The Transcription Factor Fli-1 Modulates Marginal Zone and Follicular Development in Mice

This information is current as Xian K. Zhang, Omar Moussa, Amanda LaRue, Sarah of September 29, 2021. Bradshaw, Ivan Molano, Demetri D. Spyropoulos, Gary S. Gilkeson and Dennis K. Watson J Immunol 2008; 181:1644-1654; ; doi: 10.4049/jimmunol.181.3.1644

http://www.jimmunol.org/content/181/3/1644 Downloaded from

References This article cites 64 articles, 27 of which you can access for free at: http://www.jimmunol.org/content/181/3/1644.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021

*average

Subscription Information about subscribing to The Journal of is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

The Transcription Factor Fli-1 Modulates Marginal Zone and Follicular B Cell Development in Mice1

Xian K. Zhang,2*† Omar Moussa,‡ Amanda LaRue,†‡ Sarah Bradshaw,* Ivan Molano,* Demetri D. Spyropoulos,‡ Gary S. Gilkeson,*† and Dennis K. Watson‡

Fli-1 belongs to the Ets transcription factor family and is expressed primarily in hematopoietic cells, including most cells active in immunity. To assess the role of Fli-1 in development in vivo, we generated mice that express a truncated Fli-1 protein, lacking the C-terminal transcriptional activation domain (Fli-1⌬CTA). Fli-1⌬CTA/Fli-1⌬CTA mice had significantly fewer splenic follicular B cells, and an increased number of transitional and marginal zone B cells, compared with wild-type controls. Bone marrow reconstitution studies demonstrated that this phenotype is the result of lymphocyte intrinsic effects. Expression of Ig␣ and other genes implicated in B cell development, including Pax-5, E2A, and Egr-1, are reduced, while Id1 and Id2 are ⌬ ⌬ ⌬ ⌬ increased in Fli-1 CTA/Fli-1 CTA mice. Proliferation of B cells from Fli-1 CTA/Fli-1 CTA mice was diminished, although intracel- Downloaded from .lular Ca2؉ flux in B cells from Fli-1⌬CTA/Fli-1⌬CTA mice was similar to that of wild-type controls after anti-IgM stimulation Immune responses and in vitro class switch recombination were also altered in Fli-1⌬CTA/Fli-1⌬CTA mice. Thus, Fli-1 modulates B cell development both centrally and peripherally, resulting in a significant impact on the in vivo immune response. The Journal of Immunology, 2008, 181: 1644–1654.

n mice, B cells are generated in the bone marrow after birth. population and marginal zone (MZ) B cells (5, 6). The differenti- http://www.jimmunol.org/ Their stages of development are divided into pro-B, pre-B, ation and maintenance of these mature B cells require signals de- I and immature B cells by the sequential expression of cell rived from the BCR (7). Maintenance of transitional, FO, and MZ surface markers and the ordered rearrangement of Ig H and L chain B cell subsets are controlled by their microenvironment and inter- segments (1, 2). Progenitor B cells undergo rearrangement of the actions with other cell types (5, 8). In mice, MZ B cells, together Ig H chain locus to become pro-B cells. Subsequently, expressed with metallophilic and marginal-sinus-associated macrophages, mu H chains associate with surrogate L chains and the signaling initiate a rapid first line of defense against -borne particulate molecules Ig␣ and Ig␤, forming the pre-BCR complex (2). The Ags. MZ B cell responses were first thought to be primarily di- pre-BCR complex plays a critical role in the clonal expansion of rected against T-independent Ags; however, recent reports indicate muϩ pro-B cells and differentiation to the pre-B cell stage (3, 4). that MZ B cells play roles in both T-independent and -dependent by guest on September 29, 2021 Pre-B cells undergo Ig L chain rearrangement and the resultant L immune responses. FO cells participate primarily in T-dependent chains associate with the mu H chain to form membrane-bound Ab responses (8, 9). Progression through B cell development de- IgM (3). After successful rearrangement of both H and L chain pends on the combined effects of multiple regulatory genes, in- genes, the BCR, which includes Ig␣ and Ig␤, is formed and ex- cluding Pax-5, early B cell factor (EBF), the E2A factors E12 and pressed on the surface of B cells. The BCR functions as an Ag- E47, and the Ets transcription factor, PU.1 (10). Members of the binding and signal transduction molecule during further B cell de- Ets gene family are found in genomes of diverse organisms, in- velopment (5). cluding Drosophila, Xenopus, sea urchin, chicken, mouse, and hu- Immature B cells emigrate from the bone marrow to the , man (11, 12). The transcription factor Fli-1 is a member of the Ets and there progress through transitional states. Transitional B cells family and is expressed in hematopoietic cells and a variety of enter splenic follicles, further differentiating to follicular (FO)3 B other tissues (13, 14). Like all members of the Ets gene family, cells, which comprise the majority of the mature splenic B cell Fli-1 has the conserved DNA-binding domain, the Ets domain. The Fli-1 gene encodes two protein products, the larger comprised of 452 aa (14, 15). The Ets (DNA-binding) domain of Fli-1 is *Division of Rheumatology and Immunology, Department of Medicine, Medical Uni- located between amino acids 277 and 361. Deletion analysis has versity of South Carolina, Charleston, SC 29425; †Medical Research Service, Ralph H. Johnson Veterans Affairs Medical Center, Charleston, SC 29403; and ‡Department identified two transcriptional regulatory domains, designated ATA of Pathology and Laboratory of Medicine, Medical University of South Carolina, and CTA, for N-terminal transcriptional and C-terminal transcrip- Charleston, SC 29425 tional activation domains, respectively (16). Ets proteins bind to Received for publication January 14, 2008. Accepted for publication May 13, 2008. DNA sequences that contain a consensus GGA(A/T) core motif The costs of publication of this article were defrayed in part by the payment of page (Ets-binding site) and can function as either transcriptional acti- charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. vators or repressors (11, 12). Ets proteins regulate the expression 1 This work was supported by National Institutes of Health Grants PO1-CA78582 (to of genes that are critical for the control of cellular proliferation, D.K.W.) and AR051385 and AR054546 (to X.K.Z.), and the Medical Research Ser- differentiation, and programmed cell death. Previous studies indi- vice, Department of Veterans Affairs (to G.S.G.). cate that Fli-1 plays an important role in the regulation of 2 Address correspondence and reprint requests to Dr. Xian K. Zhang, Division of megakaryocyte development (17–20). Rheumatology and Immunology, Medical University of South Carolina, 96 Jonathan Lucas Street MSC637, Suite 912, Charleston, SC 29425-6370. E-mail address: [email protected] 3 Abbreviations used in this paper: FO, follicular; MZ, marginal zone; CTA, C-ter- MZ precursor; KLH, keyhole limpet hemocyanin; BAFF, B cell-activating factor; minal transcriptional activation domain; ChIP, chromatin immunoprecipitation; MZP, TNP, 2,4,6-trinitrophenyl. www.jimmunol.org The Journal of Immunology 1645

