 6803. J Bacteriol 187: 6883-6892 Moise AR, Al-Babili S, Wurtzel ET (2014) Mechanistic aspects of carotenoid biosynthesis. Chem Rev 114: 164-193 Monma M, Ito M, Saito M, Chikuni K (2014) Carotenoid components in soybean seeds varying with seed color and maturation stage. Biosci Biotechnol Biochem 58: 926-930 Moore BD, Andrew RL, Kulheim C, Foley WJ (2014) Explaining intraspecific diversity in plant secondary metabolites in an ecological context. New Phytol 201: 733-750 Moore BD, Cheng SH, Rice J, Seemann JR (1998) Sucrose cycling, Rubisco expression, and prediction of photosynthetic acclimation to elevated
atmospheric CO2. Plant Cell Environ 21: 905-915 270
Moran NA, Jarvik T (2010) Lateral transfer of genes from fungi underlies carotenoid production in aphids. Science 328: 624-627 Moreno JC, Cerda A, Simpson K, Lopez-Diaz I, Carrera E, Handford M, Stange C (2016) Increased Nicotiana tabacum fitness through positive regulation of carotenoid, gibberellin and chlorophyll pathways promoted by Daucus carota lycopene beta-cyclase (Dclcyb1) expression. J Exp Bot 67: 2325-2338 Morris WL, Ducreux L, Griffiths DW, Stewart D, Davies HV, Taylor MA (2004) Carotenogenesis during tuber development and storage in potato. J Exp Bot 55: 975-982 Mortain-Bertrand A, Stammitti L, Telef N, Colardelle P, Brouquisse R, Rolin D, Gallusci P (2008) Effects of exogenous glucose on carotenoid accumulation in tomato leaves. Physiol Plant 134: 246-256 Moulin M, McCormac AC, Terry MJ, Smith AG (2008) Tetrapyrrole profiling in Arabidopsis seedlings reveals that retrograde plastid nuclear signaling is not due to Mg-protoporphyrin IX accumulation. Proc Natl Acad Sci U S A 105: 15178- 15183 Myers SS, Zanobetti A, Kloog I, Huybers P, Leakey AD, Bloom AJ, Carlisle E, Dietterich LH, Fitzgerald G, Hasegawa T, Holbrook NM, Nelson RL, Ottman MJ, Raboy V, Sakai H, Sartor KA, Schwartz J, Seneweera S,
Tausz M, Usui Y (2014) Increasing CO2 threatens human nutrition. Nature 510: 139-142 Nagele T, Stutz S, Hormiller, II, Heyer AG (2012) Identification of a metabolic bottleneck for cold acclimation in Arabidopsis thaliana. Plant J 72: 102-114 Nagelmuller S, Kirchgessner N, Yates S, Hiltpold M, Walter A (2016) Leaf Length Tracker: a novel approach to analyse leaf elongation close to the thermal limit of growth in the field. J Exp Bot 67: 1897-1906 Nambara E, Marion-Poll A (2005) Abscisic acid biosynthesis and catabolism. Annu Rev Plant Biol 56: 165-185 Namitha KK, Archana SN, Negi PS (2011) Expression of carotenoid biosynthetic pathway genes and changes in carotenoids during ripening in tomato (Lycopersicon esculentum). Food Funct 2: 168-173 Nangle EJ, Gardner DS, Metzger JD, Rodriguez-Saona L, Guisti MM, Danneberger TK, Petrella DP (2015) Pigment changes in cool-season turfgrasses in response to Ultraviolet-B light irradiance. Agron J 107: 41-50
271
Nath K, Phee BK, Jeong S, Lee SY, Tateno Y, Allakhverdiev SI, Lee CH, Nam HG (2013) Age-dependent changes in the functions and compositions of photosynthetic complexes in the thylakoid membranes of Arabidopsis thaliana. Photosynth Res 117: 547-556 Nawrocki WJ, Tourasse NJ, Taly A, Rappaport F, Wollman FA (2015) The plastid terminal oxidase: its elusive function points to multiple contributions to plastid physiology. Annu Rev Plant Biol 66: 49-74 Nguyen ST, Greaves T, McCurdy DW (2017) Heteroblastic development of transfer cells is controlled by the microRNA miR156/SPL module. Plant Physiol 173: 1676-1691 Niinemets U (2018) When leaves go over the thermal edge. Plant Cell Environ 41: 1247-1250 Niinemets U, Sun Z (2015) How light, temperature, and measurement and growth
CO2 interactively control isoprene emission in hybrid aspen. J Exp Bot 66: 841- 851 Nisar N, Li L, Lu S, Khin NC, Pogson BJ (2015) Carotenoid metabolism in plants. Mol Plant 8: 68-82 Niyogi KK (1999) PHOTOPROTECTION REVISITED: Genetic and molecular approaches. Annu Rev Plant Physiol Plant Mol Biol 50: 333-359 Niyogi KK, Grossman AR, Bjorkman O (1998) Arabidopsis mutants define a central role for the xanthophyll cycle in the regulation of photosynthetic energy conversion. Plant Cell 10: 1121-1134 Noguchi K, Watanabe CK, Terashima I (2015) Effects of elevated atmospheric
CO2 on primary metabolite levels in Arabidopsis thaliana Col-0 leaves: An examination of metabolome data. Plant Cell Physiol 56: 2069-2078 Noguchi T, Hayashi Y (2014) Vacuoles and storage organelles. In T Noguchi, S Kawano, H Tsukaya, S Matsunaga, A Sakai, I Karahara, Y Hayashi, eds, Atlas of Plant Cell Structure. Springer Japan, Tokyo, pp 89-106 Novakova E, Moran NA (2012) Diversification of genes for carotenoid biosynthesis in aphids following an ancient transfer from a fungus. Mol Biol Evol 29: 313- 323 O'Hare TJ, Fanning KJ, Martin IF (2015) Zeaxanthin biofortification of sweet- corn and factors affecting zeaxanthin accumulation and colour change. Arch Biochem Biophys 572: 184-187
272
O'Sullivan OS, Heskel MA, Reich PB, Tjoelker MG, Weerasinghe LK, Penillard A, Zhu L, Egerton JJ, Bloomfield KJ, Creek D, Bahar NH, Griffin KL, Hurry V, Meir P, Turnbull MH, Atkin OK (2017) Thermal limits of leaf metabolism across biomes. Glob Chang Biol 23: 209-223 Ormrod DP, Lesser VM, Olszyk DM, Tingey DT (1999) Elevated temperature and carbon dioxide affect chlorophylls and carotenoids in Douglas‐Fir seedlings. Int J Plant Sci 160: 529-534 Osteryoung KW, Pyke KA (2014) Division and dynamic morphology of plastids. Annu Rev Plant Biol 65: 443-472 Pantin F, Simonneau T, Rolland G, Dauzat M, Muller B (2011) Control of leaf expansion: a developmental switch from metabolics to hydraulics. Plant Physiol 156: 803-815 Papageorgiou GC, Govindjee (2014) The non-photochemical quenching of the electronically excited state of chlorophyll a in plants: Definitions, timelines, viewpoints, open questions. In B Demmig-Adams, G Garab, W Adams Iii, Govindjee, eds, Non-Photochemical Quenching and Energy Dissipation in Plants, Algae and Cyanobacteria. Springer Netherlands, Dordrecht, pp 1-44 Paredes M, Quiles MJ (2015) The effects of cold stress on photosynthesis in Hibiscus plants. PLoS One 10: e0137472 Park H, Kreunen SS, Cuttriss AJ, DellaPenna D, Pogson BJ (2002) Identification of the carotenoid isomerase provides insight into carotenoid biosynthesis, prolamellar body formation, and photomorphogenesis. Plant Cell 14: 321-332 Park JH, Jung S (2017) Perturbations of carotenoid and tetrapyrrole biosynthetic pathways result in differential alterations in chloroplast function and plastid signaling. Biochem Biophys Res Commun 482: 672-677 Parthier B (1988) Gerontoplasts-the yellow end in the ontogenesis of chloroplasts. Endocytobiosis Cell Res 5: 28 Pascal AA, Liu Z, Broess K, van Oort B, van Amerongen H, Wang C, Horton P, Robert B, Chang W, Ruban A (2005) Molecular basis of photoprotection and control of photosynthetic light-harvesting. Nature 436: 134-137 Pattison RJ, Csukasi F, Zheng Y, Fei Z, van der Knaap E, Catala C (2015) Comprehensive tissue-specific transcriptome analysis reveals distinct regulatory programs during early tomato fruit development. Plant Physiol 168: 1684-1701 Pérez-López U, Miranda-Apodaca J, Lacuesta M, Mena-Petite A, Muñoz-Rueda A (2015) Growth and nutritional quality improvement in two differently 273
