MASTER OF PHILOSOPHY

Investigating the role of neuropeptides in plant parasitic nematodes

Sturrock, Matthew

Award date: 2021

Awarding institution: Queen's University Belfast

Link to publication

Terms of use All those accessing thesis content in Queen’s University Belfast Research Portal are subject to the following terms and conditions of use

• Copyright is subject to the Copyright, Designs and Patent Act 1988, or as modified by any successor legislation • Copyright and moral rights for thesis content are retained by the author and/or other copyright owners • A copy of a thesis may be downloaded for personal non-commercial research/study without the need for permission or charge • Distribution or reproduction of thesis content in any format is not permitted without the permission of the copyright holder • When citing this work, full bibliographic details should be supplied, including the author, title, awarding institution and date of thesis

Take down policy A thesis can be removed from the Research Portal if there has been a breach of copyright, or a similarly robust reason. If you believe this document breaches copyright, or there is sufficient cause to take down, please contact us, citing details. Email: [email protected]

Supplementary materials Where possible, we endeavour to provide supplementary materials to theses. This may include video, audio and other types of files. We endeavour to capture all content and upload as part of the Pure record for each thesis. Note, it may not be possible in all instances to convert analogue formats to usable digital formats for some supplementary materials. We exercise best efforts on our behalf and, in such instances, encourage the individual to consult the physical thesis for further information.

Download date: 23. Sep. 2021

Investigating the Role of Neuropeptides in Plant Parasitic Nematodes

Matthew Sturrock Bsc Hons

This thesis is submitted for the degree of Master of Philosophy

Queen’s University Belfast School of Biological Sciences

October 2020

Acknowledgements

Firstly, I would like to thank my supervisor Dr Johnathan Dalzell for his continuous advice and guidance throughout this project, it’s been greatly appreciated. Additionally, my appreciation goes to The Bill and Melinda Gates foundation whose funding made this project a possibility.

Throughout my time at QUB I had the pleasure of meeting and working with some great people. Dr Rob Morris quickly became a close friend and I can’t thank him enough for helping to keep me sane throughout this experience. I would also like to thank Dr Leonie Wilson for her continuous help during the early stages of my project.

Next, a special thanks to Dr Neil Warnock for all his help (and free lunches) during my project. Once I got used to his ‘stay away from me’ demeanour I soon realised he’s a nice guy really! Neil was great source of knowledge and support throughout all my project including writing up, so thanks.

Next up is team VIGS made up of Dr Deborah Cox aka ‘mum’ and Steve Dyer. I couldn’t have done it without this pair. Working in the Dalzell lab was always a team effort and Debbie and Steve were always available to help with long ‘dig days’ even over the holidays, thanks guys! Many tea breaks, games nights and juts great memories were had with everyone mentioned above and I can’t thank them enough.

I would also like to thank my family and friends, especially my mum, for their continued support and for putting up with my many rants throughout all of this. Thanks to my partner Jack for encouraging me in the final writing stages to push it over the line.

Finally, I would like to dedicate this thesis to my older brother Philip who never realised how much our cinema trips and dinners out were a welcome distraction for me. I know he would say “it’s about time you finished it!”

i

Declaration

I declare that the work in this thesis was carried out in accordance with the requirement of Queen’s University Belfast’s Regulations and Code of Practise for Research Degree Programmes and that it has not been submitted for any other academic award. Except where indicated by specific reference in the text, the work is the candidate’s own work. Work done in collaboration with, or with the assistance of others, is indicated as such. Any views expressed in the dissertation are these of the author.

Signed ………………………………………………………………. Date…………………………….

ii

Abstract

Plant parasitic nematodes (PPNs) devastate agriculture on a global scale causing severe annual economic losses. Withdrawal of the chemical nematicides used to control PPNs, due to their harmful environmental effects, has led to a short fall in our ability to manage these pests. This thesis explores different methodologies available to probe neuropeptide gene function in economically important PPNs. A proof of concept study utilising transgenic Bacillus subtilis to deliver PPN neuropeptides in a tomato seedling invasion assay identified several neuropeptides which induce aberrant behaviours in Meloidogyne incognita and Globodera pallida conferring resistance to tomato seedlings. This thesis demonstrated Bacillus subtilis signal peptide optimisation using NLP-15b. NLP-15b showed a potent effect during initial studies conferring host resistance from Meloidogyne incognita and Globodera pallida invasion. The nlp-15 gene was chosen for further investigations using several available platforms. Firstly, localisation of nlp-15 in Radopholus similis and to cells of the anterior nervous system suggested its involvement in sensory perception.

Various RNA interference (RNAi) protocols were developed to induce silencing of nlp-15. Additionally, a Virus Induced Gene Silencing (VIGS) method was used to try and silence nlp-15 in invading Meloidogyne incognita nematodes. Taken together, the data highlight a need to further understand gene silencing techniques with respect to neuronal targets so we can develop methods that promote further study of these genes. Finally, a protocol was developed to produce transgenic tomato plants synthesising an RNAi silencing construct to target nlp-15 in feeding nematodes.

iii

CONTENTS

Acknowledgements i Declaration ii Abstract iii Contents iV List of Figures Vi List of Tables Viii Abbreviations iX

Chapter 1: General Introduction

1.1 Global Food Security 2 1.2 Nematoda 3 1.2.1 Parasitic Nematodes 4 1.2.2 Plant Parasitic Nematodes 5 1.2.3 PPN Morphology 7 1.2.4 PPN Feeding Strategies 9 1.2.5 Migratory Endoparasites 11 1.2.6 Sedentary Endoparasites 13 1.2.7 Control Strategies 17 1.3 Nematode Neuropeptides 19 1.3.1 Neuropeptide Synthesis 20 1.3.2 FMRF-amide like peptides 21 1.3.3 Insulin-like peptides 24 1.3.4 Neuropeptide-like peptides 24 1.4 Genetic Approaches to Studying Gene Function 25 1.4.1 Forwards and Reverse Genetics 25 1.4.2 RNAi: History and Applications 26 1.4.3 RNAi Pathway in Nematodes 27 1.4.4 Dicer, RISC and Secondary Amplification 30 1.4.5 In planta RNAi 33 1.4.6 HIGS as a Control Strategy 35 1.4.7 Virus Induced Gene Silencing 37 1.4.8 VIGS Mechanism and Applications 38 1.5 Chapter Aims and Hypothesis 41 1.6 References 42

iv

Chapter 2 High throughput Transgenic Approaches to Plant Parasitic Nematode Control

2.1 Abstract 58 2.2 Introduction 59 2.3 Materials and Methods 70 2.4 Results 77 2.5 Discussion 82 2.6 References 89

Chapter 3 Investigating the Role of Neuropeptide-like Protein-15 (nlp-15) in Economically Important Plant Parasitic Nematodes Using in vitro RNAi

3.1 Abstract 95 3.2 Introduction 96 3.3 Materials and Methods 100 3.4 Results 108 3.5 Discussion 117 3.6 References 123

Chapter 4 Development of Transgenic Tomato Plants Expressing Mi-nlp-15: Methods and Future Perspectives

4.1 Abstract 128 4.2 Introduction 129 4.3 Materials and Methods 133 4.4 Results 139 4.5 Discussion 150 4.6 Future Work 153 4.7 References 158

Chapter 5 General Discussion

5.1 Thesis Context 167 5.2 Delivery of dsRNA to PPNs via Soaking 168 5.3 Delivery of Nematode Neuropeptides using Transgenic 170 B. subtilis 5.4 Delivery of Silencing Triggers using VIGS Vectors 172 5.5 In Planta RNAi 173 5.6 References 175

v

List of Figures

Fig 1.1 Schematic diagram of (a) Cyst nematodes and (b) Root-knot 16 nematodes

Fig 1.2 Schematic diagram of RNA interference mechanism 30

Fig 1.3 Schematic diagram showing possible fates of dsRNA and 35 siRNA in a nematode–plant feeding cell interaction

Fig 2.1 Mean % of G. pallida infective juvenile invasion relative to 78 aprE B. subtilis clone

Fig 2.2 Example of bleaching phenotype observed in VIGS 80 inoculated plants

Fig 2.3 q-RT expression analysis of Mi-nlp-15 post VIGS exposure 81

Fig 3.1 Localising Mi-nlp-15 and Rs-nlp-15 using whole-mount in 108 situ hybridisation Fig 3.2 qRT expression analysis of Rs-nlp-15 and Rs-eng-1 under 111 different experimental conditions

Fig 3.3 qRT expression analysis of Rs-nlp-15 and Rs-eng-1 following 112 electroporation treatment

Fig 3.4 Treatment of African RKN M. incognita isolates does not 113 result in specific gene target knockdown

Fig 3.5 Treatment of African RKN M. javanica isolates does not 115 result in specific gene target knockdown

Fig 4.1 A 200bp fragament of Mi-nlp-15 was incorporated into 138 pHANNIBAL intermediate vector

vi

Fig 4.2 Stages of Agrobacterium-mediated Plant Transformation 140

Fig 4.3 Plant Transformation 141

Fig 4.4 End-point PCR Gel electrophoresis image confirms presence 148 of pART27 plasmid in transgenic plant

Fig 4.5 Reverse Transcriptase (RT)-PCR confirms nlp-15 expression 149 in Transgenic Plant

vii

List of Tables

Table 2.1 The predicted unamidated NLP complements of 61 Globodera pallida and Meloidogyne incognita

Table 2.2 PCR Primer sequences for VIGS experiment 75

Table 3.1 dsRNA synthesis and qRT-PCR primer sequences 104

Table 4.1 Plant Transformation Media Components 136

Table 4.2 Transformation efficiency of tomato 147

viii

Chapter 1: General Introduction

Abbreviations

AFBI Agri-Food and Biosciences Institute AGO Argonaute APN Animal Parasitic Nematode dsRNA double-stranded RNA FLP FMRF-amide like Peptide GMO Genetically Modified Organism GRAS Generally Regarded As Safe HIGS Host Induced Gene Silecning hpRNA hairpin RNA IAA Indole-3-Acetic Acid ILP Insulin-like Peptide J1 First Stage Juvenile J2 Second Stage Juvenile J4 Fourth Stage Juvenile J4d Dauer Juvenile MCS Multiple Cloning Site MDG Millenium Development Goal mRNA messenger RNA NLP Neuropeptide-like Protein ODS Ozone Depleting Substance ORF Open Reading Frame PCN Potato Cyst Nematode PDS Phytoene desaturase PGPR Plant Growth Promoting Rhizobacteria PPN Plant Parasitic Nematode PTGS Post Transcriptional Gene Silencing PTM Post Translational Modification qRT- quantitative Reverse Transcription- Polymerase Chain Reac- PCR tion R Gene Resistance Gene RdRP RNA-dependent RNA Polymerase RISC RNA-Induced Silening Complex RKN Root-Knot Nematode RNAi RNA interferance SCN Soybean Cyst Nematode SDG Sustainable Development Goal SHMT Soybean Serine Hydroxy Methyltransferase siRNA Short-interfering RNA TRV Tobacco Rattle Virus VIGS Virus Induecd Gene Silecning WAGO Worm specific Argonaute proteins wt wild-type

ix Chapter 1: General Introduction

Chapter 1.

General Introduction

1 Chapter 1: General Introduction

1.1. Global Food Security

The ability to support our ever-growing population has been a societal issue for some time and continues to be at the forefront of global policy making decisions. The first

World Food conference took place in 1974 and saw the introduction of the term food security. This conference discussed issues relating to malnutrition and the ability of the agricultural system to supply the demands of an ever-growing population.

Famously, Henry Kissenger the then US Secretary of State claimed that “no child would go to bed hungry within ten years” (Maxwell, 1996). To this end, an ambitious target was set that aimed to eliminate world hunger within a decade. This goal was not reached partly due to the lack of knowledge surrounding the different parameters involved in achieving food security. Policy makers failed to see food security as a multidimensional concept with many factors contributing to the overall measurement of food security or insecurity. Since then, The United Nations

Millennium Declaration set out a series of targets with the eradication of extreme poverty and hunger the first of eight Millennium Development Goals (MDGs). These goals were timebound and hoped to achieve “halving the proportion of hunger by

2015” (United Nations Organisation, 2008). It was understood that these goals were interconnected and reliant upon each other for success. Since 2015 these goals have been amended and updated with the conception of 17 Sustainable Development

Goals (SDGs), the first two of which are “no poverty” and “zero hunger” to be achieved by 2030 (United Nations, 2015). Consequently, and building upon many previous decades work, global research institutes have programs dedicated to improving food security. It is widely recognised that sustainable crop production, particularly in tropical regions, is vital to achieve global food security (Rosegrant and

2 Chapter 1: General Introduction

Cline, 2003). By 2050 the global population will reach approximately 9.6 billion and estimates predict a 70% increase in crop production between 2015 and 2050 is required to meet ever increasing demands (FAO, 2009). The ability to discover novel control strategies for the treatment of parasitic infections that burden the agricultural industry will play an important role in the pursuit to achieve global food security.

1.2. Nematoda

The phylum Nematoda comprises a diverse array of free-living and parasitic nematodes that inhabit almost every ecological niche on earth. To date more than

23,000 species have been identified (Blaxter and Koutsovoulos, 2015) although it has been estimated there could be more than 1 million species (Lambshead, 1993). In terms of species number this is second only to the phylum Arthropoda. Nevertheless, giving total individual numbers, nematodes are the most abundant animal on earth.

A noteworthy quote from the “Father of Nematology” Nathan Augustus Cobb states:

“…if all the matter in the universe except the nematodes were swept away, our world would still be dimly recognizable, and if, as disembodied spirits, we could then investigate it, we should find its mountains, hills, vales, rivers, lakes, and oceans represented by a film of nematodes”.

Most of the phylum is made up of terrestrial and marine, free-living roundworms which affect ecosystem process. However, also represented are the parasitic nematodes. These species cause severe losses to the food production sector through

3 Chapter 1: General Introduction yield reductions in both economically important crops and livestock. Additionally, human parasitic nematodes present a global health concern with diverse species causing varying disease and mortality (Crompton, 1999).

1.2.1. Parasitic Nematodes

Parasitic nematodes infect humans, animals and plants resulting in human health problems as well as economic losses attributed to poor productivity. More than one billion people are believed to be infected with parasitic nematodes (Hotez et al.,

2008). This has major socioeconomic impacts with lesser developed countries being more greatly affected. Parasitic infections result in major mortality and morbidity with sufferers being subject to diseases leading to an array of physical conditions such as blindness and organ damage. For example, Trichuris trichiura is the roundworm responsible for the disease trichuriasis of humans, which manifests clinically causing symptoms like diarrhoea, vomiting, stunted growth and finger clubbing (Cross, 1996). Many livestock animals are exposed to parasitic nematodes throughout their entire lives resulting in significant losses as well as the severe economic impact associated with treatment regimens. Several nematode species, for example Trichostrongylus spp. cause significant clinical disease in sheep throughout the UK and are also responsible for the associated subclinical losses to productivity which goes undetected (Sargison, 2012). These parasites also have a substantial impact on animal welfare. Resistance to anthelmintics proves to be common among parasitic nematodes, coupled with a reduction in available drugs due to environmental toxicity and harm to human health (Geerts and Gryseels, 2001;

Shalaby, 2013). Additionally, life stages that persist in the environment are not

4 Chapter 1: General Introduction subject to control and permit continuous re infection of the host. Animal parasitic nematodes (APNs) display a diverse variety of strategies when it comes to infecting their host. Some use intermediate hosts which act as vectors for transmission. Many of Metastrongyloidea enter molluscs as part of a complex life-cycle which is only partially fulfilled in its intermediate host (Grewal et al., 2003). Other Animal parasitic nematodes adapt both a free-living and parasitic lifestyle and do not require an intermediate host. Strongyloides stercoralis is the cause of strongyloidiasis in humans and an example of an animal parasitic nematode that does not require an intermediate host (Zygmunt, 1990). The success of these parasites can be attributed to their adaptability to many environments and their ability to overcome control strategies.

1.2.2. Plant Parasitic Nematodes

Plant Parasitic Nematodes (PPNs) are a group of microscopic round worms that have evolved over millions of years to form intricate and complex relationships with host plants (Quist et al., 2015). Belonging to the phylum Nematoda, they are obligate plant parasites that devastate agriculture on a global scale resulting in losses estimated at approximately 157 billion USD annually (Abad et al., 2008).

Although definitive losses are difficult to calculate, and estimates vary (Abd-

Elgawad and Askary, 2015). PPN species represent approximately 10% of described species in the phylum (Hugot et al., 2001). PPN infections often cause damage to the underground regions of a plant leading to a compromised root system, which ultimately limits water and nutrient availability resulting in yield losses (Dropkin,

1969). As aboveground symptoms such as stunting, and wilting are unspecific and

5 Chapter 1: General Introduction may also be attributed to drought and other stress factors the subtly of yield losses caused by PPN infection may be overlooked. The result is a conservative estimate of agricultural loss, which may only partially reflect the true extent of damage caused by PPNs. Additionally, infection by PPNs often results in secondary invasion from pathogenic bacteria and fungi leading to more damage to the plant (Jones and

Fosu-Nyarko, 2014; Mayo and Bergeson, 1970; Smiley, 2015).

PPNs are morphologically similar consisting of the ‘tube within a tube’ structure typical of organisms belonging to the phylum. One structural characteristic distinguishing PPNs from other nematodes is a hollow, spear like structure, called the stylet, which is located at the anterior of the nematode. The stylet facilitates root penetration both through mechanical thrusting and through the secretion of several cell wall degrading enzymes (Bohlmann and Sobczak, 2014).

The stylet is also used to withdraw plant cell cytoplasmic components which contains all the nutrients required for nematode development.

All nematodes are surrounded by a protective cuticle which is important for the nematode’s progression through its developmental stages. Whilst some PPNs are ectoparasites completing their lifecycle outside of the host, the most economically important PPNs are the endoparasitic plant nematodes which invade the host roots completing their lifecycle inside the host. Both ectoparasitic and endoparasitic PPNs can be either sedentary or migratory parasites. Migratory parasites continue moving throughout their lifecycle feeding as they migrate and laying eggs along their migration path. Examples include the migratory endoparasites Radopholus and Pratylenchus spp. Sedentary parasites form a more

6 Chapter 1: General Introduction intimate relationship with their host, establishing specialised feeding sites with examples including species belonging to the Meloidogyne, Globodera and

Heterodera genera.

1.2.3. Plant Parasitic Nematode Morphology

Nematodes have a distinct morphology which is well conserved across the phylum

(Bird and Bird, 1991). Their body plan takes on the form of a ‘tube within a tube’.

They are bilaterally symmetrical, unsegmented, vermiform pseudocoelomates.

PPNs are slender, spindle shaped, tapering at both ends. Mature females of several species assume a pear-shaped body and no longer look like worms. PPNs are microscopic and vary in length from 0.1 mm to 12 mm.

The nematode body plan can be divided into three distinct regions; the body wall, the inner body tube and the body cavity or pseudocoelom. The pseudocoelom is a fluid filled cavity between the body wall and the gut. Lacking a defined circulatory system, the pseudocoelom fluid serves as means of circulation for gases and metabolites as it surrounds numerous organs (Roberts and Janovy, 2009). The outer body wall of the nematode consists of the cuticle, hypodermis and somatic muscles. It serves to provide a mechanism for locomotion and plays an important role in gas exchange. The cuticle is a transparent, flexible, non-cellular, three- layered covering that covers the worm’s entire body as well as lining the pharynx, anus, vulva, excretory pore and sensory organs. It is secreted by the hypodermis and acts as a protective barrier against harsh external environments (Roberts and

Janovy, 2009). The presence of enzymes in the cuticle suggests it is metabolically active (Page, 2007; Philipp et al., 1980). The feeding stylet and copulatory spicules

7 Chapter 1: General Introduction of PPNs, formed from the cuticle. Nematodes belong to the group Ecdysozoa in that they are animals that can shed their cuticle. PPNs undergo moults as larval stages mature to adults during which a new cuticle is formed, facilitating the growth of the nematode (Telford et al., 2009). Transverse lines present on the surface of the cuticle, cause a pattern from head to tail giving the false impression the worms are segmented. Distinct variation of these lines is present in PPNs and can aid taxonomic identification (Lambert and Bekal, 2002).

The hypodermis sits beneath the basal lamina and protrudes into the pseudocoelom along the middorsal, midventral and lateral lines to form the four hypodermal cords. It provides flexibility and support in the absence of a skeleton.

Associated with the hypodermis are longitudinally arranged muscle cells known as the somatic musculature and responsible for facilitating the characteristic movement of the worm (Roberts and Janovy, 2009).

The inner body tube of the nematode consists of the stomodaeum (foregut), the mesenteron (midgut or intestine) and the proctodaeum (hindgut) (Basyoni and

Rizk, 2016). The foregut at the anterior region of the worm contains the oral aperture as well as the stylet and the pharynx. Contraction of pharynx muscles allows deposition of food into the intestine through the stylet as well as facilitating excretions. The intestine of the worm narrows in the posterior region to form the rectum. The intestine is non-muscular and as such nutrients are moved by the overall body movement as well as activity of the foregut.

The head region of the nematode contains chemoreceptors and mechanoreceptors. Important chemosensory receptors are a pair of amphids, play

8 Chapter 1: General Introduction vital roles in host finding and chemotaxis as well as phasmids which are located at the posterior end. Mechanoreception is facilitated by sensory papillae located throughout the organism. A simple nervous system controls nematode behaviour.

The main nerve centre, known as the central nerve ring from which the main nerves arise and run anteriorly and posteriorly in the hypodermal chords (Perry, 1996). The nematode’s reproductive organs are located from the middle to the posterior region. Nematode species often have male and female representatives, however, a common trait among some PPNs is reproduction by asexual parthenogenesis. Male nematodes have 1 or 2 testes and are usually equipped with 1 or more copulatory spicules which allow for their microscopic identification. Spicules keep the female vulva open and guide the sperm through the vagina during mating. This basic morphology is subject to variations between species and this is representative of specific lifestyles requiring features suitable for individual species’ parasitic journeys. An obvious example is the stylet of plant parasitic nematodes; itself, which can take on various shapes and sizes between species (van den Berg et al.,

2017).

1.2.4. PPN Feeding strategies

Collectively PPNs can feed on all parts of a plant. Many species have adapted to infect multiple hosts and use an array of strategies to facilitate environmental persistence and transmittance between hosts (Jones et al., 2013). A common feature among all PPNs is the use of a specialised feeding structure called the stylet, the morphology of which can aid in species identification as well as inferring their mode of feeding. Species can be grouped according to the feeding strategy they

9 Chapter 1: General Introduction adapt with ectoparasites grazing the exterior surface of plants and endoparasites feeding on internal structures.

An example of ectoparasitic plant nematodes are the Xiphinema spp. commonly known as the dagger nematode. They remain outside of the plant throughout their lifecycle and use their long stylet to penetrate the root and feed on the contents of the plant root cell, causing destruction to the root system which can lead to above ground symptoms such as stunted growth (Jones et al., 2013).

They are motile throughout their lifecycle and this approach to parasitism allows them to feed on multiple plants with the ability to easily migrate to a new host if the plant dies. These nematodes pose an additional challenge to plants as they can act as vectors for viruses. These viruses can line the stylet of the worm and are subsequently injected into the plant during feeding (Villate et al., 2008). The added pressure placed on the plant as a result of this secondary viral invasion can be overwhelming. This group of ectoparasites can infect many economically important crop plants and viral transmission serves to add to the losses caused.

Another feeding strategy evolved by some PPNs is demonstrated by the semi-endoparasites. These are nematodes that can migrate outside of a host, but at some point, during their lifecycle they can penetrate roots and form a permanent feeing site within the plant, at which point they swell and become sedentary. An example of a nematode deploying this strategy is Rotylenchulus reniformis, the species name derived because of the kidney-like shape mature females take on after becoming sedentary at a feeding site. The young female is the infective stage.

These nematodes are found in tropical and subtropical regions and can infect more

10 Chapter 1: General Introduction than 350 different host plant species (Jones et al., 2013; Robinson et al., 1997).

Although most PPNs are found in the soil and attack below ground parts of their host plant some species are capable of feeding on the aerial tissue of plants. Some

Ditylenchus spp. for example use water films to migrate upwards and can enter shoots via natural openings in the plant. A typical example is the stem and bulb nematode Ditylenchus dipsaci which upon entry to its host feeds as a migratory endoparasite destroying tissue as it feeds (Subbotin et al., 2005). This parasite is an example of one that can persist environmentally. Stage 4 juveniles (J4s) can enter a developmentally arrested state and overwinter as J4s clump together, becoming active once conditions become favourable (Castillo et al., 2007).

Ectoparasites represent an important group of PPNs that can infect a diverse host range and cause severe damage to economically important crops. However, they do not represent the most economically destructive PPN group. This is an accolade which belongs to the endoparasitic nematodes, specifically sedentary endoparasites belonging to Meloidogyne and Globodera genera (Bernard et al.,

2017). These nematodes are biotrophic and develop an intimate relationship with their host. Whatever the strategy it is clear that PPNs have evolved to become both specialised and highly adaptable parasites of plants and it is this adaptability to both biotic and abiotic factors that allows for their continued success and creates a significant challenge for the development of novel, effective control strategies.

1.2.5. Migratory endoparasites

As their name suggests, migratory endoparasitic nematodes continue migrating during their entire lifecycle feeding as they travel. Different species that adapt this

11 Chapter 1: General Introduction method of parasitism do however display variation in their lifecycles and techniques deployed to facilitate transmission.

The most economically important migratory endoparasites belong to the family Pratylenchidae and include the genera Pratylenchus (root lesion nematodes) and Radopholus (Pattison et al., 2002). Within the family, Pratylenchus spp. have the broadest host range (Jones and Fosu-Nyarko, 2014). All life stages of the nematode can be found within the host and extensive damage to the plant root is prominent along the migration path. Feeding on cortical tissue results in cell death and the formation of necrotic lesions. Examples include P. coffeae and P. goodeyi which are important pests of banana and plantain (Ploetz et al., 2009).

A migratory endoparasitic nematode with an interesting lifecycle is

Bursaphelenchus xylophilus (Pine wilt nematodes) which belongs to the

Aphelenchoididae family of nematodes. As their name suggests these nematodes cause pine wilt disease of pine trees (Nickle et al., 1981). This nematode is native to the US where it causes little damage to trees which have developed resistance.

However, following its introduction to Asia and Europe it has caused severe damage to pine trees that have not developed resistance to the parasite. The lifecycle of this nematode differs from other migratory endoparasites in that its transmission is facilitated by beetle vectors (Robertson et al., 2008). The developmentally arrested dauer juvenile (J4d) is environmentally resistant and transmitted in the trachea of beetles, entering the host through wounds caused by feeding beetles. The population grows rapidly within resin canals and quickly kills the host (Tanaka et al.,

2019). For the success of this nematode it needs to be vectored by beetles from

12 Chapter 1: General Introduction one host tree to the next. This is a special example, not typical of other migratory endoparasites, in which a developmentally arrested dauer can be used to aid in survival and transmission of these pests (Linit, 1988).

Another economically important crop pest belonging to the Radopholus genera is Radopholus similis. R. similis is known as the burrowing nematode and is the most damaging pest of banana. R. similis has a host range of more than 250 plant species however its primary hosts include banana, black pepper and citrus

(O’Bannon, 1977). This species enters its host near the root tips and migrate throughout the root system. Damage is caused both by feeding and the mechanical action of migrating through the root cortex. Females can lay eggs within the plant but can also do so in the soil. Like many parasitic nematodes R. similis undergoes four moults to reach the mature adult stage. Sexual dimorphism is apparent in this species and females can reproduce sexually, however, if they have not mated after a period they can reproduce as hermaphrodites. Males are the only non-feeding life stage. R. similis infestation can lead to toppling disease of banana and crop failure as a result (Marin et al., 1998). This is of major concern in developing countries where small subsistence farmers rely on banana as their sole source of income as well as being a dietary staple (Jones et al., 2013).

1.2.6. Sedentary Endoparasites

Sedentary endoparasitic nematodes invade the host root and establish specialised feeding sites from which they withdraw the nutrients they require for survival. This

13 Chapter 1: General Introduction subgroup of plant nematode represents the most economically damaging PPN and includes the root-knot nematodes belonging to the Meloidogyne genus and the cyst nematodes (Globodera and Heterodera spp.) (Jones et al., 2013).

Root-knot nematodes (RKNs) are biotrophic, polyphagous plant parasites capable of infecting almost all cultivated plants. There are more than 90 species belonging to the Meloidogyne genus and a review detailing the ten most economically damaging plant parasitic nematodes placed them at the top of this list

(Jones et al, 2013). RKNS are widespread in tropical and subtropical regions (Coyne et al., 2018). The name Root-knot comes from the characteristic galling of the root system following infection by these nematodes. First stage juveniles (J1) moult within the eggs which hatch releasing the infective second stage juveniles (J2) that migrate throughout the soil in search of a host plant. The migration towards host roots is reliant upon sensory anterior amphids which respond to chemoattractants in the rhizosphere (Liu et al., 2019). Owing to the polyphagous nature of these nematodes hatching is normally stimulated by biotic factors such as temperature and is not reliant on specific host cues (Perry and Wesemael, 2008). J2s invade the host at the root tip where they continue to migrate intercellularly upwards through the vascular cylinder towards the differentiation zone where they select a cell to become a specialised feeding cell (Paulson and Webster, 1970). The multinucleate giant cell arises as the nematode secrets effector molecules that disrupt the normal cell cycle resulting in continuous cell division without apoptosis (Palomares-Rius et al., 2017). Upon feeding the J2 becomes enlarged and undergoes an additional three moults to the reproductive adult stage. Non-feeding adult males leave the

14 Chapter 1: General Introduction root whereas enlarged, ‘pear-shaped’ females embedded within the root continue feeding and deposit eggs into a gelatinous matrix, which contains hundreds of eggs and serves as a protective coating from the external environment (Singh and

Khanna, 2017) (figure 1.1). Meloidogyne spp. display sexual dimorphism and few species reproduce by amphimixia. However, in most species reproduction is parthenogenic with males of the species only being found in high numbers during adverse conditions (Castagnone-Sereno et al., 2013).

The cyst nematode, Globodera pallida, is also a biotrophic plant nematode; however, it has a much narrower host range, hatching in response to specific cues from host root exudate (Ochola et al., 2020). Similarly to root-knot nematodes, this cyst nematode undergoes a first moult in the eggs which remain dormant until hatching is stimulated by host specific cues (Evans and Stone, 1977). Upon entry to the host root infective juveniles (J2) migrate intracellularly to the inner cortex where they probe cells with their stylet to select a cell from which to begin syncytium formation. The syncytium is a large multinucleate feeding site formed by the degradation of cell walls surrounding the initial syncytial cell. Following cell wall degradation, the protoplasts of adjoining cells fuse together to become one giant feeding structure (Jones and Northcote, 1972). Gene expression changes brought about by effector molecules secreted by the plant nematode result in increased metabolic activity of cells incorporated within the syncytia (Hewezi, 2015). Similarly to the root-knot nematodes the result is a highly metabolically active feeding structure which provides the nematode with all the nutrients it requires for reproduction and development. The nematodes remain sedentary at the feeding

15 Chapter 1: General Introduction site and undergo an additional 3 moults to reach the adult stage (figure 1.1).

Mature females die following fertilisation and their body forms a cyst which acts as a protective coating for the hundreds of eggs contained within (Evans and Stone,

1977). The potato cyst nematode Globodera pallida is a major pest of potato within the UK (Trudgill et al., 2003).