Studies regarding the role of Fli-1 in immune function or dys- Chromatin immunoprecipitation (ChIP) assays function are limited. Several reports indicate that Fli-1 can bind Total bone marrow (4 ϫ 106 cells) was isolated from wild-type and Fli- specific Ets-binding sites and transcriptionally activate a number 1⌬CTA/Fli-1⌬CTA mice. A ChIP assay was performed as described previ- of genes including those encoding Egr-1, multiple megakaryocytic ously using anti-Fli1 rabbit polyclonal Ab (21). The Ϫ160 to ϩ34 region genes, bcl-2, mb-1, and hTERT (21–25). Fli-1 can also act as a of the mouse mb-1 promoter was amplified by real-time PCR using primers Ј Ј Ј repressor of Rb and collagen 1 expression (26–27). Targeted con- 5 -GGCAGGGCTCTGAGGGCTTCT-3 and 5 -TCTCCACTCAGAGC CCACACA-3Ј, specific for the proximal promoter region. Real-time PCR stitutive disruption of the Fli-1 gene resulted in hemorrhage into was conducted using a LightCycler (Roche) with the Platinum SYBR the neural tube and embryonic death due in part to thrombocyto- Green qPCR SuperMix UDG (Invitrogen) according to the manufacturer’s penia (28–29). Two-fold overexpression of the Fli-1 protein in instructions. PCR primers were used at a concentration of 250 nM. The transgenic mice resulted in the development of a lupus-like dis- cycling conditions for mb-1 were: preincubation at 50°C for 2 min, 95°C for 2 min, followed by 55 cycles of denaturation at 94°C for 10 s, annealing ease, including progressive immune complex-mediated renal dis- 57°C for 10 s, and extension at 72°C for 25 s, with a single data acquisition ease and ultimately premature death from renal failure. Hypergam- at the end of each extension. All ramping was done at 20°C per second. maglobulinemia, splenomegaly, B cell peripheral , Relative expression analysis was conducted using the program LinRegPCR and autoantibody production (antinuclear Ab and anti-dsDNA) according to the suggested specifications. were prominent in these transgenic mice (30). We previously re- Flow cytometry analysis and cell sorting ported that reduced expression of the Fli-1 protein in MRL/lpr mice, a murine model of lupus, significantly increased survival and Single-cell suspensions were prepared from spleen, bone marrow, or thy- mus from mice at the age of 6–12 wk. The cells were stained with fluo- decreased renal disease compared with wild-type littermates (31). rochrome- or biotin-conjugated Abs and analyzed on a FACSCalibur flow MRL/lpr mice with reduced Fli-1 expression also had decreased cytometer. Data were analyzed using CellQuest (BD Immunocytometry Downloaded from total serum Ig and anti-dsDNA Abs. Taken together, these studies Systems) software. Transitional, FO, or MZ B cells were sorted by the suggested that Fli-1 plays an important role in the immune system, MoFlo High-Performance Cell Sorter (DakoCytomation) after staining the B cell being an apparent target. with Abs and used for RNA preparation in real-time PCR. All Abs were purchased from BD Pharmingen. To assess the role of Fli-1 in lymphocyte development in vivo, we generated C57BL/6 mice that expressed a truncated Fli-1 pro- Immunization and determination of Ig titers ⌬CTA tein (amino acids 1–384) lacking the CTA domain (Fli-1 ). ␮ http://www.jimmunol.org/ ⌬CTA ⌬CTA Four 8-wk-old mice were immunized by i.p. injection of 50 g of 2,4,6- Initial examination of Fli-1 /Fli-1 revealed a statistically trinitrophenyl (TNP) Ficoll or 50 ␮g of TNP-keyhole limpet hemocyanin ϩ significant reduction in total peripheral blood B220 B cells. Ex- (KLH; Biosearch Technologies) mixed with CFA. The mice immunized amination of from Fli-1⌬CTA/Fli-1⌬CTA mice demonstrated with TNP-KLH were given 50 ␮g of TNP-KLH mixed with IFA booster 1 that the percentage of FO B cells was significantly decreased, wk after first immunization. Anti-TNP Abs were determined by ELISA with TNP-BSA as described previously (32). whereas transitional B cells and MZ B cells were significantly increased. Furthermore, pre-B cells were also significantly de- B cell purification, culture, and stimulation ⌬CTA ⌬CTA creased in the bone marrow of Fli-1 /Fli-1 mice. Thus, B cells were purified with B cell-negative selection kits from Invitrogen. Fli-1 appears to be a negative regulator of MZ B cell development The purity of B cells (over 90%) was confirmed by flow cytometry anal- and a positive regulator of FO B cell development, possibly via, ysis. For CD23 induction, B cells were cultured in RPMI 1640 medium by guest on September 29, 2021 among other mechanisms, regulating surface expression of Ig␣.In with 10% FBS, 2 mM L-glutamine, and 50 ␮M 2-ME at the concentration 6 addition, altered expression of E2A and Id mRNAs may also con- of 10 cells/ml. Cells were stimulated with 50 ng/ml IL-4 (R&D Systems) and expression of CD23 was measured after 24 h by flow cytometry after tribute to the observed increase in MZ B to FO B cell ratio. These staining with anti-CD23-PE Abs. For in vitro class switch assays, B cells findings also highlight a unique in vivo function for the CTA do- were cultured at 106 cells/ml with 50 ␮g of LPS (Sigma-Aldrich) and main of Fli-1 in the regulation of B cell development and function. recombinant murine IL-4 at 50 ng/ml to induce switching to IgG1, with LPS alone to induce switching to IgG3 and IgG2b, or with LPS and IFN-␥ at 10 ng/ml (eBioscience) to induce switching IgG2a. The percentage of Materials and Methods IgG1, IgG3, IgG2a, and IgG2b expression was measured by flow cytomet- ric analysis after 4 days of stimulation and staining with FITC-conjugated Mice anti-mouse IgG1, IgG3, IgG2a, or IgG2b and PE-conjugated anti-B220. Generation of the Fli-1 allele (Fli-1⌬CTA) that encodes truncated Fli-1 pro- tein (amino acids 1–384) mice has been described in detail (O. Moussa, A. In vivo proliferation assays LaRue, R. Abangan, Jr., X. Zhang, M. Masuya, Y. Gong, D. Spyropoulos, A total of 105 purified B cells were dispensed in a 96-well plate at 100 M. Ogawa, G. Gilkeson, and D. Watson, manuscript in preparation). The ␮l/well and cultured with RPMI 1640 medium with 10% FBS, 2 mM mice were backcrossed with C57BL/6 mice for at least eight generations L-glutamine, and 50 ␮M 2-ME. Cells were stimulated with 20 or 40 ␮g/ml and then used in this study. Ly5.1 mice (B6.SJL-Ptprca Pep3b/BoyJ) were Ј anti-mouse IgM (goat F(ab )2; Jackson ImmunoResearch Laboratories) for purchased from The Jackson Laboratory for the bone marrow transplanta- 72 h, and [3H]thymidine (1 ␮Ci/well) was added to each well 24 h before tion study. All mice were maintained in the specific-pathogen-free animal harvest. facilities of the Ralph H. Johnson Veterans Affairs Medical Center, and all animal procedures were approved by the institutional animal care and use Ca2ϩ mobilization assay committee. B cells were purified as described above. B cells were incubated at 30°C for 30 min with Fluo-3 in RPMI 1640 with 10% FBS. Cells were washed Immunoblotting before stimulation. Cells were warmed at 30°C for 5 min before stimula- 2ϩ ϳ Splenocytes, , or purified B cells with negative selection kits tion and the basal Ca concentration was measured for 30 s. Stimulation Ј ␮ (Miltenyi Biotec) from spleen cells were lysed by radioimmunoprecipi- was performed with anti-mouse IgM F(ab )2 (20 g/ml; Jackson Immuno tation assay buffer. Lysates were analyzed by 10% SDS-PAGE and Research Laboratories) and the events were recorded for 220 s (33). transferred to a polyvinylidene fluoride membrane. The membrane was incubated with specific Fli-1 Ab and revealed by horseradish-conjugated Immunofluorescent staining of spleen goat-anti-rabbit Abs, following by the ECL detection system. Spleens were removed from the mice and frozen in liquid nitrogen. A section of spleen was cut at a thickness of 5 ␮m. After air-drying, tissue ELISA sections were fixed in 4% paraformaldehyde for 20 min. Immunohisto- chemical staining was done with FITC-conjugated rat anti-mouse metal- ELISA were used to detect the Ig concentrations from mice as described lophilic macrophage (MOMA-1; monoclonal; MCA947F; Serotec) and bi- previously (31). otin-conjugated goat anti-mouse IgM (Southern Biotechnology Associates) 1646 Fli-1 MODULATES B CELL DEVELOPMENT

Table I. PCR primer sequences and GenBank accession numbers

Primer Name Forward Primer Reverse Primer Amplicon Length Accession No. Taa (°C)

ID1 GGTGGAGATCCTGCAGCATGTA TAACCCCCTCCCCAAAGTCTCT 401 NM_010495 60 ID2 CTCCAAGCTCAAGGAACTGGTG CCATTCAACGTGTTCTCCTGGT 404 NM_010496 58 E2A AGTGCCTTATCCCCCAACTACG TGGTTATGCAAAAGACTGGCCC 257 NM_011548 63 EBF TGAAGAGAGCTGCCGACATTG CCGTAGCCATTCATGCTTGTG 274 NM_007897 60 Mb-1 GGTACCAAGAACCGCATCATCA AGTCAGACATATGGCAGGCAGG 308 NM_007655 59 PAX-5 ATGGCCACTCACTTCCGGGC GTCATCCAGGCCTCCAGCCA 204 NM_008782 60 Bcl-2 AGATGTCCAGTCAGCTGCACCT TCATCTGCTCAATGGCCCAT 352 NM_009741 61

Bcl-xL CCCCCCACATCTCAGTTCTCTT CACCTCACTCAATGGCTCTTGG 303 NM_009743 61 CD19 CTCCACACTTTGGCTGTCCTGT CCTTGCAATGACCTTCACGTG 255 NM_009844 60 CD22 GCTGATTTGTGAGTCACTGGCC TGACGTCTGGATTGCTGGAGTT 305 NM_009845 60 CD23 TCAAGATCCAGGTCCGAAAGG TGAAGCAAAGGAGGCTGGAAG 332 NM_010185 59 CD43 CCACCACTGTGACAACAAGCTC CACCAAGGCAATAAGCATGG 302 NM_009259 60 Egr1 GGCGATGGTGGAGACGAGTTAT TACGGTTCTCCAGACCCTGGAA 503 NM_007913 60 PU.1 AGGCGTGCAAAATGGAAGG TCTCACCCTCCTCCTCATCTGA 411 M38252 60 Fli-1 TGCTGTTGTCGCACCTCAGTTA TGTTCTTGCCCATGGTCTGTG 204 NM_008026 60 HPRT GCTGGTGAAAAGGACCTCTC ATGGCCACAGGACTAGAACAC 254 J00423 62