pigmented lettuce cultivars grown under elevated CO2 and/or salinity. Sci Hortic-Amsterdam 195: 56-66 Pérez-López U, Miranda-Apodaca J, Muñoz-Rueda A, Mena-Petite A (2015)
Interacting effects of high light and elevated CO2 on the nutraceutical quality of two differently pigmented Lactuca sativa cultivars (Blonde of Paris Batavia and Oak Leaf). Sci Hortic-Amsterdam 191: 38-48 Pérez-Pérez ME, Couso I, Crespo JL (2012) Carotenoid deficiency triggers autophagy in the model green alga Chlamydomonas reinhardtii. Autophagy 8: 376-388 Philippar K, Geis T, Ilkavets I, Oster U, Schwenkert S, Meurer J, Soll J (2007) Chloroplast biogenesis: the use of mutants to study the etioplast-chloroplast transition. Proc Natl Acad Sci U S A 104: 678-683 Poethig RS (1997) Leaf morphogenesis in flowering plants. Plant Cell 9: 1077-1087 Poethig RS (2013) Vegetative phase change and shoot maturation in plants. In ER Ann, BOC Michael, eds, Current Topics in Developmental Biology, Vol Volume 105. Academic Press, pp 125-152 Poethig RS, Sussex IM (1985) The developmental morphology and growth dynamics of the tobacco leaf. Planta 165: 158-169 Pogson B, McDonald KA, Truong M, Britton G, DellaPenna D (1996) Arabidopsis carotenoid mutants demonstrate that lutein is not essential for photosynthesis in higher plants. Plant Cell 8: 1627-1639 Pogson BJ, Albrecht V (2011) Genetic dissection of chloroplast biogenesis and development: an overview. Plant Physiol 155: 1545-1551 Pogson BJ, Ganguly D, Albrecht-Borth V (2015) Insights into chloroplast biogenesis and development. Biochim Biophys Acta 1847: 1017-1024 Pogson BJ, Niyogi KK, Bjorkman O, DellaPenna D (1998) Altered xanthophyll compositions adversely affect chlorophyll accumulation and nonphotochemical quenching in Arabidopsis mutants. Proc Natl Acad Sci U S A 95: 13324-13329 Pogson BJ, Rissler HM, Frank HA (2005) The roles of carotenoids in photosystem II of higher plants. In T Wydrzynski, K Satoh, eds, Photosystem II: the light- driven water : plastoquinone oxidoreductase, Vol 23. Springer-Verlag, Dordrecht, The Netherlands, (Dordrecht, The Netherlands), pp 515-537 Possingham JV (1980) Plastid replication and development in the life cycle of higher plants. Annu Rev Plant Physiol 31: 113-129
274
Possingham JV, Saurer W (1969) Changes in chloroplast number per cell during leaf development in spinach. Planta 86: 186-194 Prins A, Mukubi JM, Pellny TK, Verrier PJ, Beyene G, Lopes MS, Emami K, Treumann A, Lelarge-Trouverie C, Noctor G, Kunert KJ, Kerchev P,
Foyer CH (2011) Acclimation to high CO2 in maize is related to water status and dependent on leaf rank. Plant Cell Environ 34: 314-331 Pritchard SG, Ju ZL, van Santen E, Qiu JS, Weaver DB, Prior SA, Rogers HH
(2000) The influence of elevated CO2 on the activities of antioxidative enzymes in two soybean genotypes. Aust J Plant Physiol 27: 1061-1068 Pyke KA (2010) Plastid division. AoB Plants 2010: plq016 Qin G, Gu H, Ma L, Peng Y, Deng XW, Chen Z, Qu LJ (2007) Disruption of phytoene desaturase gene results in albino and dwarf phenotypes in Arabidopsis by impairing chlorophyll, carotenoid, and gibberellin biosynthesis. Cell Res 17: 471-482 Qin X, Suga M, Kuang T, Shen JR (2015) Photosynthesis. Structural basis for energy transfer pathways in the plant PSI-LHCI supercomplex. Science 348: 989-995 Quint M, Delker C, Franklin KA, Wigge PA, Halliday KJ, van Zanten M (2016) Molecular and genetic control of plant thermomorphogenesis. Nat Plants 2: 15190 Ramakrishna A, Ravishankar GA (2011) Influence of abiotic stress signals on secondary metabolites in plants. Plant Signal Behav 6: 1720-1731 Ramel F, Birtic S, Ginies C, Soubigou-Taconnat L, Triantaphylides C, Havaux M (2012) Carotenoid oxidation products are stress signals that mediate gene responses to singlet oxygen in plants. Proc Natl Acad Sci U S A 109: 5535- 5540 Reichstein M, Bahn M, Ciais P, Frank D, Mahecha MD, Seneviratne SI, Zscheischler J, Beer C, Buchmann N, Frank DC, Papale D, Rammig A, Smith P, Thonicke K, van der Velde M, Vicca S, Walz A, Wattenbach M (2013) Climate extremes and the carbon cycle. Nature 500: 287-295 Reif C, Arrigoni E, Berger F, Baumgartner D, Nyström L (2013) Lutein and β- carotene content of green leafy Brassica species grown under different conditions. Lwt-Food Sci Technol 53: 378-381
275
Reif C, Arrigoni E, Neuweiler R, Baumgartner D, Nystrom L, Hurrell RF (2012) Effect of sulfur and nitrogen fertilization on the content of nutritionally relevant carotenoids in spinach (Spinacia oleracea). J Agric Food Chem 60: 5819-5824 Richter TK, Hughes CC, Moore BS (2015) Sioxanthin, a novel glycosylated carotenoid, reveals an unusual subclustered biosynthetic pathway. Environ Microbiol 17: 2158-2171 Ritz T, Damjanovic A, Schulten K, Zhang JP, Koyama Y (2000) Efficient light harvesting through carotenoids. Photosynth Res 66: 125-144 Rivers JY (2017) Volatile apocarotenoid biosynthesis and carotenoid catabolism in Arabidopsis thaliana. PhD thesis, Australian National University Roach T, Krieger-Liszkay A (2014) Regulation of photosynthetic electron transport and photoinhibition. Curr Protein Pept Sci 15: 351-362 Roden JS, Ball MC (1996) Growth and photosynthesis of two eucalypt species
during high temperature stress under ambient and elevated CO2. Glob Chang Biol 2: 115-128 Rodriguez-Amaya DB, Kimura M (2004) HarvestPlus handbook for carotenoid analysis. International Food Policy Research Institute (IFPRI) Washington, DC, USA Rodriguez-Concepcion M (2010) Supply of precursors for carotenoid biosynthesis in plants. Arch Biochem Biophys 504: 118-122 Rodriguez-Concepcion M, Ahumada I, Diez-Juez E, Sauret-Gueto S, Lois LM, Gallego F, Carretero-Paulet L, Campos N, Boronat A (2001) 1-Deoxy-D- xylulose 5-phosphate reductoisomerase and plastid isoprenoid biosynthesis during tomato fruit ripening. Plant J 27: 213-222 Rodriguez-Concepcion M, Avalos J, Bonet ML, Boronat A, Gomez-Gomez L, Hornero-Mendez D, Limon MC, Melendez-Martinez AJ, Olmedilla-Alonso B, Palou A, Ribot J, Rodrigo MJ, Zacarias L, Zhu C (2018) A global perspective on carotenoids: Metabolism, biotechnology, and benefits for nutrition and health. Prog Lipid Res 70: 62-93 Rodriguez-Concepcion M, Stange C (2013) Biosynthesis of carotenoids in carrot: an underground story comes to light. Arch Biochem Biophys 539: 110-116 Rodriguez-Ortiz R, Limon MC, Avalos J (2009) Regulation of carotenogenesis and secondary metabolism by nitrogen in wild-type Fusarium fujikuroi and carotenoid-overproducing mutants. Appl Environ Microbiol 75: 405-413