Figure 1.1. Schematic diagram of (a) Cyst nematodes and (b) Root-knot nematodes. a: cyst nematode J2s invade roots and migrate intracellularly to the inner cortex where they produce giant syncytium. The nematode remains sedentary and moults to the adult stage. Fertilised adult females form a protective cyst containing hundreds of eggs. b: Root-knot nematode J2s invade roots and migrate intercellularly towards the differentiation zone and select a cell to become a multinucleate giant feeding cell. Upon feeding the J2s become sedentary and moult to the adult stage. Non-feeding males leave the root whereas enlarged females continue to feed and produce eggs which are deposited into a gelatinous matrix (Williamson and Gleason, 2003).

16 Chapter 1: General Introduction

1.2.7. Control Strategies

For decades, control methods have relied heavily on the use of chemical nematicides which are often applied as non-specific soil fumigants. However, concerns over environmental toxicity and potential carcinogenic/mutagenic effects have led to legislation enforcing their progressive withdrawal. For instance, the organobromide chemical methyl bromide was used for many years as a successful broad-spectrum pesticide. However, the chemical dissipates rapidly in to the atmosphere where it exerts ozone depleting properties (McSorley et al., 2009). In addition, methyl bromide binds DNA which means the chemical poses significant risks for those exposed during application. The Montreal Protocol on substances that deplete the ozone layer categorises methyl bromide as a class 1 ozone depleting substance (ODS) consisting of chemicals with the highest ozone depleting potential. Consequently, methyl bromide underwent a gradual withdrawal and ultimately was completely phased out in Europe in 2010 (Mouttet et al., 2014).

Whilst advantageous for the environment, withdrawal of the most efficacious control strategy has led to serious limitations in our ability to manage these pests

(Chitwood, 2003).

Alternative control strategies involve crop rotation with non-host species to purge the soil by taking advantage of PPN’s obligate parasitic lifestyle. This strategy, however, does not take in to account the polyphagous nature of certain species, for example many species belonging to the Meloidogyne genus are capable of infecting almost every species of crop plant (Trudgill and Blok, 2001). Even PPN species that rely on specific host cues to facilitate hatching and host finding such as the Potato

17 Chapter 1: General Introduction

Cyst Nematode (PCN) G. pallida can overcome crop rotation strategies. Cysts produced by mature G. pallida females contain hundreds of eggs that can remain dormant within the soil for many years hatching then in response to host root diffusate from a compatible host (Byrne et al., 2001). However, introduction of a

‘trap’ crop in this way can suppress populations to levels which are economically productive. Even so, crop rotation can result in economic losses for farmers due to cycling between less economically valuable crops and their primary income crop species.

Another measure used to control PPNs is to plant crops that have natural resistance genes (R genes) protecting them from PPN infection. To date, several R genes have been identified in different plant species. The best characterised R gene is the Mi gene belonging to tomato that encodes a protein that promotes resistance to several Root knot nematode species (Milligan et al., 1998). Although planting resistant crops represents an environmentally friendly approach to pest control there are several limitations associated with this strategy. Often these R genes are very specific conferring resistance only against individual strains of a species with specific biotypes possessing an ability to overcome such resistance (Castagnone-

Sereno, 2002). Also, resistance loci have not been identified in many economically important crop species. The shortcomings associated with the above-mentioned control strategies has led to an increased need for novel approaches to be developed. Favourable strategies will be target specific, whilst conferring resistance to multiple species. To this end, programmes that aim to further our understanding of a potential target are now commonplace. Advances in molecular techniques have and continue to be invaluable in facilitating this goal.

18 Chapter 1: General Introduction

1.3. Nematode neuropeptides

Nematode neuropeptides are small signalling molecules secreted by peptidergic neurons. Neuroanatomical maps are available for both the free-living nematode

Caenorhabditis elegans and the gastrointestinal parasite Ascaris summ (Hobert,

2005; Stretton et al., 1978; White et al., 1986). This information has revealed conservation of both species’ neuroanatomical morphology despite significant differences in their lifestyles (Nanda and Stretton, 2010). In both species this simple neuroanatomic structure is complemented by a chemical complexity supporting a wide range of behaviours. Widespread distribution of neuropeptides throughout the nematode nervous system provide evidence for their ability to coordinate vital aspects of nematode behaviour (Brownlee et al., 1996; McVeigh et al., 2008; Nathoo et al., 2001a).

There are three major class of nematode neuropeptide: FMFR-amide and insulin-like peptides, and neuropeptide-like proteins (FLPs, ILPs, and NLPs). The model nematode C. elegans has contributed enormously to our understanding of nematode neuropeptides. More than 113 neuropeptide genes encoding more than

250 neuropeptides have been identified to date (Li, 2008) . High conservation of neuropeptide genes within the phylum has facilitated the translation of information gained from C. elegans research to assist in the identification, localisation and functional characterisation of neuropeptide genes in important parasitic species.

Additionally the publication of several important PPN species’ genomes, eg. M. incognita and G. pallida, (Abad et al., 2008; Cotton et al., 2014) has allowed the

19 Chapter 1: General Introduction identification of novel, parasitic specific neuropeptide genes (McVeigh et al., 2008).

The abundance of information available about neuropeptides has enabled functional studies to be carried out with the aim of determining their potential as control targets. For example, behavioural assays testing the effect of neuropeptide addition on key parasitic behaviours has been a useful tool for studying various aspects of PPN biology such as stylet thrusting, invasion and chemosensation

(Warnock et al., 2017)

1.3.1. Neuropeptide synthesis

Bioactive neuropeptides are derived from precursor molecules that undergo a series of proteolytic processes cleavages and modifications to yield one or more functional neuropeptide (Li and Kim, 2014a). Individual neuropeptide genes may encode multiple transcripts which can be produced by alternative splicing of the gene. This, coupled with multiple peptides being encoded by a single gene results in the remarkable neuropeptide diversity shown in the phylum (Nelson et al., 1998).

Initial processing involves removal of the pre-propeptide’s signal peptide in the endoplasmic reticulum. Cleavage of the propeptide at distinct regions by proprotein convertase enzymes expressed throughout the nervous system release the individual neuropeptide molecules which undergo further processing (Husson et al., 2006). Proprotein convertase enzymes often cleave c-terminal to dibasic residues along the precursor propeptide, however this is not essential for their activity (Veenstra, 2000). The identification of putative neuropeptide genes is aided by searching for characteristic motifs found in the propeptide molecule, such as dibasic residues flanking the neuropeptide sequence and predicted signal peptides

20 Chapter 1: General Introduction

(McVeigh et al., 2005). Studies have been carried out using proprotein convertase knockout mutants that demonstrate aberrant behaviours as processing of the peptide precursors is reduced (Husson et al., 2006). Such studies provide supporting evidence for the role of neuropeptides in coordinating important and diverse behaviours in nematodes. In addition, this demonstrates the feasibility of the components of proteolytic processing within the peptidergic system to become a therapeutic target.

After processing of the precursor molecule, the basic residues are cleaved from the peptide by a carboxypeptidase enzyme (Fricker, 2018). Many neuropeptides then undergo further posttranslational modifications to provide protection from degradation and often to confer biological activity (De Haes et al.,

2015; Hook et al., 2018). For example, all the FLPs as well as many of the NLPs are modified by amidation (Eipper et al., 1992; Nelson et al., 1998). Notably some neuropeptides belonging to the nlp gene family are biologically active without the need for PTMs (Nathoo et al., 2001b). Neuropeptides are stored in dense core vesicles which are trafficked to the nerve terminal where they are released following a rise in calcium within the nerve terminal in response to various stimuli.

After serving their purpose, the neuropeptides are degraded within the synaptic cleft by proteolytic enzymes (Li, 2008).

1.3.2. FMRF-amide like peptides

Identified by their characteristic C-terminal RF-amide motif, neuropeptides belonging to the flp gene family represent the most well studied class of neuropeptide (Edison et al., 2000). In C. elegans 31 flp genes have been identified

21 Chapter 1: General Introduction encoding 71 putative FLP. Expression studies from cDNA libraries show all 31 flp genes are expressed (Li and Kim, 2014b). Flp genes have been shown to be expressed in neurons as well as non-neuronal tissue (Kim and Li, 2004). A diverse expression profile allows the coordination of multiple neuronal networks to generate and coordinate complex behaviours in nematodes. In C. elegans functional studies have been carried out using knockout mutants, RNA interference or by over expression of the neuropeptide (Li, 1999). These studies have linked FLPs to the coordination of vital aspects of nematode behaviour. For example, flp-1 gene knockout mutants result in worms displaying aberrant behaviours such as nose- touch insensitivity and resistance to serotonin induced egg-laying (Buntschuh et al.,

2018).

Localisation of neuropeptide genes is an important step in elucidating function. As such, localisation studies using Immunocytochemistry and in situ hybridisation have been used to determine expression patterns of neuropeptides across different nematode species (Johnston et al., 2010; Keating et al., 1995;

Kimber et al., 2002). Interestingly, although C. elegans and A. suum are neuroanatomically similar and in many instances neuropeptide sequences are conserved between the species, the distribution of these conserved neuropeptides tends to vary greatly (Jarecki et al., 2010). This is also true for the PPN G. pallida. An expression study utilising in situ hybridisation (Kimber et all, 2002) revealed the expression pattern of several flp genes. When these data were compared to homologous genes in C. elegans, it demonstrated that whilst some of these genes encode the same neuropeptide sequence, they also differ in their expression

22 Chapter 1: General Introduction pattern. What this study did reveal though was the extensive expression of several flp genes throughout the nervous system suggesting their role in various behaviours.

C. elegans is a model species, and the wealth of information available can be used to provide vital insight into none-model species. However, the above mentioned study emphasises the importance of species specific data to allow comparative studies, particularly between parasitic species where difference such as neuropeptide expression patterns may help direct therapeutic studies.

Importantly, functional studies using RNAi in plant parasitic nematodes have shown

FLPs to be important for regulating various behaviours necessary for successful parasitism such as host finding and invasion. For example, using an RNAi platform to silence five flp genes (Gp-flp-1, -6, -12, -14 or -18) resulted in aberrant locomotion phenotypes (Kimber et al., 2007). Furthermore, silencing of the RKN M. incognita flp-14 and flp-18 genes using in vitro RNAi influenced migration towards and invasion of host roots. This study also this used in planta RNAi to silence the same genes with a 50-80% reduction in infection of the transgenic tobacco plants was observed (Papolu et al., 2013) Additionally, flp genes have been linked to regulating behaviour in other economically important parasitic nematodes. For example, knockdown of flp-21 in the entamopathogenic nematode Steinernema carpocapse resulted in a reduction in nictation, a specialised host-finding behaviour or dispersal behaviour (Lee et al., 2012; Morris et al., 2017).Together, these studies highlight the importance of FLP signalling in coordinating nematode biology with

23 Chapter 1: General Introduction emphasis on behaviours which impact on the parasitic lifecycle. Disrupting FLP signalling represents a potential means of controlling parasitic nematodes.

1.3.3. Insulin-like peptides

The C. elegans genome contains 40 genes which encode the insulin-like peptides

(ILPs). These genes have been shown to be expressed in various nematode life stages and have implications for dauer formation and ageing in C. elegans, highlighting their potential as novel control targets for parasitic nematodes (Gahoi and Gautam, 2016). They share a structural motif made up of an A and B domain which are stabilised by a series of disulphide bond (Duret et al., 1998). Each ILP gene encodes a single insulin-like peptide. This class of neuropeptide act on insulin- like transmembrane receptors to regulate the insulin signalling pathway. Initiating this signal cascade results in changes in gene expression leading to regulation of phenotypes. For example, the insulin signalling pathway in C. elegans is involved in metabolism, growth and normal adult life span (Murphy, 2013).

1.3.4. Neuropeptide-like Proteins

The nlp genes encode a diverse array of peptide molecules which share little structural similarity with one another. To date 46 C. elegans nlp genes encoding approximately 159 peptides have been identified, demonstrating a chemical complexity not seen in other invertebrates (Husson et al., 2005; McVeigh et al.,

2008; Nathoo et al., 2001c). Expression data for C. elegans suggest their involvement in sensory perception, feeding and development (Li, 2008). These behaviours represent promising targets for control. If this functionality is translated

24 Chapter 1: General Introduction across PPNs then NLPs may be exploited as novel nematicide targets. Firstly, functional characterisation of NLPs is required. As yet, functional characterisation of these NLPs has been limited.

1.4. Genetic approaches to studying gene function

1.4.1. Forward and Reverse genetics

Traditionally, finding the link between a genes sequence and function involved forward genetics. These experiments set out to determine the genetic element responsible for a phenotype using naturally occurring or induced mutations in a model organism (Moresco et al., 2013). A major advantage of forward genetics is its unbiased nature, as no prior knowledge of the molecular pathway resulting in the observed phenotype is needed (Moresco et al., 2013). However, forward genetic screens can be very time consuming and resource intensive.

The advance of whole genome sequencing has seen a wealth of data provided for both model species and important parasitic species. Now, we are at a time where researchers have unbridled access to genomic information like never before. As such, what is now needed is functional characterisation to marry with all the genetic information available. Reverse genetics begins with a known gene sequence and attempts to align it with a particular function or phenotype (Tierney and Lamour, 2005). Classically such experiments utilised in vitro mutagenesis of a gene or gene knockout transgenic lines to observe the resultant phenotype (Hardy et al., 2010). Owing to its amenability to these approaches, the model nematode C.

25 Chapter 1: General Introduction elegans has been used successfully for high throughput loss of function studies. To this end there are now libraries of C. elegans ‘knockout’ mutants from which the function of specific genes has been elucidated (Cuppen et al., 2007; Fraser et al.,

2000; Kutscher, 2014). Translating this success to parasitic species of nematode has proved more difficult due to their obligate parasitic lifestyles.

The discovery of RNA interference has been invaluable in bridging the gap between sequence and function in many parasitic species that are recalcitrant to genetic transformation (Fanelli et al., 2005; Kimber et al., 2007; McCoy et al., 2015;

Morris et al., 2017). RNAi experiments apply exogenous double-stranded RNA (ds-

RNA) molecules that are complimentary to a gene of interest resulting in silencing or reduced expression of target messenger RNA (mRNA) transcripts.

1.4.2. RNAi: History and applications

In the early 90s studies focussed on the application of antisense RNA molecules to target specific endogenous genes for functional studies (Bhalla et al., 1999; Mol et al., 1990; SADIQ et al., 1994). What was then discovered was the application of both sense and antisense RNA molecules led to specific phenotypes and that the effect was systemic (Fire et al., 1998). This effect was termed RNAi. At the same time similar observations were made by researchers studying plants and fungi however they called the phenomenon co-suppression (Napoli et al., 1990) and quelling (Romano and Macino, 1992), respectively. What became apparent was distinct organisms were responding to silencing triggers in a similar manner, suggesting an evolutionarily conserved process.

26 Chapter 1: General Introduction

First discovered by Fire et al (Fire et al., 1998) RNAi has been utilised as an invaluable reverse genetics tool to uncover gene function across distinct organisms.

RNAi was first described in C. elegans when Fire and colleagues demonstrated both potent and specific gene knockdown through the application of just a few molecules of exogenous dsRNA with complementarity to target mRNA in C. elegans.

The remarkable potency of RNAi set it apart from antisense inhibition studies.

Following this seminal work, consequent studies showed RNAi to be an evolutionarily conserved process spanning across all metazoan (Obbard et al., 2009;

Shabalina and Koonin, 2008). This revelation was responsible for the many RNA- based silencing experiments that soon followed. RNAi represented the first glimpse of a high-throughput methodology that did not necessitate genetic transformation.

Indeed, this notion attracted attention across many fields of research.

Within parasitology the ability to study genes using an RNAi-based platform is invaluable as many parasitic animals are recalcitrant to genetic transformation because of their obligate parasitic lifestyle, a major hindrance for target-validation studies. Over the years, high-throughput RNAi screening in C. elegans has provided researchers with vital information regarding the complexities of the endogenous

RNAi pathway itself as well as functional studies of specific genes relevant to an organism of interest (Kamath, 2003; Simmer et al., 2003). Certainly, these studies have and continue to provide a great resource for loss of function phenotype studies across non-model organisms, including parasitic nematodes.

27 Chapter 1: General Introduction

1.4.3. RNAi pathway in nematodes

In vitro RNAi involves the delivery of exogenous dsRNA to the organism of interest, after which the dsRNA is processed by the animal’s endogenous RNAi pathway.

Uptake of dsRNA from an the external environment is facilitated by the single pass transmembrane protein SID-2, which is localised to the intestinal lumen (Winston et al., 2007) An important observation made in early RNAi experiments was that injection of dsRNA in to one tissue resulted in the silencing of transcripts in tissues throughout the worm in a systemic response to the initial trigger. It was shown that the SID-1 protein, a transmembrane channel which recognises dsRNA was responsible for cellular uptake thus facilitating systemic RNAi (Feinberg, 2003).

Notably, the presence of these genes is not required for the RNAi pathway itself.

Also, neuronal cells are known to be recalcitrant to RNAi when fed with bacteria expressing dsRNA (Fraser et al., 2000; Kamath et al., 2003). However, expression of

SID-1 in C. elegans neurons results in neuronal cells becoming susceptible to RNAi suggesting SID-1 is important for neuronal uptake of dsRNA (Calixto et al., 2010).

Additional SID proteins and other effectors have been implicated in uptake of foreign dsRNA from the environment and in facilitating the systemic RNAi pathway

(Chen et al., 2005; Hinas et al., 2012).

Exogenous dsRNA within a cell is recognised and bound by the ribonuclease

(RNase) III enzyme DICER which processes long dsRNA molecules in to 21-25bp fragments known as short-interfering (siRNAs) (Tabara et al., 2002). The next step of the pathway involves loading the siRNAs into the RNA-Induced Silencing Complex

(RISC). RISC is made up of various components which together form a ribonucleoprotein complex that acts as an adaptable machine capable of silencing

28 Chapter 1: General Introduction any nucleic acid sequence (Pratt and MacRae, 2009). Incorporation of siRNAs into

RISC is facilitated by a member of the Argonaute protein family. There are multiple members of the Argonaute protein family that appear to be evolutionarily conserved between species (Höck and Meister, 2008). As mentioned above, one function of Argonaute proteins is binding siRNAs, which guide them to complementary mRNA molecules to facilitate Post Transcriptional Gene Silencing

(PTGS). However, the function of many Argonaute proteins has yet to be elucidated. Upon incorporation into RISC the siRNA molecule is unwound, and the guide strand chaperons the complex to target RNAs through base pair complementarity (figure 1.2). RISC can induce silencing of its target through direct cleavage of the target transcript; translational suppression or transcriptional suppression (van den Berg et al., 2008). Important for this discussion, is silencing at the transcript level through mRNA degradation. Target transcript degradation is facilitated by Argonaute proteins. Perfect complementarity results in mRNA degradation, whereas mismatches in the siRNA/mRNA duplex causes gene silencing through translational inhibition (Hutvagner, 2005). It was hypothesised there must be an endogenous amplification of the silencing signal to facilitate such an effective response. Indeed, it is now known that RNA dependent RNA polymerases are responsible for this amplification. Acting upon the non-guide strand of siRNA molecules they produce secondary siRNA molecules which can then become incorporated in to RISC (Pak and Fire, 2007). Depending on the availability of pathway components this process has the potential for huge amplification of the initial signal and is likely the reason Fire and Mello observed such potent silencing with just a few molecules of dsRNA.

29 Chapter 1: General Introduction

Figure 1.2. Schematic diagram of RNA interference mechanism dsRNA or hairpin RNA molecules are processed by Dicer to produce siRNA molecules. One strand (the guide strand) of the siRNA duplex binds with Ago and other effectors to form the RNAi Induced

Silencing Complex (RISC). RISC binds to complementary mRNA transcripts leading to transcript degradation or translational suppression. Recycling of the siRNA-mRNA duplex to

RISC or generation of secondary siRNA molecules by the action of RNA-dependent RNA-

Polymerases (RdRP) may occur. (Majumdar et al., 2017)

1.4.4. Dicer, RISC and secondary amplification

The Dicer enzyme is a multidomain nuclease that facilitates the initial recognition and cleavage of dsRNA into small RNAs which serve in gene regulation as well as

30 Chapter 1: General Introduction protection from foreign viral RNA and endogenous transposable elements. Dicer molecules belong to the RNase III family of ribonucleases and function in tandem with dsRNA binding proteins to form a pre-RISC Dicer complex with dsRNA (Song and Rossi, 2017). This complex consists of RDE-1, DCR-1, RDE-4 and DRH-1 proteins.

The initial binding of long dsRNA molecules introduced exogenously is coordinated by the RDE-4 protein, which contains two copies of a dsRNA binding motif.

Biochemical studies have demonstrated that RDE-4 interacts with the other components of the Dicer complex suggesting its role in recognising foreign dsRNA, binding and facilitating its processing by DCR-1, the Dicer enzyme itself.

Additionally, it was shown that RDE-4 interacts with RDE-1 (the first Argonaute protein to be implicated in the RNAi pathway) in vivo and this may play a role in transferring the siRNAs produced from Dicer processing to the RISC complex of proteins. This interaction was also shown to provide a protective function to prevent non-specific degradation of the exogenous dsRNA molecules (Tabara et al.,

2002).

Another component of the Dicer complex which interacts with RDE-4 is the

RNA helicase, DRH-1. Although the precise function of DRH-1 has yet to be elucidated, it has been implicated in mediating an intracellular pathogen response during viral infection (Sowa et al., 2019). Also, rde-1 C. elegans mutants are recalcitrant to dsRNA mediated RNAi (Tabara et al., 1999) . One hypothesis is this interaction may coordinate the movement of dsRNA from RDE-4 to DCR-1.

Binding of dsRNA by DCR-1 is coordinated by the PAZ domain

(Piwi/Argonaute/Zwille), which contains binding surfaces for the 3’ overhangs of

31 Chapter 1: General Introduction dsRNA molecules (Song and Rossi, 2017). Catalytic activity is enabled by the RNase

IIIa and IIIb domains with each domain coordinating the cleavage of a single strand of the nucleic acid. One strand of the resultant siRNA molecule is selected as the guide strand and is subsequently incorporated into the RISC while the passenger strand is degraded. RISC is the central element of the RNAi pathway which controls the sequence specific degradation of target transcript mRNA through complementary binding of the guide strand.

As a minimum RISC is made up of Argonaute (AGO) proteins associated with siRNAs, although various cofactors may aid in the mechanisms (Pratt and MacRae,

2009). C. elegans has 27 AGOs which are characterised by their signature PAZ and

PIWI domains. These domains bind either end of the siRNA molecule with the middle of the strand free to bind to its cognate transcript. Additionally, the PIWI domain contains the catalytic region, which confers slicer activity acting upon the transcript mRNA. AGO eukaryotic proteins have been characterised across diverse organisms and have been shown to play a role in a multitude of processes (Yigit et al., 2006). Of the 27 C. elegans AGOs only a few have been functionally characterised; it is still unknown what role many of these proteins plays in the RNAi pathway.

Additionally, as mentioned, the potency with which dsRNA molecules leads to specific gene knockdown through RNAi suggests an amplification step in that pathway. Amplification of the initial silencing trigger is facilitated through the production of secondary siRNAs by an RNA-dependent RNA Polymerase (RdRP)

(Zhang and Ruvkun, 2012). RISC, with its coupled siRNA bound to the endogenous

32 Chapter 1: General Introduction transcripts recruits these RdRPs whereby de novo synthesis of dsRNA occurs with endogenous mRNA serving as the template. The dsRNA is then processed to produce secondary siRNAs by Dicer, and these can then act to amplify the RNAi response against the target gene. Two RdRPs known to facilitate this process in C. elegans are RFF-1 and EGO-1 (Aoki et al., 2007; Smardon et al., 2000). The resultant secondary siRNAs interact with Worm specific Argonaute proteins (WAGOs) to bring about gene silencing.

Another two proteins that form a complex, RDE-10 and RDE-11 have been shown to be important for this amplification pathway in C. elegans and are thought to promote secondary siRNA accumulation in a dosage sensitive manner. That is to say rde-10 and rde-11 genes are responsive to low concentrations of exogenous dsRNA where lower amounts of primary siRNAs are synthesised, and amplification is required to produce an effective RNAi response. These genes are conserved in

Caenorhabditis species and are thought to promote adaptation to changing environments where a potent and effective response against invading viral RNA is required (Zhang and Ruvkun, 2012).

1.4.5. In planta RNAi

It has been demonstrated that RNAi is an evolutionarily conserved process which spans across kingdoms. In plants PTGS involves a similar mechanism to what is observed with RNAi in animals when exposed to exogenous dsRNA (Vaucheret et al., 2001). In plant parasitism where there are distinct organisms involved this conservation has allowed for the development of potential control strategies such

33 Chapter 1: General Introduction as in planta RNAi also known as Host Induced Gene Silencing (HIGS). This involves the production of transgenic plants that synthesise dsRNA containing constructs which facilitates delivery of these silencing molecules to feeding nematodes (Dutta et al., 2015). This has enabled RNAi targeting of nematode life stages which was not previously feasible through in vitro techniques due to their obligate parasitic lifestyle. This increases the number of genes available for targeting due to the transient expression of genes that occurs throughout nematode development. This approach has the potential to discover novel control targets. Most importantly, it allows for these studies to be carried out when the nematodes are in a more natural environment as opposed to in vitro culture methods which may have their own effect on gene expression.

Transgenic plants encoding a hairpin-RNA silencing construct process this construct in the same way it would elicit an RNAi response to dsRNA from various sources. As such, the dsRNA is processed by the plant’s own endogenous Dicer enzymes to produce siRNAs (Hamilton, 1999; Levin et al., 2000; Smith et al., 2000).

Therefore, it is possible for feeding nematodes to uptake orally both dsRNA and siRNA molecules which then go on to elicit an RNAi response through the nematode’s own internal RNAi pathway (figure 1.3). Passage of dsRNA and siRNA through the feeding tube of different PPN species has been demonstrated

(Fairbairn et al., 2007; Li et al., 2017; Yadav et al., 2006).

34 Chapter 1: General Introduction

Figure 1.3. Schematic diagram showing possible fates of dsRNA and siRNA in a nematode– plant feeding cell interaction. dsRNA is produced in the feeding cell and might be processed by DICER to siRNA. dsRNA and/or siRNA might enter the nematode during feeding depending on the size exclusion limit of the feeding tube. Inside the nematode, RNAi is then mediated by its internal response to exogenous dsRNA. (Bakhetia et al., 2005)

1.4.6. Host-Induced Gene Silencing as a control strategy

In planta RNAi has been used successfully to study PPN gene functionality (Li et al.,

2010). Given that RNAi against nematode genes can induce deleterious and debilitating phenotypes, in planta RNAi may be used as a direct control strategy against agricultural pests. The ability to strategically target key parasitism genes in feeding nematodes and potentially disrupt the lifecycle may greatly reduce the burden imposed on a host plant. Researchers have designed silencing constructs which target multiple nematode genes. This leads to a stacking effect increasing the silencing inflicted on the nematodes affording the plant a greater chance of overcoming the infection and minimising damage (Klink et al., 2009; Papolu et al.,

2013). This approach is appealing for several reasons. control strategies that use transgenic plants may secrete active proteins that exert a desirable effect on the

35 Chapter 1: General Introduction target organism (Sainsbury et al., 2012). dsRNA, however, is not translated to produce an active peptide and so there is a much lower risk of off target effects which are much more frequent with functional protein molecules. As crop plants will ultimately be consumed by humans biosafety is important. Again, using RNAi as a control strategy may result in human consumption of dsRNA being produced by the transgenic plant. However, it is not uncommon for people to consume crops infected with a virus producing dsRNA and so this is not a new introduction to the human diet (Balique et al., 2015). Additionally, the use of tissue specific promoters may be used to induce dsRNA production in the below ground regions of the plant in order to tackle pests whilst aerial, vegetative tissue is not altered in this way

(Mohan et al., 2017). This affords protection to non-target organisms that may feed on the plant. Targeting specific nematode genes and avoiding genes conserved between kingdoms will also reduce the potential for unwanted non-specific effects.

Ultimately off target effects would need to be evaluated on a case by case basis.

Additionally, the specificity of this approach is much more favourable when compared to non-specific chemical treatments, which have deleterious effects towards non-target organisms and cause environmental toxicity.

Among the benefits of this approach there are also some key issues that need to be addressed for this strategy to be commercially viable. One major issue is the widespread criticism surrounding the production of Genetically Modified

Organisms (GMOs) for consumption. Traditional breeding techniques have been used for many years to select for desired traits in crop plants which make them more resistant to biotic/abiotic stresses (Foxe, 1992). However, this is limited to the natural genetic variance available. Genetic engineering on the other hand can be

36 Chapter 1: General Introduction used to incorporate foreign genes from an unrelated organism into the organism of interest (Prado et al., 2014). These foreign transgenes may have unknown and potentially undesirable consequences for the transgenic plant and other species with which it interacts. As mentioned above in the case of HIGS this can be addressed through careful target gene selection. Nevertheless, this approach must overcome many issues such as public perception and fears of economic exploitation before it could be used as a viable control method for agricultural pests. In fact, to date in Europe, only two GM crops have been approved for cultivation and lengthy approval processes have led to efforts to produce GM crops being abandoned

(Halford, 2019). With this in mind, continued research is crucial for guiding the decisions of global policy makers to insure both efficacy and safety of all GMO crops.

1.4.7. Virus Induced Gene Silencing

A further reverse genetics tool which has been developed for high throughput gene function studies in plants is Virus Induced Gene Silencing (VIGS). Like other strategies, VIGS exploits the plants innate response to viral invasion, the result being target transcript silencing. VIGS utilises viral vectors that have been engineered to carry a fragment of a target gene. This fragment is used to produce dsRNA and results in PTGS. Several viral vectors have been developed and optimised for successful silencing across a range of plant species (Robertson,

2004).The transient silencing of target genes facilitates functional characterisation without the need to undertake the laborious task of genetic transformation. The

37 Chapter 1: General Introduction large-scale production of plants synthesising dsRNA is possible using VIGS and allows a high throughput approach to be used. This method has been used to study plant genes important for various aspects of plant biology including stress responses (Manmathan et al., 2013; Senthil-Kumar et al., 2007). VIGS has also been used favourably to study plant-pest interactions (Cox et al., 2019; Dyer et al., 2019;

Van Eck et al., 2010) and may provide an approach to silence targeted parasite genes in large-scale experiments that do not rely on genetic transformation.