a Ta, Annealing temperature. Downloaded from

⌬ ϩ after blocking with 10% rat serum for 1 h. Next, the sections were stained dose-dependent, as Fli-1 CTA/Fli-1 mice had fewer B cells than with Texas-Red streptavidin (Vector Laboratories). After being washed, wild-type controls, but more than Fli-1⌬CTA/Fli-1⌬CTA mice sections were examined with an Olympus Fluoview IX70 confocal laser (Table II). scanning microscope. The IgG1 and IgG3 concentrations in serum were decreased Bone marrow transplantation Ͼ50% in Fli-1⌬CTA/Fli-1⌬CTA mice compared with controls (for http://www.jimmunol.org/ Ϯ ␮ ⌬CTA ⌬CTA Bone marrow cells were isolated from the femurs of wild-type or Fli- IgG1, wild type, 408.6 75.0 g/ml vs Fli-1 /Fli-1 mice, 1⌬CTA/Fli-1⌬CTA B/6 mice and were injected i.v. into sublethally irradiated 188.3 Ϯ 41.2 ␮g/ml, n ϭ 14–15 in each group, p ϭ 0.014; for ⌬ ⌬ recipient Ly5.1 mice (B6.SJL-Ptprca Pep3b/BoyJ) mice (600 Gy). The IgG3, wild type, 97.2 Ϯ 22.6 ␮g/ml vs Fli-1 CTA/Fli-1 CTA mice, mice were sacrificed 12 wk later and splenic B cells were examined. 44.3 Ϯ 12.2 ␮g/ml, n ϭ 14–15 in each group, p ϭ 0.045, Fig. 1B). Real-time PCR Although the concentrations of serum IgM, IgG2a, and IgG2b in Fli-1⌬CTA/Fli-1⌬CTA mice were slightly lower than in wild-type Total RNA was prepared from bone marrow, splenic cells, or purified B mice, the difference was not statistically significant (Fig. 1B). cells for real-time PCR analysis. A total of 2 ␮g of RNA was used to synthesize cDNA (SuperScript First-Strand Synthesis System; Invitrogen). by guest on September 29, 2021 Real-time PCR was performed in duplicate using Platinum SYBR Green Fli-1 deficiency affects pre-B cell development in bone marrow qPCR SuperMix UDG (Invitrogen) according to the manufacturer’s in- structions, with three independent RNA preparations. PCR was done using To further characterize the impact of Fli-1 CTA deficiency on B the LightCycler (Roche) and relative expression analysis was conducted cell development, bone marrow cells were isolated from the fe- using the program LinRegPCR according to the suggested specifications murs of wild-type and Fli-1⌬CTA/Fli-1⌬CTA mice and analyzed by (34). The cycling conditions for all genes were: preincubation at 50°C for low 2 min, 95°C for 2 min, followed by 30–50 cycles of denaturation at 94°C flow cytometry. Pre-B cells and immature B cells (B220 Ϫ ⌬CTA ⌬CTA for 5 s, annealing at 1° below the lowest temperature for a given primer pair CD43 ) were significantly reduced in Fli-1 /Fli-1 mice (Table I) for 5 s and extension for 45 s at 72°C, with a single data acqui- compared with wild-type mice as shown in Fig. 2 (wild type, sition at the end of each extension. All ramping was done at 20°C/s. 17.6 Ϯ 2.0% vs Fli-1⌬CTA/Fli-1⌬CTA mice, 10.3 Ϯ 1.1%, n ϭ 5in ϭ low Ϫ Statistical analysis each group, p 0.02). B220 CD43 cells were further subdi- vided into fractions D–F based on surface expression of IgM and Ϯ Ϫ Ϫ Quantitative data are expressed as mean SD. Statistical analysis was IgD (35). Populations of fraction D (B220lowIgM IgD ), fraction performed using the two-tailed Student t test. E (B220lowIgMϩIgDϪ), and fraction F (B220lowIgMϩIgDϩ) were ⌬CTA ⌬CTA Results all significantly lower in Fli-1 /Fli-1 mice than in wild- ⌬CTA ⌬CTA type controls (Fig. 2). There was no statistically significant differ- Generation of Fli-1 /Fli-1 mice ence in the number of pro-B cells (B220lowCD43ϩ) from Fli- Because complete disruption of the Fli-1 gene is embryonic lethal, 1⌬CTA/Fli-1⌬CTA mice compared with wild-type mice (Fig. 2). we generated a new Fli-1 allele (Fli-1⌬CTA) that encodes a trun- cated Fli-1 protein (amino acids 1–384) lacking the CTA domain and used homozygous mutant mice to evaluate the role of Fli-1 in Fli-1 deficiency impacts FO and MZ B cell development normal lymphocyte development. Removal of this domain of Fli-1 Next, we examined whether Fli-1 deficiency affected splenic B cell reduces overall in vitro transcriptional activation activity by 40– populations. The total number of spleen cells was significantly 50% (16). We backcrossed Fli-1⌬CTA/Fli-1ϩ mice (B6 ϫ 129 het- higher in Fli-1⌬CTA/Fli-1⌬CTA mice compared with wild-type con- erozygotes) with C57BL/6 (B6) mice for eight generations. Fli- trols (wild type, 74.8 ϫ 106 Ϯ 10.4 ϫ 106 cells, vs Fli-1⌬CTA/Fli- 1⌬CTA/Fli-1ϩ B6 mice were mated to generate two groups of mice, 1⌬CTA, 105.7 ϫ 106 Ϯ 4.9 ϫ 106, n ϭ 8 in each group, p ϭ 0.035, Fli-1⌬CTA/Fli-1⌬CTA and wild-type (Fli-1ϩ/Fli-1ϩ) littermate con- Fig. 3A) though spleen weights were similar (data not shown). The trols for this study. A stable truncated Fli-1 protein was expressed percentage of CD3ϩ T cells in spleens from Fli-1⌬CTA/Fli-1⌬CTA in splenocytes, thymocytes, and isolated splenic B cells from Fli- mice tended to be higher compared with wild-type control mice, 1⌬CTA/Fli-1⌬CTA mice (Fig. 1A). Peripheral blood analysis dem- but did not reach statistical significance (wild type, 28.1 Ϯ 0.9% vs onstrated that Fli-1⌬CTA/Fli-1⌬CTA mice had a significant decrease Fli-1⌬CTA/Fli-1⌬CTA, 32.3 Ϯ 2.7%, n ϭ 8, p ϭ 0.18). The per- in B220ϩ B cells (Table II). The difference in B cell number was centage of splenic B cells, however, was significantly decreased in The Journal of Immunology 1647 Downloaded from http://www.jimmunol.org/ FIGURE 1. Fli-1 expression in immune cells and impact on Ig levels. A, Immunoblot analysis of truncated Fli-1 expression in isolated total splenocytes, thymocytes, and B cells. Western blot of spleen and thymus tissue extracts prepared from wild-type, heterozygous Fli1⌬CTA/Fli1ϩ, and homozygous Fli1⌬CTA/Fli1⌬CTA mice. A total of 30 ␮g of protein extract was resolved on a 12.5% acrylamide gel and probed with rabbit anti-Fli-1 polyclonal Ab. Blots were reprobed with anti-actin as a loading control. B, Serum Ig titers from Fli-1⌬CTA/Fli-1⌬CTA mice and wild-type controls. Sera were collected from Fli-1⌬CTA/Fli-1⌬CTA mice (n ϭ 14) and littermate wild-type controls (n ϭ 15) at the age of 8–12 wk. Ig concentrations were determined by ELISA.

Fli-1⌬CTA/Fli-1⌬CTA mice compared with wild-type littermate con- In contrast to the decreased percentage of FO B cells, MZ B cell Ϯ ⌬CTA ⌬CTA ⌬CTA ⌬CTA trols (wild-type mice, 40.9 1.7% vs Fli-1 /Fli-1 mice, percentage was significantly increased in Fli-1 /Fli-1 by guest on September 29, 2021 30.2 Ϯ 2.6%, n ϭ 8, p ϭ 0.0014), though due to the overall mice compared with wild-type controls (Fig. 3B, wild type, 5.5 Ϯ increase in spleen cell number, the total number of splenic B cells 0.5% vs Fli-1⌬CTA/Fli-1⌬CTA, 8.3 Ϯ 0.9%, n ϭ 8; p ϭ 0.0371). in the Fli-1⌬CTA/Fli-1⌬CTA mice was slightly greater than wild- The significant increase in MZ B cells from Fli-1⌬CTA/Fli-1⌬CTA type mice (Fig. 3A). mice was further confirmed using additional markers for MZ B Next, we analyzed the splenic B cells for surface expression of CD21 and CD23 to discriminate between FO B cells (B220ϩ CD21intCD23high) and MZ B cells (B220ϩCD21highCD23Ϫ/low). The percentage of FO B cells were significantly decreased in Fli- 1⌬CTA/Fli-1⌬CTA mice compared with wild-type controls (wild- type, 62.3 Ϯ 0.7% vs Fli-1⌬CTA/Fli-1⌬CTA mice, 43.8 Ϯ 0.8%, n ϭ 8, p Ͻ 0.0001, Fig. 3B). The total number of FO B cells in the spleens from Fli-1⌬CTA/Fli-1⌬CTA mice was significantly less than in wild-type controls (Fig. 3A). Overall, the intensity of cell sur- face CD23 expression on all splenic B cells was reduced in Fli- 1⌬CTA/Fli-1⌬CTA mice compared with wild-type mice (Fig. 3C). It has been reported that CD23 is up-regulated by IL-4 (36). We found that expression of CD23 in B cells from both wild-type and Fli-1⌬CTA/Fli-1⌬CTA mice was up-regulated similarly after IL-4 stimulation (data not shown).

Table II. Flow cytometric analysis of peripheral blood cell from wild-type, Fli-1⌬CTA/Fli-1ϩ heterozygous, and Fli-1⌬CTA/Fli-1⌬CTA micea FIGURE 2. Pre-B and immature B cells are reduced in Fli-1⌬CTA/Fli- ⌬CTA ϩ ⌬CTA ⌬CTA Wild Type Fli-1 / Fli-1 /Fli-1 1⌬CTA mice. Fli-1⌬CTA/Fli-1⌬CTA and wild-type control mice were sacri- (n ϭ 20) (n ϭ 7) (n ϭ 20) ficed at the age of 10 wk. Cells were isolated from bone marrow and B220ϩ 52.36 Ϯ 4.82 41.40 Ϯ 5.99b,c 32.58 Ϯ 8.19b analyzed for the expression of B220 and CD43 by flow cytometric analysis. Pro-B cells and pre-B/immature B cells are defined as B220lowCD43ϩ and a ϩ The percentages of B220 cells were assessed by flow cytometry. Values rep- B220lowCD43Ϫ, respectively. Numbers reflect the percentage of the cells in resent mean Ϯ SD. b Value of p Ͻ 0.0001 when compared to wild type. each gated population. Data are representative of five mice per experiment c Value of p Ͻ 0.05 when compared to Fli-1⌬CTA/Fli-1⌬CTA homozygous mice. from three independent experiments. 1648 Fli-1 MODULATES B CELL DEVELOPMENT Downloaded from

FIGURE 4. Increased T1 and MZP B cells in Fli-1⌬CTA/Fli-1⌬CTA mice. Spleen cells were analyzed for T1 and MZP B cells from Fli-1⌬CTA/Fli- 1⌬CTA and wild-type mice. T1 and MZP B cells were defined as

B220ϩIgMhighCD21Ϫ/lowCD23Ϫ and B220ϩIgMhighD21highCD23ϩ,re- http://www.jimmunol.org/ spectively. The percentage of each gated population is shown. Data are representative of five mice per experiment from a total of four independent experiments.

cells, including CD1d and CD9 (Fig. 3D). The absolute number of MZ B cells in spleens from Fli-1⌬CTA/Fli-1⌬CTA mice was also significantly higher than in wild-type mice (Fig. 3A). Histological ϩ examination of the spleens showed an increase of IgM B cells by guest on September 29, 2021 outside the MOMA-1ϩ metallophilic macrophage region, which defines the boundary between the FO and MZ B cell zones (data not shown). These data, consistent with the flow cytometric data, demonstrate that Fli-1⌬CTA/Fli-1⌬CTA mice have an increased number of MZ B cells.