276
Rodriguez-Villalon A, Gas E, Rodriguez-Concepcion M (2009) Colors in the dark: a model for the regulation of carotenoid biosynthesis in etioplasts. Plant Signal Behav 4: 965-967 Rodriguez-Villalon A, Gas E, Rodriguez-Concepcion M (2009) Phytoene synthase activity controls the biosynthesis of carotenoids and the supply of their metabolic precursors in dark-grown Arabidopsis seedlings. Plant J 60: 424-435 Rojo E, Gillmor CS, Kovaleva V, Somerville CR, Raikhel NV (2001) VACUOLELESS1 is an essential gene required for vacuole formation and morphogenesis in Arabidopsis. Dev Cell 1: 303-310 Romer S, Fraser PD, Kiano JW, Shipton CA, Misawa N, Schuch W, Bramley PM (2000) Elevation of the provitamin A content of transgenic tomato plants. Nat Biotechnol 18: 666-669 Rosenstiel TN, Potosnak MJ, Griffin KL, Fall R, Monson RK (2003) Increased
CO2 uncouples growth from isoprene emission in an agriforest ecosystem. Nature 421: 256-259 Rottet S, Devillers J, Glauser G, Douet V, Besagni C, Kessler F (2016) Identification of plastoglobules as a site of carotenoid Cleavage. Front Plant Sci 7: 1855 Rowan BA, Oldenburg DJ, Bendich AJ (2009) A multiple-method approach reveals a declining amount of chloroplast DNA during development in Arabidopsis. BMC Plant Biol 9: 3 Ruan YL (2014) Sucrose metabolism: gateway to diverse carbon use and sugar signaling. Annu Rev Plant Biol 65: 33-67 Ruban AV (2016) Nonphotochemical chlorophyll fluorescence quenching: Mechanism and effectiveness in protecting plants from photodamage. Plant Physiol 170: 1903-1916 Rudowska L, Gieczewska K, Mazur R, Garstka M, Mostowska A (2012) Chloroplast biogenesis - correlation between structure and function. Biochim Biophys Acta 1817: 1380-1387 Ruiz-Sola MA, Arbona V, Gomez-Cadenas A, Rodriguez-Concepcion M, Rodriguez-Villalon A (2014) A root specific induction of carotenoid biosynthesis contributes to ABA production upon salt stress in Arabidopsis. PLoS One 9: e90765 Ruiz-Sola MA, Coman D, Beck G, Barja MV, Colinas M, Graf A, Welsch R, Rutimann P, Buhlmann P, Bigler L, Gruissem W, Rodriguez-Concepcion 277
M, Vranova E (2016) Arabidopsis GERANYLGERANYL DIPHOSPHATE SYNTHASE 11 is a hub isozyme required for the production of most photosynthesis-related isoprenoids. New Phytol 209: 252-264 Ruiz-Sola MA, Rodriguez-Concepcion M (2012) Carotenoid biosynthesis in Arabidopsis: a colorful pathway. Arabidopsis Book 10: e0158 Ruiz-Sola MA, Rodriguez-Villalon A, Rodriguez-Concepcion M (2014) Light- sensitive Phytochrome-Interacting Factors (PIFs) are not required to regulate phytoene synthase gene expression in the root. Plant Signal Behav 9: e29248 Ruyter-Spira C, Al-Babili S, van der Krol S, Bouwmeester H (2013) The biology of strigolactones. Trends Plant Sci 18: 72-83 Rymen B, Fiorani F, Kartal F, Vandepoele K, Inze D, Beemster GT (2007) Cold nights impair leaf growth and cell cycle progression in maize through transcriptional changes of cell cycle genes. Plant Physiol 143: 1429-1438 Sacharz J, Giovagnetti V, Ungerer P, Mastroianni G, Ruban AV (2017) The xanthophyll cycle affects reversible interactions between PsbS and light- harvesting complex II to control non-photochemical quenching. Nat Plants 3: 16225 Sakamoto W, Miyagishima SY, Jarvis P (2008) Chloroplast biogenesis: control of plastid development, protein import, division and inheritance. Arabidopsis Book 6: e0110 Samuoliene G, Virsile A, Brazaityte A, Jankauskiene J, Sakalauskiene S, Vastakaite V, Novickovas A, Viskeliene A, Sasnauskas A, Duchovskis P (2017) Blue light dosage affects carotenoids and tocopherols in microgreens. Food Chem 228: 50-56 Sanchez-Rodriguez E, Moreno DA, Ferreres F, Rubio-Wilhelmi Mdel M, Ruiz JM (2011) Differential responses of five cherry tomato varieties to water stress: changes on phenolic metabolites and related enzymes. Phytochemistry 72: 723- 729 Santabarbara S, Casazza AP, Ali K, Economou CK, Wannathong T, Zito F, Redding KE, Rappaport F, Purton S (2013) The requirement for carotenoids in the assembly and function of the photosynthetic complexes in Chlamydomonas reinhardtii. Plant Physiol 161: 535-546 Savitch LV, Barker-Astrom J, Ivanov AG, Hurry V, Oquist G, Huner NP, Gardestrom P (2001) Cold acclimation of Arabidopsis thaliana results in
278
incomplete recovery of photosynthetic capacity, associated with an increased reduction of the chloroplast stroma. Planta 214: 295-303 Schaub P, Rodriguez-Franco M, Cazzonelli CI, Alvarez D, Wust F, Welsch R (2018) Establishment of an Arabidopsis callus system to study the interrelations of biosynthesis, degradation and accumulation of carotenoids. PLoS One 13: e0192158 Schaub P, Wust F, Koschmieder J, Yu Q, Virk P, Tohme J, Beyer P (2017) Nonenzymatic beta-carotene degradation in provitamin A-biofortified crop plants. J Agric Food Chem 65: 6588-6598 Schenk ER, Mendez V, Landrum JT, Ridgeway ME, Park MA, Fernandez-Lima F (2014) Direct observation of differences of carotenoid polyene chain cis/trans isomers resulting from structural topology. Anal Chem 86: 2019-2024 Schenker G, Lenz A, Korner C, Hoch G (2014) Physiological minimum temperatures for root growth in seven common European broad-leaved tree species. Tree Physiol 34: 302-313 Schledz M, al-Babili S, von Lintig J, Haubruck H, Rabbani S, Kleinig H, Beyer P (1996) Phytoene synthase from Narcissus pseudonarcissus: functional expression, galactolipid requirement, topological distribution in chromoplasts and induction during flowering. Plant J 10: 781-792 Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative CT method. Nat. Protocols 3: 1101-1108 Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9: 671-675 Schwanz P, Polle A (2001) Differential stress responses of antioxidative systems to drought in pendunculate oak (Quercus robur) and maritime pine (Pinus
pinaster) grown under high CO2 concentrations. J Exp Bot 52: 133-143 Schwarz N, Armbruster U, Iven T, Bruckle L, Melzer M, Feussner I, Jahns P (2015) Tissue-specific accumulation and regulation of zeaxanthin epoxidase in Arabidopsis reflect the multiple functions of the enzyme in plastids. Plant Cell Physiol 56: 346-357 Scott KJ (2001) Detection and measurement of carotenoids by UV/VIS spectrophotometry. In Current Protocols in Food Analytical Chemistry. John Wiley & Sons, Inc.