1.4.8. VIGS Mechanism and applications

Virus infected plants mount an RNA-mediated silencing response to invading foreign viral RNA that targets the viral genome. VIGS is used to exploit this conserved process and infect plants with a modified viral genome carrying fragments derived from a target gene leading to degradation of endogenous complimentary RNA transcripts (Liu et al., 2016). Virus genomes are modified to remove symptom causing genes and the viral genome is cloned into a modified viral vector under the control of a constitutive promoter (Liu et al., 2002). Target gene inserts are cloned into the viral vector and carefully selected to avoid off-target effects. The publication of candidate plant species genomes allows users to trawl the genome selecting regions of a gene of interest which facilitates optimal design of a VIGS construct that is target specific and less likely to induce off-target effects.

The Sol Genomics Network (SGN) have developed software specifically to aid in the design of VIGS constructs for optimal gene silencing (Fernandez-Pozo et al., 2015) .

38 Chapter 1: General Introduction

Viral vectors are transformed into competent Agrobacterium tumefaciens bacterium which are inoculated into the plant. The T-DNA region of the

Agrobacterium containing the modified viral genome is integrated into the plant genome in one or more host plant cells. Once the viral genome is introduced into the plant, transcribed and translated, the plant’s RNA-mediated defence is initiated.

The transgene is recognised by the plant’s endogenous RdRP molecules and amplified to produce dsRNA. Also, the viral genome itself contains its own RdRP gene and the translated protein also facilitates transgene amplification

(Ramegowda et al., 2014). These dsRNA molecules are recognised by DICER enzymes which cleave the dsRNA to produce siRNAs. SiRNAs are incorporated into the RISC, which adopts one strand of the duplex to guide and promote binding to its cognate mRNA transcript resulting in its degradation. mRNA degradation leads to less transcript, less protein and ultimately a loss of function conferred by the target gene allowing for functional characterisation of the gene and its associated biological pathways. The silencing signal is amplified, spreads systemically and facilitates transient knockdown of endogenous genes with plants being able to make a full recovery from the effects of silencing (Ruiz et al., 1998), although, longer term silencing has been observed (Senthil-Kumar and Mysore, 2011).

As mentioned, several viral vectors have been adapted for VIGS and one common viral genome widely used is that from the Tobacco Rattle Virus (TRV) owning to its ability to infect a wide range of host plants (Ratcliff et al., 2001). One useful aspect of VIGS is the ability to target multiple genes and particularly to silence a marker gene that can be used to select those plants which have been successfully targeted by VIGS. For example, targeting the Phytoene desaturase PDS

39 Chapter 1: General Introduction gene in some plants leads to a bleaching phenotype that can be used as a selectable marker (Turnage et al., 2002). VIGS offers a high throughput approach that can be used for multi-gene experiments to study complex biological processes in plants and their associated pests.

There are however some limitations involved with VIGS. These include the lack of uniform silencing throughout individual plants as well as between plants in an experimental screen. Also, the efficiency of VIGS is temperature dependent and so requires optimisation for each viral vector-plant species combination and in some cases a trade-off between silencing efficiency of the virus and growth conditions of the plant is necessary for optimal silencing (Broderick and Jones, 2014)

Nevertheless, VIGS provides a platform which can been used to study plant genes associated with defence against economically important pests. In addition, several researchers have adapted this well-established platform and purposed it towards

RNAi against PPN genes serving to study parasitic genes in planta without the requirement of producing stable transformants (Dubreuil et al., 2009; Kandoth et al., 2013).

40 Chapter 1: General Introduction

1.5 Hypothesis and Chapter Aims

‘Silencing plant nematode nlp genes using reverse genetics techniques will negatively impact important parasitism behaviours and allow novel control strategies to be developed’.

Chapter 2: To optimise a B. subtilis transgenic delivery system by creating a signal peptide clone library to test the efficacy different B. subtilis clones have on conferring resistance to tomato in an invasion assay. Also, to develop a VIGS protocol to silence nlp-15 in host invading M. incognita juveniles.

Chapter 3: To test the efficacy of several RNAi protocols to silence nlp-15 in R. similis juveniles and to assess the effect different isolates of the same species have on silencing using a standardised RNAi methodology.

Chapter 4: To develop transgenic tomato plants which synthesise an RNAi silencing construct to target nlp-15 using Agrobacterium tumefaciens mediated plant transformation.

41 Chapter 1: General Introduction

1.6 References

Abad, P., Gouzy, J., Aury, J.-M., Castagnone-Sereno, P., Danchin, E.G.J., Deleury, E., Perfus- Barbeoch, L., et al. (2008), ‘Genome sequence of the metazoan plant-parasitic nematode Meloidogyne incognita’, Nature Biotechnology, Vol. 26 No. 8, pp. 909–915. Abd-Elgawad, M.M.M. and Askary, T.H. (2015), ‘Impact of phytonematodes on agriculture economy.’, Biocontrol Agents of Phytonematodes Aoki, K., Moriguchi, H., Yoshioka, T., Okawa, K. and Tabara, H. (2007), ‘In vitro analyses of the production and activity of secondary small interfering RNAs in C. elegans’, The EMBO Journal, Vol. 26 No. 24, pp. 5007–5019. Bakhetia, M., Charlton, W.L., Urwin, P.E., McPherson, M.J. and Atkinson, H.J. (2005), ‘RNA interference and plant parasitic nematodes’, Trends in Plant Science, Vol. 10 No. 8, pp. 362–367. Balique, F., Lecoq, H., Raoult, D. and Colson, P. (2015), ‘Can Plant Viruses Cross the Kingdom Border and Be Pathogenic to Humans?’, Viruses, Vol. 7 No. 4, pp. 2074– 2098. Basyoni, M.M.A. and Rizk, E.M.A. (2016), ‘Nematodes ultrastructure: complex systems and processes’, Journal of Parasitic Diseases van den Berg, A., Mols, J. and Han, J. (2008), ‘RISC-target interaction: Cleavage and translational suppression’, Biochimica et Biophysica Acta - Gene Regulatory Mechanisms van den Berg, E., Marais, M. and Swart, A. (2017), ‘Nematode Morphology and Classification’, Nematology in South Africa: A View from the 21st Century, Springer International Publishing, Cham, pp. 33–71. Bernard, G.C., Egnin, M. and Bonsi, C. (2017), ‘The Impact of Plant-Parasitic Nematodes on Agriculture and Methods of Control’, Nematology - Concepts, Diagnosis and Control Bhalla, P.L., Swoboda, I. and Singh, M.B. (1999), ‘Antisense-mediated silencing of a gene encoding a major ryegrass pollen allergen’, Proceedings of the National Academy of Sciences, Vol. 96 No. 20, pp. 11676–11680. Bird, A.F. and Bird, J. (1991), ‘The Exoskeleton’, The Structure of Nematodes, Elsevier, pp. 44–74. Blaxter, M. and Koutsovoulos, G. (2015), ‘The evolution of parasitism in Nematoda’, Parasitology, Vol. 142 No. S1, pp. S26–S39. Bohlmann, H. and Sobczak, M. (2014), ‘The plant cell wall in the feeding sites of cyst nematodes’, Frontiers in Plant Science, Vol. 5

42 Chapter 1: General Introduction

Broderick, S.R. and Jones, M.L. (2014), ‘An Optimized Protocol to Increase Virus-Induced Gene Silencing Efficiency and Minimize Viral Symptoms in Petunia’, Plant Molecular Biology Reporter, Vol. 32 No. 1, pp. 219–233. Brownlee, D.J.A., Fairweather, I., Holden-Dye, L. and Walker, R.J. (1996), ‘Nematode neuropeptides: Localization, isolation and functions’, Parasitology Today. Buntschuh, I., Raps, D.A., Joseph, I., Reid, C., Chait, A., Totanes, R., Sawh, M., et al. (2018), ‘FLP-1 neuropeptides modulate sensory and motor circuits in the nematode Caenorhabditis elegans’, edited by Hart, A.C.PLOS ONE, Vol. 13 No. 1, p. e0189320. Byrne, J.T., Maher, N.J. and Jones, P.W. (2001), ‘Comparative responses of Globodera rostochiensis and G. pallida to hatching chemicals’, Journal of Nematology, Vol. 33 No. 4, pp. 195–202. Calixto, A., Chelur, D., Topalidou, I., Chen, X. and Chalfie, M. (2010), ‘Enhanced neuronal RNAi in C. elegans using SID-1’, Nature Methods, Vol. 7 No. 7, pp. 554–559. Castagnone-Sereno, P. (2002), ‘Genetic variability in parthenogenetic root-knot nematodes, Meloidogyne spp., and their ability to overcome plant resistance genes’, Nematology, Vol. 4 No. 5, pp. 605–608. Castagnone-Sereno, P., Danchin, E.G.J., Perfus-Barbeoch, L. and Abad, P. (2013), ‘Diversity and Evolution of Root-Knot Nematodes, Genus Meloidogyne : New Insights from the Genomic Era’, Annual Review of Phytopathology, Vol. 51 No. 1, pp. 203–220. Castillo, P., Vovlas, N., Azpilicueta, A., Landa, B.B. and Jiménez-Díaz, R.M. (2007), ‘Host- Parasite Relationships in Fall-Sown Sugar Beets Infected by the Stem and Bulb Nematode, Ditylenchus dipsaci’, Plant Disease, Vol. 91 No. 1, pp. 71–79. Chen, C.-C.G., Simard, M.J., Tabara, H., Brownell, D.R., McCollough, J.A. and Mello, C.C. (2005), ‘A Member of the Polymerase β Nucleotidyltransferase Superfamily Is Required for RNA Interference in C. elegans’, Current Biology, Vol. 15 No. 4, pp. 378– 383. Chitwood, D.J. (2003), ‘Nematicides’, Encyclopedia of Agrochemicals Cotton, J.A., Lilley, C.J., Jones, L.M., Kikuchi, T., Reid, A.J., Thorpe, P., Tsai, I.J., et al. (2014), ‘The genome and life-stage specific transcriptomes of Globodera pallida elucidate key aspects of plant parasitism by a cyst nematode’, Genome Biology, Vol. 15 No. 3, p. R43. Cox, D.E., Dyer, S., Weir, R., Cheseto, X., Sturrock, M., Coyne, D., Torto, B., et al. (2019), ‘ABC transporter genes ABC-C6 and ABC-G33 alter plant-microbe-parasite interactions in the rhizosphere’, Scientific Reports, Vol. 9 No. 1, p. 19899.

43 Chapter 1: General Introduction

Coyne, D.L., Cortada, L., Dalzell, J.J., Claudius-Cole, A.O., Haukeland, S., Luambano, N. and Talwana, H. (2018), ‘Plant-parasitic nematodes and food security in Sub-Saharan Africa’, Annual Review of Phytopathology Crompton, D.W.T. (1999), ‘How Much Human Helminthiasis Is There in the World?’, The Journal of Parasitology, Vol. 85 No. 3, p. 397. Cross, J.H. (1996), Enteric Nematodes of Humans, Medical Microbiology. Cuppen, E., Gort, E., Hazendonk, E., Mudde, J., van de Belt, J., Nijman, I.J., Guryev, V., et al. (2007), ‘Efficient target-selected mutagenesis in Caenorhabditis elegans: Toward a knockout for every gene’, Genome Research, Vol. 17 No. 5, pp. 649–658. Dropkin, V.H. (1969), ‘Cellular Responses of Plants to Nematode Infections’, Annual Review of Phytopathology, Vol. 7 No. 1, pp. 101–122. Dubreuil, G., Magliano, M., Dubrana, M.P., Lozano, J., Lecomte, P., Favery, B., Abad, P., et al. (2009), ‘Tobacco rattle virus mediates gene silencing in a plant parasitic root-knot nematode’, Journal of Experimental Botany, Vol. 60 No. 14, pp. 4041–4050. Duret, L., Guex, N., Peitsch, M.C. and Bairoch, A. (1998), ‘New Insulin-Like Proteins with Atypical Disulfide Bond Pattern Characterized in Caenorhabditis elegans by Comparative Sequence Analysis and Homology Modeling’, Genome Research, Vol. 8 No. 4, pp. 348–353. Dutta, T.K., Papolu, P.K., Banakar, P., Choudhary, D., Sirohi, A. and Rao, U. (2015), ‘Tomato transgenic plants expressing hairpin construct of a nematode protease gene conferred enhanced resistance to root-knot nematodes’, Frontiers in Microbiology, Vol. 6 Dyer, S., Weir, R., Cox, D., Cheseto, X., Torto, B. and Dalzell, J.J. (2019), ‘Ethylene Response Factor (ERF) genes modulate plant root exudate composition and the attraction of plant parasitic nematodes’, International Journal for Parasitology Van Eck, L., Schultz, T., Leach, J.E., Scofield, S.R., Peairs, F.B., Botha, A.-M. and Lapitan, N.L.V. (2010), ‘Virus-induced gene silencing of WRKY53 and an inducible phenylalanine ammonia-lyase in wheat reduces aphid resistance’, Plant Biotechnology Journal, Vol. 8 No. 9, pp. 1023–1032. Edison, A.S., Espinoza, E., Carrigan, M., Thomas, S.G. and Shaw, G. (2000), ‘A Statistical View of FMRFamide Neuropeptide Diversity’, Molecular Neurobiology, Vol. 21 No. 1–2, pp. 035–056. Eipper, B.A., Staffers, D.A. and Mains, R.E. (1992), ‘The biosynthesis of neuropeptides: Peptide α-amidation’, Annual Review of Neuroscience Evans, K. and Stone, A.R. (1977), ‘A Review of the Distribution and Biology of the Potato

44 Chapter 1: General Introduction

Cyst-Nematodes Globodera rostochiensis and G. pallida’, PANS, Vol. 23 No. 2, pp. 178–189. Fairbairn, D.J., Cavallaro, A.S., Bernard, M., Mahalinga-Iyer, J., Graham, M.W. and Botella, J.R. (2007), ‘Host-delivered RNAi: an effective strategy to silence genes in plant parasitic nematodes’, Planta, Vol. 226 No. 6, pp. 1525–1533. Fanelli, E., Di Vito, M., Jones, J.T. and De Giorgi, C. (2005), ‘Analysis of chitin synthase function in a plant parasitic nematode, Meloidogyne artiellia, using RNAi’, Gene, Vol. 349, pp. 87–95. FAO. (2009), ‘News Article: 2050: A third more mouths to feed’, Food and Agriculture Organization of the United Nations. Feinberg, E.H. (2003), ‘Transport of dsRNA into Cells by the Transmembrane Protein SID-1’, Science, Vol. 301 No. 5639, pp. 1545–1547. Fernandez-Pozo, N., Rosli, H.G., Martin, G.B. and Mueller, L.A. (2015), ‘The SGN VIGS Tool: User-Friendly Software to Design Virus-Induced Gene Silencing (VIGS) Constructs for Functional Genomics’, Molecular Plant, Vol. 8 No. 3, pp. 486–488. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E. and Mello, C.C. (1998), ‘Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans’, Nature, Vol. 391 No. 6669, pp. 806–811. Foxe, M.J. (1992), ‘Breeding for viral resistance: conventional methods’, Netherlands Journal of Plant Pathology, Vol. 98 No. S2, pp. 13–20. Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000), ‘Functional genomic analysis of C. elegans chromosome I by systematic RNA interference’, Nature, Vol. 408 No. 6810, pp. 325–330. Fricker, L.D. (2018), ‘Carboxypeptidase E and the Identification of Novel Neuropeptides as Potential Therapeutic Targets’, Advances in Pharmacology Gahoi, S. and Gautam, B. (2016), ‘Identification and analysis of insulin like peptides in nematode secretomes provide targets for parasite control’, Bioinformation, Vol. 12 No. 12, pp. 412–415. Geerts, S. and Gryseels, B. (2001), ‘Anthelmintic resistance in human helminths: a review’, Tropical Medicine and International Health, Vol. 6 No. 11, pp. 915–921. Grewal, P.S., Grewal, S.K., Tan, L. and Adams, B.J. (2003), ‘Parasitism of molluscs by nematodes: Types of associations and evolutionary trends’, Journal of Nematology, pp. 146–156. De Haes, W., Van Sinay, E., Detienne, G., Temmerman, L., Schoofs, L. and Boonen, K.

45 Chapter 1: General Introduction

(2015), ‘Functional neuropeptidomics in invertebrates’, Biochimica et Biophysica Acta - Proteins and Proteomics Halford, N.G. (2019), ‘Legislation governing genetically modified and genome-edited crops in Europe: the need for change’, Journal of the Science of Food and Agriculture, Vol. 99 No. 1, pp. 8–12. Hamilton, A.J. (1999), ‘A Species of Small Antisense RNA in Posttranscriptional Gene Silencing in Plants’, Science, Vol. 286 No. 5441, pp. 950–952. Hardy, S., Legagneux, V., Audic, Y. and Paillard, L. (2010), ‘Reverse genetics in eukaryotes’, Biology of the Cell, Vol. 102 No. 10, pp. 561–580. Hewezi, T. (2015), ‘Cellular Signaling Pathways and Posttranslational Modifications Mediated by Nematode Effector Proteins’, Plant Physiology, Vol. 169 No. 2, pp. 1018– 1026. Hinas, A., Wright, A.J. and Hunter, C.P. (2012), ‘SID-5 Is an Endosome-Associated Protein Required for Efficient Systemic RNAi in C. elegans’, Current Biology, Vol. 22 No. 20, pp. 1938–1943. Hobert, O. (2005), ‘Specification of the nervous system’, WormBook Höck, J. and Meister, G. (2008), ‘The Argonaute protein family’, Genome Biology, Vol. 9 No. 2, p. 210. Hook, V., Lietz, C.B., Podvin, S., Cajka, T. and Fiehn, O. (2018), ‘Diversity of Neuropeptide Cell-Cell Signaling Molecules Generated by Proteolytic Processing Revealed by Neuropeptidomics Mass Spectrometry’, Journal of the American Society for Mass Spectrometry Hotez, P.J., Brindley, P.J., Bethony, J.M., King, C.H., Pearce, E.J. and Jacobson, J. (2008), ‘Helminth infections: the great neglected tropical diseases’, Journal of Clinical Investigation, Vol. 118 No. 4, pp. 1311–1321. Hugot, J.P., Baujard, P. and Morand, S. (2001), ‘Biodiversity in helminths and nematodes as a field of study: An overview’, Nematology Husson, S.J., Clynen, E., Baggerman, G., Janssen, T. and Schoofs, L. (2006), ‘Defective processing of neuropeptide precursors in Caenorhabditis elegans lacking proprotein convertase 2 (KPC-2/EGL-3): mutant analysis by mass spectrometry’, Journal of Neurochemistry, Vol. 98 No. 6, pp. 1999–2012. Husson, S.J., Clynen, E., Baggerman, G., De Loof, A. and Schoofs, L. (2005), ‘Discovering neuropeptides in Caenorhabditis elegans by two dimensional liquid chromatography and mass spectrometry’, Biochemical and Biophysical Research Communications, Vol.

46 Chapter 1: General Introduction

335 No. 1, pp. 76–86. Hutvagner, G. (2005), ‘Small RNA asymmetry in RNAi: Function in RISC assembly and gene regulation’, FEBS Letters, Vol. 579 No. 26, pp. 5850–5857. Jarecki, J.L., Andersen, K., Konop, C.J., Knickelbine, J.J., Vestling, M.M. and Stretton, A.O. (2010), ‘Mapping Neuropeptide Expression by Mass Spectrometry in Single Dissected Identified Neurons from the Dorsal Ganglion of the Nematode Ascaris suum’, ACS Chemical Neuroscience, Vol. 1 No. 7, pp. 505–519. Johnston, M.J.G., McVeigh, P., McMaster, S., Fleming, C.C. and Maule, A.G. (2010), ‘FMRFamide-like peptides in root knot nematodes and their potential role in nematode physiology’, Journal of Helminthology, Vol. 84 No. 3, pp. 253–265. Jones, J.T., Haegeman, A., Danchin, E.G.J., Gaur, H.S., Helder, J., Jones, M.G.K., Kikuchi, T., et al. (2013), ‘Top 10 plant-parasitic nematodes in molecular plant pathology’, Molecular Plant Pathology, Vol. 14 No. 9, pp. 946–961. Jones, M.G.K. and Fosu-Nyarko, J. (2014), ‘Molecular biology of root lesion nematodes ( Pratylenchus spp.) and their interaction with host plants’, Annals of Applied Biology, Vol. 164 No. 2, pp. 163–181. Jones, M.G.K. and Northcote, D.H. (1972), ‘Nematode-induced syncytium-A multinucleate transfer cell’, Journal of Cell Science. Kamath, R. (2003), ‘Genome-wide RNAi screening in Caenorhabditis elegans’, Methods, Vol. 30 No. 4, pp. 313–321. Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., et al. (2003), ‘Systematic functional analysis of the Caenorhabditis elegans genome using RNAi’, Nature, Vol. 421 No. 6920, pp. 231–237. Kandoth, P.K., Heinz, R., Yeckel, G., Gross, N.W., Juvale, P.S., Hill, J., Whitham, S.A., et al. (2013), ‘A virus-induced gene silencing method to study soybean cyst nematode parasitism in Glycine max’, BMC Research Notes, Vol. 6 No. 1, p. 255. Keating, C.D., Holden-Dye, L., Thorndyke, M.C., Williams, R.G., Mallett, A. and Walker, R.J. (1995), ‘The FMRFamide-like neuropeptide AF2 is present in the parasitic nematode Haemonchus contortus’, Parasitology, Vol. 111 No. 4, pp. 515–521. Kim, K. and Li, C. (2004), ‘Expression and regulation of an FMRFamide-related neuropeptide gene family inCaenorhabditis elegans’, The Journal of Comparative Neurology, Vol. 475 No. 4, pp. 540–550. Kimber, M.J., Fleming, C.C., Prior, A., Jones, J.T., Halton, D.W. and Maule, A.G. (2002), ‘Localisation of Globodera pallida FMRFamide-related peptide encoding genes using

47 Chapter 1: General Introduction

in situ hybridisation’, International Journal for Parasitology, Vol. 32 No. 9, pp. 1095– 1105. Kimber, M.J., McKinney, S., McMaster, S., Day, T.A., Fleming, C.C. and Maule, A.G. (2007), ‘flp gene disruption in a parasitic nematode reveals motor dysfunction and unusual neuronal sensitivity to RNA interference’, The FASEB Journal, Vol. 21 No. 4, pp. 1233– 1243. Klink, V.P., Kim, K.-H., Martins, V., MacDonald, M.H., Beard, H.S., Alkharouf, N.W., Lee, S.- K., et al. (2009), ‘A correlation between host-mediated expression of parasite genes as tandem inverted repeats and abrogation of development of female Heterodera glycines cyst formation during infection of Glycine max’, Planta, Vol. 230 No. 1, pp. 53–71. Kutscher, L.M. (2014), ‘Forward and reverse mutagenesis in C. elegans’, WormBook, pp. 1– 26. Lambert, K. and Bekal, S. (2002), ‘Introduction to Plant-Parasitic Nematodes’, The Plant Health Instructor Lambshead, P.J.D. (1993), ‘Recent developments in marine benthic biodiversity research’, Oceanis. Lee, H., Choi, M., Lee, D., Kim, H., Hwang, H., Kim, H., Park, S., et al. (2012), ‘Nictation, a dispersal behavior of the nematode Caenorhabditis elegans, is regulated by IL2 neurons’, Nature Neuroscience, Vol. 15 No. 1, pp. 107–112. Levin, J.Z., De Framond, A.J., Tuttle, A., Bauer, M.W. and Heifetz, P.B. (2000), ‘Methods of double-stranded RNA-mediated gene inactivation in arabidopsis and their use to define an essential gene in methionine biosynthesis’, Plant Molecular Biology, Vol. 44 No. 6, pp. 759–775. Li, C. (1999), ‘Chapter 3.3.7 Analyzing neuropeptide function in Caenorhabditis elegans by reverse genetics’, Techniques in the Behavioral and Neural Sciences, pp. 585–601. Li, C. (2008), ‘Neuropeptides’, WormBook, No. 212, pp. 1–36. Li, C. and Kim, K. (2014a), ‘Family of FLP Peptides in Caenorhabditis elegans and Related Nematodes’, Frontiers in Endocrinology, Vol. 5 Li, C. and Kim, K. (2014b), ‘Family of FLP peptides in Caenorhabditis elegans and related nematodes’, Frontiers in Endocrinology Li, J., Todd, T.C. and Trick, H.N. (2010), ‘Rapid in planta evaluation of root expressed transgenes in chimeric soybean plants’, Plant Cell Reports, Vol. 29 No. 2, pp. 113–123. Li, Y., Wang, K., Lu, Q., Du, J., Wang, Z., Wang, D., Sun, B., et al. (2017), ‘Transgenic

48 Chapter 1: General Introduction

Nicotiana benthamiana plants expressing a hairpin RNAi construct of a nematode Rs- cps gene exhibit enhanced resistance to Radopholus similis’, Scientific Reports, Vol. 7 No. 1, p. 13126. Linit, M.J. (1988), ‘Nematode-vector relationships in the pine wilt disease system’, Journal of Nematology, Vol. 20 No. 2, pp. 227–235. Liu, N., Xie, K., Jia, Q., Zhao, J., Chen, T., Li, H., Wei, X., et al. (2016), ‘Foxtail Mosaic Virus - Induced Gene Silencing in Monocot Plants’, Plant Physiology, Vol. 171 No. 3, pp. 1801–1807. Liu, W., Jones, A.L., Gosse, H.N., Lawrence, K.S. and Park, S.-W. (2019), ‘Validation of the Chemotaxis of Plant Parasitic Nematodes Toward Host Root Exudates’, Journal of Nematology, Vol. 51, pp. 1–10. Liu, Y., Schiff, M. and Dinesh-Kumar, S.P. (2002), ‘Virus-induced gene silencing in tomato’, The Plant Journal, Vol. 31 No. 6, pp. 777–786. Majumdar, R., Rajasekaran, K. and Cary, J.W. (2017), ‘RNA Interference (RNAi) as a Potential Tool for Control of Mycotoxin Contamination in Crop Plants: Concepts and Considerations’, Frontiers in Plant Science, Vol. 8 Manmathan, H., Shaner, D., Snelling, J., Tisserat, N. and Lapitan, N. (2013), ‘Virus-induced gene silencing of Arabidopsis thaliana gene homologues in wheat identifies genes conferring improved drought tolerance’, Journal of Experimental Botany, Vol. 64 No. 5, pp. 1381–1392. Marin, D.H., Sutton, T.B. and Barker, K.R. (1998), ‘Dissemination of bananas in Latin America and the Caribbean and its relationship to the occurrence of Radopholus similis’, Plant Disease Maxwell, S. (1996), ‘Food security: a post-modern perspective’, Food Policy, Vol. 21 No. 2, pp. 155–170. Mayo, P.S. and Bergeson, G.B. (1970), ‘The Role of Secondary Invaders in Meloidogyne incognita Infection.’, Journal of Nematology, Vol. 2 No. 1, pp. 80–83. McCoy, C.J., Warnock, N.D., Atkinson, L.E., Atcheson, E., Martin, R.J., Robertson, A.P., Maule, A.G., et al. (2015), ‘RNA interference in adult Ascaris suum – an opportunity for the development of a functional genomics platform that supports organism-, tissue- and cell-based biology in a nematode parasite’, International Journal for Parasitology, Vol. 45 No. 11, pp. 673–678. McSorley, R., Wang, K.H., Rosskopf, E.N., Kokalis-Burelle, N., Petersen, H.N.H., Gill, H.K. and Krueger, R. (2009), ‘Nonfumigant alternatives to methyl bromide for management of

49 Chapter 1: General Introduction

nematodes, soil-borne disease, and weeds in production of snapdragon (Antirrhinum majus)’, International Journal of Pest Management, McVeigh, P., Alexander-Bowman, S., Veal, E., Mousley, A., Marks, N.J. and Maule, A.G. (2008), ‘Neuropeptide-like protein diversity in phylum Nematoda’, International Journal for Parasitology, Vol. 38 No. 13, pp. 1493–1503. McVeigh, P., Leech, S., Mair, G.R., Marks, N.J., Geary, T.G. and Maule, A.G. (2005), ‘Analysis of FMRFamide-like peptide (FLP) diversity in phylum Nematoda’, International Journal for Parasitology, Vol. 35 No. 10, pp. 1043–1060. Milligan, S.B., Bodeau, J., Yaghoobi, J., Kaloshian, I., Zabel, P. and Williamson, V.M. (1998), ‘The Root Knot Nematode Resistance Gene Mi from Tomato Is a Member of the Leucine Zipper, Nucleotide Binding, Leucine-Rich Repeat Family of Plant Genes’, The Plant Cell, Vol. 10 No. 8, pp. 1307–1319. Mohan, C., Jayanarayanan, A.N. and Narayanan, S. (2017), ‘Construction of a novel synthetic root-specific promoter and its characterization in transgenic tobacco plants’, 3 Biotech, Vol. 7 No. 4, p. 234. Mol, J.N.M., van der Krol, A.R., van Tunen, A.J., van Blokland, R., de Lange, P. and Stuitje, A.R. (1990), ‘Regulation of plant gene expression by antisense RNA’, FEBS Letters, Vol. 268 No. 2, pp. 427–430. Moresco, E.M.Y., Li, X. and Beutler, B. (2013), ‘Going Forward with Genetics’, The American Journal of Pathology, Vol. 182 No. 5, pp. 1462–1473. Morris, R., Wilson, L., Sturrock, M., Warnock, N.D., Carrizo, D., Cox, D., Maule, A.G., et al. (2017), ‘A neuropeptide modulates sensory perception in the entomopathogenic nematode Steinernema carpocapsae’.PLOS Pathogens, Vol. 13 No. 3, p. e1006185. Mouttet, R., Escobar-Gutiérrez, A., Esquibet, M., Gentzbittel, L., Mugniéry, D., Reignault, P., Sarniguet, C., et al. (2014), ‘Banning of methyl bromide for seed treatment: could Ditylenchus dipsaci again become a major threat to alfalfa production in Europe?’, Pest Management Science, Vol. 70 No. 7, pp. 1017–1022. Murphy, C.T. (2013), ‘Insulin/insulin-like growth factor signaling in C. elegans’, WormBook, pp. 1–43. Nanda, J.C. and Stretton, A.O.W. (2010), ‘In situ hybridization of neuropeptide-encoding transcripts afp-1, afp-3, and afp-4 in neurons of the nematode Ascaris suum’, The Journal of Comparative Neurology, Vol. 518 No. 6, pp. 896–910. Napoli, C., Lemieux, C. and Jorgensen, R. (1990), ‘Introduction of a Chimeric Chalcone Synthase Gene into Petunia Results in Reversible Co-Suppression of Homologous