Increased number of transitional B cells in Fli-1⌬CTA/Fli-1⌬CTA mice Upon arrival in the spleen, immature B cells emerging from the bone marrow are designated as transitional B cells and are divided into transitional stage 1 (T1) and transitional stage 2 (T2) B cells by Loder et al. (37). Recently, several studies demonstrated that these T2 cells are actually MZ precursors (MZP) cells (8, 38–39). To further delineate possible B cell developmental alterations in the spleens of Fli-1⌬CTA/Fli-1⌬CTA mice, the FIGURE 3. Decrease of FO B cells and increase of MZ B cells in Fli- 1⌬CTA/Fli-1⌬CTA mice. A, The absolute numbers of spleen cells, B cells, populations were examined. T1 B cells were characterized by ϩ high Ϫ/low Ϫ FO, MZ, T1, and MZP B cells in the spleens from Fli-1⌬CTA/Fli-1⌬CTA B220 IgM CD21 CD23 surface marker expression, and ϩ high high ϩ mice and controls. Mean Ϯ SD of the cells from a minimum of six mice MZP B cells by the expression of B220 IgM CD21 CD23 . p Ͻ As shown in Fig. 4, significant increases in splenic percentage of ,ء ;are shown. Data are representative of four independent experiments 0.05. B, Flow cytometric analysis of FO B cells and MZ B cells in Fli- T1 and MZP B cells were observed in Fli-1⌬CTA/Fli-1⌬CTA mice ⌬ ⌬ 1 CTA/Fli-1 CTA and wild-type mice. Spleen cells were analyzed for the compared with wild-type mice (for T1 B cells, wild type, 4.7 Ϯ expression of B220, CD21, and CD23. FO B cells and MZ B cells were 0.2%, vs Fli-1⌬CTA/Fli-1⌬CTA, 11.2 Ϯ 0.9%, n ϭ 5, p ϭ 0.0003; ϩ int high ϩ high Ϫ/low defined as B220 CD21 CD23 and B220 CD21 CD23 ,re- for MZP B cells, wild type, 6.8 Ϯ 0.3%, vs Fli-1⌬CTA/Fli-1⌬CTA, spectively. Numbers represent the percentage of cells in indicated gates. C, Ϯ ϭ ϭ ⌬CTA ⌬CTA 8.2 0.5%, n 5, p 0.0442, Fig. 4). The absolute number of Comparison of CD23 expression on B cells from Fli-1 /Fli-1 mice ⌬ ⌬ T1 B cells in Fli-1 CTA/Fli-1 CTA mice is 10-fold higher than in and wild-type controls. D, Increase of CD1dhigh and CD9high MZ B cells in ϫ 5 ϫ 5 the Fli-1⌬CTA/Fli-1⌬CTA mice. B220ϩ B cells were first gated and analyzed wild-type controls (40.3 10 vs 4.0 10 , respectively, Fig. by the expression of CD1d or CD9. The numbers indicate the percentage 3A). However, the absolute number of MZP B cells in the spleen ⌬CTA ⌬CTA of the positive cells. is similar between Fli-1 /Fli-1 and wild-type control mice, despite the differences in percentage. These data suggest that efficient progression of T1 B cells to the FO B cell stage was The Journal of Immunology 1649

Fli-1⌬CTA/Fli-1⌬CTA bone marrow cells had an increased number of MZ B cells with a decreased number of FO B cells, similar to unmanipulated Fli-1⌬CTA/Fli-1⌬CTA mice (for FO B cell, wild-type bone marrow recipients, 77.0 Ϯ 0.5% vs Fli-1⌬CTA/Fli-1⌬CTA bone marrow recipients, 49.5 Ϯ 1.6%, n ϭ 5; p Ͻ 0.0001, for MZ B cells, wild-type bone marrow recipients, 4.5 Ϯ 0.5% vs Fli-1⌬CTA/ Fli-1⌬CTA bone marrow recipients, 14.0 Ϯ 1.1%, n ϭ 5, p Ͻ 0.0001). These data indicated that the reduction of FO B cells and increase of transitional B cells and MZ B cells results from lym- phocyte/bone marrow-intrinsic Fli-1 deficiency and not stromal cell effects.

Altered B cell gene expression in Fli-1⌬CTA/Fli-1⌬CTA mice Because previous reports suggested Fli-1 may be involved in reg- ulation of Ig␣ (mb-1) expression (23), we first examined the ex- pression of Ig␣ on B cells from Fli-1⌬CTA/Fli-1⌬CTA mice. As shown in Fig. 6A, the surface expression of Ig␣ on B cells from Fli-1⌬CTA/Fli-1⌬CTA mice was decreased compared with wild-type

mice. Real-time RT-PCR analysis of mb-1 mRNA demonstrated Downloaded from significantly reduced expression in bone marrow from Fli-1⌬CTA/ Fli-1⌬CTA mice compared with that from wild-type mice. (Fig. 6B). FIGURE 5. Impaired development of FO and MZ B cell in Fli-1⌬CTA/ Thus, both at the protein and transcript level, Ig␣ expression was ⌬ ⌬ Fli-1⌬CTA mice is a bone marrow autonomous affect. Bone marrow from decreased in Fli-1 CTA/Fli-1 CTA mice. wild-type and Fli-1⌬CTA/Fli-1⌬CTA mice (CD45.2) were transplanted into A limited set of transcription factors (e.g., ikaros, PU.1, E2A,

sublethally irradiated CD45.1 B6 mice. Spleen cells from recipient mice EBF, Pax-5) regulate expression of B-lineage-specific genes. B http://www.jimmunol.org/ were stained with anti-B220, -CD21, -CD23, and -CD45.2 and analyzed by cell development is dependent upon proper expression of multiple FACS. A, Over 94% of spleen cells from recipient mice were CD45.2 transcription factors, including E2A (E12 and E47), Id1, and Id2 positive. B, MZ B cells and FO B cells in recipient mice. Percentages (10, 40–41). Real-time RT-PCR was used to examine the expres- indicate cells in the gated populations. Data are representative of five mice sion of multiple transcripts in mRNA prepared from total bone per group from two independent experiments. marrow and purified B cells (Fig. 6B). Id proteins are negative regulators of transcription factors E2A and Pax-5 (40, 41). Al- though PU.1 and EBF were not significantly altered in the Fli-1- decreased in Fli-1-deficient mice. The increase in MZ B cells may deficient mice, the expression of E2A and Pax-5 mRNA was sig- reflect preferential development of MZ B cells in Fli-1 deficiency nificantly reduced and Id1 and Id2 mRNA was significantly by guest on September 29, 2021 due to a block in FO B cell development rather than a positive increased in RNA prepared from bone marrow of Fli-1-deficient vs effect on MZ B cell development. wild-type mice (Fig. 6B). E2A transcript levels were reduced in RNA prepared from splenic B cells of the Fli-1-deficient mice, B1 cell development is not affected in Fli-1⌬CTA/Fli-1⌬CTA mice although the values did not reach statistical significance. Id2 tran- B1 cells are self-renewing, residing mainly in the peritoneal and scripts were statistically significantly increased in total RNA pre- pleural cavities (9). To examine whether Fli-1 deficiency also af- pared from bone marrow and purified splenic B cells (Fig. 6B) fected B1 cell development, we collected peritoneal from Fli-1⌬CTA/Fli-1⌬CTA compared with wild-type mice. Egr-1 is ⌬ ⌬ from Fli-1 CTA/Fli-1 CTA and wild-type control mice. The cells required for B cell maturation and is regulated by Fli-1 (25, 42). were stained with anti-CD5 and -IgM. There was no significant Quantitative real-time RT-PCR assessment of Egr-1 mRNA ⌬ difference in peritoneal B1 cell numbers between Fli-1 CTA/Fli- levels in RNA prepared from bone marrow and purified B cells ⌬ 1 CTA and wild-type control mice (wild type, 14.7 Ϯ 1.2%, vs demonstrated a consistent reduction in Fli-1⌬CTA/Fli-1⌬CTA ⌬ ⌬ Fli-1 CTA/Fli-1 CTA, 14.2 Ϯ 3.4%, n ϭ 5, p ϭ 0.8792). mice compared with wild-type mice. Transitional, FO, and MZ B cells were isolated with a FACSVantage cell sorter for anal- B cell-autonomous Fli-1 defect affects B cell development in ⌬CTA ⌬CTA ysis of gene expression. Reduced expression of mb1 and Pax-5 Fli-1 /Fli-1 mice in Fli-1⌬CTA/Fli-1⌬CTA mice compared with wild-type controls The reduced number of FO B cells and increased number of tran- was observed in these isolated populations (Fig. 6C). Transi- sitional and MZ B cells could be the result of an intrinsic Fli-1 tional B cells demonstrated higher expression of Fli-1 than MZ defect in the B cells themselves or due to influences of Fli-1 de- and FO B cells (Fig. 6C). ficiency on the splenic microenvironment (non-B cells). To distin- Programmed cell death is a critical process in B lymphocyte ϫ 6 guish between these two possibilities, 1 10 bone marrow cells development. We found that Bcl-xL and Bcl-2 expression was de- from wild-type or Fli-1⌬CTA/Fli-1⌬CTA mice with the Ly5.2 creased in Fli-1⌬CTA/Fli-1⌬CTA mice compared with wild-type (CD45.2) genotype were transferred into sublethally irradiated B6 controls (Fig. 6B). We did not, however, detect differences in in mice with the Ly5.1 (CD45.1) genotype. The mice were sacrificed vivo or in vitro apoptosis between wild-type and Fli-1⌬CTA/Fli- 12 wk after transplantation and the spleen cells were analyzed by 1⌬CTA mice (data not shown). flow cytometry. As shown in Fig. 5A, over 94% of spleen cells As noted above (Fig. 3C), cell surface CD23 protein expression from the recipients were CD45.2ϩ indicating that the reconstitut- was reduced in Fli-1⌬CTA/Fli-1⌬CTA mice. Consistent with this ob- ing B cells in the recipients were derived from donor bone marrow. servation, CD23 mRNA was also reduced in Fli-1⌬CTA/Fli-1⌬CTA B6 Ly5.1 recipients that received wild-type bone marrow had bone marrow and isolated B cells. The CD23 mRNA reduction numbers of MZ B cells and FO B cells similar to those of wild- demonstrated in the spleen was over 2-fold (Fig. 6B). Furthermore, type mice (Fig. 5B). In contrast, the B6 Ly5.1 mice that received CD19 transcripts were reduced in Fli-1⌬CTA/Fli-1⌬CTA mice 1650 Fli-1 MODULATES B CELL DEVELOPMENT Downloaded from http://www.jimmunol.org/