279
Seo E, Lee H, Jeon J, Park H, Kim J, Noh YS, Lee I (2009) Crosstalk between cold response and flowering in Arabidopsis is mediated through the flowering-time gene SOC1 and its upstream negative regulator FLC. Plant Cell 21: 3185-3197 Shemesh K, Zohar M, Bar-Ya'akov I, Hatib K, Holland D, Isaacson T (2017) Analysis of carotenoids in fruit of different apricot accessions reveals large variability and highlights apricot as a rich source of phytoene and phytofluene. Fruits 72: 185-202 Shen R, Yang SP, Zhao GH, Shen Q, Diao XM (2015) Identification of carotenoids in foxtail millet (Setaria italica) and the effects of cooking methods on carotenoid content. J Cereal Sci 61: 86-93 Shewmaker CK, Sheehy JA, Daley M, Colburn S, Ke DY (1999) Seed-specific overexpression of phytoene synthase: increase in carotenoids and other metabolic effects. Plant J 20: 401-412X Shi Y, Liu P, Xia Y, Wei P, Li W, Zhang W, Chen X, Cao P, Xu Y, Jin L, Li F, Luo Z, Wei C, Zhang J, Xie X, Qu L, Yang J, Lin F, Wang R (2015) Downregulation of the lycopene ε-cyclase gene confers tolerance to salt and drought stress in Nicotiana tabacum. Acta Physiol Plant 37: 1-15 Shinkawa R, Morishita A, Amikura K, Machida R, Murakawa H, Kuchitsu K, Ishikawa M (2013) Abscisic acid induced freezing tolerance in chilling- sensitive suspension cultures and seedlings of rice. BMC Res Notes 6: 351 Shumbe L, Bott R, Havaux M (2014) Dihydroactinidiolide, a high light-induced beta-carotene derivative that can regulate gene expression and photoacclimation in Arabidopsis. Mol Plant 7: 1248-1251 Shumbe L, Chevalier A, Legeret B, Taconnat L, Monnet F, Havaux M (2016) Singlet oxygen-induced cell death in Arabidopsis under high-light stress is controlled by OXI1 kinase. Plant Physiol 170: 1757-1771 Shumskaya M, Bradbury LM, Monaco RR, Wurtzel ET (2012) Plastid localization of the key carotenoid enzyme phytoene synthase is altered by isozyme, allelic variation, and activity. Plant Cell 24: 3725-3741 Sillmann J, Kharin VV, Zwiers FW, Zhang X, Bronaugh D (2013) Climate extremes indices in the CMIP5 multimodel ensemble: Part 2. Future climate projections. J Geophys Res-Atmos 118: 2473-2493 Simkin AJ, Zhu C, Kuntz M, Sandmann G (2003) Light-dark regulation of carotenoid biosynthesis in pepper (Capsicum annuum) leaves. J Plant Physiol 160: 439-443 280
Simpson K, Quiroz LF, Rodriguez-Concepcion M, Stange CR (2016) Differential contribution of the first two enzymes of the MEP pathway to the supply of metabolic precursors for carotenoid and chlorophyll biosynthesis in carrot (Daucus carota). Front Plant Sci 7: 1344
Singh A, Agrawal M (2015) Effects of ambient and elevated CO2 on growth, chlorophyll fluorescence, photosynthetic pigments, antioxidants, and secondary metabolites of Catharanthus roseus (L.) G Don. grown under three different soil N levels. Environ Sci Pollut Res Int 22: 3936-3946 Singh SK, Reddy VR, Fleisher DH, Timlin DJ (2017) Relationship between photosynthetic pigments and chlorophyll fluorescence in soybean under varying
phosphorus nutrition at ambient and elevated CO2. Photosynthetica 55: 421-433 Sinha S, Kukreja B, Arora P, Sharma M, Pandey G, Agarwal M, Chinnusamy V (2015) The omics of cold stress responses in plants. In GK Pandey, ed, Elucidation of Abiotic Stress Signaling in Plants. Springer New York, pp 143- 194 Smith SD, Huxman TE, Zitzer SF, Charlet TN, Housman DC, Coleman JS,
Fenstermaker LK, Seemann JR, Nowak RS (2000) Elevated CO2 increases productivity and invasive species success in an arid ecosystem. Nature 408: 79- 82 Solovchenko A, Neverov K (2017) Carotenogenic response in photosynthetic organisms: a colorful story. Photosynth Res 133: 31-47 Song X, Diao J, Ji J, Wang G, Li Z, Wu J, Josine TL, Wang Y (2016) Overexpression of lycopene epsilon-cyclase gene from lycium chinense confers tolerance to chilling stress in Arabidopsis thaliana. Gene 576: 395-403
Song X, Kristie DN, Reekie EG (2009) Why does elevated CO2 affect time of flowering? An exploratory study using the photoperiodic flowering mutants of Arabidopsis thaliana. New Phytol 181: 339-346 Sourkes TL (2009) The discovery and early history of carotene. Bull. Hist. Chem 34: 33
Springer CJ, Ward JK (2007) Flowering time and elevated atmospheric CO2. New Phytol 176: 243-255 Steiger S, Perez-Fons L, Fraser PD, Sandmann G (2012) Biosynthesis of a novel C30 carotenoid in Bacillus firmus isolates. J Appl Microbiol 113: 888-895
281
Stessman D, Miller A, Spalding M, Rodermel S (2002) Regulation of photosynthesis during Arabidopsis leaf development in continuous light. Photosynth Res 72: 27-37 Stettler M, Eicke S, Mettler T, Messerli G, Hortensteiner S, Zeeman SC (2009) Blocking the metabolism of starch breakdown products in Arabidopsis leaves triggers chloroplast degradation. Mol Plant 2: 1233-1246 Stitt M, Krapp A (1999) The interaction between elevated carbon dioxide and nitrogen nutrition: the physiological and molecular background. Plant Cell Environ 22: 583-621 Stitt M, Zeeman SC (2012) Starch turnover: pathways, regulation and role in growth. Curr Opin Plant Biol 15: 282-292 Strand A, Asami T, Alonso J, Ecker JR, Chory J (2003) Chloroplast to nucleus communication triggered by accumulation of Mg-protoporphyrinIX. Nature 421: 79-83 Streb R, Aubert S, Bligny R (2003) High temperature effects on light sensitivity in the two high mountain plant species Soldanella alpina (L.) and Rannunculus glacialis (L.). Plant Biol (Stuttg) 5: 432-440 Strzałka K, Kostecka-Gugała A, Latowski D (2003) Carotenoids and environmental stress in plants: Significance of carotenoid-mediated modulation of membrane physical properties. Russ J Plant Physl 50: 168-173 Stylinski C, Gamon J, Oechel W (2002) Seasonal patterns of reflectance indices, carotenoid pigments and photosynthesis of evergreen chaparral species. Oecologia 131: 366-374 Subczynski WK, Markowska E, Sielewiesiuk J (1991) Effect of polar carotenoids on the oxygen diffusion-concentration product in lipid bilayers. An EPR spin label study. Biochim Biophys Acta 1068: 68-72 Sugiyama A, Ikoma Y, Fujii H, Endo T, Nesumi H, Shimada T, Omura M (2017) Allelic diversity of phytoene synthase gene influences the transcription level in citrus fruit among a citrus F1 hybrid population. Breed Sci 67: 382-392 Sun T, Yuan H, Cao H, Yazdani M, Tadmor Y, Li L (2018) Carotenoid metabolism in plants: The role of plastids. Mol Plant 11: 58-74 Sun Z, Niinemets U, Huve K, Rasulov B, Noe SM (2013) Elevated atmospheric
CO2 concentration leads to increased whole-plant isoprene emission in hybrid aspen (Populus tremula x Populus tremuloides). New Phytol 198: 788-800
282
Takaichi S (2011) Carotenoids in algae: distributions, biosyntheses and functions. Mar Drugs 9: 1101-1118 Takaichi S, Tsuji K, Matsuura K, Shimada K (1995) A monocyclic carotenoid glucoside ester is a major carotenoid in the green filamentous bacterium Chloroflexus aurantiacus. Plant Cell Physiol 36: 773-778 Takatani N, Ito T, Kiba T, Mori M, Miyamoto T, Maeda S, Omata T (2014)
Effects of high CO2 on growth and metabolism of Arabidopsis seedlings during growth with a constantly limited supply of nitrogen. Plant Cell Physiol 55: 281- 292 Tallis MJ, Lin Y, Rogers A, Zhang J, Street NR, Miglietta F, Karnosky DF, De Angelis P, Calfapietra C, Taylor G (2010) The transcriptome of Populus in
elevated CO2 reveals increased anthocyanin biosynthesis during delayed autumnal senescence. New Phytol 186: 415-428 Tardy F, Havaux M (1997) Thylakoid membrane fluidity and thermostability during the operation of the xanthophyll cycle in higher-plant chloroplasts. Biochim Biophys Acta 1330: 179-193 Tarkowski LP, Van den Ende W (2015) Cold tolerance triggered by soluble sugars: a multifaceted countermeasure. Front Plant Sci 6: 203
Teng N, Wang J, Chen T, Wu X, Wang Y, Lin J (2006) Elevated CO2 induces physiological, biochemical and structural changes in leaves of Arabidopsis thaliana. New Phytol 172: 92-103 Teskey R, Wertin T, Bauweraerts I, Ameye M, McGuire MA, Steppe K (2015) Responses of tree species to heat waves and extreme heat events. Plant Cell Environ 38: 1699-1712 Thomas H, Ougham HJ, Wagstaff C, Stead AD (2003) Defining senescence and death. J Exp Bot 54: 1127-1132 Tian L (2015) Recent advances in understanding carotenoid-derived signaling molecules in regulating plant growth and development. Front Plant Sci 6: 790 Tian L, Xu P, Chukhutsina VU, Holzwarth AR, Croce R (2017) Zeaxanthin- dependent nonphotochemical quenching does not occur in photosystem I in the higher plant Arabidopsis thaliana. Proc Natl Acad Sci U S A 114: 4828-4832 Tikhonov AN (2013) pH-dependent regulation of electron transport and ATP synthesis in chloroplasts. Photosynth Res 116: 511-534