50 Chapter 1: General Introduction

Genes in trans’, The Plant Cell, Vol. 2 No. 4, p. 279. Nathoo, A.N., Moeller, R.A., Westlund, B.A. and Hart, A.C. (2001a), ‘Identification of neuropeptide-like protein gene families in Caenorhabditis elegans and other species’, Proceedings of the National Academy of Sciences, Vol. 98 No. 24, pp. 14000–14005. Nathoo, A.N., Moeller, R.A., Westlund, B.A. and Hart, A.C. (2001b), ‘Identification of neuropeptide-like protein gene families in Caenorhabditis elegans and other species’, Proceedings of the National Academy of Sciences, Vol. 98 No. 24, pp. 14000–14005. Nathoo, A.N., Moeller, R.A., Westlund, B.A. and Hart, A.C. (2001c), ‘Identification of neuropeptide-like protein gene families in Caenorhabditis elegans and other species’, Proceedings of the National Academy of Sciences, Vol. 98 No. 24, pp. 14000–14005. Nelson, L.S., Kim, K., Memmott, J.E. and Li, C. (1998), ‘FMRFamide-related gene family in the nematode, Caenorhabditis elegans’, Molecular Brain Research Nickle, W.R., Golden, A.M., Mamiya, Y. and Wergin, W.P. (1981), ‘On the Taxonomy and Morphology of the Pine Wood Nematode, Bursaphelenchus xylophilus (Steiner &Buhrer 1934) Nickle 1970.’, Journal of Nematology, Vol. 13 No. 3, pp. 385–92. O’Bannon, J.H. (1977), ‘Worldwide dissemination of Radopholus similis and its importance in crop production.’, Journal of Nematology. Obbard, D.J., Gordon, K.H.J., Buck, A.H. and Jiggins, F.M. (2009), ‘The evolution of RNAi as a defence against viruses and transposable elements’, Philosophical Transactions of the Royal Society B: Biological Sciences, Vol. 364 No. 1513, pp. 99–115. Ochola, J., Cortada, L., Ng’ang’a, M., Hassanali, A., Coyne, D. and Torto, B. (2020), ‘Mediation of Potato–Potato Cyst Nematode, G. rostochiensis Interaction by Specific Root Exudate Compounds’, Frontiers in Plant Science Page, A. (2007), ‘The cuticle’, WormBook Pak, J. and Fire, A. (2007), ‘Distinct Populations of Primary and Secondary Effectors During RNAi in C. elegans’, Science, Vol. 315 No. 5809, pp. 241–244. Palomares-Rius, J.E., Escobar, C., Cabrera, J., Vovlas, A. and Castillo, P. (2017), ‘Anatomical Alterations in Plant Tissues Induced by Plant-Parasitic Nematodes’, Frontiers in Plant Science, Vol. 8 Papolu, P.K., Gantasala, N.P., Kamaraju, D., Banakar, P., Sreevathsa, R. and Rao, U. (2013), ‘Utility of Host Delivered RNAi of Two FMRF Amide Like Peptides, flp-14 and flp-18, for the Management of Root Knot Nematode, Meloidogyne incognita’, edited by Davis, K.R.PLoS ONE, Vol. 8 No. 11, p. e80603. Pattison, A.B., Stanton, J.M., Cobon, J.A. and Doogan, V.J. (2002), ‘Population dynamics and

51 Chapter 1: General Introduction

economic threshold of the nematodes Radopholus similis and pratylenchus goodeyi on banana in Australia’, International Journal of Pest Management Paulson, R.E. and Webster, J.M. (1970), ‘ Giant cell formation in tomato roots caused by Meloidogyne incognita and Meloidogyne hapla (Nematoda) infection. A light and electron microscope study ’, Canadian Journal of Botany Perry, R.N. (1996), ‘Chemoreception in plant parasitic nematodes’, Annual Review of Phytopathology Perry, R.N. and Wesemael, W.M.L. (2008), ‘Host plant effects on hatching of root-knot nematodes’, Russian Journal of Nematology, Vol. 16, pp. 1–5. Philipp, M., Parkhouse, R.M.E. and Ogilvie, B.M. (1980), ‘Changing proteins on the surface of a parasitic nematode’, Nature, Vol. 287 No. 5782, pp. 538–540. Ploetz, R.C., Thomas, J.E. and Slabaugh, W.R. (2009), ‘Diseases of banana and plantain.’, Diseases of Tropical Fruit Crops Prado, J.R., Segers, G., Voelker, T., Carson, D., Dobert, R., Phillips, J., Cook, K., et al. (2014), ‘Genetically Engineered Crops: From Idea to Product’, Annual Review of Plant Biology, Vol. 65 No. 1, pp. 769–790. Pratt, A.J. and MacRae, I.J. (2009), ‘The RNA-induced Silencing Complex: A Versatile Gene- silencing Machine’, Journal of Biological Chemistry, Vol. 284 No. 27, pp. 17897–17901. Quist, C.W., Smant, G. and Helder, J. (2015), ‘Evolution of Plant Parasitism in the Phylum Nematoda’, Annual Review of Phytopathology, Vol. 53 No. 1, pp. 289–310. Ramegowda, V., Mysore, K.S. and Senthil-Kumar, M. (2014), ‘Virus-induced gene silencing is a versatile tool for unraveling the functional relevance of multiple abiotic-stress- responsive genes in crop plants’, Frontiers in Plant Science, Vol. 5 Ratcliff, F., Martin-Hernandez, A.M. and Baulcombe, D.C. (2001), ‘Technical Advance. Tobacco rattle virus as a vector for analysis of gene function by silencing.’, The Plant Journal : For Cell and Molecular Biology, Vol. 25 No. 2, pp. 237–245. Roberts, L.S. and Janovy, J. (2009), Gerald D. Schmidt and Larry S Roberts Foundations of Parasitology, 8ed, The American Journal of Tropical Medicine and Hygiene. Robertson, D. (2004), 'VIGS Vectors for Gene Silencing: Many Targets, Many Tools’, Annual Review of Plant Biology, Vol. 55 No. 1, pp. 495–519. Robertson, L., García-Álvarez, A., Arcos, S.C., Díez-Rojo, M.A., Mansilla, J.P., Sanz, R., Martínez, C., et al. (2008), ‘Potential Insect Vectors of Bursaphelenchus spp. (Nematoda: Parasitaphelenchidae) in Spanish Pine Forests’, Pine Wilt Disease: A Worldwide Threat to Forest Ecosystems, Springer Netherlands, Dordrecht, pp. 221–

52 Chapter 1: General Introduction

234. Robinson, A.F., Inserra, R.N., Caswell-Chen, E.P., Vovlas, N. and Troccoli, A. (1997), ‘Rotylenchulus species: Identification, distribution, host ranges, and crop plant resistance’, Nematropica. Romano, N. and Macino, G. (1992), ‘Quelling: transient inactivation of gene expression in Neurospora crassa by transformation with homologous sequences’, Molecular Microbiology, Vol. 6 No. 22, pp. 3343–3353. Rosegrant, M.W. and Cline, S.A. (2003), ‘Global food security: challenges and policies.’, Science (New York, N.Y.), Vol. 302 No. 5652, pp. 1917–9. Ruiz, M.T., Voinnet, O. and Baulcombe, D.C. (1998), ‘Initiation and Maintenance of Virus- Induced Gene Silencing’, The Plant Cell, Vol. 10 No. 6, pp. 937–946. Sadiq, M., Hilderbrandt, M., Maniak, M. and Nellen, W. (1994), ‘Developmental Regulation of Antisense-Mediated Gene Silencing in Dictyostelium’, Antisense Research and Development, Vol. 4 No. 4, pp. 263–267. Sainsbury, F., Benchabane, M., Goulet, M.-C. and Michaud, D. (2012), ‘Multimodal Protein Constructs for Herbivore Insect Control’, Toxins, Vol. 4 No. 6, pp. 455–475. Sargison, N.D. (2012), ‘Pharmaceutical treatments of gastrointestinal nematode infections of sheep—Future of anthelmintic drugs’, Veterinary Parasitology, Vol. 189 No. 1, pp. 79–84. Senthil-Kumar, M., Govind, G., Kang, L., Mysore, K.S. and Udayakumar, M. (2007), ‘Functional characterization of Nicotiana benthamiana homologs of peanut water deficit-induced genes by virus-induced gene silencing’, Planta, Vol. 225 No. 3, pp. 523–539. Senthil-Kumar, M. and Mysore, K.S. (2011), ‘Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato’, Plant Biotechnology Journal, Vol. 9 No. 7, pp. 797–806. Shabalina, S. and Koonin, E. (2008), ‘Origins and evolution of eukaryotic RNA interference’, Trends in Ecology & Evolution, Vol. 23 No. 10, pp. 578–587. Shalaby, H.A. (2013), ‘Anthelmintics resistance; how to overcome it?’, Iranian Journal of Parasitology, Vol. 8 No. 1, pp. 18–32. Simmer, F., Moorman, C., Van Der Linden, A.M., Kuijk, E., Van Den Berghe, P.V.E., Kamath, R.S., Fraser, A.G., et al. (2003), ‘Genome-wide RNAi of C. elegans using the hypersensitive rrf-3 strain reveals novel gene functions’, PLoS Biology Singh, K.P. and Khanna, A.S. (2017), ‘Morphological and morphometrical characterization of

53 Chapter 1: General Introduction

Meloidogyne incognita from different hosts’, Journal of Hill Agriculture, Vol. 8 No. 2, p. 200. Smardon, A., Spoerke, J.M., Stacey, S.C., Klein, M.E., Mackin, N. and Maine, E.M. (2000), ‘EGO-1 is related to RNA-directed RNA polymerase and functions in germ-line development and RNA interference in C. elegans’, Current Biology, Vol. 10 No. 4, pp. 169–178. Smiley, R.W. (2015), ‘Root-lesion nematodes: Biology and management in Pacific Northwest wheat cropping systems’, A Pacific Northwest Extension Publication. Smith, N.A., Singh, S.P., Wang, M.-B., Stoutjesdijk, P.A., Green, A.G. and Waterhouse, P.M. (2000), ‘Total silencing by intron-spliced hairpin RNAs’, Nature, Vol. 407 No. 6802, pp. 319–320. Song, M.-S. and Rossi, J.J. (2017), ‘Molecular mechanisms of Dicer: endonuclease and enzymatic activity’, Biochemical Journal, Vol. 474 No. 10, pp. 1603–1618. Sowa, J.N., Jiang, H., Somasundaram, L., Tecle, E., Xu, G., Wang, D. and Troemel, E.R. (2019), ‘The Caenorhabditis elegans RIG-I Homolog DRH-1 Mediates the Intracellular Pathogen Response upon Viral Infection’, edited by Pfeiffer, J.K.Journal of Virology, Vol. 94 No. 2 Stretton, A.O.W., Fishpool, R.M., Southgate, E., Donmoyer, J.E., Walrond, J.P., Moses, J.E. and Kass, I.S. (1978), ‘Structure and physiological activity of the motoneurons of the nematode Ascaris.’, Proceedings of the National Academy of Sciences, Vol. 75 No. 7, pp. 3493–3497. Subbotin, S.A., Madani, M., Krall, E., Sturhan, D. and Moens, M. (2005), ‘Molecular diagnostics, taxonomy, and phylogeny of the stem nematode Ditylenchus dipsaci species complex based on the sequences of the internal transcribed spacer-rDNA’, Phytopathology Tabara, H., Sarkissian, M., Kelly, W.G., Fleenor, J., Grishok, A., Timmons, L., Fire, A., et al. (1999), ‘The rde-1 Gene, RNA Interference, and Transposon Silencing in C. elegans’, Cell, Vol. 99 No. 2, pp. 123–132. Tabara, H., Yigit, E., Siomi, H. and Mello, C.C. (2002), ‘The dsRNA Binding Protein RDE-4 Interacts with RDE-1, DCR-1, and a DExH-Box Helicase to Direct RNAi in C. elegans’, Cell, Vol. 109 No. 7, pp. 861–871. Tanaka, S.E., Dayi, M., Maeda, Y., Tsai, I.J., Tanaka, R., Bligh, M., Takeuchi-Kaneko, Y., et al. (2019), ‘Stage-specific transcriptome of Bursaphelenchus xylophilus reveals temporal regulation of effector genes and roles of the dauer-like stages in the lifecycle’,

54 Chapter 1: General Introduction

Scientific Reports Telford, M.J., Bourlat, S.J., Economou, A., Papillon, D. and Rota-Stabelli, O. (2009), ‘The origins and evolution of the Ecdysozoa’, Animal Evolution: Genomes, Fossils, and Trees Tierney, M.B. and Lamour, K.H. (2005), ‘An Introduction to Reverse Genetic Tools for Investigating Gene Function.’, The Plant Health Instructor, Trudgill, D.L. and Blok, V.C. (2001), ‘Apomictic , Polyphagous Root-Knot Nematodes : Exceptionally Successful and Damaging Biotrophic Root Pathogens’, Annual Review of Phytopathology, Vol. 39 No. 1, pp. 53–77. Trudgill, D.L., Elliott, M.J., Evans, K. and Phillips, M.S. (2003), ‘The white potato cyst nematode (Globodera pallida) - A critical analysis of the threat in Britain’, Annals of Applied Biology Turnage, M.A., Muangsan, N., Peele, C.G. and Robertson, D. (2002), ‘Geminivirus-based vectors for gene silencing in Arabidopsis’, The Plant Journal, Vol. 30 No. 1, pp. 107– 114. United Nations. (2015), ‘Transforming our world: the 2030 Agenda for Sustainable Development. United Nations Sustainable knowledge platform’, Sustainable Development Goals United Nations Organisation. (2008), ‘The Millennium Development Goals Report’, United Nations. Vaucheret, H., Béclin, C. and Fagard, M. (2001), ‘Post-transcriptional gene silencing in plants’, Journal of Cell Science. Veenstra, J.A. (2000), ‘Mono- and dibasic proteolytic cleavage sites in insect neuroendocrine peptide precursors.’, Archives of Insect Biochemistry and Physiology, Vol. 43 No. 2, pp. 49–63. Villate, L., Fievet, V., Hanse, B., Delemarre, F., Plantard, O., Esmenjaud, D. and van Helden, M. (2008), ‘Spatial Distribution of the Dagger Nematode Xiphinema index and Its Associated Grapevine fanleaf virus in French Vineyard’, Phytopathology, Vol. 98 No. 8, pp. 942–948. Warnock, N.D., Wilson, L., Patten, C., Fleming, C.C., Maule, A.G. and Dalzell, J.J. (2017), ‘Nematode neuropeptides as transgenic nematicides.’, edited by Mackey, D.PLoS Pathogens, Vol. 13 No. 2, p. e1006237. White, J.G., Southgate, E., Thomson, J.N. and Brenner, S. (1986), ‘The structure of the nervous system of the nematode Caenorhabditis elegans’, Philosophical Transactions of the Royal Society of London. B, Biological Sciences, Vol. 314 No. 1165, pp. 1–340.

55 Chapter 1: General Introduction

Williamson, V.M. and Gleason, C.A. (2003), ‘Plant–nematode interactions’, Current Opinion in Plant Biology, Vol. 6 No. 4, pp. 327–333. Winston, W.M., Sutherlin, M., Wright, A.J., Feinberg, E.H. and Hunter, C.P. (2007), ‘Caenorhabditis elegans SID-2 is required for environmental RNA interference’, Proceedings of the National Academy of Sciences, Vol. 104 No. 25, pp. 10565–10570. Yadav, B.C., Veluthambi, K. and Subramaniam, K. (2006), ‘Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection’, Molecular and Biochemical Parasitology, Vol. 148 No. 2, pp. 219–222. Yigit, E., Batista, P.J., Bei, Y., Pang, K.M., Chen, C.-C.G., Tolia, N.H., Joshua-Tor, L., et al. (2006), ‘Analysis of the C. elegans Argonaute Family Reveals that Distinct Argonautes Act Sequentially during RNAi’, Cell, Vol. 127 No. 4, pp. 747–757. Zhang, C. and Ruvkun, G. (2012), ‘New insights into siRNA amplification and RNAi’, RNA Biology, Vol. 9 No. 8, pp. 1045–1049. Zygmunt, D.J. (1990), ‘Strongyloides stercoralis’, Infection Control and Hospital Epidemiology, Vol. 11 No. 9, pp. 495–497.

56 Chapter 2: Transgenic Approaches

Chapter 2.

High throughput Transgenic Approaches to Plant Parasitic

Nematode Control

57

Chapter 2: Transgenic Approaches

2.1. Abstract

Transgenic approaches have long been a vital tool for studying gene function. Plant parasitic nematode research has been somewhat lacking with respect to transgenic approaches due to the inability to genetically transform these obligate parasites. In this study, transgenic Bacillus subtilis has been engineered to secrete the unamidated NLP-15b protein, which has an identical sequence in both Globodera pallida and Meloidogyne incognita. Warnock et al. (2017) provides a proof of concept study that demonstrated resistance in tomato seedlings to these species was conferred using a host invasion assay in which infective juveniles were exposed to exogenous NLP-15b in the assay media over a 24-hour period. Here we develop a

Bacillus subtilis signal peptide clone library to test the effect different signal peptides have on the efficacy of NLP-15b using the same invasion assay and

Globodera pallida juveniles. We have identified three signal peptide clones (25, 47 and 61), which confer improved resistance to tomato seedlings compared to the

Bacillus subtilis aprE signal peptide used in the proof of concept study. In addition, we also investigated the use of a novel Virus Induced Gene Silencing platform to silence nlp-15 in invading Meloidogyne incognita juveniles. The Virus induced gene silencing protocol used a topical application method to apply Agrobacterium tumefaciens cultures transformed with modified viral vectors to tomato seedlings.

Progeny of invading juveniles were tested for transcript knockdown. No target silencing was observed in this study, however further optimisation of this platform is outlined within. This study demonstrates the use of a transgenic delivery system to confer resistance to a crop plant, with the potential for large-scale field deployment.

58

Chapter 2: Transgenic Approaches

2.2. Introduction

Exploiting the peptidergic system of PPNs represents a promising control strategy.

Nematode neuropeptides are highly conserved across the phylum (McVeigh et al.,

2008) and are responsible for coordinating all aspects of nematode behaviour (Li,

2005; McVeigh et al., 2006). As such, disrupting normal function of this system will lead to dysregulation of important behaviours responsible for parasitism. Assuming the sequence conservation observed between species (Nathoo et al., 2001) translates to functional conservation, an approach which targets multiple species seems highly feasible. This is particularly important given the high incidence of co- infection observed in the field (Onkendi et al., 2014).

In the model nematode C. elegans, the major chemosensory neurons located within the head region of the worm (amphids), demonstrate the ability to uptake a fluorescent dye (Hedgecock et al., 1985). Similarly, it has been shown that

PPNs share this retrograde transport mechanism and uptake peptides from their external environment. These peptides travel along neuronal axons to the central nerve ring where they gather and can exert biological affects through interactions with nearby receptors (Wang et al., 2011; Warnock et al., 2017). The neuropeptide- like protein (NLP) complement of economically important PPNs has been described

(McVeigh et al., 2008). Many of these have been localised to the anterior neurons and although they represent the least studied of the 3 major classes of neuropeptide, they have been shown to be important for regulating feeding, development, reproduction and sensory perception. An important feature of the

NLPs is that many do not require Post Translational Modifications (PTMs) and this

59

Chapter 2: Transgenic Approaches opens the door for novel transgenic delivery approaches (Table 3.1) To explore this at a molecular level there are multiple approaches available with each having its own merits and drawbacks.

2.2.1 Transgenic Delivery of Peptides

The rhizosphere is the area of soil surrounding a plant, the composition of which is directly affected by plant root secretions and associated bacteria (Ryan et al., 2001).

Parasitic nematode behaviours such as host finding are directly affected by the chemical make-up of the rhizosphere (Liu et al., 2019). As such it is possible for researchers to manipulate this region using transgenic plants and bacterium secreting effector molecules such as peptides and enzyme inhibitors into the rhizosphere with the aim of disrupting important parasitic behaviours.

Consequently, this can allow for target specific control strategies to be applied.

This approach is much more favourable than the non-specific chemical nematicides which are damaging to the environment, harmful to human health, target beneficial species and have been subject to withdrawal legislation as a result.

One group utilised an already potent nematicide, the cholinesterase inhibitor

Aldicarb in order to affect cyst nematode invasion and infection levels. Aldicarb has been subject to withdrawal due to issues around contamination of groundwater.

However, it is a potent nematicide which does not confer toxicity to plants. Liu et al. (2005) screened synthetic combinatorial libraries to develop peptide mimetics of the already effective Aldicarb nematicide and a peptide that binds to nicotinic receptors. They utilised transgenic root systems and transgenic plants for the delivery of these peptide analogues (Liu et al., 2005). Secretion of these peptides

60

Chapter 2: Transgenic Approaches leads to retrograde transport by nematodes and subsequent chemo-disruption.

Specifically, Liu et al. demonstrated reduced root invasion of Heterodera glycines following pre-soaking in root exudates of transgenic potato expressing the peptide analogue. This study emphasises our ability to exploit PPNs unique peptide transport mechanism and influence their behaviour through specific adjustments to the rhizosphere.

Another example which employed effector molecules to control nematode behaviour involved the production of transgenic plantain. Tripathi et al. (2015) generated transgenic plantain expressing a cysteine proteinase inhibitor and a synthetic peptide that impacts root invasion to confer resistance to Radopholus similis and Helicotylenchus multicinctus (Tripathi et al., 2015). This group generated transgenic lines expressing the cystatin or synthetic peptide, or by gene stacking to allow for the synthesis of both in one transgenic line. This study successfully demonstrated resistance to these two economically important nematode species using transgenic cultivars. The above studies effectively show how transgenic expression of effector molecules can act on nematode receptors and influence important behaviours conferring resistance and offering a valuable control strategy.

61

Chapter 2: Transgenic Approaches

Table 2.1 The predicted unamidated NLP complements of Globodera pallida and Meloidogyne incognita. (Adapted from Warnock et al 2017, NLP-15b peptide highlighted in bold). Globodera pallida NLPs Meloidogyne incognita NLPs Gp-NLP-8a FSDDELAAMPLNDLYLSSPYAFGPF Mi-NLP-2 SSLASGRIGFRPA Gp-NLP-8b SFDRLEESAFFGQ Mi-NLP-8a AFDRLDVSPFDFDAMT Gp-NLP-14a ALDILESDDFGGF Mi-NLP-8b FNDDELSSLPFNFEYFPSLDTH Gp-NLP-14b ALDVMDGDGFGSFE Mi-NLP-8c AFDRLEDSGFFGL Gp-NLP-14c ALDTLEGDDFMGL Mi-NLP-8d AFDRLDNSFMLL Gp-NLP-14d LNELEGDGFMGLD Mi-NLP-9a AGARAFQRPDFDDASYEL Gp-NLP-14e ALDILDGDDFTGFS Mi-NLP-9b GGARTFLVGE Gp-NLP-14f ALDALEGNSFGF Mi-NLP-9c GGARAFAKLEE Gp-NLP-15a SFDSLTGPGFTGLDT Mi-NLP-9d GGARPFYEE Gp-NLP-15b SFDSFTGPGFTGLD Mi-NLP-9e GGARPFYGFFGGGEGTW Gp-NLP-15c SFDSFTGSGFTGLD Mi-NLP-9f GGGRYFIRPFADQ Gp-NLP-15d AAFDTDFTNYD Mi-NLP-14a ALDMLEGDDFIGMQ Gp-NLP-15e FEPFDGYGFNGFE Mi-NLP-14b ALDLMEGDGFGGGFD Gp-NLP-15f SFDSFMGPGFTGMD Mi-NLP-14c ALDMMEGDDFIGL Gp-NLP-15g AFDSFTGPGFTGMD Mi-NLP-15a AFDSFGTPGFTGFD Gp-NLP-15h AFDLFTGPGFTGMD Mi-NLP-15b SFDSFTGPGFTGLD Gp-NLP-21a GGARAFNFFAPPDE Mi-NLP-15c SFDSFVGKGFTGMD Gp-NLP-21b GGARAFNFFAPDE Mi-NLP-15d AFDSFGTPGFTGFD Gp-NLP-21c GGTRAFNFFVSDALPSSYE Mi-NLP-15e SAFDSFVGRGFTGMD Gp-NLP-21d SGIQTFRDDYDEKQAGEL Mi-NLP-15f AFDSFAGNGFTGFD Gp-NLP-21e AGGRLFRMVDLPDGDDFVPEG Mi-NLP-15g NFDAFMGPGFTGLD Gp-NLP-21f GGARPFYGGGYMDGTW Mi-NLP-15h AAFDSFVGRGFTGMD Gp-NLP-21g AGGRYFMRHFDDSPFAGWMA Mi-NLP-18a FAPRQFAFA Gp-NLP-21h GGARAFFGDADGPFNSASYWAP Mi-NLP-18b GMRNFAFA Gp-NLP-21i GGARAFNGAEETLLNVANLA Mi-NLP-18c SFGDYPFGSRTFAFA Mi-NLP-18d AAENFDENNDIN Mi-NLP-18e SSQFGGENSFARFAFA Mi-NLP-40 MVSWQPV

62

Chapter 2: Transgenic Approaches

2.2.2 Transgenic Delivery of neuropeptides using Bacillus subtilis

Transgenic plants are not without their issues. Concerns around their safety for consumption and issues with large biotech companies monopolising the industry have generated public interest and political controversy in this field. As such their commercial success had been impeded and continues to prove an issue when developing plants with resistance to phytopathogens. There are however alternative strategies which may be deployed to provide resistance to PPNs.

Exogenously applied NLPs have been shown to disrupt multiple behaviours in PPNs, including host invasion and chemosensation (Warnock et al., 2017).

Warnock et al screened the ability of NLPs (predicted to be unamidated, uNLPs) to disrupt the behaviour of M. incognita and G. pallida infective stage juveniles (Table

2.1). They found that NLP-15b, encoded by nlp-15, disrupted both normal chemotaxis and host invasion and; genetically engineered B. subtilis secreting NLP-

15b, identical in both M. incognita and G. pallida: SFDSFTGPGFTGLD, conferred resistance to tomato from both species.

Bacillus subtilis is a gram-positive Plant Growth Promoting Rhizobacteria

(PGPR) (Hashem et al., 2019). B. subtilis is a spore forming bacterium that can tolerate harsh environments increasing its longevity in the rhizosphere. For some time, Bacillus spp. have been utilised by the biotechnology industry for protein production processes owing to their high yields and quality (Westers et al., 2004;

Wong, 1995). Additionally, wt strains have been used as biocontrol agents in their own right in order to promote plant growth and provide stress protection

63

Chapter 2: Transgenic Approaches

(Radhakrishnan et al., 2017). As such, genetically engineered B. subtilis which secretes peptides to confer resistance to specific PPN species may also result in additional protection already inherit in B. subtilis rhizo-bacterium.

Warnock et al. (2017) developed this strategy as a proof of concept but a need for optimal peptide delivery was identified. B. subtilis secretes these peptides under the influence of a signal peptide. The signal peptide has a direct influence on the protein transport pathway which in turn determines the amount of peptide secreted externally and its subsequent bioactivity (Tjalsma et al., 2000). Therefore, in this work a tomato seedling invasion assay was used as a model to establish optimal performance of several B. subtilis clones with different signal peptide sequences. As B. subtilis has FDA approval and Generally Regarded As Safe (GRAS) status this approach has great promise for field deployment (Elshaghabee et al.,

2017).

Optimal performance of this system is necessary to deliver a robust and novel control strategy for managing PPNs. The results within demonstrate the effect that different signal peptides have on peptide secretion and consequently the resistance conferred to tomato seedlings when challenged with G. pallida juveniles exposed to NLP-15b.

2.2.3. Virus Induced Gene Silencing

Given the sedentary obligate nature of many of the economically important plant nematodes, the ability to target specific genes whist the worms are feeding is highly desirable. Studying gene function whilst the parasites are in their normal environment is more favourable as gene expression is more likely to reflect wild

64

Chapter 2: Transgenic Approaches populations than what would be possible under stressed in vitro experiments. In vitro techniques can not achieve this, and genetic transformation is not available for these parasites.

Virus Induced Gene Silencing is a reverse genetic technique that can be used to study gene function in plants and their parasites via PTGS. Previously Cox et al.

(2019) demonstrated the use of a modified VIGS platform to silence ABC transporter genes in tomato. They profiled the root exudate composition of VIGS treated plants and showed silencing of these two transporter genes resulted in an altered semi-volatile compound profile. Moreover, root exudate chemotaxis assays led to the repulsion of M. incognita and G. pallida infective juveniles relative to control exudates which these PPN species display attraction to (Cox et al., 2019).

This study shows the important role plant root exudate composition plays in parasite interactions and highlights a lack of our understanding of these interactions. Further research is required to bridge this gap so we can meaningfully target genes to produce exudate compositions beneficial to crop production and pest management. Another study applied the same VIGS inoculation method to silence Ethylene Response Factor genes also resulting in altered exudate composition, which resulted in aberrant chemotaxis behaviours in PPN species

(Dyer et al., 2019).

By introducing a fragment of DNA into plants via a viral vector, dsRNA is produced which in turn induces RNAi-mediated transcript knockdown. This tool takes advantage of the plant’s natural response to viral infections (Bai et al., 2012;

Liu et al., 2017). Numerous viral vectors have been modified and optimised for VIGS

65

Chapter 2: Transgenic Approaches experiments (Ali et al., 2017; Dommes et al., 2019; Li et al., 2019). Viral vectors produced from the Tobacco Rattle Virus (TRV) have been hugely successful owing to their ability to infect multiple host plants and spread systemically throughout plant tissues whilst inducing slight symptoms of infection. TRV vectors are particularly efficacious among Solanaceae plants. (Liu, Schiff and Dinesh-Kumar,

2002; Liu, Schiff, Marathe, et al., 2002; Ratcliff et al., 2001).

TRV is a positive strand RNA virus that has a bipartite genome (called TRV1 and TRV2). It is the TRV2 genome that is modified to contain a fragment of the gene of interest. TRV1 encodes proteins that facilitate movement and replication within the host plant whilst TRV2 encodes proteins that enable plant to plant transmission via soil borne nematodes (MacFarlane, 1999). VIGS vectors are constructed by individually inserting the TRV1 and TRV2 cDNA clones between the Right-hand and

Left-hand borders of the T-DNA region of A. tumefaciens. The plasmids contain a duplicated CaMV 35s promoter region, which has been shown to increase transcriptional activity (Kay et al., 1987). These vectors are subsequently transformed into electrocompetent A. tumefaciens cells before pTRV1 and pTRV2 cultures are combined and inoculated into host plants. T-DNA genes infiltrate cells of the inoculated region and become incorporated into the plant genome, are transcribed and facilitate systemic spread of the virus in the host plant (Lu, 2003).

The ability to carry out large scale RNAi experiments to study gene functionality in PPNs is somewhat lacking. Traditional in vitro dsRNA soaking methods, when successful, are still carried out on a small scale. Without a high throughput approach, we do not have the ability to efficiently screen multiple

66

Chapter 2: Transgenic Approaches genes to determine functionality and uncover novel control targets. VIGS is one method which can be deployed to achieve this; that does not require the production of genetically modified plants.