FIGURE 6. Altered B cell gene expression in Fli-1⌬CTA/Fli-1⌬CTA mice. A, Decreased Ig␣ expression in B cells from Fli-1⌬CTA/Fli-1⌬CTA mice. Spleen ⌬CTA ⌬CTA cells were stained with Abs against B220 and Ig␣ and analyzed by flow cytometry. Ig␣ expression in Fli-1 /Fli-1 mice was reduced compared with by guest on September 29, 2021 wild-type mice. Data are representative of five mice per experiment from a total of four independent experiments. B, Altered gene expression in bone marrow and splenic B cells from Fli-1⌬CTA/Fli-1⌬CTA mice. Total RNA was prepared from bone marrow or purified B cells for real-time PCR analysis. Total RNA was converted to cDNA with the SuperScript First-Strand Synthesis System (Invitrogen). Real-time PCR was done in triplicate with the appropriate (Statistically significant differences in expression. C, Altered gene expression in transitional B cells (TB), FO B cells (FO), and MZ B cells (MZ ,ء .primers from Fli-1⌬CTA/Fli-1⌬CTA mice. Total RNA was prepared from sorted transitional, FO, or MZ B cells for real-time PCR analysis. D, ChIP analysis of Fli-1 binding to the mb-1 promoter. Total bone marrow (4 ϫ 106 cells) was isolated from wild-type and Fli-1⌬CTA/Fli-1⌬CTA mice. The Ϫ160 to ϩ34 region of the mouse mb-1 promoter was amplified by real-time PCR using mb-1 primers specific for the proximal promoter region as outlined in Materials and Methods. Relative expression analysis was conducted using the program LinRegPCR according to the suggested specifications. As a positive control, 5% of the input chromatin was used as a template. Normal rabbit IgG was used as a negative control.

(Fig. 6B). At this time, it is unclear whether the reduction in CD23 from Fli-1⌬CTA/Fli-1⌬CTA mice following anti-IgM cross-linking and CD19 is a primary effect of Fli-1 deficiency or is secondary to was significantly less than that from wild-type controls (Fig. 7A) the impact of Fli-1 on B cell development. indicating that B cells from Fli-1⌬CTA/Fli-1⌬CTA mice have de- Next, we asked whether the reduced gene expression observed creased proliferative capacity compared with wild-type B cells. To reflects decreased binding of Fli-1⌬CTA to Fli-1-responsive pro- determine whether the decreased proliferation was due to early moters. For this, we examined whether truncated Fli-1 protein components of BCR signaling, we assessed intracellular Ca2ϩ lev- binds the mb1 promoter in vivo in B cells. After immunoprecipi- els following anti-IgM cross-linking. Despite the clear impact of tation with a Fli-1-specific Ab that binds both native Fli-1 and Fli-1⌬CTA/Fli-1⌬CTA on B cell proliferation, intracellular Ca2ϩ in- truncated Fli-1, enrichment of the endogenous promoter fragments crease after anti-IgM stimulation of B cells from Fli-1⌬CTA/Fli- in each sample was detected by PCR amplification. As a positive 1⌬CTA mice was similar to that of wild-type controls (Fig. 7B). control, 5% of the input chromatin was used as a template. Normal Thus, the decreased proliferative capacity following BCR cross- rabbit IgG was used as a negative control (Fig. 6D). These results linking of Fli-1⌬CTA/Fli-1⌬CTA B cells was not due to early defects indicate that while native Fli-1 and truncated Fli-1 each bound to in BCR signaling, despite the decrease in Ig␣ expression. the mb-1 promoter, Fli-1⌬CTA appears to have reduced affinity. Immune responses of Fli-1⌬CTA/Fli-1⌬CTA mice BCR signaling and proliferation of B cell ⌬CTA ⌬CTA FO and MZ B cells have different functions in immune responses in Fli-1 /Fli-1 mice (6, 8). A decrease in FO B cells and an increase of MZ B cells in Because Ig␣ expression was decreased in Fli-1⌬CTA/Fli-1⌬CTA Fli-1⌬CTA/Fli-1⌬CTA mice may affect in vivo immune responses. mice, we isolated B cells and measured proliferation after cross- Thus, to determine whether the lack of Fli-1 CTA had a significant linking the BCR with anti-IgM. [3H]Thymidine uptake by B cells in vivo effect, we examined the humoral immune responses to T The Journal of Immunology 1651

FIGURE 8. Altered humoral immune responses in the Fli-1⌬CTA/Fli- 1⌬CTA mice. Mice were challenged with -independent Ag TNP-Ficoll or T cell-dependent Ag TNP-KLH at the age of 10 wk. The concentration Downloaded from of TNP-specific Abs on days 7, 14, and 21 after immunization were ex- amined by ELISA and are shown for four littermates from each phenotype. Statistically ,ء .Data are representative of two independent experiments significant changes. FIGURE 7. Impact of Fli-1 on responses to BCR cross-linking. A, Im- paired proliferation of FO B cells from Fli-1⌬CTA/Fli-1⌬CTA mice. FO B ⌬CTA ⌬CTA cells were purified from Fli-1 /Fli-1 mice and wild-type controls http://www.jimmunol.org/ and stimulated by cross-linking with anti-IgM. Proliferation responses were determined by [3H]thymidine incorporation. Data are representative 0.029). There was no significant difference in IgG3 expression ⌬ ⌬ of two independent experiments. B,Ca2ϩ flux is not affected in Fli-1⌬CTA/ between B cells from Fli-1 CTA/Fli-1 CTA mice and that from Fli-1⌬CTA mice. Purified FO B cells from Fli-1⌬CTA/Fli-1⌬CTA mice and wild-type controls (Fig. 9, wild type, 11.4 Ϯ 1.2%, vs Fli-1⌬CTA/ wild-type controls were preloaded with Fluo-3 and stimulated with anti- Fli-1⌬CTA, 10.2 Ϯ 0.4%, n ϭ 5, p ϭ 0.1806). Percentages of Ј 2ϩ IgM F(ab )2. Data shown are the change in relative intracellular Ca con- IgG2a- and IgG2b-expressing B cells were also not significantly centrations. The arrow shows the point of stimulation. Data are represen- different between B cells from wild-type mice and Fli-1⌬CTA/Fli- tative of four independent experiments. ⌬ 1 CTA mice after stimulation (data not shown). by guest on September 29, 2021 ⌬ ⌬ T cell development was not affected in thymus cell-independent and -dependent Ags in Fli-1 CTA/Fli-1 CTA mice in ⌬CTA ⌬CTA mice compared with wild-type controls. Mice were injected with 50 ␮g Fli-1 /Fli-1 of T cell-independent Ag TNP-Ficoll or T cell-dependent Ag TNP- Finally, we investigated whether T cell development was af- KLH mixed with CFA i.p. Mice immunized with T cell-dependent fected in Fli-1⌬CTA/Fli-1⌬CTA mice. populations TNP-KLH were boosted with 50 ␮g of TNP-KLH mixed with IFA were isolated from Fli-1⌬CTA/Fli-1⌬CTA and wild-type mice and 1 wk after the first immunization. Induced TNP-specific Abs were measured 7, 14, and 21 days after immunization. Fli-1⌬CTA/Fli- 1⌬CTA mice produced significantly lower levels of IgG1 Abs against the T cell-dependent Ag compared with wild-type control mice. Fli-1⌬CTA/Fli-1⌬CTA mice, however, produced higher levels of IgM Abs against the T cell-independent Ag, and higher levels of IgG3 Abs against both T cell-dependent and -independent Ags (Fig. 8). These results are consistent with effect of Fli-1⌬CTA on B cell development, given the increased MZ B cells (increased IgM and IgG3 response) and decreased FO B cells (reduced IgG1 re- sponse) observed in Fli-1⌬CTA/Fli-1⌬CTA mice.