283
Tissue DT, Lewis JD (2010) Photosynthetic responses of cottonwood seedlings
grown in glacial through future atmospheric [CO2] vary with phosphorus supply. Tree Physiol 30: 1361-1372 Tjoelker MG (2018) The role of thermal acclimation of plant respiration under climate warming: Putting the brakes on a runaway train? Plant Cell Environ 41: 501-503 Toh S, Imamura A, Watanabe A, Nakabayashi K, Okamoto M, Jikumaru Y, Hanada A, Aso Y, Ishiyama K, Tamura N, Iuchi S, Kobayashi M, Yamaguchi S, Kamiya Y, Nambara E, Kawakami N (2008) High temperature-induced abscisic acid biosynthesis and its role in the inhibition of gibberellin action in Arabidopsis seeds. Plant Physiol 146: 1368-1385 Toledo-Ortiz G, Huq E, Rodriguez-Concepcion M (2010) Direct regulation of phytoene synthase gene expression and carotenoid biosynthesis by phytochrome-interacting factors. Proc Natl Acad Sci U S A 107: 11626-11631 Tran TLH, Raymundo LC (1999) Biosynthesis of carotenoids in bittermelon at high temperature. Phytochemistry 52: 275-280 Triantaphylides C, Krischke M, Hoeberichts FA, Ksas B, Gresser G, Havaux M, Van Breusegem F, Mueller MJ (2008) Singlet oxygen is the major reactive oxygen species involved in photooxidative damage to plants. Plant Physiol 148: 960-968 Tripathy BC, Pattanayak GK (2012) Chlorophyll biosynthesis in higher plants. In JJ Eaton-Rye, BC Tripathy, TD Sharkey, eds, Photosynthesis: Plastid Biology, Energy Conversion and Carbon Assimilation. Springer Netherlands, Dordrecht, pp 63-94 Tsukaya H (2013) Leaf development. Arabidopsis Book 11: e0163 Tsukaya H, Shoda K, Kim GT, Uchimiya H (2000) Heteroblasty in Arabidopsis thaliana (L.) Heynh. Planta 210: 536-542 Tzuri G, Zhou X, Chayut N, Yuan H, Portnoy V, Meir A, Sa'ar U, Baumkoler F, Mazourek M, Lewinsohn E, Fei Z, Schaffer AA, Li L, Burger J, Katzir N, Tadmor Y (2015) A 'golden' SNP in CmOr governs the fruit flesh color of melon (Cucumis melo). Plant J 82: 267-279 Uemura M, Tominaga Y, Nakagawara C, Shigematsu S, Minami A, Kawamura Y (2006) Responses of the plasma membrane to low temperatures. Physiol Plant 126: 81-89
284
Umeno D, Arnold FH (2003) A C35 carotenoid biosynthetic pathway. Appl Environ Microbiol 69: 3573-3579 Updike AA, Schwartz SJ (2003) Thermal processing of vegetables increases cis isomers of lutein and zeaxanthin. J Agric Food Chem 51: 6184-6190 Urban J, Ingwers M, McGuire MA, Teskey RO (2017) Stomatal conductance increases with rising temperature. Plant Signal Behav 12: e1356534 Urban J, Ingwers MW, McGuire MA, Teskey RO (2017) Increase in leaf temperature opens stomata and decouples net photosynthesis from stomatal conductance in Pinus taeda and Populus deltoides x nigra. J Exp Bot 68: 1757- 1767 Urbonaviciute A, Samuoliene G, Sakalauskaite J, Duchovskis P, Brazaityte A, Siksnianiene JB, Ulinskaite R, Sabajeviene G, Baranauskis K (2006) The
effect of elevated CO2 concentrations on leaf carbohydrate, chlorophyll contents and photosynthesis in radish. Pol J Environ Stud 15: 921-925 van Gorsel E, Wolf S, Cleverly J, Isaac P, Haverd V, Ewenz C, Arndt S, Beringer J, Resco de Dios V, Evans BJ, Griebel A, Hutley LB, Keenan T, Kljun N, Macfarlane C, Meyer WS, McHugh I, Pendall E, Prober SM, Silberstein R (2016) Carbon uptake and water use in woodlands and forests in southern Australia during an extreme heat wave event in the “Angry Summer” of 2012/2013. Biogeosciences 13: 5947-5964 Van Norman JM, Zhang J, Cazzonelli CI, Pogson BJ, Harrison PJ, Bugg TD, Chan KX, Thompson AJ, Benfey PN (2014) Periodic root branching in Arabidopsis requires synthesis of an uncharacterized carotenoid derivative. Proc Natl Acad Sci U S A 111: E1300-1309 van Oort B, Roy LM, Xu P, Lu Y, Karcher D, Bock R, Croce R (2018) Revisiting the role of xanthophylls in nonphotochemical quenching. J Phys Chem Lett 9: 346-352 Varkonyi Z, Masamoto K, Debreczeny M, Zsiros O, Ughy B, Gombos Z, Domonkos I, Farkas T, Wada H, Szalontai B (2002) Low-temperature- induced accumulation of xanthophylls and its structural consequences in the photosynthetic membranes of the cyanobacterium Cylindrospermopsis raciborskii: an FTIR spectroscopic study. Proc Natl Acad Sci U S A 99: 2410- 2415
285
Vasquez-Caicedo AL, Heller A, Neidhart S, Carle R (2006) Chromoplast morphology and beta-carotene accumulation during postharvest ripening of Mango Cv. 'Tommy Atkins'. J Agric Food Chem 54: 5769-5776 Vecchia FD, Barbato R, La Rocca N, Moro I, Rascio N (2001) Responses to bleaching herbicides by leaf chloroplasts of maize plants grown at different temperatures. J Exp Bot 52: 811-820 Vershinin A (1999) Biological functions of carotenoids-diversity and evolution. Biofactors 10: 99-104 von Caemmerer S, Evans JR (2015) Temperature responses of mesophyll conductance differ greatly between species. Plant Cell Environ 38: 629-637 von Gromoff ED, Alawady A, Meinecke L, Grimm B, Beck CF (2008) Heme, a plastid-derived regulator of nuclear gene expression in Chlamydomonas. Plant Cell 20: 552-567 von Lintig J, Welsch R, Bonk M, Giuliano G, Batschauer A, Kleinig H (1997) Light-dependent regulation of carotenoid biosynthesis occurs at the level of phytoene synthase expression and is mediated by phytochrome in Sinapis alba and Arabidopsis thaliana seedlings. Plant J 12: 625-634 Vranova E, Coman D, Gruissem W (2013) Network analysis of the MVA and MEP pathways for isoprenoid synthesis. Annu Rev Plant Biol 64: 665-700 Walter MH, Floss DS, Paetzold H, Manke K, Vollrath J, Brandt W, Strack D (2012) Control of plastidial isoprenoid precursor supply: Divergent 1-Deoxy- d -Xylulose 5-Phosphate Synthase (DXS) isogenes regulate the allocation to primary or secondary metabolism. In TJ Bach, M Rohmer, eds, Isoprenoid Synthesis in Plants and Microorganisms. Springer New York, New York, NY, pp 251-270 Walter MH, Strack D (2011) Carotenoids and their cleavage products: biosynthesis and functions. Nat Prod Rep 28: 663-692 Wang H, Ou CG, Zhuang FY, Ma ZG (2014) The dual role of phytoene synthase genes in carotenogenesis in carrot roots and leaves. Mol Breed 34: 2065-2079 Wang KY, Kellomaki S, Zha T (2003) Modifications in photosynthetic pigments and chlorophyll fluorescence in 20-year-old pine trees after a four-year exposure to carbon dioxide and temperature elevation. Photosynthetica 41: 167-175
Wang M, Liu H, Dong C, Fu Y, Liu H (2016) Elevated CO2 enhances photosynthetic efficiency, ion uptake and antioxidant activity of Gynura bicolor
286
DC. grown in a porous-tube nutrient delivery system under simulated microgravity. Plant Biol (Stuttg) 18: 391-399 Wang M, Xie B, Fu Y, Dong C, Hui L, Guanghui L, Liu H (2015) Effects of
different elevated CO2 concentrations on chlorophyll contents, gas exchange, water use efficiency, and PSII activity on C3 and C4 cereal crops in a closed artificial ecosystem. Photosynth Res 126: 351-362 Wang P, Li C, Wang Y, Huang R, Sun C, Xu Z, Zhu J, Gao X, Deng X, Wang P (2014) Identification of a Geranylgeranyl reductase gene for chlorophyll synthesis in rice. Springerplus 3: 201 Wang S, Zhang L, Chi S, Wang G, Wang X, Liu T, Tang X (2018) Phylogenetic analyses of the genes involved in carotenoid biosynthesis in algae. Acta Oceanol Sin 37: 89-101 Wang X, Cai J, Liu F, Dai T, Cao W, Wollenweber B, Jiang D (2014) Multiple heat priming enhances thermo-tolerance to a later high temperature stress via improving subcellular antioxidant activities in wheat seedlings. Plant Physiol Biochem 74: 185-192 Wang XZ, Anderson OR, Griffin KL (2004) Chloroplast numbers, mitochondrion numbers and carbon assimilation physiology of Nicotiana sylvestris as affected
by CO2 concentration. Environ Exp Bot 51: 21-31 Wanner LA, Junttila O (1999) Cold-induced freezing tolerance in Arabidopsis. Plant Physiol 120: 391-400 Ware MA, Dall'Osto L, Ruban AV (2016) An in vivo quantitative comparison of photoprotection in Arabidopsis xanthophyll mutants. Front Plant Sci 7: 841 Watanabe CK, Sato S, Yanagisawa S, Uesono Y, Terashima I, Noguchi K (2014)