Vectors from the TRV can be modified to include target gene fragments which facilitate dsRNA production in plant tissues (Chung et al., 2004; Liu, Schiff and

Dinesh-Kumar, 2002; Ratcliff et al., 2001). Moreover, TRV vectors have been used to demonstrate efficient gene silencing in plant root tissues (MacFarlane and

Popovich, 2000). Much in the same way as in planta RNAi, silencing triggers delivered to root tissues in VIGS treated plants can be consumed by feeding nematodes and trigger an endogenous RNAi response leading to transcript degradation (Fairbairn et al., 2007; Sindhu et al., 2009).

Dubreuil et al. (2009) used TRV to silence M. incognita genes using Nicotiana benthamiana as the host plant. They demonstrated virus treated plants did produce silencing triggers within feeding cells and this subsequently led to gene knockdown of target transcripts in the progeny of feeding nematodes (Dubreuil et al., 2009).

This discovery has important consequences for our ability to study RKN genes. The fact that continuous exposure to silencing triggers resulted in the silencing effect being observed in progeny nematodes may allow us to study genes expressed early in development which are not normally accessible using classic in vitro RNAi techniques. The authors did point out that differences in the efficacy of silencing between plants may hamper the use of this platform for high throughput studies.

Another research group developed a VIGS protocol to effectively silence soybean genes involved in soybean cyst nematode (SCN) resistance. They

67

Chapter 2: Transgenic Approaches demonstrated the silencing of a soybean serine hydroxy methyltransferase (SHMT) gene which led to an increased susceptibility to SCN when compared to controls

(Kandoth et al., 2013). This work shows the use of a VIGS platform to study plant genes with important relevance to plant-nematode interactions and provides an additional means by which new resistance genes can be elucidated and functionally characterised.

The aim of this chapter was to develop a robust silencing platform using virus inoculated plants to target specific nematode genes. To this end a co-silencing construct was produced in order to silence our target gene and induce a marker phenotype in the plants to select plants in which the virus has successfully propagated. The results of this work demonstrate that further optimisation of this platform will be needed to produce a high throughput method of silencing PPN genes.

68

Chapter 2: Transgenic Approaches

2.3. Materials and Methods

2.3.1. PPN Maintenance

Meloidogyne incognita were cultured in tomato plants (‘Moneymaker’) (16h light,

8h dark cycle; 23˚C). After 8 weeks eggs were harvested from the plant roots by cleaning the root system with tap water and treating the roots with 5% sodium hypochlorite to soften the tissue, releasing the eggs. The eggs were passed through three sieves of decreasing pore size (180µM, 150µM and 38µM) whilst being washed with water. The eggs collected from the bottom sieve were further separated from soil by density gradient centrifugation (372g for 2 minutes) in 125% sucrose solution and collected in a 1.5ml layer of spring water. Eggs were treated with and antimitotic/antibiotic solution (Merck) and placed in a nylon mesh (20µM) contained in a Petri dish of spring water. The eggs were incubated at 23˚C in darkness until infective juveniles emerged. J2s hatched within 24 h were used for subsequent experiments.

Globdera pallida were maintained at the Agri-Food and Biosciences Institute Belfast

(AFBI) in potato. Soil was collected, dried and washed through sieves to collect cysts. Cysts were incubated in potato root diffusate in dark at 17˚C until infective juveniles emerged.

2.3.2 Construction of NLP expression/secretion plasmid

Nb: NLP-15b expression plasmid was constructed during Warnock et al (2017) study. This plasmid was then used to generate individual signal peptide clones for this work. Briefly, DNA sequences coding for the desired neuropeptide flanked by

69

Chapter 2: Transgenic Approaches restriction sites to clone into the B. subtilis expression vector pBE-S (Clontech, USA) were synthesised by GeneArt Gene Synthesis (Life Technologies, USA). The NLP-15b secretion insert, and vector pBE-S were digested using XbaI/MluI (New England

Biolabs, USA) and ligated using T4 ligase (New England Biolabs, USA) (Warnock et al.

2017).

2.3.3 Generation of B subtilis signal peptide clone library

The pBE-s vector containing NLP-15b was used alongside the B. subtilis Secretory

Protein Expression System (Takara, USA) to generate a B. subtilis clone library containing 173 unique signal peptide sequences according to the manufacturer’s instructions. The pBE-s vector was restriction digested using Mlu I andEco52 I enzymes and mixed with the signal peptide DNA mixture. This was then transformed into One shot Top10 E. coli chemically competent cells (Life

Technologies, USA). Ampicillin (Sigma Aldrich, USA) was used to select colonies containing the pBE-s plasmids which were subsequently extracted using the High

Pure Plasmid Isolation kit (Roche) to produce the plasmid Library. Clones were sequence confirmed by Eurofins Genomics UK. B. subtilis RIK1285 competent cells

(Takara, USA) were transformed with the plasmids according to the manufacture’s instructions and transformants selected on kanamycin (10µg/ml) selective plates.

Individual colonies were picked and grown in LB broth overnight at 37°C.

Quantitative Reverse Transcription-PCR (qRT-PCR) (pBE-S universal FWD:

GGATCAGCTTGTTGTTTGCGT, nlp-15b REV: CCTGGCCCAGTGAAAGAGTC) was performed to confirm the expression of uNLP secretion cassettes.

2.3.4 Tomato Invasion Assays

70

Chapter 2: Transgenic Approaches

Tomato seeds ( ‘Moneymaker’) were sterilised with 2.5% sodium hypochlorite solution for 2 minutes, washed 3 times with autoclaved ddH20 and sown on 0.5%

MS agar (Murashige and Skoog) plates. Plates were incubated at 4˚C for 48 hours, after which they were germinated at 23˚C with 16h of white light (140-160µE.m-1.s-

1)/8 h. An agar slurry was prepared by autoclaving 0.5% Agar in autoclaved spring water and agitated overnight to achieve a smooth consistency. B. subtilis cultures

(APRE and clones produced using signal peptide kit) were grown overnight in LB media containing Kanamycin (30µg/ml) whist shanking at 180rpm. Cultures were harvested during the log phase of growth determined by measuring OD600. Cultures

(5ml) at 0.1OD were spun down and the pellet was subsequently mixed with 3ml of

0.5% agar slurry and 500 freshly emerged G. pallida J2s in a 6 well plate. A single tomato seedling 2 days post-germination was added to each well. The assays were incubated at 17˚C in darkness for 24 hours. Seedlings were stained using acid

Fuschin and the number of nematodes visible in the roots were counted. Data shows the mean ±SEM ***, p<0.001, n=10 (Student’s unpaired t test, Graphpad

Prism 8).

2.3.5 Virus Induced Gene Silencing

Tomato seeds (‘Moneymaker’) were sterilised and germinated as above. Once cotyledons had emerged seedlings were transferred to John Innes no2 compost.

The Tobacco Rattle Virus (TRV) VIGS vector pTRV2 was modified to contain a 200 bp fragment of the tomato PDS gene (Solyc03g123760; pTRV2-PDS). Additionally, pTRV2 was modified to generate a co-silencing construct containing both a 200 bp fragment of the tomato PDS gene and a 200 bp fragment of our gene of interest

71

Chapter 2: Transgenic Approaches

(Mi-nlp-15; JK281600.1; pTRV2-PDS-mi-nlp-15). Modified pTRV2 vectors were synthesised by Genewiz. Agrobacterium tumefacinens strain GV3101 competent cells were transformed by electroporation with a pulse of 2.2KV delivered to the plasmid, electro-competent cell mixture. Cells were suspended in LB broth and incubated at 28˚C for 2 hours whilst agitated at 180rpm, before being plated on LB agar selective plates (50µg/ml gentamycin, 50µg/ml kanamycin. Positive colonies were selected by colony PCR using pTRV backbone primers. Positive transformants were stored as single use glycerol stocks.

2.3.6 Preparation of A tumefaciens cultures

For each construct (pTRV1; pTRV2; pTRV2-PDS; pTRV2-mi-nlp-15) a single use glycerol stock, produced as described above, was thawed, added to 5ml of LB broth

(50µg/ml gentamycin; 50µg/ml kanamycin) and incubated in darkness for 48 hours at 28˚C; 180rpm. Cultures were subsequently diluted to 35ml with LB broth containing: 50µg/ml gentamycin; 50µg/ml kanamycin, 10mM MES and 20µM acetosyringone and incubated for 24 hours at 28˚C; 180rpm. The cultures were subsequently normalised to an OD600 of 1 in infiltration buffer (200µM acetosyringone, 10mM MES, 10mM MgCl2, pH 5.7), covered with foil and incubated for 3 hours at room temperature. Before topical application of the cultures they were mixed individually in a 1:1 v/v ratio with pTRV2 and Silwet-L77 was added to a concentration of 0.02%.

2.3.7 Topical application of A. tumefaciens

Plants were watered prior to application. For topical application 0.02 % Silwett was added to the cultures, immediately prior to application, and an autoclaved paint

72

Chapter 2: Transgenic Approaches brush was used to paint the surface of the cotyledons and the hypocotyl. Inoculated plants were then were incubated at 18˚C in darkness for 24 hours after which the foil lined propagator lid was removed, and the treated plants were maintained at

18˚C, 16 hour light, 8 hour dark cycle.

2.3.8 Infecting plants with M. incognita Infective juveniles

After 18 days, plants with bleaching phenotypes from each treatment were selected and re-potted into larger plant pots with John Innes no2 compost. Three days after re-potting (3 weeks post inoculation) plants were infected with 500 freshly hatched M. incognita juveniles and incubated at 18˚C. Plants were watered daily.

2.3.9 Extraction of M. incognita eggs

After 12 weeks post infection, eggs were harvested from the plant roots by cleaning the root system with water and treating the roots with 5% sodium hypochlorite to soften the tissue, releasing the eggs. The eggs were passed through three sieves of decreasing pore size (180µM, 150µM and 38µM) whilst being washed with water.

The eggs collected from the bottom sieve were further separated from soil by density gradient centrifugation (372g for 2 minutes) in 125% sucrose solution and collected in a 1.5ml layer of spring water. Eggs were treated with and antimycotic/antibiotic solution (sigma-aldrich) and placed in a nylon mesh (20µM) contained in a Petri dish of spring water. The eggs were incubated at 23˚C in darkness until infective juveniles emerged. Freshly hatched J2s were used for subsequent experiments.

73

Chapter 2: Transgenic Approaches

2.3.10 RNA extraction and qRT-PCR analysis of gene knockdown

Total RNA was extracted from 1000 M. incognita infective juveniles (from PDS and mi-nlp-15 treated plants) using the Maxwell 16LEV Simply RNA tissue kit (Promega) which was processed using the Maxwell 16 instrument (Promega). Total RNA was eluted in 40µl of nuclease free water (Promega) and DNase treated (37˚C for 30 minutes) to remove genomic DNA contamination (Turbo DNase, Invitrogen). The

DNase treated RNA was then quantified using the NanoDrop 1000

Spectrophotometer. The RNA was reverse transcribed to produce first strand cDNA using the High Capacity RNA to cDNA kit (Applied Biosystems) according to the manufacturer’s instructions. The cDNA could be used immediately for downstream applications or stored at -20˚C until required.

Each qRT-PCR reaction was comprised of the following in a 12µl volume total: 6µl 2x

SensiFastTM SYBR® No-Rox kit (BioLine), 0.5µl of each forward and reverse primers

(20µM), 3µl water and 2µl cDNA. PCR reactions were carried out in triplicate for each individual cDNA using a Rotorgene Q thermal cycler under the following conditions: [95 °C x 10 min, 40 x (95 °C x 20 s, 60 °C x 20 s, 72 °C x 20 s) 72 °C x 10 min]. Primer sets were optimised for annealing temperature and melt curve analysis carried out to ensure there was no non-specific amplification. The PCR reaction efficiency of each amplicon was calculated using the Rotorgene Q software. The relative quantification of the Mi-nlp-15 transcript relative to two endogenous house-keeping genes (Mi-actin; BE225475.1 and Mi-β-tubulin;

CN443135.1) was calculated using the ΔΔCT method (Pfaffl, 2001). A Student’s unpaired t-test was used to analyse the data, n=3 (Graphpad prism 8).

74

Chapter 2: Transgenic Approaches

Table 2.2. PCR Primer sequences for VIGS experiment

Primers were designed using Primer 3+ (http://www.bioinformatics.nl/cgi- bin/primer3plus/primer3plus.cgi). F and R refers to Forward and Reverse primers used in the synthesis of 200 bp fragment for vector insert. qF and qR refer to primers used for qRT-PCR analysis.

Gene Id/ accession Origin Primer sequence (5’-3’)

nlp-15 Meloidogyne incognita F: CCTTCACAGGCTCTGGATTT JK281600.1 R: CTGTAAAACCCCTTCCCACA qF: AGCGCAATTTTGATGCTTTT qR: ATCCTCGTCCAACAAAGGAA

Actin Meloidogyne incognita qF: AGGACGTGATTTGACCGACT BE225475.1 qR: CCAAGAAAGATGGCTGGAAG

Β-tubulin Meloidogyne incognita qF: TGGAAAGTATGTCCCAAGAGC CN443135.1 qR: CACCACCAAGCGAGTGAGT

PDS Solanum lycopersicum F: GAAGGCGCTGTCTTATCAGG Solyc03g123760 R: GCTTGCTTCCGACAACTTCT

pTRV1 Vector F: GAGGGGAAACAAGCGGTACA R: TACCTCGTTCCCAAACAGCC

pTRV2 Vector F: ACTCACGGGCTAACAGTGCT R: GACGTATCGGACCTCCACTC

75

Chapter 2: Transgenic Approaches

2.4 Results

2.4.1 Optimising delivery of NLP-15b using B. subtilis signal peptide clones

The aim of this work was to build upon work previously carried out by Warnock et al. (2017) in which they determined NLP-15b had a negative impact on important parasitism behaviours such as chemosensation and host-finding. This work established a platform to deliver the peptide using genetically engineered B. subtilis. Taking this further, a library of clones containing different signal peptides was generated and used to determine what effect different signal peptides had when tomato seedlings were challenged with infection in host invasion assays.

The original B. subtilis vector used contained the aprE signal peptide which is replaced by the 173 different signal peptides included with the B. subtilis secretory protein expression system kit (Takura, USA). As such, in this chapter the host invasion results from different signal peptide clones were calculated as a mean percentage relative to the aprE sp clone which was used as a control for this study.

The results show that the B. subtilis signal peptide 50 clone shows a significant reduction in its ability to confer resistance to tomato from invasion with G. pallida with a mean invasion of 435% ± 71.49%. (p= 0.0004) relative to aprE. Noticeably, signal peptide clones 25, 47 and 61 confer the greatest resistance to tomato from invasion with G. pallida juveniles with a mean invasion of 35% ± 15.49% (p=0.0008);

42% ± 18.06% (p=0.0061) and 37% ± 24.77% (p=0.0226), respectively, relative to aprE (Figure 2.1.). These data highlight the effect that differential peptide secretion

(NLP-15b) under the influence of distinct signal peptides has on the ability of G. pallida juveniles to invade tomato seedlings in this invasion assay.

76

Chapter 2: Transgenic Approaches

Figure 2.1 Mean % of G. pallida infective juvenile invasion relative to aprE B. subtilis clone.

77

Chapter 2: Transgenic Approaches

2.4.2 Transgenerational VIGS

The aim of this work was to establish a high throughput gene silencing platform to target neuropeptide genes in nematodes. The principle was that VIGS plants expressing silencing triggers would elicit an RNAi response to feeding nematodes.

The resultant silencing could then be probed in the nematode’s offspring extracted post-infection.

The TRV pTRV2 genome was modified to produce a co-silencing construct which contained fragments of both the tomato PDS gene and mi-nlp-15. A leaf bleaching phenotype was visible on plants 2 weeks after topical application of cultures and the frequency of plants displaying bleaching was approximately 90%

(Figure 2.2). Those plants displaying this bleaching phenotype were selected to be taking forward for infection challenges with M. incognita infective juveniles.

Eggs were extracted 12 weeks post infection. During routine lab maintenance of M. incognita in tomato, the plants are incubated at 23˚C and egg extractions are carried out 8 weeks post infection. However, to allow virus propagation a lower incubation temperature of 18˚C was required. This appeared to influence the life cycle of the worms as galls on the root surface were not visible at the usual 8 weeks extraction time point. This is why harvesting eggs from the

VIGS treated plants was carried out at a later time point to allow completion of the lifecycle. Harvested eggs were allowed to hatch and freshly emerged juveniles were tested for target gene knockdown using RT-qPCR. Figure 2.3 shows transcript abundance relative to endogenous house-keeping genes. Mi-nlp-15 expression was not reduced compared to control genes following exposure of infective juveniles to

78

Chapter 2: Transgenic Approaches

VIGS plants and subsequent extraction of eggs 12 weeks post infection. Mi-nlp-15 relative transcript abundance: 1.067 ± 0.113; PDS relative transcript abundance:

0.953 ± 0.076, p=0.1659.

Figure 2.2 Example of bleaching phenotype observed in VIGS inoculated plants. Red circle highlights characteristic bleaching phenotype.

79

Chapter 2: Transgenic Approaches

Figure 2.3 q-RT expression analysis of Mi-nlp-15 post VIGS exposure.

Mean ratio of Mi-nlp-15 transcript abundance relative to endogenous reference genes. Endogenous reference genes refer to Mi-β-tubulin and Mi-actin. Worms exposed to plants inoculated with A. tumefaciens transformed with pTRV2-PDS vector were used as a non-endogenous control, n=3.

80

Chapter 2: Transgenic Approaches

2.5 Discussion

2.5.1 B. subtilis signal peptide expression system

Whilst able to show microbial secretion of NLP-15b using ELISA, it was not possible to quantify the amount of peptide being secreted. With commercial B. subtilis strains, secretion of the heterologous peptide is coordinated by a signal peptide sequence fused to the Open Reading Frame (ORF) of the protein. This signal peptide sequence has important implications for both the correct production and secretion of the peptide. It has been demonstrated that different signal peptide sequences interact differently with a given recombinant protein and so for any protein expression system individual optimisation of the signal peptide is required (Freudl,

2018).

As such, kits are commercially available to produce a B. subtilis clone library in which individual clones contain the target gene’s ORF fused with different signal peptide sequences. Usually, this approach allows for the use of a downstream assay to quantify protein production therefore identifying the clone with optimal protein secretion. However, as mentioned above, owing to a lack of immunogenicity of

NLP-15b it was not possible to directly quantify peptide secretion. Therefore, in this case optimised peptide secretion was derived by screening a B. subtilis signal peptide clone library against a tomato seedling invasion assay to determine which clone conferred the greatest resistance to tomato seedling challenged with G. pallida infective juveniles.

NLP-15b was chosen as the peptide of interest for this study because of work previously demonstrated by Warnock et al. (2017). This peptide showed

81

Chapter 2: Transgenic Approaches potent inhibition of G. pallida chemotaxis when applied exogenously; however, the authors demonstrate pre-treatment with exogenously applied NLP-15b did not influence host invasion. This contrasts with observations through transgenic delivery of the peptide and may be the result of a continuous exposure to the peptide that does not permit a recovery time. The NLP-15b peptide sequence is identical in both G. pallida and M. incognita (Table 2.1) which adds to its appeal as any novel control strategy developed using this method may be used to target both economically important species using one platform. Further to this, the peptide sequence is dissimilar to non-target soil-borne organisms reducing the chances off deleterious off target effects (Warnock et al., 2017).

The data in this chapter shows the different invasion results for G. pallida infective juveniles across 24 unique signal peptide B. subtilis clones relative to our control strain aprE (Figure 2.1). Different invasion rates are seen across individual clones with three clones (25,47 and 61) showing a significant reduction in the mean

% of G. pallida juveniles invading tomato seedlings as described in the results above. Clearly, exogenous uptake of NLP-15b by G. pallida juveniles results in endogenous interactions which translate to disruption of host invasion behaviours.

Again, the sequence similarity of neuropeptides between PPN species further increases their value as nematacide agents. The use of a commercially available B. subtilis strain as a delivery system demonstrates the potential for field deployment treatments conferring resistance to host plants against these economically important pests. In order to take this work further, we would select those B. subtilis signal peptide clones identified in this study as providing the

82

Chapter 2: Transgenic Approaches greatest resistance and carry out scaled-up experiments to further challenge their efficacy and reproducibility. Additionally, Warnock et al demonstrated that NLP-15b did not negatively impact the behaviours of mixed stage C. elegans and S. carpocapse infective juveniles. This could be tested further and applied to other non-target species to get a fuller understanding of the effects this peptide may have in the rhizosphere.

Furthermore, the same invasion assay described within should be used to further optimise B. subtilis peptide secretion when applied to M. incognita. Other unamidated NLPs can be tested with this transgenic delivery method allowing a stacking approach to be applied to future treatment regimes. In conclusion, this system represents a means to apply a novel nematacide treatment directly to fields with the potential to confer resistance to multiple crop species without the need to produce a single transgenic crop. This prevents the use of transgenic cultivars resulting in reduced genetic diversity and the ability for resistance breaking strains of other crop pests to take hold. This approach may also be more favourable when considering the controversial nature of transgenic crops given that the use of B. subtilis expression systems is already widespread in the biotechnology and pharmaceutical industries (van Dijl and Hecker, 2013; Schallmey et al., 2004; Zhang et al., 2020)

2.5.2 Developing a VIGS platform to target nematode genes

Neuropeptides are abundant throughout the nematode nervous system. They are highly conserved between species within the phylum and are important for controlling behaviours (Brownlee et al., 1996; Li, 2008; Li and Kim, 2014; Nathoo et

83

Chapter 2: Transgenic Approaches al., 2001). For this reason, they are the subject of various research efforts to localise and elucidate function as well as the cognate receptors on which they act.

Functional characterisation of neuropeptides will allow new control strategies designed specifically to impair or enhance a particular behaviour to manage crop damaging pests.

The Neuropeptide-like peptide (NLP) family of peptides in nematodes are the focus of this work. Some of these neuropeptides do not require post translational modifications to become biologically active. Specifically, unamidated

NLPs can be delivered to feeding nematodes via transgenic bacteria and confer resistance to host plants, as shown in this chapter. To date, however, little functional characterisation has been achieved for this group of peptides. Despite this, expression profiles of NLPs have shown they are expressed throughout the nervous system, including the anterior neurons as well as non-neuronal tissues, implicating them in various behaviours as well as reproductive development (Li,

2008).

This work focuses on characterisation of nlp-15 in PPNs. This gene represents a promising control target as it encodes multiple peptides with high conservation between species allowing for a multi-species control strategy. As such, this work aimed to further study the function of nlp-15 by developing a high throughput VIGS platform.

This study utilised a new VIGS inoculation approach which was developed within our research group (Cox et al., 2019). This method is preferred over the typical blunt syringe method of inoculation as it is less damaging to the plants. Cox

84

Chapter 2: Transgenic Approaches et al. (2019) demonstrated that topical application via painting improved plant growth and resulted in longer lasting gene silencing when compared to the blunt application method. For this experiment it was important to apply a less damaging method to the plants, which would subsequently be challenged by nematode infection. We did not want the plants to be overcome by the multitude of stresses inflicted during this experiment and required optimal plant growth to ensure they could cope with nematode infection for an entire life cycle, which in this case was

12 weeks.

Another consideration for the design of this experiment was the use of a selectable marker. In this case we used a co-silencing construct (pTRV2-PDS-Mi-nlp-

15) to effect silencing of our target genes. A 200 bp fragment was inserted into the pTRV2 vector. Phytoene DeSaturas (PDS) is an enzyme involved in carotenoid biosynthesis in plants and A. thaliana mutants deficient in this enzyme display an albino phenotype (Qin et al., 2007). This is due to the accumulation of the white pigment phytoene (Busch et al., 2002). What this means for the VIGS construct is silencing the PDS gene of tomato plants causes a bleaching phenotype that serves as a visual aid to select those plants in which virus propagation has been successful

(Figure 2.2). With approximately 90% of treated plants displaying a bleaching phenotype we can say that virus infiltration was largely successful across this experiment.

The progeny extracted from VIGS treated plants challenged by M. incognita infection were tested for target transcript knockdown by RT-qPCR. The results of this experiment show that Mi-nlp-15 transcript abundance was not reduced relative

85

Chapter 2: Transgenic Approaches to endogenous housekeeping genes (Figure 2.3). Although this platform did not reduce target transcript abundance, it has enabled us to successfully inoculate tomato plants with our VIGS silencing construct and to subsequently passage infective juveniles through the treated plants to complete a full life cycle allowing for egg extraction.

This platform may be used in the future to test other gene targets which may be more favourable to knockdown by RNAi. Doing so would allow a high throughput gene study approach which is resource light and inexpensive when compared to the laborious task of producing a genetically modified plant. Moving forward with this particular experiment it would be beneficial to conduct a

Northern blot analysis to establish if the dsRNA/siRNA silencing triggers are being expressed in the plant roots (Dubreuil et al., 2009; Moustafa and Cross, 2016). If so, then some optimisation may be required to achieve target gene knockdown, such as a time point experiment by which infection is initiated at different stages post virus inoculation. As gene silencing with VIGS is transient, exposure to the interfering molecules is likely to be time dependent.

Furthermore, northern blot analysis over a time course could show how persistent the silencing triggers were in the root tissue and further inform the best point at which to challenge the plants with infection. Additionally, extracting eggs at different time points after infection may also influence our ability to capture gene knockdown using RT-qPCR. Finally, as mentioned various gene targets can be challenged by VIGS co-silencing constructs using this platform which may lead to new control targets being discovered. These VIGS constructs can be designed to

86

Chapter 2: Transgenic Approaches silence multiple genes simultaneously creating a stacking effect which could be used to study gene interactions in susceptible targets (George et al., 2012; Li et al.,

2013). For this work, further optimisation is required to establish transcript knockdown.

87

Chapter 2: Transgenic Approaches

2.6 References

Ali, S., Nasir, I.A., Rafiq, M., Butt, S.J., Ihsan, F., Rao, A.Q. and Husnain, T. (2017), ‘Sugarcane mosaic virus-based gene silencing in Nicotiana benthamiana’, Iranian Journal of Biotechnology

Bai, M., Yang, G.S., Chen, W.T., Mao, Z.C., Kang, H.X., Chen, G.H., Yang, Y.H., et al. (2012), ‘Genome-wide identification of Dicer-like, Argonaute and RNA-dependent RNA polymerase gene families and their expression analyses in response to viral infection and abiotic stresses in Solanum lycopersicum’, Gene

Brownlee, D.J.A., Fairweather, I., Holden-Dye, L. and Walker, R.J. (1996), ‘Nematode neuropeptides: Localization, isolation and functions’, Parasitology Today.

Busch, M., Seuter, A. and Hain, R. (2002), ‘Functional Analysis of the Early Steps of Carotenoid Biosynthesis in Tobacco’, Plant Physiology, Vol. 128 No. 2, pp. 439–453.

Chung, E., Seong, E., Kim, Y.-C., Chung, E.J., Oh, S.-K., Lee, S., Park, J.M., et al. (2004), ‘A method of high frequency virus-induced gene silencing in chili pepper (Capsicum annuum L. cv. Bukang).’, Molecules and Cells, Vol. 17 No. 2, pp. 377–80.

Clough, S.J. and Bent, A.F. (1998), ‘Floral dip: A simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana’, Plant Journal

Cox, D.E., Dyer, S., Weir, R., Cheseto, X., Sturrock, M., Coyne, D., Torto, B., et al. (2019), ‘ABC transporter genes ABC-C6 and ABC-G33 alter plant-microbe-parasite interactions in the rhizosphere’, Scientific Reports, Vol. 9 No. 1, p. 19899. van Dijl, J.M. and Hecker, M. (2013), ‘Bacillus subtilis: From soil bacterium to super- secreting cell factory’, Microbial Cell Factories

Dommes, A.B., Gross, T., Herbert, D.B., Kivivirta, K.I. and Becker, A. (2019), ‘Virus-induced gene silencing: Empowering genetics in non-model organisms’, Journal of Experimental Botany

Dubreuil, G., Magliano, M., Dubrana, M.P., Lozano, J., Lecomte, P., Favery, B., Abad, P., et al. (2009), ‘Tobacco rattle virus mediates gene silencing in a plant parasitic root-knot nematode’, Journal of Experimental Botany, Vol. 60 No. 14, pp. 4041–4050.

Dyer, S., Weir, R., Cox, D., Cheseto, X., Torto, B. and Dalzell, J.J. (2019), ‘Ethylene Response Factor (ERF) genes modulate plant root exudate composition and the attraction of

88

Chapter 2: Transgenic Approaches

plant parasitic nematodes’, International Journal for Parasitology

Elshaghabee, F.M.F., Rokana, N., Gulhane, R.D., Sharma, C. and Panwar, H. (2017), ‘Bacillus As Potential Probiotics: Status, Concerns, and Future Perspectives’, Frontiers in Microbiology, Vol. 8

Fairbairn, D.J., Cavallaro, A.S., Bernard, M., Mahalinga-Iyer, J., Graham, M.W. and Botella, J.R. (2007), ‘Host-delivered RNAi: an effective strategy to silence genes in plant parasitic nematodes’, Planta, Vol. 226 No. 6, pp. 1525–1533.

Freudl, R. (2018), ‘Signal peptides for recombinant protein secretion in bacterial expression systems’, Microbial Cell Factories, Vol. 17 No. 1, p. 52.

George, G.M., Bauer, R., Blennow, A., Kossmann, J. and Lloyd, J.R. (2012), ‘Virus-induced multiple gene silencing to study redundant metabolic pathways in plants: Silencing the starch degradation pathway in Nicotiana benthamiana’, Biotechnology Journal

Hashem, A., Tabassum, B. and Fathi Abd_Allah, E. (2019), ‘Bacillus subtilis: A plant-growth promoting rhizobacterium that also impacts biotic stress’, Saudi Journal of Biological Sciences

Hedgecock, E.M., Culotti, J.G., Thomson, J.N. and Perkins, L.A. (1985), ‘Axonal guidance mutants of Caenorhabditis elegans identified by filling sensory neurons with fluorescein dyes’, Developmental Biology, Vol. 111 No. 1, pp. 158–170.

Kandoth, P.K., Heinz, R., Yeckel, G., Gross, N.W., Juvale, P.S., Hill, J., Whitham, S.A., et al. (2013), ‘A virus-induced gene silencing method to study soybean cyst nematode parasitism in Glycine max’, BMC Research Notes, Vol. 6 No. 1, p. 255.

Kay, R., Chan, A., Daly, M. and Mcpherson, J. (1987), ‘Duplication of CaMV 35S Promoter Sequences Creates a Strong Enhancer for Plant Genes’, Science, Vol. 236 No. 4806, pp. 1299–1302.

Li, C. (2005), ‘The ever-expanding neuropeptide gene families in the nematode Caenorhabditis elegans’, Parasitology

Li, C. and Kim, K. (2008), ‘Neuropeptides’, WormBook, The C elegans Research Community No. 212, pp. 1–36.