Reduced in vitro IgG1 class switch of B cells from Fli-1⌬CTA/Fli-1⌬CTA mice Because the level of IgG1 Abs was lower in Fli-1⌬CTA/Fli-1⌬CTA mice after immunization compared with wild-type controls, next we investigated whether the IgG1 class switch of B cells from Fli-1⌬CTA/Fli-1⌬CTA mice was alternated. B cells were purified from spleen and stimulated with 50 ␮g of LPS and recombinant FIGURE 9. Decreased in vitro IgG1 class switch recombination effi- ciency in B cells from Fli-1⌬CTA/Fli-1⌬CTA mice. The purified B cells were murine IL-4 at 50 ng/ml to induce switching to IgG1, with LPS cultured with 50 ␮g of LPS (Sigma-Aldrich) and recombinant murine IL-4 alone to induce switching to IgG3 and IgG2b, or with LPS and at 50 ng/ml to induce switching to IgG1, with LPS alone to induce switch- ␥ IFN- at 10 ng/ml to induce switching IgG2a. The percentage of ing to IgG3 for 4 days. The percentages of IgG1 and IgG3 expression were ⌬CTA IgG1-expressing B cells was significantly lower in Fli-1 /Fli- measured by flow cytometric analysis. The percentage of the gated popu- ⌬CTA 1 mice compared with wild-type mice (Fig. 9, wild type, lation is shown. Data are representative of five mice per experiment from ⌬ ⌬ 26.9 Ϯ 1.6%, vs Fli-1 CTA/Fli-1 CTA, 20.9 Ϯ 1.0%, n ϭ 5, p ϭ a total of two independent experiments. 1652 Fli-1 MODULATES B CELL DEVELOPMENT analyzed by flow cytometry. There were no significant differ- ences in mature CD4ϩCD8Ϫ and CD4ϪCD8ϩ thymocytes be- tween Fli-1⌬CTA/Fli-1⌬CTA and wild-type mice (data not shown). Furthermore, the numbers of CD4ϩCD8ϩ and CD4Ϫ CD8Ϫ thymocytes in Fli-1⌬CTA/Fli-1⌬CTA mice were similar to those found in wild-type mice (data not shown).

Discussion Prior experiments in Fli-1-transgenic and heterozygous knockout mice indicated that Fli-1 has significant effects on immune func- tion, specifically B cell function (30, 31). Because complete defi- ciency of Fli-1 is embryonic lethal, to determine the impact of Fli-1 deficiency on B cell development, we developed a mouse that expressed a truncated Fli-1 protein and demonstrated con- clusively that Fli-1 plays a critical role in B cell development. Specifically, we found a significant decrease in splenic FO B cells and an increase in transitional and MZ B cells in Fli- ⌬ ⌬ 1 CTA/Fli-1 CTA mice compared with wild-type controls. Al- Downloaded from though bone marrow pro-B cell number was not affected, the reduction of bone marrow pre-B cells observed in Fli-1⌬CTA/ Fli-1⌬CTA mice compared with wild-type mice supports the pro- posed model that wild-type Fli-1 function is required for max- imum efficiency of early B cell differentiation. ⌬CTA The pre-B cell population was significantly lower in Fli-1 / http://www.jimmunol.org/ Fli-1⌬CTA mice compared with wild-type mice, suggesting that Fli-1 plays a critical role in the differentiation of pro- to pre-B cells. Formation of the pre-BCR is required for the clonal expan- sion of pro-B cells and differentiation to the pre-B cell stage (3, 4). Disruption of pre-BCR signaling resulted in a significant reduction FIGURE 10. Model indicating the possible mechanism of Fli-1 during of pre-B cells in mice (43). Complete knockout of the Pax-5 gene the B cell development. The Fli-1 gene plays a critical role in the transi- resulted in arrest at the early pro-B cell stage and lack of pro- to tions from pro-B to pre-B cell, pre-B to immature B cells, and transitional pre-B cell differentiation (44, 45). Elevated Id1 contributed to a B cells to FO or MZ B cells. reduced pre-B cell population (46, 47). Disruption of Egr-1 and by guest on September 29, 2021 E2A genes also significantly reduced pre-B cell populations (42, 48, 49). We found that expression of mb-1, Pax-5, E2A, and Egr-1 was significantly reduced and expression of Id1 was increased in Ig␣ and Egr-1 in Fli-1-deficient mice likely contribute to the de- bone marrow-derived cells from Fli-1⌬CTA/Fli-1⌬CTA mice com- creased transition of T1 B cells to mature B cells (Fig. 10). pared with wild-type controls. The decrease in pre-B cells in Fli- In this study, we found a significant decrease in FO B cells and 1⌬CTA/Fli-1⌬CTA mice is likely due to the combination of de- increased MZ B cells in Fli-1–1⌬CTA/Fli-1⌬CTA mice. The BCR- creased expression of Ig␣ (pre-BCR), Erg-1, Pax-5, and E2A or signaling pathway is a major factor in determining the fate of ma- increased expression of Id (Fig. 10). The decreased proliferative ture B cells (5, 8, 51). Disruption of BCR-signaling components response of Fli-1-deficient B cells to BCR cross-linking indicates blocks transition of T2 B cells to FO B cells (43, 52, 53). Mice in that a Fli-1-regulated factor is required for full BCR responsive- which BCR signaling was impaired because of the presence of a ness. We believed that the decreased expression of Ig␣ would knocked-in L chain mutation had increased numbers of MZ B cells result in decreased intracellular Ca2ϩ flux following BCR (51). A model was proposed to explain the defects observed in MZ cross-linking. The similar response of Fli-1-deficient B cells and FO B cell development in these gene-disrupted animals (5, 8). and wild-type B cells to calcium indicates that the impact of In this model, strong BCR signaling leads immature B cells to Fli-1 expression is not at the earliest phases of BCR signaling, differentiate to FO B cells, while weak BCR signaling leads im- but further down the signal transduction pathway. Thus, it is mature B cells to differentiate to MZ B cells. Ig␣ is one of the unlikely that the decreased expression of Ig␣ alone is sufficient signaling components of the BCR and plays a very important role to explain the B cell phenotype observed in the Fli-1- in the BCR-signaling pathway as noted above. Disruption of the deficient mice. Ig␣ cytoplasmic tail blocked generation of mature B cells (53). The significant increase of T1 B cells in Fli-1⌬CTA/Fli-1⌬CTA Mice in which the tyrosine residues in the Ig␣ ITAM were mutated mice indicated that Fli-1 is critical in the progression of B cells to phenylalanine exhibited enhanced Caϩ2 signaling downstream through the transitional stages to mature B cell subsets. A trun- of the BCR and resultant decreased number of MZ B cells (52). cated cytoplasmic tail of Ig␣ or Ig␤ resulted in failure of T1 B cells Fli-1 has been reported to coregulate Ig␣ expression with Pax-5 to progress to mature B cells. These results suggested that the BCR (23). In the current study, we demonstrated that Fli-1 protein can is also important in the transition of T1 to mature B cells (37, 50). directly bind to the promoter of the mb-1 gene. Although the trun- In addition to being an early response gene following AgR en- cated Fli-1 protein can also bind to the promoter of mb1, it does so gagement on mature B cells, a role for Egr-1 in promotion of to a reduced extent, perhaps accounting, in part, for the decreased transitional B cells to mature B cell subsets was demonstrated (42). expression of surface Ig␣ protein and mRNA in B cells from Fli- We have found that expression of Egr-1 is reduced in splenic B 1⌬CTA/Fli-1⌬CTA mice compared with wild-type controls. This re- cells in Fli-1⌬CTA/Fli-1⌬CTA mice. The decreased expressions of duced expression may contribute to “weak” BCR signaling and The Journal of Immunology 1653 concomitant decreased number of FO B cells and increased num- IgG1, but increased IgM Ab production, following challenge with ber of MZ B cells observed in these mice. We also found that T cell-dependent and -independent Ags, compared with wild-type expression of Id genes were higher in B cells from Fli-1⌬CTA/Fli- control mice. These data are consistent with Fli-1⌬CTA/Fli-1⌬CTA 1⌬CTA mice. Relative to BCR signaling, Id1 expression is nega- resulting in increased MZ B cells and decreased FO B cells and tively correlated with mb-1 expression (54). Thus, elevated Id1 indicate that Fli-1 induced changes in splenic B cells are of in vivo may contribute to the reduced FO B cell population. Notch-RBP-J physiologic relevance. signaling was reported to be involved in the fate determination of In summary, the lack of a CTA domain of Fli-1 resulted in a MZ B cells (55, 56). Because we did not find significant differ- novel profound impact on B cell development. The transitions ences in the expression of Notch 1 or its negative regulators, from pro- to pre-B cell, pre-B to immature B cells, and T1 B cells NUMB, NrarP, MINT, and sel-10 (data not shown), it is unlikely to FO or MZ B cells appear primarily affected. A number of genes that Fli-1 affects MZ B cell development via aberrant Notch sig- known to affect B cell development showed altered expression in naling. B cell-activating factor (BAFF) plays an important role in Fli-1⌬CTA/Fli-1⌬CTA mice (Fig. 10). The impact of Fli-1 on B cell B cell development. BAFF-deficient mice lost all FO and MZ B development is, thus, likely multifactorial, implicating BCR sig- cells, but B1 cell development was not affected (57, 58). We found naling and expression of transcription factors important for B cell that there was no difference in the BAFF concentrations in the sera lineage development/differentiation. Further studies, such as ge- from Fli-1⌬CTA/Fli-1⌬CTA mice compared with that from wild-type netic reconstitution and generation of B cell-specific Fli-1-null mice (data no shown). However, in this study, we did not inves- mice, are needed to dissect the distinct mechanisms underlying the tigate whether the expression of BAFF receptors in Fli-1⌬CTA/Fli- B cell effects noted. The in vivo importance of these findings in ⌬ 1 CTA mice was affected, nor did we investigate signaling through normal immunity is evidenced by the altered response to immu- Downloaded from the BAFF receptor. Such an alternation of BAFF receptor signal- nization of mice deficient in Fli-1 CTA expression. Furthermore, ing could contribute to the lower numbers of FO B cells in our previous report of a profound effect of Fli-1 heterozygosity on Fli-1⌬CTA/Fli-1⌬CTA mice. lupus development in MRL/lpr mice underscores the in vivo im- Fli-1 is also reported to regulate the expression of Bcl-2 (22, plications of these studies. 59). Bcl-2 is involved in the development of FO and MZ B cells