Effects of elevated CO2 on levels of primary metabolites and transcripts of genes encoding respiratory enzymes and their diurnal patterns in Arabidopsis thaliana: possible relationships with respiratory rates. Plant Cell Physiol 55: 341-357 Watkins J (2013) Cis-carotenes: Do they have regulatory roles in plants? BSc (Honours) thesis, Australian National University Way DA, Ghirardo A, Kanawati B, Esperschutz J, Monson RK, Jackson RB,
Schmitt-Kopplin P, Schnitzler JP (2013) Increasing atmospheric CO2 reduces metabolic and physiological differences between isoprene- and non-isoprene- emitting poplars. New Phytol 200: 534-546
287
Weber RWS, Davoli P (2002) Autophagocytosis of carotenoid-rich lipid droplets into vacuoles during aeciospore ageing in Puccinia distincta. New Phytol 154: 471-479 Wehner A, Storf S, Jahns P, Schmid VH (2004) De-epoxidation of violaxanthin in light-harvesting complex I proteins. J Biol Chem 279: 26823-26829 Wei S, Gruber MY, Yu B, Gao MJ, Khachatourians GG, Hegedus DD, Parkin IA, Hannoufa A (2012) Arabidopsis mutant sk156 reveals complex regulation of SPL15 in a miR156-controlled gene network. BMC Plant Biol 12: 169 Wei S, Yu B, Gruber MY, Khachatourians GG, Hegedus DD, Hannoufa A (2010) Enhanced seed carotenoid levels and branching in transgenic Brassica napus expressing the Arabidopsis miR156b gene. J Agric Food Chem 58: 9572-9578 Welsch R, Beyer P, Hugueney P, Kleinig H, von Lintig J (2000) Regulation and activation of phytoene synthase, a key enzyme in carotenoid biosynthesis, during photomorphogenesis. Planta 211: 846-854 Welsch R, Medina J, Giuliano G, Beyer P, Von Lintig J (2003) Structural and functional characterization of the phytoene synthase promoter from Arabidopsis thaliana. Planta 216: 523-534 Welsch R, Wust F, Bar C, Al-Babili S, Beyer P (2008) A third phytoene synthase is devoted to abiotic stress-induced abscisic acid formation in rice and defines functional diversification of phytoene synthase genes. Plant Physiol 147: 367- 380 Welsch R, Zhou X, Yuan H, Alvarez D, Sun T, Schlossarek D, Yang Y, Shen G, Zhang H, Rodriguez-Concepcion M, Thannhauser TW, Li L (2018) Clp Protease and OR directly control the proteostasis of phytoene synthase, the crucial enzyme for carotenoid biosynthesis in Arabidopsis. Mol Plant 11: 149- 162 Wetzel CM, Rodermel SR (1998) Regulation of phytoene desaturase expression is independent of leaf pigment content in Arabidopsis thaliana. Plant Mol Biol 37: 1045-1053 Whitfield DM, Rowan KS (1974) Changes in the chlorophylls and carotenoids of leaves of Nicotiana tabacum during senescence. Phytochemistry 13: 77-83
Wijewardana C, Henry WB, Gao W, Reddy KR (2016) Interactive effects on CO2, drought, and ultraviolet-B radiation on maize growth and development. J Photochem Photobiol B 160: 198-209
288
Wingler A, Hennessy D (2016) Limitation of grassland productivity by low temperature and seasonality of growth. Front Plant Sci 7: 1130 Wisniewski M, Nassuth A, Arora R (2018) Cold hardiness in trees: A mini-review. Front Plant Sci 9: 1-9 Wu G, Poethig RS (2006) Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3. Development 133: 3539-3547 Wurtzel ET (2004) Genetics, and biochemistry of maize carotenoid biosynthesis. In JT Romeo, ed, Secondary Metabolism in Model Systems, Vol 38. Elsevier, pp 85-110 Wurtzel ET (2019) Changing form and function through carotenoids and synthetic biology. Plant Physiol 179: 830-843 Wustman BA, Oksanen E, Karnosky DF, Noormets A, Isebrands JG, Pregitzer
KS, Hendrey GR, Sober J, Podila GK (2001) Effects of elevated CO2 and O3
on aspen clones varying in O3 sensitivity: can CO2 ameliorate the harmful
effects of O3? Environ Pollut 115: 473-481 Xiong D, Huang J, Peng S, Li Y (2017) A few enlarged chloroplasts are less efficient in photosynthesis than a large population of small chloroplasts in Arabidopsis thaliana. Sci Rep 7: 5782 Xu M, Hu T, Smith MR, Poethig RS (2016) Epigenetic regulation of vegetative phase change in Arabidopsis. Plant Cell 28: 28-41 Xu M, Hu T, Zhao J, Park MY, Earley KW, Wu G, Yang L, Poethig RS (2016) Developmental functions of miR156-regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes in Arabidopsis thaliana. PLoS Genet 12: e1006263 Xu Y, Ramanathan V (2017) Well below 2 degrees C: Mitigation strategies for avoiding dangerous to catastrophic climate changes. Proc Natl Acad Sci U S A 114: 10315-10323 Xu Z, Jiang Y, Zhou G (2015) Response and adaptation of photosynthesis,
respiration, and antioxidant systems to elevated CO2 with environmental stress in plants. Front Plant Sci 6: 701 Yabuzaki J (2017) Carotenoids Database: structures, chemical fingerprints and distribution among organisms. Database (Oxford) 2017: bax004-bax004
Yildiz G, Dere Ş (2015) The effects of elevated-CO2 on physiological performance of Bryopsis plumosa. Acta Oceanol Sin 34: 125-129
289
Yin Y, Li S, Liao W, Lu Q, Wen X, Lu C (2010) Photosystem II photochemistry, photoinhibition, and the xanthophyll cycle in heat-stressed rice leaves. J Plant Physiol 167: 959-966 Young AJ, Frank HA (1996) Energy transfer reactions involving carotenoids: quenching of chlorophyll fluorescence. J Photochem Photobiol B 36: 3-15 Yu Q, Ghisla S, Hirschberg J, Mann V, Beyer P (2011) Plant carotene cis-trans isomerase CRTISO: a new member of the FAD(RED)-dependent flavoproteins catalyzing non-redox reactions. J Biol Chem 286: 8666-8676 Yuan H, Zhang J, Nageswaran D, Li L (2015) Carotenoid metabolism and regulation in horticultural crops. Hortic Res 2: 15036 Yuan W, Cai W, Chen Y, Liu S, Dong W, Zhang H, Yu G, Chen Z, He H, Guo W, Liu D, Liu S, Xiang W, Xie Z, Zhao Z, Zhou G (2016) Severe summer heatwave and drought strongly reduced carbon uptake in Southern China. Sci Rep 6: 18813 Zeng Y, Yu J, Cang J, Liu L, Mu Y, Wang J, Zhang D (2011) Detection of sugar accumulation and expression levels of correlative key enzymes in winter wheat (Triticum aestivum) at low temperatures. Biosci Biotechnol Biochem 75: 681- 687 Zhang B, Liu C, Wang Y, Yao X, Wang F, Wu J, King GJ, Liu K (2015) Disruption of a CAROTENOID CLEAVAGE DIOXYGENASE 4 gene converts flower colour from white to yellow in Brassica species. New Phytol 206: 1513-1526 Zhang P, Li Z, Lu L, Xiao Y, Liu J, Guo J, Fang F (2017) Effects of stepwise nitrogen depletion on carotenoid content, fluorescence parameters and the cellular stoichiometry of Chlorella vulgaris. Spectrochim Acta A Mol Biomol Spectrosc 181: 30-38 Zhang R, Wise RR, Struck KR, Sharkey TD (2010) Moderate heat stress of Arabidopsis thaliana leaves causes chloroplast swelling and plastoglobule formation. Photosynth Res 105: 123-134 Zhang Z, Liu L, Zhang M, Zhang Y, Wang Q (2014) Effect of carbon dioxide enrichment on health-promoting compounds and organoleptic properties of tomato fruits grown in greenhouse. Food Chem 153: 157-163 Zhang ZW, Yuan S, Feng H, Xu F, Cheng J, Shang J, Zhang DW, Lin HH (2011) Transient accumulation of Mg-protoporphyrin IX regulates expression of
290
PhANGs - New evidence for the signaling role of tetrapyrroles in mature Arabidopsis plants. J Plant Physiol 168: 714-721 Zhao C, Nabity PD (2017) Phylloxerids share ancestral carotenoid biosynthesis genes of fungal origin with aphids and adelgids. PLoS One 12: e0185484 Zhou X, Welsch R, Yang Y, Alvarez D, Riediger M, Yuan H, Fish T, Liu J, Thannhauser TW, Li L (2015) Arabidopsis OR proteins are the major posttranscriptional regulators of phytoene synthase in controlling carotenoid biosynthesis. Proc Natl Acad Sci U S A 112: 3558-3563 Zhou YH, Yu JQ, Mao WH, Huang LF, Song XS, Nogues S (2006) Genotypic variation of Rubisco expression, photosynthetic electron flow and antioxidant metabolism in the chloroplasts of chill-exposed cucumber plants. Plant Cell Physiol 47: 192-199 Ziska LH, Panicker S, Wojno HL (2008) Recent and projected increases in atmospheric carbon dioxide and the potential impacts on growth and alkaloid production in wild poppy (Papaver setigerum DC.). Clim Change 91: 395-403
291
ANNEXES
292
Annex I
Primers used for the qRT PCR. Primers were designed online using Primer3Plus (http://primer3plus.com/cgi-bin/dev/primer3plus.cgi).