Li, C., Hirano, H., Kasajima, I., Yamagishi, N. and Yoshikawa, N. (2019), ‘Virus-induced gene silencing in chili pepper by apple latent spherical virus vector’, Journal of Virological

89

Chapter 2: Transgenic Approaches

Methods, Vol. 273, p. 113711.

Li, C. and Kim, K. (2014), ‘Family of FLP Peptides in Caenorhabditis elegans and Related Nematodes’, Frontiers in Endocrinology, Vol. 5

Li, C., Yan, J.M., Li, Y.Z., Zhang, Z.C., Wang, Q.L. and Liang, Y. (2013), ‘Silencing the SpMPK1, SpMPK2, and SpMPK3 genes in tomato reduces abscisic acid-mediated drought tolerance’, International Journal of Molecular Sciences

Liu, B., Hibbard, J.K., Urwin, P.E. and Atkinson, H.J. (2005), ‘The production of synthetic chemodisruptive peptides in planta disrupts the establishment of cyst nematodes’, Plant Biotechnology Journal, Vol. 3 No. 5, pp. 487–496.

Liu, J.-Z., Li, F. and Liu, Y. (2017), ‘Editorial: Plant Immunity against Viruses’, Frontiers in Microbiology, Vol. 8

Liu, W., Jones, A.L., Gosse, H.N., Lawrence, K.S. and Park, S.-W. (2019), ‘Validation of the Chemotaxis of Plant Parasitic Nematodes Toward Host Root Exudates’, Journal of Nematology, Vol. 51, pp. 1–10.

Liu, Y., Schiff, M. and Dinesh-Kumar, S.P. (2002), ‘Virus-induced gene silencing in tomato’, The Plant Journal, Vol. 31 No. 6, pp. 777–786.

Liu, Y., Schiff, M., Marathe, R. and Dinesh-Kumar, S.P. (2002), ‘Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus’, Plant Journal

Lu, R. (2003), ‘Virus-induced gene silencing in plants’, Methods, Vol. 30 No. 4, pp. 296–303.

MacFarlane, S.A. (1999), ‘Molecular biology of the tobraviruses’, Journal of General Virology

MacFarlane, S.A. and Popovich, A.H. (2000), ‘Efficient expression of foreign proteins in roots from tobravirus vectors’, Virology

McVeigh, P., Alexander-Bowman, S., Veal, E., Mousley, A., Marks, N.J. and Maule, A.G. (2008), ‘Neuropeptide-like protein diversity in phylum Nematoda’, International Journal for Parasitology, Vol. 38 No. 13, pp. 1493–1503.

McVeigh, P., Leech, S., Marks, N.J., Geary, T.G. and Maule, A.G. (2006), ‘Gene expression and pharmacology of nematode NLP-12 neuropeptides’, International Journal for Parasitology

90

Chapter 2: Transgenic Approaches

Moustafa, K. and Cross, J. (2016), ‘Genetic Approaches to Study Plant Responses to Environmental Stresses: An Overview’, Biology, Vol. 5 No. 2, p. 20.

Nathoo, A.N., Moeller, R.A., Westlund, B.A. and Hart, A.C. (2001), ‘Identification of neuropeptide-like protein gene families in Caenorhabditis elegans and other species’, Proceedings of the National Academy of Sciences, Vol. 98 No. 24, pp. 14000–14005.

Onkendi, E.M., Kariuki, G.M., Marais, M. and Moleleki, L.N. (2014), ‘The threat of root-knot nematodes (Meloidogyne spp.) in Africa: A review’, Plant Pathology

Qin, G., Gu, H., Ma, L., Peng, Y., Deng, X.W., Chen, Z. and Qu, L.J. (2007), ‘Disruption of phytoene desaturase gene results in albino and dwarf phenotypes in Arabidopsis by impairing chlorophyll, carotenoid, and gibberellin biosynthesis’, Cell Research

Radhakrishnan, R., Hashem, A. and Abd Allah, E.F. (2017), ‘Bacillus: A biological tool for crop improvement through bio-molecular changes in adverse environments’, Frontiers in Physiology

Ratcliff, F., Martin-Hernandez, A.M. and Baulcombe, D.C. (2001), ‘Tobacco rattle virus as a vector for analysis of gene function by silencing’, Plant Journal

Ryan, P., Delhaize, E. and Jones, D. (2001), ‘Function and mechanism of organic anion exudation from plant roots.’, Annual Review of Plant Physiology and Plant Molecular Biology, Vol. 52 No. 1, pp. 527–560.

Schallmey, M., Singh, A. and Ward, O.P. (2004), ‘Developments in the use of Bacillus species for industrial production’, Canadian Journal of Microbiology

Sindhu, A.S., Maier, T.R., Mitchum, M.G., Hussey, R.S., Davis, E.L. and Baum, T.J. (2009), ‘Effective and specific in planta RNAi in cyst nematodes: Expression interference of four parasitism genes reduces parasitic success’, Journal of Experimental Botany

Tjalsma, H., Bolhuis, A., Jongbloed, J.D.H., Bron, S. and van Dijl, J.M. (2000), ‘Signal Peptide- Dependent Protein Transport inBacillus subtilis: a Genome-Based Survey of the Secretome’, Microbiology and Molecular Biology Reviews, Vol. 64 No. 3, pp. 515–547.

Tripathi, L., Babirye, A., Roderick, H., Tripathi, J.N., Changa, C., Urwin, P.E., Tushemereirwe, W.K., et al. (2015), ‘Field resistance of transgenic plantain to nematodes has potential for future African food security’, Scientific Reports, Vol. 5 No. 1, p. 8127.

Wang, D., Jones, L.M., Urwin, P.E. and Atkinson, H.J. (2011), ‘A synthetic peptide shows

91

Chapter 2: Transgenic Approaches

retro- and anterograde neuronal transport before disrupting the chemosensation of plant-pathogenic nematodes’, PLoS ONE

Warnock, N.D., Wilson, L., Patten, C., Fleming, C.C., Maule, A.G. and Dalzell, J.J. (2017), ‘Nematode neuropeptides as transgenic nematicides.’, edited by Mackey, D.PLoS Pathogens, Vol. 13 No. 2, p. e1006237.

Westers, L., Westers, H. and Quax, W.J. (2004), ‘Bacillus subtilis as cell factory for pharmaceutical proteins: a biotechnological approach to optimize the host organism’, Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, Vol. 1694 No. 1–3, pp. 299–310.

Wong, S.L. (1995), ‘Advances in the use of Bacillus subtilis for the expression and secretion of heterologous proteins’, Current Opinion in Biotechnology

Zhang, K., Su, L. and Wu, J. (2020), ‘Recent Advances in Recombinant Protein Production by Bacillus subtilis’, Annual Review of Food Science and Technology

92

Chapter 3: in vitro RNAi

Chapter 3.

Investigating the Role of Neuropeptide-like Protein-15 (nlp-

15) in Economically Important Plant Parasitic Nematodes

Using in vitro RNAi

94

Chapter 3: in vitro RNAi

3.1. Abstract

In situ hybridisation was used to localise the nlp-15 gene of two economically important nematodes, Radopholus similis and Meloidogyne incognita, to cells of the anterior neuronal system. The nlp-15 gene of plant nematodes has been localised to both neuronal and non-neuronal cells suggesting pleiotropic roles in sensory perception and development. This study tested a series of RNAi platforms to target silencing of Rs-nlp-15. Using these methods Rs-nlp-15 appeared to be largely recalcitrant to transcript knockdown using in vitro RNAi. Only a modest amount of gene silencing (23%) was observed relative to controls using electroporation to induce dsRNA uptake. Furthermore, five Meloidogyne incognita and five

Meloidogyne javanica populations isolated from Sub-Saharan Africa were screened using a standardised RNAi soaking procedure to assess any differences in their ability to mount an RNAi response to nlp-15 and nlp-3 dsRNA. The data shows no statistically significant knockdown of target transcripts relative to non-endogenous control genes across all strains. Further work is warranted to understand the discrepancies frequently observed between laboratories conducting PPN RNAi experiments.

95

Chapter 3: in vitro RNAi

3.2. Introduction

Fire and colleagues demonstrated both potent and specific gene knockdown through the application of just a few molecules of exogenous double-stranded RNA complementary to target mRNA in the model free-living nematode Caenorhabditis elegans (Fire et al. 1998). RNAi is now thought to be an evolutionarily conserved process spanning across all metazoan (Shabalina and Koonin, 2008). The conservation of RNA based silencing strategies serves multiple purposes across kingdoms. In plants, RNAi or Post Transcriptional Gene Silencing (PTGS), a potent and sensitive response to foreign nucleic acids acts as an antiviral defence mechanism where RNA viruses are a major threat (Hamilton, 1999). In animals, RNA based silencing is necessary to supress the mutagenic potential of transposable elements (Chung et al., 2008; Obbard et al., 2009). In addition, the RNAi pathway is vital for the regulation of gene expression and is particularly important during development (Hall et al., 2013). Despite differences in the mechanism, the process involves a conserved RNA interfering pathway with many pathway components found to be homologous between kingdoms (Shabalina and Koonin, 2008).

The major advantage of RNAi is that it is a high-throughput gene silencing methodology that does not require genetic transformation (Urwin et al., 2002). As a result RNAi has been applied to many fields of research (Campochiaro, 2006; Martin and Caplen, 2007; Morris and Rossi, 2006). This is particularly attractive within parasitology; here the ability to study genes using an RNAi-based platform is invaluable as many parasitic animals are recalcitrant to genetic transformation because of their obligate parasitic lifestyle, a major hindrance for target-validation

96

Chapter 3: in vitro RNAi studies. Over the years, high-throughput RNAi screening in C. elegans has provided researchers with vital information regarding the complexities of the endogenous

RNAi pathway itself as well as functional studies of specific genes relevant to an organism of interest (Kamath, 2003; Winston, 2002). Certainly, these studies have and continue to provide a great resource for loss of function phenotype studies across non-model organisms, including parasitic nematodes. Experimental RNAi has developed over the years to improve on dsRNA delivery methods. In the model nematode C. elegans, different modes of dsRNA delivery have been used successfully. These are delivery through feeding bacteria which express the silencing molecules, soaking in a solution containing dsRNA, electroporation, or through microinjection (Tabara, 1998).

Within the field of plant nematology adaptations of the above-mentioned delivery strategies have been needed to facilitate gene knock-down. For example, due to their microscopic size dsRNA delivery via microinjection is both a laborious task and results in death or damage to the nematode. In addition, because of their obligate parasitic lifestyle researchers are limited by the life stage of the nematode that is available for in vitro studies. With this in mind, in vitro RNAi studies in PPNs are generally conducted using the second-stage juveniles (J2s). In sedentary endoparasites this is a non-feeding stage of the nematode’s life cycle and this again causes issues for delivering silencing triggers. However, silencing of various gene targets has been accomplished in PPN J2s using in vitro RNAi following a simple soaking procedure. Urwin et al. ( 2002) added the biogenic amine Octopamine

Hydrochloride (HCl) to a dsRNA solution. Octopamine HCl induces pharyngeal pumping behaviour within the J2 (analogous to natural feeding behaviour) and this

97

Chapter 3: in vitro RNAi facilitates uptake of dsRNA. When the nematodes are incubated in this solution for a period of time, specific and systemic target gene knockdown can be achieved.

What has become apparent within nematode RNAi research is that although gene silencing is achievable through the above mentioned experimental techniques the efficacy of target gene knockdown can be both target and species specific

(Dalzell et al., 2012). Although negative data tends to be unpublished, anecdotal accounts have become increasingly apparent in recent years depicting RNAi failure within PPN knockdown experiments. The reasons for this remain unknown and because of the large number of variables associated with in vitro RNAi experiments it is difficult to draw conclusions from research conducted across various institutes.

Key factors already mentioned include the target gene to be silenced, with spatial and temporal expression of a target likely playing an important role in RNAi efficacy

(Dalzell et al., 2012). Also, the species of nematode being studied may affect the outcome of an RNAi experiment. For example, RNAi pathway components known to be important for systemic RNAi in C. elegans are lacking in other species of nematode (Abad et al., 2008). Furthermore, when carrying out in vitro RNAi experiments in parasitic organisms we are attempting to exploit an energy dependent and notoriously dynamic endogenous pathway outside of the nematode’s natural environment. Speculatively, this may be overwhelming and not conductive to normal regulatory processing.

A notable study conducted by Felix et al. (2011) demonstrated that different strains of the same species of nematode can differ in their ability to elicit an RNAi response. The group discovered a novel RNA virus infecting a wild-type (wt) C.

98

Chapter 3: in vitro RNAi elegans isolate (Orsay virus). They found this novel virus was also capable of infecting RNAi deficient laboratory C. elegans strains demonstrating greater infections when compared to the wild-type N2 strain which can elicit an RNAi response to viral RNA. Notably different wild C. elegans isolates displayed different levels of viral infection. This study clearly showed the importance of an RNAi response to this virus and importantly, demonstrated that different isolates of the same species can differ in their ability to elicit an RNAi response. This study provides us with the rationale for carrying out a screen of different PPN isolates differing in the source plant and location they were taken from.

This chapter describes the experimental optimisation of in vitro RNAi to silence the neuropeptide-like protein 15 (nlp-15) gene in the migratory endoparasitic nematode Radopholus similis. In addition, an in vitro RNAi screen of

10 different wild-type isolates of the sedentary endoparasitic nematodes

Meloidogyne incognita and Meloidogyne javanica was conducted to ascertain any differences in their ability to elicit an RNAi response against nlp-15 dsRNA.

99

Chapter 3: in vitro RNAi

3.3. Materials and Methods

3.3.1 Plant Parasitic Nematode Maintenance

Meloidogyne incognita and Meloidogyne javanica were cultured in tomato plants

(cv. Moneymaker) (16h light, 8h dark cycle; 23˚C). After 8 weeks, eggs were harvested from the plant roots by cleaning the root system with water and treating the roots with 5% sodium hypochlorite to soften the tissue, releasing the eggs. The eggs were passed through three sieves of decreasing pore size (180µM, 150µM and

38µM) whilst being washed with water. The eggs collected from the bottom sieve were further separated from soil by density gradient centrifugation (372g for 2 minutes) in 125% sucrose solution and collected in a 1.5 ml layer of spring water.

Eggs were treated with and antimycotic/antibiotic solution (Merck) and placed in a nylon mesh (20µM) contained in a Petri dish of spring water. The eggs were incubated at 23˚C in darkness until infective juveniles emerged. J2s hatched within

24h were used for subsequent experiments.

Radopholus similis was maintained as in vitro cultures on carrot disks. Carrots were washed with sterile water and flame sterilised by spraying with 70% ethanol and passing through a Bunsen flame. The carrots were then peeled and cut in to disks of approximately 0.5cm (carrot peeler and knife were autoclaved prior to use). The carrot disks were placed in to sterile Petri dishes. Approximately 100 R. similis mixed stage nematodes were treated with an antimycotic/antibiotic solution

(Merck) before being pipetted on to individual carrot disks. Petri dishes with inoculated carrot disks were sealed with parafilm and incubated at 28˚C in darkness until nematodes began to emerge on to the surface of the carrot disks

100

Chapter 3: in vitro RNAi

(approximately 6 weeks). Nematodes were harvested from the surface of the carrot disk by rinsing with sterile double distilled water into a falcon tube and used for subsequent experiments.

3.3.2 dsRNA synthesis

Total RNA was extracted from 1000 M. javanica and M. incognita infective juveniles

(from each isolate) and 1000 R. similis mixed stage nematodes, using the Maxwell

16LEV Simply RNA tissue kit (Promega), which was processed using the Maxwell 16 instrument (Promega). Total RNA was eluted in 40 µl of nuclease free water

(Promega) and DNase treated (37˚C for 30 minutes) to remove genomic DNA contamination (Turbo DNase, Invitrogen). The DNase treated RNA was then quantified using the NanoDrop 1000 Spectrophotometer. The RNA was reverse transcribed to produce first strand cDNA using the High Capacity RNA to cDNA kit

(Applied Biosystems) according to the manufacturer’s instructions. The cDNA could be used immediately for downstream applications or stored at -20˚C until required.

The cDNA served as a template for PCR reactions to produce target gene specific dsRNA templates with T7 promoter sites using gene specific primers (Table 3.1).

Primers were designed to generate the following sense and antisense T7 templates:

M. incognita nlp-15 (219 bp) and nlp-3 (216 bp), M. javanica nlp-15 (219 bp) and nlp-3 (202 bp), R. similis nlp-15 (200 bp) and R. similis 1,3-eng (317 bp). Primers were designed using Primer 3+ (http://www.bioinformatics.nl/cgi- bin/primer3plus/primer3plus.cgi). Non-endogenous control dsRNA templates

(green fluorescent protein and neomycin phosphotransferase genes) were also generated using gene specific primers (Table 3.1) that amplified an approximate

101

Chapter 3: in vitro RNAi

200 bp region of the pEGFP-N1 cloning vector (GenBank: U55762.1). The PCR reactions were carried out in a 50µl reaction mixture consisting of 25µl 2x MyTaqTM

Mix (BioLine); 1µl of forward and reverse primer (20µM), 2µl of cDNA template, distilled water to total reaction volume. Separate sense and antisense PCR reactions

(Forward and ReverseT7 primers; and Reverse and ForwardT7 primers) were carried out using the following thermocycler conditions: [95°C x 10 min, 40 x (95 °C x 30 sec, 60 °C x 30 sec, 72 °C x 30 sec) 72 °C x 10min]. PCR products were assessed by gel electrophoresis and purified using the ChargeSwitch PCR clean-up kit (Life

Technologies). dsRNA was then synthesised using the T7 RiboMaxTM Express Large-

Scale RNA Production System (Promega) according to the manufacturer’s instructions. The dsRNA was purified using Phenol-Chloroform and precipitated with 70% ethanol. The dsRNA was assessed using gel electrophoresis and quantified using the NanoDrop 1000 spectrophotometer. dsRNA with a 260/280 and 230/260 value of >1.8 was used for subsequent RNAi experiments.

3.3.3 dsRNA incubation procedures in vitro RNAi optimisation in R. similis

Approximately 500 mixed stage R. similis nematodes were incubated in a 50µl buffer solution of 0.25x M9 (10.9mM Na2HPO4, 5.5mM KH2PO4, 2.1mM NaCl,

4.7mM NH4Cl) with either 2mg/ml or 5mg/ml target gene or non-endogenous control dsRNA. Target gene refers to Rs-nlp-15 or Rs-eng-1. Different experimental platforms were tested to stimulate gene knockdown. dsRNA incubation was carried out over a 24hr or 48hr time course. The dsRNA incubation solution was added to

102

Chapter 3: in vitro RNAi the worms with or without additives. Additives refer to Gelatin (0.05%),

Octopamine HCl (50mM), and Spermidine (3mM).

Electroporation experimental protocol was utilised to stimulate systemic dsRNA uptake. Approximately 500 mixed stage R. similis nematodes were electroporated at 1000mV; after which they were incubated for 24h in dsRNA solution with additives. Each treatment was carried out in triplicate including a control treatment which contained no dsRNA. Post-incubation the worms were washed 3x in sterile spring water and total RNA extracted as described above. The RNA was quantified using a NanoDrop 1000 spectrophotometer, normalised and used as a template for first strand cDNA synthesis as described above.

3.3.4 RKN in vitro RNAi screen

A standardised approach across all 10 isolates tested was carried out.

Approximately 500 J2s were incubated in a 50µl buffer solution of 0.25x M9 and

0.5mg/ml target or control dsRNA or no dsRNA; at 23˚C for 24 h in darkness. Each treatment was carried out in triplicate. Post-incubation the worms were washed 3x in sterile spring water and total RNA extracted as described above. The RNA was quantified using a NanoDrop 1000 spectrophotometer, normalised and used as a template for first strand cDNA synthesis as described above.

3.3.5 Quantitative (q)RT-PCR

Each qRT-PCR reaction was comprised of the following in a 12µl volume total: 6µl 2x

SensiFastTM SYBR® No-Rox kit (BioLine), 0.5µl of each forward and reverse primers

(20µM), 3µl water and 2µl cDNA. PCR reactions were carried out in triplicate for

103

Chapter 3: in vitro RNAi each individual cDNA using a Rotorgene Q thermal cycler under the following conditions: [95 °C x 10 min, 40 x (95 °C x 20 s, 60 °C x 20 s, 72 °C x 20 s) 72 °C x 10 min]. Primer sets were optimised for annealing temperature and melt curve analysis carried out to ensure there was no non-specific amplification. The PCR reaction efficiency of each amplicon was calculated using the Rotorgene Q software. The relative quantification of each target transcript relative to two endogenous house-keeping genes (actin and β-tubulin) specific for each species; was calculated using the ΔΔCT method (Pfaffl, 2001). A One-Way-ANOVA or

Student’s unpaired t-test was used to analyse the data (Graphpad prism 7).

Table 3.1. dsRNA synthesis and qRT-PCR primer sequences

Gene Id/ accession Origin Sequence (5’-3’) Fragment length nlp-15 Meloidogyne F: CCTTCACAGGCTCTGGATTT incognita JK281600.1 R: CTGTAAAACCCCTTCCCACA qF: AGCGCAATTTTGATGCTTTT qR: ATCCTCGTCCAACAAAGGAA nlp-3 Meloidogyne F: TTGTTGGCAATTTGTTCTGC incognita KY054882.1 R: GGCTGATCGTTTTCCAAGAG qF: TGTCATCTCTTAGCAGCAAC qR: AATTAAAGAGACGCCGAAGATAAC

Actin Meloidogyne qF: AGGACGTGATTTGACCGACT incognita BE225475.1 qRCCAAGAAAGATGGCTGGAAG Β-tubulin Meloidogyne qF: TGGAAAGTATGTCCCAAGAGC incognita CN443135.1 qR: CACCACCAAGCGAGTGAGT nlp-15 Meloidogyne javanica F: CCTTCACAGGCTCTGGATTT BE578108.1 R: CTGTAAAACCCCTTCCCACA qF: TGGCTGCCAATCTTCTAGC

104

Chapter 3: in vitro RNAi

qR: CGTTTGAAAGGTGGACGTAAAG nlp-3 Meloidogyne javanica F: CCTTCACAGGCTCTGGATTT CK427465.1 R: CTGTAAAACCCCTTCCCACA qF: TGGCTGCCAATCTTCTAGC qR: CGTTTGAAAGGTGGACGTAAAG Actin Meloidogyne javanica qF: TCCTCACTGAACGTGGTTATTC AF532605.1 qR GCTCAAAGTCCAAAGCAACATAG Β-tubulin Meloidogyne javanica qF: CAAAGTTGTCAGGACGGAAGA BG737220.1 qR: GGTGGAAAGTATGTCCCAAGAG nlp-15 Radopholus similis F: AGAGGGCCTTCGACTCCTTT RSAA-aab03c11.g1 R: ATCTCATTCCACCCCAGTGA qF: CACAGACATCCCGATCTCATTC qR: TGCAAGTGCTAGAATCTGTGTAA Β-1,4-endoglucanase Radopholus similis F: GCTGTTCTGGTCGCAATG EU414839.1 R: CAGAGGTGGGCTCATTGTAG qF: AATCTCTTACGTGAACTGGGC qR: GGTCGCTCCAGATTTAGTCG Actin Radopholus similis qF: AGATCGTCCGCGACATAAAG EU000540.1 qR: GAAAGAGGGCCGGAAGAG Β-tubulin Radopholus similis qF: GCCGAACTCACAAAGCAAAT RSAA-aab18f02.g1 qR: ATGATGTCGGTGCAGAACAA Neomycin pEGFP-N1 cloning F: GGTGGAGAGGCTATTCGGCTA vector U55762.1 R: CCTTCCCGCTTCAGTGACAA Green Fluorescent pEGFP-N1 cloning F: GGCATCGACTTCAAGGAGGA Protein vector R: GTAGTGGTTGTCGGGCAGCA U55762.1 T7 promoter sequence TAATACGACTCACTATAGG

105

Chapter 3: in vitro RNAi

3.3.6 Whole mount in situ hybridisation

PCR primers were designed to amplify a 200 bp region of Mi-nlp-15 and Rs-nlp-15 from the respective IJ cDNA (same primers as those used for dsRNA synthesis, see table 1). Template PCR products were generated as follows : [95°C x 10 min, 40 x

(95 °C x 30 sec, 60 °C x 30 sec, 72 °C x 30 sec) 72 °C x 10 min]. PCR products were assessed by gel electrophoresis and cleaned using the Chargeswitch PCR clean-up kit (Life Technologies). Amplicons were quantified by a Nanodrop 1000 spectrophotometer. Sense and antisense probes were generated using amplicons in an asymmetric PCR reaction. The components of each reaction were as follows:

2.0µl of Reverse primer (or Forward primer for control probe); 2.5µl 10X PCR buffer with MgCl2 (Roche Diagnostics); 2µl DIG DNA labelling mix (Roche Diagnostics);

0.25µl 10x Taq DNA polymerase (Roche Diagnostics); 20ng DNA template; distilled water to a volume of 25µl. Probes were assessed by gel electrophoresis.

Freshly emerged M. incognita J2s or R. similis mixed stage nematodes were fixed in

2 % paraformaldehyde in M9 buffer overnight at 4°C followed by 4h at room temperature. Nematodes were chopped roughly using a sterile razor blade for 2 minutes and washed three times in DEPC M9. Subsequently, the chopped nematodes were incubated in 0.4 mg/ml proteinase K (Roche Diagnostics) for 20 minutes at room temperature. Following three washes in DEPC M9, the nematodes were pelleted (7000g) and frozen for 15 minutes on dry ice. Subsequently the nematode sections were incubated for 1 minute in -20˚C methanol and then in -

20˚C acetone for 1 minute. The nematodes were then rehydrated using DEPC M9

106

Chapter 3: in vitro RNAi and incubated at room temperature for 20 minutes, after which three wash steps in

DEPC M9 were carried out to remove any acetone.

The nematodes were pre-hybridised in 150 µl hybridisation buffer (prepared as detailed by Boer et al., 1998) for 15 minutes. The hybridisation probes were heat denatured at 95˚C for 10 minutes, after which they were diluted with 125 µl hybridisation buffer. The probe-hybridisation mixture was then added to the nematode sections which were incubated at 50˚C overnight. Post hybridisation washes were carried out as follows: three washes in 4x Saline Sodium Citrate buffer

(15 minutes, 50˚C); three washes in 0.1x SSC/0.1x Sodium dodecyl sulphate (20 minutes, 50˚C) and; 30 minute incubation in 1% blocking reagent (Roche

Diagnostics) in maleic acid buffer (50˚C). Subsequently the nematodes were incubated at room temperature for 2 h in alkaline phosphatase conjugated anti- digoxigenin antibody (diluted 1:1000 in 1% blocking reagent in maleic acid buffer).

Detection was completed with an overnight incubation in 5-Bromo-4-chloro-3- indolyl phosphate/Nitro blue tetrazolium at 4˚C. The staining was stopped with two washes in DEPC treated water. The nematode sections were mounted on to glass slides for visualisation.

107

Chapter 3: in vitro RNAi

3.4 Results

3.4.1. Localising Mi-nlp-15 and Rs-nlp-15 using Wholemount in situ hybridisation

Here we have localised nlp-15 to the anterior neurons of the plant parasitic nematode R. similis J2s for the first time, indicating potential roles in sensory perception. Control experiments using the sense probe resulted in no visible staining. (Figure 3.1).

Figure 3.1. Localising Mi-nlp-15 and Rs-nlp-15 using whole-mount in situ hybridisation.

(A) Localisation of Rs-nlp-15 to cells of the anterior neuronal system. (B) Control image from in situ experiment using sense probe. White arrows indicate areas of positive staining.

108

Chapter 3: in vitro RNAi

3..4.2. Optimising an RNAi platform to target Rs-nlp-15

Treatment of mixed stage R. similis nematodes with 2mg/ml dsRNA and several additives, (see methods) thought to aid in vitro RNAi responsiveness, was not able to trigger target transcript knockdown relative to the endogenous reference genes,

Rs-β-tubulin and Rs-β-actin compared with gfp dsRNA serving as a non-endogenous control. Rs-nlp-15 relative transcript abundance: 1.133 ± 0.06741; gfp relative transcript abundance: 1.347 ± 0.2624, p=0.4750 (Figure 3.2A).

To test the possibility that R. similis was perhaps recalcitrant to in vitro RNAi when targeting a neuronally expressed gene, the above experiment was repeated using the non-neuronal gene Rs-eng-1. This treatment did result in very modest knockdown of the target gene relative to endogenous reference genes when compared with gfp control dsRNA. Rs-eng-1 relative transcript abundance: 0.843 ±

0.06173; gfp relative transcript abundance: 1.33 ± 0.1097, p=0.0181 (Figure 3.2B).

The next stage in this series of experiments was to test if increasing the amount of dsRNA applied to the nematodes could stimulate transcript reduction. However, increasing the dsRNA amount to 5mg/ml did not have the desired effect. Rs-nlp-15 relative transcript abundance: 0.83 ± 0.08185; neo relative transcript abundance:

1.017 ± 0.05783, p= 0.1360. (Figure 3.2C).

An additional treatment was carried out to test whether removing additives from the dsRNA incubation mixture had any effect on the knockdown of Rs-eng-1.

When examining Rs-eng-1 transcript abundance a higher SEM was observed between replicates and no statistically significant gene knockdown occurred. Rs-

109

Chapter 3: in vitro RNAi eng-1 relative transcript abundance: 0.8 ± 0.35; gfp relative transcript abundance:

1.39 ± 0.09, p= 0.2441 (Figure 3.2D).

As has been demonstrated in the literature, electroporation can help to facilitate systemic dsRNA uptake in nematodes (Chen et al., 2012) and this can aid in the RNAi response to exogenous silencing triggers. As part of this investigation R. similis mixed stage nematodes were electroporated with 2mg/ml target gene dsRNA prior to a 24h incubation. When the nematodes were electroporated with

1000mV and incubated in 2mg/ml Rs-nlp-15 dsRNA a modest amount of transcript knockdown was observed when compared with a gfp control treatment. Rs-nlp-15 relative transcript abundance: 0.77 ± 0.05; gfp relative transcript abundance: 1.035

± 0.035, p= 0.0492 (Figure 3.3A). As with the previous experiments in vitro RNAi of the non-neuronal gene Rs-eng-1 was also assessed under the same conditions. In this case knockdown of the target gene was not achieved. Rs-eng-1 relative transcript abundance: 2.21 ± 0.41; gfp relative transcript abundance: 1.275 ± 0.275, p= 0.1987 (Figure 3.3B).