(60). Bcl-2-transgenic mice have no MZ B cells, whereas Bcl-2- Acknowledgments http://www.jimmunol.org/ knockout mice have an increased number of MZ B cells (60). We We thank Jeremy Mathenia for excellent technical support, Dr. David Turner for assistance with laser scanning microscopy, and Dr. Haiqun Zeng found that Bcl-2 and Bcl-xL expression was decreased in Fli- 1⌬CTA/Fli-1⌬CTA mice compared with wild-type controls. Thus, for help with cell sorting. decreased expression of these antiapoptotic genes may partially contribute to the increase of MZ B cells, although we could not Disclosures demonstrate a significant impact of Fli-1 genotype on measures of The authors have no financial conflict of interest. apoptosis in the spleen (data not shown). References We and others have demonstrated that Fli-1 is highly expressed

1. Loffert, D., S. Schaal, A. Ehlich, R. R. Hardy, Y. R. Zou, W. Muller, and by guest on September 29, 2021 in T cells, and expression of Fli-1 is decreased after T cell acti- K. Rajewsky. 1994. Early B-cell development in the mouse: insights from mu- vation (61, 62). Although the T cell population was higher in the tations introduced by gene targeting. Immunol. Rev. 137: 135–153. spleen, we did not find significant differences in the stages of T cell 2. Rolink, A., and F. Melchers. 1996. B-cell development in the mouse. Immunol. Lett. 54: 157–161. ⌬CTA ⌬CTA development in the thymus in Fli-1 /Fli-1 mice. Because 3. Clark, M. R., A. B. Cooper, L. D. Wang, and I. Aifantis. 2005. The pre-B cell only the CTA domain was removed in Fli-1⌬CTA/Fli-1⌬CTA mice, receptor in B cell development: recent advances, persistent questions and con- served mechanisms. Curr. Top. Microbiol. Immunol. 290: 87–103. it remains possible that, while Fli-1 is involved in the development 4. Hardy, R. R., and K. Hayakawa. 2001. B cell development pathways. Annu. Rev. of T cells, the CTA domain is not critical for these functions. In Immunol. 19: 595–621. addition, these results suggest that this allele does not seem to 5. Niiro, H., and E. D. Clark. 2002. Regulation of B-cell fate by antigen-receptor signals. Nat. Rev. Immunol. 2: 945–956. regulate T cell lymphocyte lineage choice. These results also sug- 6. Martin, F., and J. F. Kearney. 2002. Marginal-zone B cells. Nat. Rev. Immunol. gest that the B cell lineage differences are not secondary to T cell 2: 323–335. effects, but are rather intrinsic to B cells. 7. Gaudin, E., M. Rosado, F. Agenes, A. McLean, and A. A. Freitas. 2004. B-cell homeostasis, competition, resources, and positive selection by self-antigens. Im- Several studies have demonstrated that stromal cells play an munol. Rev. 197: 102–115. important role in lymphocyte development, and that gene-deficient 8. Pillai, S., A. Cariappa, and S. T. Moran. 2005. Marginal zone B cells. Annu. Rev. Immunol. 23: 161–196. stromal cells affect normal lymphocyte development (63, 64). Our 9. Martin, F., and J. F. Kearney. 2000. B-cell subsets and the mature preimmune bone marrow transplantation study clearly demonstrated that the reportorial: marginal zone and B1 cells as part of a “natural immune memory”. observed reduction of FO B cells and increase of MZ and transi- Immunol. Rev. 175: 70–79. 10. Hagman, J., and K. Lukin. 2006. Transcription factors drive B cell development. tional B cells resulted from bone marrow cell-intrinsic Fli-1 defi- Curr. Opin. Immunol. 18: 127–134. ciency, not stromal cell Fli-1 deficiency. 11. Hsu, T., M. Trojanowska, and D. K. Watson. 2004. Ets proteins in biological Fli-1 deficiency impacts in vivo immune response phenotypes. control and cancer. J. Cell. Biochem. 91: 896–890. 12. Seth, A., and D. K. Watson. 2005. ETS transcription factors and their emerging ⌬CTA Serum IgG1 concentrations were significantly lower in Fli-1 / roles in human cancer. Eur. J. Cancer 41: 2462–2478. Fli-1⌬CTA mice compared with wild-type controls, probably due to 13. Ben-David, Y., E. B. Giddens, K. Letwin, and A. Berstein. 1991. Erythroleuke- mia induction by Friend murine virus: insertional activation of a new the decreased number of FO B cells and their decreased abilities to member of the ets gene family: Fli-1, closely linked to c-ets-1. Genes Dev. 5: switch IgG1 in these mice. It is also notable that the serum IgG3 908–918. concentrations were also significantly lower in Fli-1⌬CTA/Fli- 14. Watson, D. K., F. E. Smyth, D. M. Thompson, J. Q. Cheng, J. R. Testa, ⌬CTA T. S. Papas, and A. Seth. 1992. The ERGB/Fli-1 gene: isolation and character- 1 mice, even though the total number of MZ B cells was ization of a new member of the family of human ETS transcription factors. Cell higher in these mice. MZ B cells participate in early T cell-inde- Growth Differ. 3: 705–713. pendent immune responses and interact with blood-borne Ags by 15. Zhang, L., V. Lemarchandel, P. H. Romeo, Y. Ben-David, P. Greer, and A. Bernstein. 1993. The Fli-1 proto-oncogene, involved in erythroleukemia and production of IgM and IgG3. MZ B cells also play a role in T Ewing’s sarcoma, encodes a transcriptional activator with DNA-binding speci- cell-dependent immune responses, but mature FO B cells are the ficities distinct from other Ets family members. Oncogene 8: 1621–1630. principal effectors of these responses via IgG1 production (6, 8). 16. Rao, V. N., T. Ohno, D. D. Prasad, G. Bhattacharya, and E. S. Reddy. 1993. ⌬ ⌬ Analysis of the DNA-binding and transcriptional activation functions of human We found that Fli-1 CTA/Fli-1 CTA mice had significantly less Fli-1 protein. Oncogene 8: 2167–2173. 1654 Fli-1 MODULATES B CELL DEVELOPMENT