SN Primer name Accession Gene name Sequence (5'→3') Tm 1 AtDXS-F AT4G15560 Deoxyxylulose 5 phosphate synthase CTTGCTCTCGATGGTCTTCTTG 59.1 2 AtDXS-R AT4G15560 Deoxyxylulose 5 phosphate synthase TGGTGCACCGATTAAGTTAAGTG 59.3 3 AtHDR-F At4G34350 Hydroxy methylbutenyl diphosphate reductase TTACTCGAGACAACAATGATGCGC 61.9 4 AtHDR-R At4G34350 Hydroxy methylbutenyl diphosphate reductase GGTGTTACTTGAATTCCATCCGCC 62.2 5 AtGPPS1-F AT2G34630 Geranyl pyrophosphate synthase 1 TGGAGTCATAACAGCCCCAATC 60.1 6 AtGPPS1-R AT2G34630 Geranyl pyrophosphate synthase 1 CTGCTGCTAGATTCGCATGTTC 60.0 7 AtGGPPS11-F AT4G36810 Geranylgeranyl pyrophosphate synthase 11 GGCGTTGCTTGAAGCTTCTG 60.4 8 AtGGPPS11-R AT4G36810 Geranylgeranyl pyrophosphate synthase 11 TCCCAGCAGTTTTCCCTAACTC 60.0 9 AtGGPPS12-F AT4G38460 Geranylgeranyl pyrophosphate synthase 12 TGACATCACCGAGGACAAGAAG 60.0 10 AtGGPPS12-R AT4G38460 Geranylgeranyl pyrophosphate synthase 12 TGTCGATGAGCAGCGTAGTC 59.9 11 AtPSY-F AT5G17230 Phytoene synthase TGACTTTCCCCACATAAGCTCTC 60.1 12 AtPSY-R AT5G17230 Phytoene synthase CGAGCAAGAATGTTCTTCGACG 60.2 13 AtCRTISO-F AT1G06820 Carotenoid isomerase TGCGAGTGTCCTTAGCCAAC 60.3 14 AtCRTISO-R AT1G06820 Carotenoid isomerase GATGGTCTATACTGCGTGGGG 60.0 15 AtLCYE-F AT5G57030 Lycopene epsilon cyclase CCAGAAAGGAAAAGACAGAGAGC 59.2 16 AtLCYE-R AT5G57030 Lycopene epsilon cyclase AGCAAAGAGAACGAGATCTCCTG 60.1 17 AtLCYB-F AT3G10230 Lycopene beta cyclase AGGAACAGTCCCCTTTGTCATG 60.2 18 AtLCYB-R AT3G10230 Lycopene beta cyclase TGCATTCTTTGATCTGCAACCTC 59.8 19 AtZEP-F AT5G67030 Zeaxanthin epoxidase CGTCGATTTCGGAGTTTTCCTG 59.9 20 AtZEP-R AT5G67030 Zeaxanthin epoxidase GATGGATCTTCGAAGCGAACAC 59.7 21 AtVDE-F AT1G08550 Violaxanthin de-epoxidase 1 TCGTGCAAGATCCTAACCAACC 60.6
293
22 AtVDE-R AT1G08550 Violaxanthin de-epoxidase 1 ACCATATCCATCCCAAGCATCG 60.3 23 AtCCD1-F AT3G63520 Carotenoid cleavage dioxygenase 1 TGAGACAGCAGAAGAAGACGAC 60.0 24 AtCCD1-R AT3G63520 Carotenoid cleavage dioxygenase 1 TGTAACAAACAAGGCATGGAAGC 60.2 25 AtCCD4-F AT4G19170 Carotenoid cleavage dioxygenase 4 TGTACGGTTCAGGTTGTTACGG 60.5 26 AtCCD4-R AT4G19170 Carotenoid cleavage dioxygenase 4 CGATTTAGCGTCCATCACCAGA 60.5 27 SPL15-F AT3G57920 Squamosa promoter binding protein like 15 GCCCATCTCAACACATCAGC 63.1 28 SPL15-R AT3G57920 Squamosa promoter binding protein like 15 CAGCTCAAATCCACCCATTG 61.3
294
Annex II
Christopher I Cazzonellia,*,1, Xin Houb,*, Yagiz Alagoza, John Riversb, Namraj
Dhamia, Jiwon Leec, Marri Shashikanthb and Barry J Pogsonb,1 (Under review). A cis- carotene derived apocarotenoid regulates etioplast and chloroplast development. eLife. (manuscript is under revision after peer review)
* These two authors contributed equally
Affiliations a Hawkesbury Institute for the Environment, Western Sydney University, Locked Bag
1797, Penrith NSW 2751, Australia. b Australian Research Council Centre of Excellence in Plant Energy Biology,
Research School of Biology, The Australian National University, Canberra, ACT
2601, Australia. c Centre for Advanced Microscopy, The Australian National University, Canberra,
ACT 2601, Australia
1 Address correspondence to [email protected] and [email protected]
Abstract
Carotenoids are core plastid components, yet a regulatory function during plastid biogenesis remains enigmatic. A unique carotenoid biosynthesis mutant, carotenoid chloroplast regulation 2 (ccr2), that has no prolamellar body
(PLB) and normal PROTOCHLOROPHYLLIDE OXIDOREDUCTASE (POR) levels, was used to demonstrate a regulatory function for carotenoids under varied dark-light regimes. A forward genetics approach revealed how an epistatic interaction
295 between a ζ-carotene isomerase mutant (ziso-155) and ccr2 blocked the biosynthesis of specific cis-carotenes and restored PLB formation in etioplasts. We attributed this to a novel apocarotenoid signal, as chemical inhibition of carotenoid cleavage dioxygenase activity restored PLB formation in ccr2 etioplasts during skotomorphogenesis. The apocarotenoid acted in parallel to the transcriptional repressor of photomorphogenesis, DEETIOLATED1 (DET1), to post- transcriptionally regulate PROTOCHLOROPHYLLIDE OXIDOREDUCTASE
(POR), PHYTOCHROME INTERACTING FACTOR3 (PIF3) and ELONGATED
HYPOCOTYL5 (HY5) protein levels. The apocarotenoid signal and det1 complemented each other to restore POR levels and PLB formation, thereby controlling plastid development.