110

Chapter 3: in vitro RNAi

Figure 3.2. Transcriptional expression analysis of genes Rs-nlp-15 and Rs-eng-1 from Radopholus similis under different experimental conditions. (A) Mean ratio of Rs-nlp-15 transcript abundance relative to endogenous reference genes, following treatment with 2mg/ml Rs-nlp-15 dsRNA over a 24h incubation period, with additives. (B) Mean ratio of Rs-eng-1 transcript abundance relative to endogenous reference genes, following treatment with 2mg/ml Rs-eng-1 dsRNA over a 24h incubation period, with additives. (C) Mean ratio of Rs-nlp-15 transcript abundance relative to endogenous reference genes, following treatment with 5mg/ml Rs-nlp-15 dsRNA over a 24h incubation period, with additives. (D) Mean ratio of Rs-eng-1 transcript abundance relative to endogenous reference genes, following treatment with 2mg/ml Rs-eng-1 dsRNA over a 24h incubation period without additives. Endogenous reference genes refer to Rs-β-tubulin and Rs-actin. Additives refer to Gelatin (0.05%), Octopamine Hcl (50Mm) and Spermidine (3mM). Treatment with either gfp or neo dsRNA served as non-endogenous controls. Data shows the mean ±SEM *, P<0.05 (student unpaired t-Test, Graphpad prism 7).

111

Chapter 3: in vitro RNAi

Figure 3.3. Transcriptional expression analysis of genes Rs-nlp-15 and Rs-eng-1 from Radopholus similis following electroporation treatment. (A) Mean ratio of Rs-nlp-15 transcript abundance relative to endogenous reference genes, following electroporation at 1000mV prior to a 24h incubation with 2mg/ml Rs-nlp-15 dsRNA, with additives. (B) Mean ratio of Rs-eng-1 transcript abundance relative to endogenous reference genes, following electroporation at 1000mV prior to a 24h incubation with 2mg/ml Rs-eng-1 dsRNA, with additives. Endogenous reference genes refer to Rs-β-tubulin and Rs-actin. Additives refer to Gelatin (0.05%), Octopamine Hcl (50mM) and Spermidine (3mM). Treatment with gfp dsRNA served as non-endogenous controls. Data shows the mean ±SEM *, P<0.05 (student unpaired t-Test, Graphpad prism 7).

3.4.3. RNAi screen of African Root Knot Nematode isolates

As discussed in the introduction, it has been established that different isolates of the same species of C. elegans have different RNAi capabilities (Félix et al., 2011).

To test this in PPNs an RNAi screen of multiple RKNs was carried out. Both M. incognita and M. javanica isolates were tested in this screen. For each experiment the nematodes were incubated for 24h with 0.5mg/ml dsRNA targeting nlp-15 and nlp-3 of the target species. A standardised approach was used to facilitate testing several isolates. The conditions selected were based on the success Dash et al.

(2017) had in knocking down their target genes Mi-nlp-3 and Mi-nlp-12. In these experiments the methodology applied by Dash et al. was tested and nlp-3 was used

112

Chapter 3: in vitro RNAi as a positive control for this purpose. When following the aforementioned protocol treatment with 0.5m/ml dsRNA for 24h did not result in target transcript knockdown across all 10 isolates tested. (Figures 3.4 and 3.5).

113

Chapter 3: in vitro RNAi

Figure 3.4. Treatment of African RKN Meloidogyne incognita isolates does not result in specific gene target knockdown. q-RT-PCR expression analysis of Mi-nlp-15 and Mi-nlp-3 relative to endogenous reference genes Mi-β-actin and Mi-β-tubulin following 24 h treatment with 0.5mg/ml dsRNA complementary to Mi-nlp-15 and Mi-nlp-3; and gfp as a non-endogenous control.(A) isolate 1-nig-ing-3d (B) isolate 1-nig-ing-3e (C), isolate 2-nig-ing-4a (D), isolate 2-nig-ing-4b (E), isolate 2-nig- ing-4c. Data shown represent the mean±SEM (Graphpad prism,7).

114

Chapter 3: in vitro RNAi

115

Chapter 3: in vitro RNAi

Figure 3.5.. Treatment of African RKN Meloidogyne javanica isolates does not result in specific gene target knockdown. q-RT-PCR expression analysis of Mj-nlp-15 and Mj-nlp-3 relative to endogenous reference genes Mi-β-actin and Mi-β-tubulin following 24 h treatment with 0.5mg/ml Mi-nlp-15 and Mi-nlp-3 and gfp as a non-endogenous control. (A) isolate 1-nig-jav-2e (B) isolate 1- nig-jav-2f (C), isolate 2-nig-jav-2a (D), isolate 2-nig-jav-2c (E), isolate 2-nig-jav-2e. Data shown represent the mean±SEM (student unpaired t-test, Graphpad prism,7).

116

Chapter 3: in vitro RNAi

3.5. Discussion

The aim of this chapter was to establish an in vitro RNAi platform that would successfully knockdown the nlp-15 gene in the migratory endoparasitic PPN R. similis and the sedentary endoparasites M. incognita and M. javanica. Expression patterns of nlp-15 in the model nematode C. elegans suggest pleiotropic roles in sensory perception, feeding and development. For example, nlp-15 has been localised to the amphid neuron ASH (Li, 2008). This is a sensory neuron involved in nociception and social feeding (de Bono et al., 2002; Hilliard et al., 2004; Sambongi et al., 1999). Additionally, nlp-15 expression has been localised to the intestine of C. elegans as well as neurons that innervate vulval muscles (Nathoo et al., 2001).

These expression data suggest the involvement of nlp-15 in coordinating important behaviours. If this functionality is translated across PPNs then this gene may be exploited as a potential novel nematicide target. Disrupting these important behaviours may provide protection to crops and represents a worthwhile avenue of investigation.

Additionally, previous work carried out within our research group demonstrated that RNAi silencing of the nlp-15 gene in the Potato Cyst Nematode

G. pallida resulted in dysregulation of important parasitism behaviours such as chemosensation and stylet thrusting (personal communication with L Wilson and J

Dalzell). The successful knockdown of the nlp-15 gene in these species may help to further elucidate its function and provide novel insights in to its role in parasitism.

Conservation of neuropeptides in both free living and parasitic nematodes is

117

Chapter 3: in vitro RNAi prominent and specific motifs conserved between species indicates functional conservation may also be present. For example, several nlp genes across different species have been found to encode the YGGYG motif found in the putative antimicrobial peptides of C. elegans nlp-24 -33 (McVeigh et al., 2008). Taking advantage of this conservation to target multiple PPN species using a singular approach would make for a favourable control strategy.

In addition, nlp-15 represents a promising gene target for novel control strategies as it is one of several nlp genes that encode NLP peptides which do not require C-terminal amidation for biological function (Warnock et al., 2017). As such, constructs encoding nlp-15 can be transformed and utilised in bacterial delivery systems. Warnock et al (2017) demonstrated transgenic secretion of NLPs using the rhizobacterium Bacillus subtilis and the microalgae Chlamydomonas reinhardtii resulted in reduced tomato infection by G. pallida and M. incognita up to 90%. The group conducted a screen of unamidated NLPs and the NLP-15b peptide encoded by nlp-15 was shown to disrupt important parasitism in an in vitro screen.

To gain further insight in to the function of this gene, a series of experiments was designed to test the in vitro RNAi susceptibility of the above mentioned PPNs.

As a starting point, the successful RNAi silencing methodology established by Urwin et al. (2002) was used. This method uses a soaking procedure to introduce the silencing triggers; dsRNA. Additionally, a biogenic amine was applied to stimulate feeding behaviour and facilitate dsRNA uptake. In these experiments Octopamine

HCl was used as the stimulating agent. Using this soaking procedure, it was not possible to stimulate target gene knockdown in R. similis (Figure 3.2A). The reason

118

Chapter 3: in vitro RNAi for this has yet to be elucidated. As there are many variables associated with RNAi experiments, such as gene target, dsRNA concentration, the use of additives, and each may impact its efficacy, more extensive studies could be carried out to further probe RNAi in R. similis. However, it may be that RNAi is simply not an efficient means to study gene function in PPNs. Other research groups have been successful in triggering RNAi silencing of their target genes in R. similis using a similar approach (Haegman et al., 2009; Zhang et al., 2012).

It is known that neuronal cells of C. elegans isolates are relatively recalcitrant to neuronal RNAi (Kamath et al., 2003). This may also be true with PPNs and so one control measure taken in these experiments was to include a gene which is not neuronally expressed in the R. similis genome. The gene chosen was

Rs-eng-1 which encodes the cell wall degrading enzyme endo-1,-4-beta-glucanase

(Haegeman et al., 2008). Under the same conditions Rs-eng-1 did display a very modest reduction in transcript abundance when compared to control gene gfp

(Figure 3.2B).

RNAi experiments are notoriously difficult to reproduce between research groups (Maule et al., 2011). Also, as mentioned different worm isolates may also have an impact on any RNAi experiment. In some cases knockdown of PPN genes has been accomplished without the additives mentioned above (Dalzell et al., 2010;

Nsengimana et al., 2013) However, when targeting Rs-eng-1 using this approach transcript reduction was not achieved (Figure 3.2D).

When RNAi was first discovered, Fire et al. demonstrated how only a few molecules of dsRNA were required to obtain a potent and specific response.

119

Chapter 3: in vitro RNAi

However it is not uncommon to require substantial amounts of the silencing trigger to achieve target gene knockdown. For example, (Morris et al., 2017) needed to apply 5mg/ml dsRNA to the entomopathogenic nematode Steinernema carpocapse to achieve substantial transcript knockdown of the FMRF amide neuropeptide gene flp-21. They showed how lesser amounts of exogenous dsRNA (1mg/ml) did not achieve the same level of transcript reduction.With this in mind, 5mg/ml Rs-nlp-15 dsRNA was applied to mixed stage R. similis nematodes to stimulate gene silencing.

In this experiment however, the increase in dsRNA did not achieve transcript reduction (see figure 3.2C).

Another means which has been used to stimulate RNAi is electroporation

(Issa et al., 2005). In a similar concept to bacterial transformation, electroporating nematodes is thought to make cells more ‘porous’ and therefore amenable to dsRNA uptake. When R. similis was electroporated as described above, prior to incubation with 2mg/ml dsRNA a small amount of transcript reduction was observed (23%) (Figure 3.3A). Comparing these results with the previous experiment without electroporation (Figure 3.2A) it is apparent that electroporation did improve R. similis’ RNAi response to exogenous nlp-15 dsRNA.

Electroporation has been the most effective means used to trigger transcript silencing seen so far but the level of knockdown is very slight. Further testing is needed to establish if any measurable phenotypes are apparent with this level of gene silencing. It may be the case that with this specific gene target in R. similis in vitro RNAi is not a feasible test to elucidate gene function.

120

Chapter 3: in vitro RNAi

A potential reason for the lack of reproducibility of RNAi experiments between laboratories is the different nematode isolates being used. It has been demonstrated that different isolates of the same species of nematode can differ in their ability to mount an RNAi response to RNA viruses. As discussed in the introduction this was shown by Félix et al. (2011) where different wild-type C. elegans isolates displayed different level of viral infection and this was linked to the isolate’s ability to elicit an RNAi response. As such, this investigation was set up to screen a range of PPN isolates of the Meloidogyne spp. to assess if there were any strains that would exhibit transcript knockdown in response to exogenously applied target dsRNA. For this study, nlp-3 was also selected as a target for gene silencing.

Dash et al. (Dash et al. 2017) successfully silenced this gene in M. incognita using in vitro RNAi. Following gene knockdown, they observed aberrant behaviors. The same Mi-nlp-3 primers were used for both dsRNA synthesis and transcript quantification as were used by Dash et al. In addition, Mj-nlp-3 primers were designed as described in the methods section (see table 3.1). A standard approach was used across the screen following the same methodology used by Dash et al. As described above, no transcript knockdown was observed across all isolates tested using this method. Again, this highlights the issues present in this area of research.

Specifically, reproducibility between research groups remains a problem.

The current study looks at some of the variables involved in in vitro RNAi experiments in an attempt to optimise a working RNAi platform to further investigate the role of nlp-15 in PPNs. However, many variables exist and it would appear that each target investigation may require a specific set of conditions for optimal silencing. As such, using in vitro RNAi to study neuropeptide gene function

121

Chapter 3: in vitro RNAi in PPNs may not be the most efficient means. Certainly, it seems this approach is not high throughput and alternative strategies to study gene function are more suited.

122

Chapter 3: in vitro RNAi

3.6. References

Abad, P., Gouzy, J., Aury, J.-M., Castagnone-Sereno, P., Danchin, E.G.J., Deleury, E., Perfus- Barbeoch, L., et al. (2008), ‘Genome sequence of the metazoan plant-parasitic nematode Meloidogyne incognita’, Nature Biotechnology, Vol. 26 No. 8, pp. 909–915.

Aboobaker, A.A. and Blaxter, M.L. (2003), ‘Use of RNA interference to investigate gene function in the human filarial nematode parasite Brugia malayi’, Molecular and Biochemical Parasitology, Vol. 129 No. 1, pp. 41–51. de Bono, M., Tobin, D.M., Davis, M.W., Avery, L. and Bargmann, C.I. (2002), ‘Social feeding in Caenorhabditis elegans is induced by neurons that detect aversive stimuli’, Nature, Vol. 419 No. 6910, pp. 899–903.

Campochiaro, P.A. (2006), ‘Potential applications for RNAi to probe pathogenesis and develop new treatments for ocular disorders’, Gene Therapy, Vol. 13 No. 6, pp. 559– 562.

Chen, X., Yang, Y., Yang, J., Zhang, Z. and Zhu, X. (2012), ‘RNAi-Mediated Silencing of Paramyosin Expression in Trichinella spiralis Results in Impaired Viability of the Parasite’, edited by Carlow, C.K.PLoS ONE, Vol. 7 No. 11, p. e49913.

Chung, W.-J., Okamura, K., Martin, R. and Lai, E.C. (2008), ‘Endogenous RNA Interference Provides a Somatic Defense against Drosophila Transposons’, Current Biology, Vol. 18 No. 11, pp. 795–802.

Dalzell, J.J., McMaster, S., Fleming, C.C. and Maule, A.G. (2010), ‘Short interfering RNA- mediated gene silencing in Globodera pallida and Meloidogyne incognita infective stage juveniles’, International Journal for Parasitology, Vol. 40 No. 1, pp. 91–100.

Dalzell, J.J., Warnock, N.D., McVeigh, P., Marks, N.J., Mousley, A., Atkinson, L. and Maule, A.G. (2012), ‘Considering RNAi experimental design in parasitic helminths.’, Parasitology, Vol. 139 No. 5, pp. 589–604.

Dash, M., Dutta, T.K., Phani, V., Papolu, P.K., Shivakumara, T.N. and Rao, U. (2017), ‘RNAi- mediated disruption of neuropeptide genes, nlp-3 and nlp-12 , cause multiple behavioral defects in Meloidogyne incognita’, Biochemical and Biophysical Research Communications, Vol. 490 No. 3, pp. 933–940.

Dietzl, G., Chen, D., Schnorrer, F., Su, K.-C., Barinova, Y., Fellner, M., Gasser, B., et al. (2007),

123

Chapter 3: in vitro RNAi

‘A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila’, Nature, Vol. 448 No. 7150, pp. 151–156.

Félix, M.-A., Ashe, A., Piffaretti, J., Wu, G., Nuez, I., Bélicard, T., Jiang, Y., et al. (2011), ‘Natural and Experimental Infection of Caenorhabditis Nematodes by Novel Viruses Related to Nodaviruses’, edited by Hodgkin, J.PLoS Biology, Vol. 9 No. 1, p. e1000586.

Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E. and Mello, C.C. (1998), ‘Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans’, Nature, Vol. 391 No. 6669, pp. 806–811.

Haegeman, A., Jacob, J., Vanholme, B., Kyndt, T. and Gheysen, G. (2008), ‘A family of GHF5 endo-1,4-beta-glucanases in the migratory plant-parasitic nematode Radopholus similis’, Plant Pathology, Vol. 57 No. 3, pp. 581–590.

Haegman, A., Vanholme, B. and Gheysen, G. (2009), ‘Characterization of a putative endoxylanase in the migratory plant-parasitic nematode Radopholus similis’, Molecular Plant Pathology, Vol. 10 No. 3, pp. 389–401.

Hall, S.E., Chirn, G.-W., Lau, N.C. and Sengupta, P. (2013), ‘RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans’, RNA, Vol. 19 No. 3, pp. 306–319.

Hamilton, A.J. (1999), ‘A Species of Small Antisense RNA in Posttranscriptional Gene Silencing in Plants’, Science, Vol. 286 No. 5441, pp. 950–952.

Hilliard, M.A., Bergamasco, C., Arbucci, S., Plasterk, R.H.A. and Bazzicalupo, P. (2004), ‘Worms taste bitter: ASH neurons, QUI-1, GPA-3 and ODR-3 mediate quinine avoidance in Caenorhabditis elegans’, The EMBO Journal, Vol. 23 No. 5, pp. 1101– 1111.

Hughes, C.L. and Kaufman, T.C. (2000), ‘RNAi analysis of Deformed, proboscipedia and Sex combs reduced in the milkweed bug Oncopeltus fasciatus: novel roles for Hox genes in the hemipteran head.’, Development (Cambridge, England), Vol. 127 No. 17, pp. 3683–3694.

Issa, Z., Grant, W.N., Stasiuk, S. and Shoemaker, C.B. (2005), ‘Development of methods for RNA interference in the sheep gastrointestinal parasite, Trichostrongylus colubriformis’, International Journal for Parasitology, Vol. 35 No. 9, pp. 935–940.

Kamath, R. (2003), ‘Genome-wide RNAi screening in Caenorhabditis elegans’, Methods, Vol.

124

Chapter 3: in vitro RNAi

30 No. 4, pp. 313–321.

Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., et al. (2003), ‘Systematic functional analysis of the Caenorhabditis elegans genome using RNAi’, Nature, Vol. 421 No. 6920, pp. 231–237.

Konopova, B. and Jindra, M. (2007), ‘Juvenile hormone resistance gene Methoprene- tolerant controls entry into metamorphosis in the beetle Tribolium castaneum’, Proceedings of the National Academy of Sciences, Vol. 104 No. 25, pp. 10488–10493.

Li, C. (2008), ‘Neuropeptides’, WormBook, No. 212, pp. 1–36.

Martin, S.E. and Caplen, N.J. (2007), ‘Applications of RNA Interference in Mammalian Systems’, Annual Review of Genomics and Human Genetics, Vol. 8 No. 1, pp. 81–108.

Maule, A.G., McVeigh, P., Dalzell, J.J., Atkinson, L., Mousley, A. and Marks, N.J. (2011), ‘An eye on RNAi in nematode parasites’, Trends in Parasitology.

McVeigh, P., Alexander-Bowman, S., Veal, E., Mousley, A., Marks, N.J. and Maule, A.G. (2008), ‘Neuropeptide-like protein diversity in phylum Nematoda’, International Journal for Parasitology, Vol. 38 No. 13, pp. 1493–1503.

Morris, K.V. and Rossi, J.J. (2006), ‘Antiviral Applications of RNAi’, in Erdmann, V., Barciszewski, J. and Brosius, J. (Eds.), RNA Towards Medicine, Springer Berlin Heidelberg, Berlin, Heidelberg, pp. 105–116.

Morris, R., Wilson, L., Sturrock, M., Warnock, N.D., Carrizo, D., Cox, D., Maule, A.G., et al. (2017), ‘A neuropeptide modulates sensory perception in the entomopathogenic nematode Steinernema carpocapsae’, PLOS Pathogens, Vol. 13 No. 3, p. e1006185.

Nathoo, A.N., Moeller, R.A., Westlund, B.A. and Hart, A.C. (2001), ‘Identification of neuropeptide-like protein gene families in Caenorhabditis elegans and other species’, Proceedings of the National Academy of Sciences, Vol. 98 No. 24, pp. 14000–14005.

Nsengimana, J., Bauters, L., Haegeman, A. and Gheysen, G. (2013), ‘Silencing of Mg-pat-10 and Mg-unc-87 in the Plant Parasitic Nematode Meloidogyne graminicola Using siRNAs’, Agriculture, Vol. 3 No. 3, pp. 567–578.

Obbard, D.J., Gordon, K.H.., Buck, A.H. and Jiggins, F.M. (2009), ‘The evolution of RNAi as a defence against viruses and transposable elements’, Philosophical Transactions of the Royal Society B: Biological Sciences, Vol. 364 No. 1513, pp. 99–115.

125

Chapter 3: in vitro RNAi

Pekarik, V., Bourikas, D., Miglino, N., Joset, P., Preiswerk, S. and Stoeckli, E.T. (2003), ‘Screening for gene function in chicken embryo using RNAi and electroporation’, Nature Biotechnology, Vol. 21 No. 1, pp. 93–96.

Sambongi, Y., Nagae, T., Liu, Y., Yoshimizu, T., Takeda, K., Wada, Y. and Futai, M. (1999), ‘Sensing of cadmium and copper ions by externally exposed ADL, ASE, and ASH neurons elicits avoidance response in Caenorhabditis elegans’, NeuroReport, Vol. 10 No. 4, pp. 753–757.

Shabalina, S. and Koonin, E. (2008), ‘Origins and evolution of eukaryotic RNA interference’, Trends in Ecology & Evolution, Vol. 23 No. 10, pp. 578–587.

Tabara, H. (1998), ‘Reverse Genetics:RNAi in C. elegans: Soaking in the Genome Sequence’, Science, Vol. 282 No. 5388, pp. 430–431.

Urwin, P.E., Lilley, C.J. and Atkinson, H.J. (2002), ‘Ingestion of Double-Stranded RNA by Preparasitic Juvenile Cyst Nematodes Leads to RNA Interference’, Molecular Plant- Microbe Interactions, Vol. 15 No. 8, pp. 747–752.

Warnock, N.D., Wilson, L., Patten, C., Fleming, C.C., Maule, A.G. and Dalzell, J.J. (2017), ‘Nematode neuropeptides as transgenic nematicides.’, edited by Mackey, D.PLoS Pathogens, Vol. 13 No. 2, p. e1006237.

Winston, W.M. (2002), ‘Systemic RNAi in C. elegans Requires the Putative Transmembrane Protein SID-1’, Science, Vol. 295 No. 5564, pp. 2456–2459.

Zhang, C., Xie, H., Xu, C.-L., Cheng, X., Li, K.-M. and Li, Y. (2012), ‘Differential expression of Rs-eng-1b in two populations of Radopholus similis (Tylenchida: Pratylecnchidae) and its relationship to pathogenicity’, European Journal of Plant Pathology, Vol. 133 No. 4, pp. 899–910.

126

Chapter 3: in vitro RNAi

Chapter 4.

Development of Transgenic Tomato Plants Expressing Mi-nlp- 15: Methods and Future Perspectives

127

Chapter 4: Transgenic Tomato

4.1. Abstract

Plant parasitic nematodes impose significant economic losses on global agriculture, threatening food security. European Union and global treaties imposing the withdrawal of many chemical nematacides due to environmental toxicity means new control strategies are required. Localisation of neuropeptide-like protein (nlp) genes in the model nematode Caenorhabditis elegans suggest pleiotropic roles in sensory perception, feeding, and development. The ability to target different nlp genes across PPN species using RNA interference will enable a functional profile to be developed, increasing our understanding of NLP signalling and validating their potential as control targets. Targeting nematode genes involved in feeding, development, reproduction and innate immunity through in planta production of dsRNA means that RNAi could be used directly as a control strategy. Here we show the early stages of developing transgenic tomato plants using Agrobacterium- mediated plant transformation. We have designed and synthesised a binary pART27 vector with an intron-containing hairpin RNAi silencing cartridge with sense and antisense fragments complementary to Mi-nlp-15. We have demonstrated the process of transforming this vector into tomato ( ‘MoneyMaker’) using cotyledons as explant material. Further development of this protocol will be used to study the effect our transgenic lines have on invading juveniles. This approach has the potential to both study genes of interest, such as those involved in parasitism, feeding and development, and to reduce the burden imposed by PPNs through field deployment of resistant transgenic plants.

128

Chapter 4: Transgenic Tomato

4.2. Introduction

In planta RNAi can be used to overcome a major bottleneck associated with in vitro

RNAi, that is the delivery of silencing molecules to all parasitic life stages of the nematode. dsRNA may be readily ingested as PPNs feed on a transgenic plant synthesising silencing triggers complementary to a gene of interest (Bakhetia et al.,

2005). Current literature on in vivo delivery of silencing triggers to facilitate target transcript knockdown have shown this technique to be widely successful in PPNS encompassing various plant and nematode species as well as multiple gene targets

(Chaudhary et al., 2019; Steeves et al., 2006; Yadav et al., 2006).

For example, one research group used transgenic Arabidopsis thaliana plants expressing dsRNA complementary to a RKN effector molecule to silence the gene in feeding nematodes (Huang et al., 2006). This peptide (16D10) is expressed in the early stages of parasitism when feeding sites are being established.

Transgenic A. thaliana expressing siRNA silencing triggers resulted in resistance to four economically important Meloidogyne species (Huang et al., 2006). The authors showed this gene to be highly conserved across these four species and this work demonstrated the potential for in planta RNAi to be used to study gene function and to confer broad resistance to multiple RKN species. Applying this to important crop species represents a promising control strategy for multiple species.

Enriched genome databases for economically important species allows careful selection of the target gene when designing Host Induced Gene Silencing

(HIGS) experiments (Abad et al., 2008; Cotton et al., 2014; Opperman et al., 2008).

The ability to choose a target gene with high nucleotide identity across different

129

Chapter 4: Transgenic Tomato species may enable strategies that confer broad spectrum resistance to host plants.

Furthermore, publication of many host plant genomes allows smart design of constructs to select gene fragments with little or no homology to endogenous plant genes thus reducing unintended off target effects (Fernandez-Pozo et al., 2015).

HIGS takes advantage of a plant’s innate response to mount an RNAi defence response to foreign RNA molecules (Buchon and Vaury, 2006). The plant’s endogenous RNAi machinery will act upon these molecules, processing them into siRNA silencing triggers. These siRNA molecules are subsequently ingested by feeding-nematodes via the feeding tube ultimately resulting in sequence specific degradation of the target transcript.

4.2.1 A. tumefaciens T-DNA transfer

A. tumefaciens, the causative agent of crown gall disease (Nester et al., 1984), is a natural genetic engineer, which is utilised in molecular plant biology to introduce transgenes into a plant’s genome (Gelvin, 1998). Wild type A. tumefaciens have a tumour inducing (Ti) plasmid, named because it contains an oncogenic region that integrates into the plant genome inducing uncontrolled cell division resulting in a tumorous phenotype (Van Larebeke et al., 1975). The section of DNA that is transferred to the plant is called T-DNA. The Ti plasmid contains the virulence (vir) genes, which are activated by plant phenolic compounds, such as acetosyringone, released at wound sites and encode the proteins required for transfer of single strand T-DNA into the nucleus of the plant (Baker et al., 2005; Subramoni et al.,

2014). Moreover, these compounds also induce bacterial chemotaxis towards the plant facilitating the bacteria-host close interaction required for the transfer of

130

Chapter 4: Transgenic Tomato genetic material (Guo et al., 2017). virA and virG genes encode effector molecules which regulate expression of the vir genes in response to plant emitted compounds

(Winans et al., 1994).

The precise mechanism of T-DNA transfer and integration is not completely understood, however the function of various effectors involved have been elucidated (Gelvin, 2012; Li et al., 2018). The T-DNA is bordered by short direct repeat nucleotide sequences comprising the left- and right-hand borders (LB and

RB). Significantly, virD2, an endonuclease required for excising the T-DNA strand from the Ti plasmid, only relies on recognition of these border sequences to function (Yanofsky et al., 1986). This permits modification of this region between the LB and RB for genetic engineering purposes. VirD2 remains bound to the 5’ end of the T-strand (Young and Nester, 1988) and is subsequently translocated out of the bacterial cell crossing the cell membrane via a secretion system made up of virB1-Virb11 effector proteins encoded by virB and VirD4 (Fullner et al., 1996).

A combination of bacterial and host factors is required for chromosomal integration, although the mechanism remains to be fully elucidated. Although different models of integration have been proposed (Gelvin, 2017), naturally occurring breaks in host DNA appear to be favourable integration sites allowing for integration of the T-strand via DNA repair pathways facilitated by the plant (Tzfira et al., 2003). Although a greater understanding of these mechanisms is required to advance biotechnological techniques, the result of T-DNA being inserted into a host plant’s genome can be exploited to enable stable plant transformation. Disarmed

131

Chapter 4: Transgenic Tomato binary vector systems containing a transgene of interest are utilised allowing gene function and crop plant improvement studies (Kiyokawa et al., 2009).

4.2.2 Vector Design

A silencing construct must be synthesised and successfully transformed into the plant. A popular vector choice to produce an intron-containing hairpin RNA

(ihpRNA) construct is the intermediate vector pHANNIBAL. Hairpin RNA is single stranded self-complimentary RNA separated by an intron loop which is subsequently processed in vivo to produce dsRNA. This type of construct has been shown to improve RNAi efficiency in plants when compared to antisense strand silencing (Wesley et al., 2001). In this instance we synthesised pHANNIBAL vectors containing sense and antisense inserts complimentary to a 200 bp region of our genes of interest, in this case the nlp-15 gene encoded in the M. incognita genome.

This silencing construct must then be transformed into a binary vector amenable to plant transformation. pART27 is one such binary vector that can be used for agrobacterium mediated plant transformation. pART27 contains a modified T-DNA region delimited by a LB and RB, and a Not1 restriction site facilitates incorporation of the pHANNIBAL derived RNAi expression cassette containing the forward and reverse inserts including the intron region and a constitutive CMV35s promoter (Gleave, 1992). This vector can then be transformed into A. tumefaciens, which is subsequently used for plant transformation. This chapter describes the process of production and maintenance of transgenic tomato plants synthesising dsRNA complimentary to Mi-nlp-15 gene of interest and discusses future directions for this work.

132

Chapter 4: Transgenic Tomato

4.3. Materials and Methods

4.3.1. pHannibal Vector Construction and Transformation into E. coli

A 200 bp M. incognita nlp-15 forward strand, with an upstream T7 promoter, flanked by restriction sites (Xho I and EcoRI), and a 200 bp reverse strand with an upstream T7 promoter, flanked by restrictions sites (Bam HI and Xba I), were synthesised by GeneArt. Fragments were restricted, with the forward strand ligated into Multiple Cloning Site (MCS) 1 of the plant vector pHANNIBAL, and the reverse strand ligated into MCS 2 using T4 DNA ligase (New England Biolabs) (Figure

4.1.). E. coli TOPO 10 cells (Invitrogen) were transformed with recombinant pHANNIBAL by electroporation, grown in LB with 100 ug/ml of ampicillin (Merck), and the plasmid extracted using the High Pure Plasmid Isolation Kit (Roche).

Successful cloning was confirmed by sequencing (Eurofins).

4.3.2. pART 27 Vector Construction and Transformation into E. coli

The pHANNIBAL vector with the sequence confirmed forward and reverse strands was restricted using NOT I (New England Biolabs), and the larger fragment containing the inserts excised by gel extraction NucleoSpin™ Gel and PCR Clean- up (Macherey-Nagel), and ligated into the NOT I restriction sites of the binary vector pART27. Successful ligation was confirmed by transforming the pHANN- pART27 construct into E. coli, grown in 100 ug/ml of spectinomycin (Sigma). The plasmid was extracted using the High Pure Plasmid Isolation Kit (Roche) and successful cloning was confirmed by sequencing (Eurofins).