17. Athanasiou, M., P. A. Clausen, G. J. Mavrothalassitis, X. K. Zhang, 41. Roberts, E. C., R. W. Deed, T. Inoue, J. D. Norton, and A. D. Sharrocks. 2001. D. K. Watson, and D. G. Blair. 1996. Increased expression of ETS-related tran- Id helix-loop-helix proteins antagonize pax transcription factor activity by inhib- scriptional factor FLI-1/ERGB correlates with and can induce the megakaryo- iting DNA binding. Mol. Cell. Biol. 21: 524–533. cytic phenotype. Cell Growth Differ. 7: 1525–1534. 42. Dinkel, A., K. Warnatz, B. Ledermann, A. Rolink, P. F. Zipfel, K. Burki, and 18. Lemarchandel, V., J. Ghysdael, V. Mignotte, C. Rahuel, and P. H. Romeo. 1993. H. Eibel. 1998. The transcription factor early growth response 1 (Egr-1) advances GATA and Ets cis-acting sequences mediate megakaryocyte-specific expression. differentiation of pre-B and immature B cells. J. Exp. Med. 188: 2215–2224. Mol. Cell. Biol. 13: 668–676. 43. Sun, T., M. R. Clark, and U. Storb. 2002. A point mutation in the constant region 19. Wang, X., J. D. Crispino, D. L. Letting, M. Nakazawa, M. Poncz, and of Ig ␭1 prevents normal B cell development due to defective BCR signaling. G. A. Blobel. 2002. Control of megakaryocyte-specific gene expression by Immunity 16: 245–255. GATA-1 and FOG-1: role of Ets transcription factors. EMBO J. 21: 225–234. 44. Nutt, S. L., P. Urbanek, A. Rolink, and M. Busslinger. 1997. Essential functions 20. Szalai, G., A. C. LaRue, and D. K. Watson. 2006. Molecular mechanisms of of Pax5 (BSAP) in pro-B cell development: difference between fetal and adult B megakaryopoiesis. Cell. Mol. Life Sci. 63: 2460–2476. and reduced V-to-DJ recombination at the IgH locus. Genes Dev. 21. Jackers, P., G. Szalai, O. Moussa, and D. K. Watson. 2004. Ets-dependent reg- 11: 476–491. ulation of target gene expression during megakaryopoiesis. J. Biol. Chem. 279: 45. Urbanek, P., Z. Q. Wang, I. Fetka, E. F. Wagner, and M. Busslinger. 1994. 52183–52190. Complete block of early B cell differentiation and altered patterning of the pos- 22. Lesault, I., C. T. Quang, J. Frampton, and J. Ghysdael. 2002. Direct regulation of terior midbrain in mice lacking Pax5/BSAP. Cell 79: 901–912. BCL-2 by FLI-1 is involved in the survival of FLI-1-transformed erythroblasts. 46. Jaleco, A. C., A. P. Stegmann, M. H. Heemskerk, F. Couwenberg, A. Q. Bakker, EMBO J. 21: 694–703. K. Weijer, and H. Spits. 1999. Genetic modification of human B-cell develop- 23. Maier, H., R. Ostraat, S. Parenti, D. Fitzsimmons, L. J. Abraham, C. W. Garvie, ment: B-cell development is inhibited by the dominant negative helix loop helix and J. Hagman. 2003. Requirements for selective recruitment of Ets proteins and factor Id3. Blood 94: 2637–2646. ␣ 47. Spits, H., F. Couwenberg, A. Q. Bakker, K. Weijer, and C. H. Uittenbogaart. activation of mb-1/Ig- gene transcription by Pax-5 (BSAP). Nucleic Acids Res. ϩ 31: 5483–5489. 2000. Id2 and Id3 inhibit development of CD34 stem cells into predendritic cell 24. Xiao, X., M. Athanasiou, I. A. Sidorov, I. Horikawa, G. Cremona, D. Blair, (pre-DC)2 but not into pre-DC1: evidence for a lymphoid origin of pre-DC2. J. C. Barret, and D. S. Dimitrov. 2003. Role of Ets/Id proteins for telomerase J. Exp. Med. 192: 1775–1784. regulation in human cancer cells. Exp. Mol. Pathol. 75: 238–247. 48. Bain, G., E. C. Maandag, D. J. Izon, D. Amsen, A. M. Kruisbeek, Downloaded from 25. Watson, D. K., L. Robinson, D. R. Hodge, I. Kola, T. S. Papas, and A. Seth. 1997. B. C. Weintraub, I. Krop, M. S. Schlissel, A. J. Feeney, M. van Roon, et al. 1994. FLI1 and EWS-FLI1 function as ternary complex factors and ELK1 and SAP1a E2A proteins are required for proper B cell development and initiation of im- function as ternary and quaternary complex factors on the Egr1 promoter serum munoglobulin gene rearrangements. Cell 79: 885–892. response elements. Oncogene 14: 213–221. 49. Zhuang, Y., P. Soriano, and H. Weintraub. 1994. The helix-loop-helix gene E2A 26. Czuwara-Ladykowska, J., F. Shirasaki, P. Jackers, D. K. Watson, and is required for B cell formation. Cell 79: 875–884. M. Trojanowska. 2001. Fli-1 inhibits collagen type I production in dermal fibro- 50. Reichlin, A., Y. Hu, E. Meffre, H. Nagaoka, S. Gong, M. Kraus, K. Rajewsky, blasts via an Sp1-dependent pathway. J. Biol. Chem. 276: 20839–20848. and M. C. Nussenzweig. 2001. B cell development is arrested at the immature B cell stage in mice carrying a mutation in the cytoplasmic domain of immuno- 27. Tamir, A., J. Howard, R. R. Higgins, Y. J. Li, L. Berger, E. Zacksenhaus, ␤ J. Exp. Med. http://www.jimmunol.org/ M. Reis, and Y. Ben-David. 1999. Fli-1, an Ets-related transcription factor, reg- globulin- . 193: 13–23. ulates erythropoietin-induced erythroid proliferation and differentiation: evidence 51. Cariappa, A., M. Tang, C. Parng, E. Nebelitskiy, M. Carroll, K. Georgopoulos, for direct transcriptional repression of the Rb gene during differentiation. Mol. and S. Pillai. 2001. The follicular versus marginal zone B lymphocyte cell fate Immunity Cell. Biol. 19: 4452–4464. decision is regulated by Aiolos, Btk, and CD21. 14: 603–615. 52. Kraus, M., L. I. Pao, A. Reichlin, Y. Hu, B. Canono, J. C. Cambier, 28. Hart, A., F. Melet, P. Grossfeld, K. Chien, C. Jones, A. Tunnacliffe, R. Favier, M. C. Nussenzweig, and K. Rajewsky. 2001. Interference with immunoglobulin and A. Bernstein. 2000. Fli-1 is required for murine vascular and megakaryocytic (Ig)␣ immunoreceptor tyrosine-based activation motif (ITAM) phosphorylation development and is hemizygously deleted in patients with thrombocytopenia. modulates or blocks B cell development, depending on the availability of an Ig␤ Immunity 13: 167–177. cytoplasmic tail. J. Exp. Med. 194: 466–469. 29. Spyropoulos, D. D., P. N. Pharr, K. R. Lavenburg, P. Jackers, T. S. Papas, 53. Torres, R. M., H. Flaswinkel, M. Reth, and K. Rajewsky. 1996. Aberrant B cell M. Ogawa, and D. K. Watson. 2000. Hemorrhage, impaired hematopoiesis, and development and immune response in mice with a compromised BCR complex. lethality in mouse embryos carrying a targeted disruption of the Fli1 transcription Science 272: 1804–1808. factor. Mol. Cell. Biol. 20: 5643–5652. 54. Sigvardsson, M., D. R. Clark, D. Fitzsimmons, M. Doyle, P. Akerblad, T. Breslin, by guest on September 29, 2021 30. Zhang, L., A. Eddy, Y. T. Teng, M. Fritzler, M. F. Kluppel, A. Melet, and S. Bilke, R. Li, C. Yeamans, G. Zhang, and J. Hagman. 2002. Early B-cell factor, A. Berstein. 1995. An immunological renal disease in transgenic mice that over- E2A, and Pax-5 cooperate to activate the early B cell-specific mb-1 promoter. express Fli-1, a member of the ets family of transcription factor genes. Mol. Cell. Mol. Cell. Biol. 22: 8539–8551. Biol. 15: 6961–6970. 55. Kuroda, K., H. Han, S. Tani, K. Tanigaki, T. Tun, T. Furukawa, Y. Taniguchi, 31. Zhang, X. K., S. Gallant, I. Molano, O. M. Moussa, P. Ruiz, D. D. Spyropoulos, H. Kurooka, Y. Hamada, S. Toyokuni, and T. Honjo. 2003. Regulation of mar- D. K. Watson, and G. Gilkeson. 2004. Decreased expression of the Ets family ginal zone B cell development by MINT, a suppressor of Notch/RBP-J signaling transcription factor Fli-1 markedly prolongs survival and significantly reduces pathway. Immunity 18: 301–312. renal disease in MRL/lpr mice. J. Immunol. 173: 6481–6489. 56. Tanigaki, K., H. Han, N. Yamamoto, K. Tashiro, M. Ikegawa, K. Kuroda, 32. Stuber, E., and W. Strober. 1996. The T cell-B cell interaction via OX40-OX40L A. Suzuki, T. Nakano, and T. Honjo. 2002. Notch-RBP-J signaling is involved in is necessary for the T cell-dependent humoral immune response. J. Exp. Med. cell fate determination of marginal zone B cells. Nat. Immunol. 3: 443–450. 183: 979–989. 57. Hardy, R. R., P. W. Kincade, and K. Dorshkind. 2007. The protean nature of cells 33. Greimers, R., M. Trebak, M. Moutschen, N. Jacobs, and J. Bonier. 1996. Im- in the B lymphocyte lineage. Immunity 26: 703–714. proved four-color flow cytometry method using Fluo-3 and triple immunofluo- 2ϩ 58. Schneider, P., H. Takatsuka, A. Wilson, F. Mackay, A. Tardivel, S. Lens, rescence for analysis of intracellular calcium ion (Ca ) fluxes among mouse T. G. Cachero, D. Finke, F. Beermann, and J. Tschopp. 2001. Maturation of B- and T-lymphocyte subsets. Cytometry 23: 205–217. maginal zone and follicular B cells requires B cell activation factor of the tumor 34. Ramakers, C., J. M. Ruijter, R. H. Deprez, and A. F. Moorman. 2003. Assump- necrosis factor family and in independent of B cell maturation antigen. J. Exp. tion-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Med. 194: 1691–1697. Neurosci. Lett. 339: 62–66. 59. Pereira, R., C. T. Quang, I. Lesaut, H. Dolznig, H. Beug, and J. Ghysdael. 1999. 35. Li, Y. S., K. Hayakawa, and R. R. Hardy. 1993. The regulated expression of B Fli-1inhibits differentiation and induces proliferation of primary erythroblasts. lineage associated gene during B cell differentiation in bone marrow and fetal Oncogene 18: 1597–1608. liver. J. Exp. Med. 178: 951–960. 60. Brunner, C., D. Marinkovic, J. Klein, T. Samardzic, L. Nitschke, and T. Wirth. 36. Bettler, B., H. Hofstettle, M. Rao, W. H. Yokoyama, F. Kilchher, and 2003. B cell-specific transgenic expression of Bcl2 rescues early B lymphopoiesis D. H. Conrad. 1989. Molecular structure and expression of murine lymphocyte but not B cell responses in BOB.a/OBF.1-defient mice. J. Exp. Med. 197: low-affinity receptor for IgE (Fc␧RII). Proc. Natl. Acad. Sci. USA 685: 713–739. 1205–1211. 37. Loder, F., B. Mutschler, R. J. Ray, C. J. Paige, P. Sideras, R. Torres, 61. Mao, X., S. Miesfeldt, H. Yang, J. M. Leiden, and C. B. Thompson. 1994. The M. C. Lamers, and R. Carsetti. 1999. B cell development in the spleen takes place FLI-1 and chimeric EWS-FLI-1 oncoproteins display similar DNA binding spec- in discrete steps and is determined by the quality of B cell receptor-derived ificities. J. Biol. Chem. 269: 18216–18222. signals. J. Exp. Med. 190: 75–89. 62. Zhang, X. K., and D. K. Watson. 2005. The FLI-1 transcription factor is a short- 38. Srivastava, B., W. J. Quinn, III, K. Hazard, J. Erikson, and D. Allman. 2005. lived phosphoprotein in T cells. J. Biochem. 137: 297–302. Characterization of marginal zone B cell precursors. J. Exp. Med. 202: 63. Fukui, Y., O. Hashimoto, T. Sanui, T. Oono, H. Koga, M. Abe, A. Inayoshi, 1225–1234. M. Noda, M. Oike, T. Shirai, and T. Sasazuki. 2001. Haematopoietic cell-specific 39. Cariappa, A., C. Boboila, S. T. Moran, H. Liu, H. N. Shi, and S. Pillai. 2007. The CDM family protein DOCK2 is essential for lymphocyte migration. Nature 412: recirculating B cell pool contains two functionally distinct long-lived, posttran- 826–831. sitional, follicular B cell populations. J. Immunol. 179: 2270–2281. 64. Weih, D. S., Z. B. Yilmaz, and F. Weih. 2001. Essential role of RelB in germinal 40. Busslinger, M. 2004. Transcriptional control of early B cell development. Annu. center and marginal zone formation and proper expression of homing chemo- Rev. Immunol. 22: 55–79. kines. J. Immunol. 167: 1909–1919.