296
Annex III
Talk
30th International Conference on Arabidopsis Research (ICAR2019), June 16-21,
2019, Wuhan, China.
Young leaves of Arabidopsis thaliana provide a model system to investigate carotenogenesis and chloroplast development.
Dhami, N.1, Pogson, B. J.2, Tissue, D. T.1, Cazzonelli C. I.1 (2019).
1Hawkesbury Institute for the Environment, Western Sydney University, Hawkesbury
Campus, Bourke Street, Richmond, NSW 2753, Australia
2ARC Centre of Excellence in Plant Energy Biology, Research School of Biology,
The Australian National University, Canberra, ACT, Australia
Abstract
How chloroplasts orchestrate developmental and environmental cues to maintain carotenogenesis in leaves can be confounded by changes in cell division and expansion during leaf maturation. We revealed that the young leaves of Arabidopsis accumulate higher carotenoid levels compared to mature leaves. The changes in foliar carotenoid content were not linked to leaf phase identity or enzymatic oxidation.
Neither the loss of function or overexpression of enzymes catalysing carotenoid biosynthesis affected the age-related decline in foliar pigment levels. However, the carotenoid isomerase (crtiso) mutant reduced total carotenoid and chlorophyll accumulation in younger, but not older leaves. The incubation of Arabidopsis rosettes in norflurazon caused a reduction in foliar pigments while accumulated 2- to 6-fold higher phytoene in young leaves compared to that in old leaves. Exposure to a non- freezing cold or darkness also reduced pigment levels in young leaves mimicking the norflurazon effect. We reason that retrograde signals induced by crtiso, NFZ, cold and darkness can affect chloroplast development in rapidly dividing and/or expanding
297 cells in young leaves. We propose that the higher level of carotenoids in younger leaves may be caused by a greater cell density and hence higher plastid capacity.
Young leaves can, thus, provide an in-planta model system to decipher how developmental and environmental signals can affect chloroplast development and carotenogenesis.
298
Annex IV
Poster presentation
ComBio2017, October 2-5, 2017, Adelaide, Australia
Leaf maturation affects carotenoid metabolism in Arabidopsis
Dhami, N.1, Alagoz, Y.1, Tissue, D. T.1, Cazzonelli C. I.1 (2017).
1Hawkesbury Institute for the Environment, Western Sydney University, Hawkesbury
Campus, Bourke Street, Richmond, NSW 2753, Australia
Abstract
Foliar carotenoids contribute to photosynthesis, photoprotection, and phytohormone biosynthesis in plants. Arabidopsis displays characteristic developmental phase change patterns in rosette leaves as the plant grows. The early emerged (juvenile) leaves and lately emerged (adult) leaves retain their developmental phase identity throughout the lifespan even though both leaf types undergo maturation. We investigated juvenile and adult leaves of Arabidopsis to explore if leaf maturation affects carotenoid accumulation during the developmental phase change. We observed that recently emerged immature leaves comprised significantly higher levels of carotenoids and chlorophylls in comparison to mature leaf tissues, regardless of their developmental phases. The relative proportions of lutein and violaxanthin decreased whereas that of β-carotene and neoxanthin increased in mature leaves, suggesting a metabolic flux reallocation as the leaf maturation progresses. We found significantly higher expression of CCD4 and
CCD7 whereas decreased expression of eLCY in mature leaves. The expression level of PSY, CRTISO, and bLCY was similar in both leaf types. These evidence demonstrate that mature leaf tissues have higher rates of carotenoid degradation due to the higher level of CCDs and shift metabolite flux towards β-chain carotenoids indicating the production and/or requirement of apocarotenoid signals that control
299 leaf maturation. We propose that the age, rather than developmental phase plays a key role in maintaining carotenoid homeostasis and production of apocarotenoids and perhaps immature leaves provide a safer sink to sequester carotenoids.
300
Annex V
Poster presentation
International Symposium on Carotenoids, July 9-14, 2017, Lucerne, Switzerland.
International Carotenoid Society
Immature Arabidopsis leaves have a greater pigment sink capacity revealing a subtle increase in carotenoids under elevated atmospheric CO2
Dhami, N.1, Tissue, D. T.1, Cazzonelli C. I.1 (2017)
1Hawkesbury Institute for the Environment, Western Sydney University, Hawkesbury
Campus, Bourke Street, Richmond, NSW 2753, Australia
Abstract
Background
Carotenoids contribute to photosynthesis, photoprotection, and phytohormone biosynthesis in plants. Carotenoid derived metabolites influence plant growth and development and their accumulation can be responsive to changes in the environment.
Elevated atmospheric CO2 enhances carbon assimilation presumably increasing metabolic precursors of isoprenoid biosynthesis including carotenoids. However, literature reports variable effects (increase, decrease or no change) of elevated CO2 on carotenoid accumulation in different plant species. We hypothesise an age-dependent interaction of elevated CO2 on the sink capacity to maintain carotenoid homeostasis in leaves.
Objective
Our objective was to quantify the effect of elevated CO2 on the foliar carotenoid accumulation during the aging of Arabidopsis thaliana leaves.
Design
A. thaliana wild type plants were grown in growth chambers at 400 (ambient) and 800 (elevated) parts per million of CO2. The number of rosette leaves, rosette
301 area, plant biomass and seed yield were measured. Carotenoid and chlorophyll levels were quantified in immature and mature leaf tissues.
Results
Elevated CO2 increased leaf number, rosette area, biomass and yield. Total carotenoid and chlorophyll levels were about 70 % and 50 % higher respectively in immature leaves. Carotenoids and chlorophylls both showed an age-dependent decrease during the leaf maturation. Newly emerged immature leaves showed a higher proportion of lutein relative to the other xanthophylls. Elevated CO2 caused a marginal, yet significant increase (10 %) in carotenoid, as well as chlorophyll, accumulation in immature leaves perhaps the relative proportion of lutein, b-carotene, neoxanthin and violaxanthin remain unchanged. Mature leaves comprised similar amounts of carotenoids and chlorophylls irrespective of the CO2 concentration.
Conclusion
Elevated CO2 enhanced carbon assimilation as demonstrated by a significant increase in plant growth attributes. The foliar carotenoids increased marginally in recently emerged immature leaves under elevated CO2. Carotenoid levels decreased in maturing leaf tissues highlighting potentially higher rates of carotenoid degradation or reduced biosynthesis in the older leaves. The leaf-age, rather than the stage of plant development or carbon availability, is a key factor determining biosynthesis, degradation and accumulation of carotenoids in chloroplasts.
302
Annex VI
Poster presentation
Mechanism and Mysteries in Epigenetics Conference. Garvan Institute of Medical
Research. April 21, 2016, Sydney, Australia.
Carotenoid homeostasis and environmental memory acquisition in plants
Namraj Dhami*1, Rishi Aryal1, Barry J Pogson2 and Christopher I. Cazzonelli1
1Hawkesbury Institute for the Environment, Western Sydney University, Hawkesbury
Campus, Bourke Street, Richmond, NSW 2753, AUSTRALIA
2Research School of Biology, The Australian National University, Canberra, ACT
0200, AUSTRALIA
Abstract
Carotenoids are highly conserved isoprenoids required for photosynthesis, photoprotection and the production of phytohormones as well as signalling molecules during plant development. Carotenoid metabolism is tightly regulated by developmental and environmental stimuli. The epigenetic regulatory loops in carotenogenesis are important in mediating cellular homeostasis and cellular communication. In Arabidopsis, the histone lysine methylation enzyme SET
DOMAIN GROUP 8 (SDG8) regulates the permissive expression of the carotenoid isomerase (CRTISO) gene in a tissue-specific manner. CRTISO controls cis- carotenoid and xanthophyll accumulation, plastid biogenesis and possibly involved in the generation of signalling metabolites that promote cross-talk between the chloroplast and nucleus. The loss of function sdg8 mutants show an increase in the number of rosette shoots and an early flowering phenotype. Interestingly, overexpression of miR156 also regulates carotenogenesis and enhances branching.
303
Given that miRNA targeted gene silencing and chromatin modification can both perturb carotenogenesis and shoot branching, we hypothesise that carotenoids and/or their derivatives play a key role during the epigenetic programming by vernalization
(a prolonged cold winter period that promotes early flowering in spring). Our preliminary results demonstrate that the exposure of crtiso mutants to a prolonged cold period increases shoot branching and alters foliar carotenoid levels. We aim to unravel how epigenetic regulatory mechanisms control carotenogenesis and decipher the new roles for carotenoids in epigenetic memory forming events in plants.
The End!
304