133

Chapter 4: Transgenic Tomato

4.3.3. Transformation of pHANN-pART27 binary vector into A. tumefaciens

Sequenced confirmed pHANN-pART27 containing the forward and reverse inserts were transformed into electro-competent A. tumefaciens. A. tumefaciens strain

AGL1 competent cells were transformed by electroporation with a pulse of 2.2KV delivered to the plasmid, electro-competent cell mixture. Cells were suspended in

LB broth and incubated at 28˚C for 2 hours whilst agitated at 180rpm, before being plated on LB agar selective plates (100µg/ml Spectinomycin). Positive colonies were selected by colony PCR using MCS2 universal plasmid backbone primers:

MCS2F: 5'- TCGAACATGAATAAACAAGCTAACA-3'

MCS2R: 5'-AGGCGTCTCGCATATCTCAT-3'

Positive transformants were stored as single use glycerol stocks.

4.3.4. Agrobacterium-mediated plant transformation of tomato ‘Moneymaker’

Tomato seeds (‘Moneymaker’) were sterilised with 2.5% sodium hypochlorite solution for 2 minutes, washed 3 times with autoclaved ddH20 and sown on 0.5%

MS agar (Murashige and Skoog) plates. Plates were incubated at 4˚C for 48 hours, after which they were germinated at 23˚C with 16h of white light (140-160µE.m-1.s-

1)/8 h dark. Explants from 7-10-day old tomato seedlings were used for plant transformation.

4.3.5. Agrobacterium tumefaciens Culturing

10ml of LB broth (Merck) with 200µg/ml Spectinomycin (Merck) as a selective agent was inoculated with A. tumefaciens strain AGL1 glycerol stock prepared as above.

134

Chapter 4: Transgenic Tomato

The Agrobacterium was cultured for 48 hours at 28˚C in a shaking incubator

(180rpm). Agrobacterium solutions were normalised to an OD600 of 0.5 and resuspended in MS media.

4.3.6. Co-cultivation, Callus induction

Cotyledons were cut to give explants of approximately 0.5mm. The cotyledons were then incubated in the Agrobacterium solution for 10 minutes before being blotted dry on sterile filter paper and transferred to co-cultivation plates abaxial side down.

The co-cultivation plates were sealed with parafilm and incubated at 25˚C for 48 hours in darkness.

Following co-cultivation explants were transferred to callus induction media plates, sealed with micropore tape and incubated at 25˚C with 16h of white light (140-

160µE.m-1.s-1)/8 h dark. Explants were transferred to fresh callus induction media every 2 weeks with any contaminated material being discarded.

4.3.7 Shoot and root elongation

Explants that developed callus tissue were transferred to shoot elongation media plates. Callus tissue was cultured in Petri dishes until the propagation material became too large for the Petri dish, after which they were transferred to magenta jars containing shoot elongation media.

After 6 weeks of shoot development in magenta jars, shoots were cut from the callus tissue at the longest possible length and transferred to root elongation media. The Callus tissue was then transferred to fresh shoot elongation media to allow for further shoots to develop from the tissue. Shoots were left in root

135

Chapter 4: Transgenic Tomato elongation media until roots began to develop (approximately 2 weeks). Once several roots had emerged from a shoot it was then transferred to a soil pot (John

Innes no.2) and watered daily. Shoots that failed to develop roots at the first attempt were re-cut and placed in fresh rooting medium. (See Table 4.1 for composition of the various plant transformation media).

Table 4.1. Plant Transformation Media Components

Media Type Media Composition

MS 4.4g/l Ms, 30g/l Sucrose, 100µM Acetosyringone, pH 5.8

Callus Induction 4.4g/l Ms, 30g/l Sucrose, 3g/l phytagel, 1.5mg/l Zeatin, 100µg/ml

Kanamycin, 325mg/ml Timentin, pH5.8

4.4g/l Ms, 30g/l Sucrose, 3g/l phytagel, 1mg/l Zeatin, 100µg/ml Kanamycin, Shoot Elongation 325mg/ml Timentin, pH5.8

2.2g/l Ms, 15g/l Sucrose, 3g/l phytagel, 50mg/l Kanamycin, 325mg/l Root elongation Timentin, pH5.8

4.3.10 Checking Putative Transgenic Plants for pART27 Expression

Plants that developed root systems and were subsequently transferred to soil were tested for the pART-27 plasmid expression. A small leaf cutting was taken and flash frozen in liquid Nitrogen before being crushed. Total genomic DNA was extracted using the PureLink Genomic Plant DNA purification kit (Invitrogen) according to the manufacturer’s instructions. The resultant DNA was quantified using the NanoDrop

136

Chapter 4: Transgenic Tomato

1000 Spectrophotometer before being used as template for an end-point PCR reaction using the MCS2 F/R universal pART27 backbone primers. PCR products were assessed via gel electrophoresis.

4.3.11 Checking Putative Transgenic Plants for Target Trans-gene Expression

Plants which tested positive for the presence of pART27 were further tested for Mi- nlp-15 transgene expression. Tissue was snap frozen in liquid Nitrogen and crushed with a pestle and mortar into a fine powder. Frozen tissue was transferred to an

Eppendorf and total RNA extracted using the Maxwell 16LEV Simply RNA tissue kit

(Promega) which was processed using the Maxwell 16 instrument (Promega). Total

RNA was eluted in 40µl of nuclease free water (Promega) and DNase treated (37˚C for 30 minutes) to remove genomic DNA contamination (Turbo DNase, Invitrogen).

The DNase treated RNA was then quantified using the NanoDrop 1000

Spectrophotometer. The RNA was reverse transcribed to produce first strand cDNA using the High Capacity RNA to cDNA kit (Applied Biosystems) according to the manufacturer’s instructions. The cDNA served as a template to amplify a 100 bp region of the target gene using Mi-nlp15 forward and reverse primers:

Mi-nlp-15 F: 5’-CCCAGCACAGAAATCAGCTC-3’

Mi-nlp-15 R: 5’-AAACCGGTAAAGCCTGGAGT -3’

The PCR reactions were carried out in a 50µl reaction mixture consisting of 25µl 2x

MyTaqTM Mix (BioLine); 1µl of forward and reverse primer (20µM), 2µl of cDNA template, distilled water to total reaction volume. PCR products were assessed by gel electrophoresis.

137

Chapter 4: Transgenic Tomato

Mi-nlp-15 Forward Insert ATGTCACGCTAGGAACCAAAAGGCTCGAGACAGGCACACAAGCTTTGTTACTCCCTG TAATACTCTCTACATTAATTGTTACTAGAACAATCGCTGCCCCAGCACAGAAATCAGCT CTTGTAGCTACTCCGCCTAAAGAAAATGTAAAGCGAGCTTTTGACTCTTTTGGAACTC CAGGCTTTACCGGTTTTGATAAACGATCGTTTGATTCCTTCACAGGCTCTGGATTGAA TTCTGCTGACCCACAGATGGTTAATG Mi-nlp-15 Reverse Insert ATGTCACGCTAGGAACCAAAAGGGGATCCAATCCAGAGCCTGTGAAGGAATCAAAC GATCGTTTATCAAAACCGGTAAAGCCTGGAGTTCCAAAAGAGTCAAAAGCTCGCTTT ACATTTTCTTTAGGCGGAGTAGCTACAAGAGCTGATTTCTGTGCTGGGGCAGCGATT GTTCTAGTAACAATTAATGTAGAGAGTATTACAGGGAGTAACAAAGCTTGTGTGCCTG TTCTAGATGCTGACCCACAGATGGTTAATG

Figure 4.1. A 200bp fragament of Mi-nlp-15 was incorporated into pHANNIBAL intermediate vector. The forward strand was ligated in to MCS 1and the reverse strand ligated in to MCS2 (MCS 1 and MCS2 Highlighted in red circles). Highlighted in green are the forward and reverse primers for each insert. In yellow are the 200bp fragments. In blue are the restriction sites.

138

Chapter 4: Transgenic Tomato

4.4 Results

4.4.1. Agrobacterium tumefaciens-mediated Plant Transformation

The model tomato cultivar (‘Moneymaker’) was transformed with A. tumefaciens

AGL1 strain containing pART27 with our gene of interest in a hairpin RNAi construct. Cotyledons cut to approximately 0.5cm from 7-10 day old tomato seedlings were used as explant tissue. These were co-cultivated with A. tumefaciens before being sub-cultured on callus induction medium (Figure 4.2. A and B). The callus induction media contained Timentin to supress the excess A. tumefaciens cells from the plant tissue. Timentin is a mixture consisting of the penicillin derived antibiotic ticarcillin disodium and the β-lactamase inhibitor clavulanate potassium.

This antibiotic has shown to have negligible phytotoxic effects with respect to callus formation and shoot generation (Costa et al., 2000; Zhang et al., 2017). Callus induction media was also supplemented with the plant growth hormone zeatin.

Zeatin is a cytokinin important for plant growth and development (Schäfer et al.,

2015).

Explants began to develop callus tissue at approximately 3 weeks post co- cultivation after which shoot buds began to regenerate (Figure 4.2. C). Callus tissue from which shoots emerged were subsequently transferred to shoot elongation media to facilitate shoot generation (Figure 4.2. D). Multiple shoots were produced from callus tissue which had developed shoot buds and shoot elongation was further promoted at this stage by reducing the concentration of zeatin in the shoot

139

Chapter 4: Transgenic Tomato

elongation media to 1mg/l. In all media Kanamycin was used as the selective agent

for transgenic cells.

A B

D C

Figure 4.2. Stages of Agrobacterium-mediated Plant Transformation. (A) Explants in co-cultivation

media (B) Explants in callus induction media (C) Callus tissue formation (D)Shoots emerging from

callus tisse

Following a period of elongation shoots were cut close to the shoot bud and

transferred to rooting medium (Figure 4.3. A). After approximately 2 weeks in

rooting medium shoots which developed roots were selected for transfer to soil

(Figure 4.3. B and C). Following transfer to soil, those plants which established in

140

Chapter 4: Transgenic Tomato

soil were tested for expression of the pART27 plasmid. Successful transformants

were allowed to develop to mature plants with flower formation visible after

approximately 8 weeks in soil (Figure 4.3. D) Table 4.2. shows the transformation

efficiency for one experiment was 20%, where efficiency was determined as the

percentage of explants that produced rooted plants in rooting medium.

A B

C D

Figure 4.3. Plant Transformation (A) Shoots propagating in shoot-elongation media. (B) putative

transformant potted in soil (C) Growth of putative transgenic plant (D) Flowers on putative

transgenic plant.

141

Chapter 4: Transgenic Tomato

Table 4.2. Transformation efficiency of tomato

No. of explants No. of explants that No. of calli that Transformation inoculated with A formed callus tissue resulted in rooted Efficiency a tumefaciensb plants

50 24 10 20% a percentage of explants forming rooted plants in rooting medium b A tumefaciens transformed with pART27 containing Mi-nlp-15 transgene

4.4.2. Transgenic Plant Confirmed by PCR using Universal pART27 Backbone

Primers

Once a putative transgenic plant had established in soil, a small leaf cutting was taken for total DNA extraction and PCR amplification to confirm the presence of the binary pART27 vector. Figure 4.4. represents pART27 expression from two independent transgenic lines. Figures 4.4. A and B show the expected 350 bp gene fragment when DNA was amplified using the multiple cloning site 2 universal plasmid backbone primers (MSC2 F/R). These results show that for two independent transgenic plants the pART27 vector containing M-nlp-15 silencing fragments has been stably incorporated into the plant’s genome.

147

Chapter 4: Transgenic Tomato

Figure 4.4. End-point PCR Gel electrophoresis image confirms presence of pART27 plasmid in transgenic plant. (A) (B) Bands representative of pART27 expression following total DNA extractions from putative transformed plant tissue and PCR amplification using universal plasmid backbone primers (MCS2 F/R). (C) Negative control using total DNA extracted from untransformed tomato plant tissue. (D) Positive control using pAT27 plasmid as template DNA for PCR amplification. Marker

DNA ladder bands represent 100bp increments. Expected product size: 350 bp.

4.4.3. Confirmation of Mi-nlp-15 gene expression in transgenic plant

Thus far, we have shown incorporation of the binary vector pART27 into the genome of tomato plants. The presence of pART27 in the genome however does not confirm expression of our transgene. In order to show that Mi-nlp-15 dsRNA is being expressed in our transgenic plant total RNA was extracted, reverse transcribed and PCR amplified using primers designed to amplify a 100 bp region of the 200 bp fragment incorporated into the silencing construct. The amplified cDNA was examined using gel electrophoresis (Figure 4.5). These results demonstrate the production of a transgenic tomato plant with our modified pART27 vector

148

Chapter 4: Transgenic Tomato incorporated in the genome and we have shown that in vivo transcription of our transgene has resulted in expression of the Mi-nlp-15 transgene.

Figure 4.5. Reverse Transcriptase (RT)-PCR confirms nlp-15 expression in Transgenic Plant. (A,B,C)

Bands representative of Mi-nlp-15 expression in transgenic plant (confirmed in figure 4.4.) following total RNA extraction from plant tissue, reverse transcription and end-point PCR amplification of the cDNA using Mi-nlp-15 qF/qR primers. (D) Positive control using pART27 plasmid with sequence confirmed Mi-nlp-15 hairpin RNAi construct. (E) Negative control using total RNA extracted from untransformed tomato plant tissue. Marker DNA ladder represents 100 bp increments. Expected product size: 100 bp.

149

Chapter 4: Transgenic Tomato

4.5. Discussion

As discussed throughout this thesis nematode neuropeptides are abundant throughout the nervous system and play a role in coordinating all aspects of behaviour, including parasitism behaviours (Li, 2008). As such, the ability to determine the functions of specific neuropeptides may open the door for novel nematacide treatments.

Here we have produced a transgenic plant expressing the Mi-nlp-15 transgene. This gene encodes for eight neuropeptides, one of which, NLP-15b, has been shown to negatively impact host-finding behaviours in both M. incognita and

G. pallida when delivered using a B. subtilis transgenic delivery system (Chapter 3)

(Warnock et al., 2017). Additionally, localisation of nlp-15 to cells of the anterior neurons suggest its role in sensory perception (Chapter 2) and the ability to target nematode genes involved in sensory perception and development through in planta

RNAi could facilitate next generation control approaches.

Agrobacterium-mediated plant transformation is facilitated by the gram- negative soil bacterium A. tumefaciens. Wild-type A tumefaciens cause crown gall disease in dicotyledons (Guo et al., 2011). This occurs through the stable insertion of a region of their genome (T-DNA) into the plant’s genome. This T-DNA (A section of the Ti plasmid) region encodes for auxin and cytokinin which accumulate causing uncontrolled proliferation resulting in the characteristic tumorous phenotype. T-

DNA also contains the genes necessary for opine synthesis which is metabolised specifically by A. tumefaciens. Thus, this bacterium uses host plant machinery to create its own specific nutrient source (Lacroix and Citovsky, 2019). The discovery

150

Chapter 4: Transgenic Tomato that the genes within the T-DNA region could be replaced with target trans genes and subsequently inserted into the plant’s genome brought about the production of the first transgenic tobacco plant in 1983 (Zambryski et al., 1983). Since then, many plants have been genetically engineered using A. tumefaciens (Bechtold and

Pelletier, 1998; Fillatti et al., 1987; Han et al., 2000; Nishimura et al., 2006) and numerous vectors and methodologies have been optimised for specific plant species and cultivar (Hellens et al., 2000; McBride and Summerfelt, 1990; Nakagawa et al., 2009).

For this work, our gene silencing construct was produced by cloning both sense and antisense fragments of a 200 bp region of Mi-nlp-15 into the intermediate vector pHANNIBAL (Figure4.1). This intermediate vector was constructed for the purpose of inserting a single PCR product that could be made into an effective hairpin RNA (hpRNA) silencing cassette for subcloning into the binary vector pART27 (Wesley et al., 2001). Wesley et al. demonstrated the inclusion of an intron sequence between the strands of the hairpin RNA improved target gene silencing efficiency in plants. It has been hypothesised that intron splicing improves formation of the self-complimentary hairpin RNA duplex (Smith et al., 2000). As such, the pHANNIBAL vector in this study encodes a PDK (Pyruvate

Orthophosphate Dikinase) intron sequence between both multiple cloning sites where sense and antisense sequences of our gene of interest are ligated.

A useful feature of pHANNIBAL is the ability to remove the expression cartridge as a Not I fragment and insert into a binary vector ( Wesley et al., 2001).

The binary vector pART27 was used for stable insertion of our transgene into the

151

Chapter 4: Transgenic Tomato plant genome. pART27 encodes replicons for both maintenance in A. tumefaciens and enhanced copy number in E. coli (Gleave, 1992). This feature allowed us to obtain high copy number clones of the plasmid using E. coli for subsequent sequence confirmation and transformation into Agrobacterium. Bacteria selection is conferred by a spectinomycin resistance gene which allows selection of positive transformants in both E. coli and A. tumefaciens. Explants were co-cultivated with transformed Agrobacterium after which transgenic plant selection was facilitated by the kanamycin resistance gene incorporated within the T-DNA region of our binary vector. Furthermore, pART27 was designed with reduced duplicated promoter sequences as these are thought to cause instability of the vector in both the bacteria and plants genomes (Gleave, 1992).

For one transformation experiment in this study the efficiency was calculated to be 20%. The transformation efficiency was calculated as the number of rooted plants in rooting medium relative to the number of co-cultivated explants as a percentage (Table 4.2.). Putative transformants were transferred to soil, at which point some failed to establish and some tested negative when DNA was extracted and pART27 expression was tested. As such, the final transformation efficiency will be <20% in terms of confirmed positive transgenic lines. Rooted plants which established in soil and then tested negative for vector expression were deemed escapes. These are non-transformed cells which regenerated from explant tissue despite antibiotic selection and can be a common issue with plant transformation experiments (PEÑA et al., 2004; Sarker et al., 2009; Yasmeen et al.,

2009). Additionally, false positives may also arise due to the chimeric nature of callus tissue. This is caused by limited exposure of the selective antibiotic to non-

152

Chapter 4: Transgenic Tomato transformed cells due to protection by nearby transgenic cell lines. As a result chimeric callus tissue is produced which consists of both transformed and non- transformed cells (Chen, 2011; Faize et al., 2010).

In order to confirm expression of our transgene total RNA was extracted from plants confirmed to have incorporated pART27 into their genome. Reverse transcriptase (RT) PCR demonstrated that our transgene Mi-nlp-15 was being expressed by the plant as shown in Figure 4.4. This demonstrates we have produced a transgenic tomato plant containing a modified binary vector pART27 and this vector is being processed by the plant to express our transgene. Expression of Mi-nlp-15 dsRNA by the plant represents a means to deliver silencing triggers to feeding nematodes. Ultimately, we hope this will allow functional studies to be carried out to discern the effects nlp-15 silencing has on nematode development and behaviour with the aim to develop this platform as a next generation control strategy.

4.6. Future work

This chapter details just the beginning stages of producing transgenic tomato lines for gene function studies. Firstly, further optimisation of the tomato transformation protocol is required to improve efficiency to produce multiple stably transformed plants including control lines. The methodology used in this work was adapted from a protocol developed for the miniature tomato cultivar, MicroTom (Sun et al.,

2006). The authors reported transformation efficiencies of >40% for one of their transgenes. Since the first example of Agrobacterium-mediated transformation of tomato (McCormick et al., 1986), reported transformation efficiencies in tomato

153

Chapter 4: Transgenic Tomato cultivars have varied greatly (Frary and Earle, 1996; Park et al., 2003; van Roekel et al., 1993), highlighting the need for optimisation for specific plants species, cultivars, bacteria strain and even the trans gene to be inserted. In order to improve our transformation efficiency different variables need to be tested comparatively to the protocol outlined here.

It should be noted that time taken from start to rooted plant in soil is approximately 4 months and so improvement of regeneration times would also be beneficial. One group demonstrated the addition of indole-3-acetic acid (IAA) to the media reduced the overall transformation time in the tomato cultivar M82 whilst obtaining >50% frequency (Gupta and Van Eck, 2016). Currently our plant transformation media contains just the plant growth regulator zeatin. Various studies have seen improved results through supplementing media with plant hormones (Soliman et al., 2017; Li et al., 2017). Another factor which impacts on plant transformation is the bacterial strain used. Here the highly virulent AGL1 strain was used. Due to the aggressiveness of this strain strong antibiotic regimes are needed to remove bacterial cells following co-cultivation. The persistence of A. tumefaciens in the culture media can cause false positive results and so regular transfer to fresh media containing Timentin is required. The benefit of a virulent bacteria strain is an improved transformation frequency as has been observed (Van

Eck et al., 2019).

A review by Altperter et al. (2016) considers the many issues associated with current plant transformation protocols and the areas of improvement necessary to overcome the bottleneck of inefficient transformations and unstable

154

Chapter 4: Transgenic Tomato transformation event. Further work is necessary to improve plant transformation via tissue culture in order lessen culture time and improve efficiency to fully take advantage of this technology in crop plants.

In this work a positive transformant expressing Mi-nlp-15 was determined using RT-PCR. Progressing from here, positive transformants should be further screened using Northern blot analysis across multiple tissues, particularly the roots.

The purpose of this experiment is to produce transgenic tomato plants that synthesise dsRNA complementary to our gene of interest in the nematode in order to induce RNAi silencing of this gene in vivo. This is achieved by infecting our transgenic plants with infective juveniles which set up feeding sites and ingest the cytoplasmic contents of the plant. As such, we need to determine that each transgenic line is expressing silencing triggers in roots tissue. Confirmation of both long dsRNA and siRNA molecules in the roots can be achieved through a Northern blot as demonstrated here (Huang et al., 2006).

Confirmed T0 plants should then be grown to maturity and seeds harvested from the fruits generated. T1 seeds must then be germinated on kanamycin plates to select for progeny that have inherited the resistance gene associated with pART27 expression. Again, PCR and RNA blot analysis will be conducted to determine trans gene expression.

Agrobacterium-mediated transgene integration into the plant genome is random (Gelvin, 2017). In the absence of novel approaches for tomato transformation, the current strategy relies on producing many transformation events and selecting successful transformations to take forward for analysis, a

155

Chapter 4: Transgenic Tomato laborious task. (approximately 10 T1 lines for each transgene is ideal). Positively identified transgenic plants will need to be assessed for trans gene copy number and integration site. Both factors have important consequences for transgene expression levels, stability and overall plant health (Betts et al., 2019; Strauss and

Sax, 2016). A single copy integration is favourable at a site which does not have consequences for important plant growth and health traits (Kohli et al., 2006;

Latham et al., 2006). Following the production of transgenic tomato plants that have been assessed as above, we can move forward with infection assays to determine what effect our transgenic lines have on nematode behaviour and target gene expression levels.

Transgenic plants will be challenged with M. incognita infection. Control plants will include those transformed with an empty pART27 blank vector and plants transformed with a non-endogenous nematode gene, gfp or neomycin. Post- infection, plants should be assayed for physical characteristics compared to controls, this will include counting galls and assessing the overall visible health of the root system. Extracted eggs should be hatched and infective juveniles analysed for nlp-15 silencing as carried out in chapter2.

Clearly, continuation of this work is required to meet the aims of this project. These early stages outline the production of transgenic tomato plants expressing a trans gene silencing molecule complementary to a nematode neuropeptide gene. Conceptually, this system has the potential to improve our knowledge on the function of individual genes. Importantly, if resistance is

156

Chapter 4: Transgenic Tomato conferred to these transgenic plants this could represent a novel control strategy available for field deployment when policy permits.

157

Chapter 4: Transgenic Tomato

4.7. References

Abad, P., Gouzy, J., Aury, J.-M., Castagnone-Sereno, P., Danchin, E.G.J., Deleury, E., Perfus-

Barbeoch, L., et al. (2008), ‘Genome sequence of the metazoan plant-parasitic

nematode Meloidogyne incognita’, Nature Biotechnology, Vol. 26 No. 8, pp. 909–915.

Altpeter, F., Springer, N.M., Bartley, L.E., Blechl, A.E., Brutnell, T.P., Citovsky, V., Conrad,

L.J., et al. (2016), ‘Advancing crop transformation in the era of genome editing’, Plant

Cell

Baker, C.J., Mock, N.M., Whitaker, B.D., Roberts, D.P., Rice, C.P., Deahl, K.L. and Aver’yanov,

A.A. (2005), ‘Involvement of acetosyringone in plant–pathogen recognition’,

Biochemical and Biophysical Research Communications, Vol. 328 No. 1, pp. 130–136.

Bakhetia, M., Charlton, W.L., Urwin, P.E., McPherson, M.J. and Atkinson, H.J. (2005), ‘RNA

interference and plant parasitic nematodes’, Trends in Plant Science, Vol. 10 No. 8, pp.

362–367.

Bechtold, N. and Pelletier, G. (1998), ‘In planta Agrobacterium-mediated transformation of

adult Arabidopsis thaliana plants by vacuum infiltration.’, Methods in Molecular

Biology (Clifton, N.J.)

Betts, S.D., Basu, S., Bolar, J., Booth, R., Chang, S., Cigan, A.M., Farrell, J., et al. (2019),

‘Uniform Expression and Relatively Small Position Effects Characterize Sister

Transformants in Maize and Soybean’, Frontiers in Plant Science, Vol. 10

Buchon, N. and Vaury, C. (2006), ‘RNAi: A defensive RNA-silencing against viruses and

transposable elements’, Heredity

Chaudhary, S., Dutta, T.K., Tyagi, N., Shivakumara, T.N., Papolu, P.K., Chobhe, K.A. and Rao,

U. (2019), ‘Host-induced silencing of Mi-msp-1 confers resistance to root-knot

nematode Meloidogyne incognita in eggplant’, Transgenic Research

158

Chapter 4: Transgenic Tomato

Chen, G.Q. (2011), ‘Effective reduction of chimeric tissue in transgenics for the stable

genetic transformation of lesquerella fendleri’, HortScience

Costa, M.G.C., Nogueira, F.T.S., Figueira, M.L., Otoni, W.C., Brommonschenkel, S.H. and

Cecon, P.R. (2000), ‘Influence of the antibiotic timentin on plant regeneration of

tomato ( Lycopersicon esculentum Mill.) cultivars’, Plant Cell Reports, Vol. 19 No. 3,

pp. 327–332.

Cotton, J.A., Lilley, C.J., Jones, L.M., Kikuchi, T., Reid, A.J., Thorpe, P., Tsai, I.J., et al. (2014),

‘The genome and life-stage specific transcriptomes of Globodera pallida elucidate key

aspects of plant parasitism by a cyst nematode’, Genome Biology, Vol. 15 No. 3, p.

R43.

Van Eck, J., Keen, P. and Tjahjadi, M. (2019), ‘Agrobacterium tumefaciens-Mediated

Transformation of Tomato’, Methods in Molecular Biology, pp. 225–234.

Faize, M., Faize, L. and Burgos, L. (2010), ‘Using quantitative real-time PCR to detect

chimeras in transgenic tobacco and apricot and to monitor their dissociation’, BMC

Biotechnology, Vol. 10 No. 1, p. 53.

Fernandez-Pozo, N., Rosli, H.G., Martin, G.B. and Mueller, L.A. (2015), ‘The SGN VIGS Tool:

User-Friendly Software to Design Virus-Induced Gene Silencing (VIGS) Constructs for

Functional Genomics’, Molecular Plant, Vol. 8 No. 3, pp. 486–488.

Fillatti, J.A.J., Sellmer, J., McCown, B., Haissig, B. and Comai, L. (1987), ‘Agrobacterium

mediated transformation and regeneration of Populus’, MGG Molecular & General

Genetics

Frary, A. and Earle, E.D. (1996), ‘An examination of factors affecting the efficiency

ofAgrobacterium-mediated transformation of tomato’, Plant Cell Reports, Vol. 16 No.

3–4, pp. 235–240.

159

Chapter 4: Transgenic Tomato

Fullner, K.J., Lara, J.C. and Nester, E.W. (1996), ‘Pilus assembly by Agrobacterium T-DNA

transfer genes’, Science

Gelvin, S.B. (1998), ‘The introduction and expression of transgenes in plants’, Current

Opinion in Biotechnology, Vol. 9 No. 2, pp. 227–232.

Gelvin, S.B. (2012), ‘Traversing the Cell: Agrobacterium T-DNA’s Journey to the Host

Genome’, Frontiers in Plant Science, Vol. 3

Gelvin, S.B. (2017), ‘Integration of Agrobacterium T-DNA into the Plant Genome’, Annual

Review of Genetics

Gleave, A.P. (1992), ‘A versatile binary vector system with a T-DNA organisational structure

conducive to efficient integration of cloned DNA into the plant genome’, Plant

Molecular Biology

Guo, M., Bian, X., Wu, X. and Wu, M. (2011), ‘Agrobacterium-Mediated Genetic

Transformation: History and Progress’, Genetic Transformation

Guo, M., Huang, Z. and Yang, J. (2017), ‘Is there any crosstalk between the chemotaxis and

virulence induction signaling in Agrobacterium tumefaciens?’, Biotechnology Advances

Gupta, S. and Van Eck, J. (2016), ‘Modification of plant regeneration medium decreases the

time for recovery of Solanum lycopersicum cultivar M82 stable transgenic lines’, Plant

Cell, Tissue and Organ Culture (PCTOC), Vol. 127 No. 2, pp. 417–423.

Han, K.H., Meilan, R., Ma, C. and Strauss, S.H. (2000), ‘An Agrobacterium tumefaciens

transformation protocol effective on a variety of cottonwood hybrids (genus

Populus)’, Plant Cell Reports

Hellens, R.P., Anne Edwards, E., Leyland, N.R., Bean, S. and Mullineaux, P.M. (2000),

‘pGreen: A versatile and flexible binary Ti vector for Agrobacterium-mediated plant

160

Chapter 4: Transgenic Tomato

transformation’, Plant Molecular Biology

Huang, G., Allen, R., Davis, E.L., Baum, T.J. and Hussey, R.S. (2006), ‘Engineering broad root-

knot resistance in transgenic plants by RNAi silencing of a conserved and essential

root-knot nematode parasitism gene’, Proceedings of the National Academy of

Sciences of the United States of America

Kiyokawa, K., Yamamoto, S., Sakuma, K., Tanaka, K., Moriguchi, K. and Suzuki, K. (2009),

‘Construction of Disarmed Ti Plasmids Transferable between Escherichia coli and

Agrobacterium Species’, Applied and Environmental Microbiology, Vol. 75 No. 7, pp.

1845–1851.

Kohli, A., González-Melendi, P., Abranches, R., Capell, T., Stoger, E. and Christou, P. (2006),

‘The quest to understand the basis and mechanisms that control expression of

introduced transgenes in crop plants’, Plant Signaling and Behavior,

Lacroix, B. and Citovsky, V. (2019), ‘Pathways of DNA Transfer to Plants from

Agrobacterium tumefaciens and Related Bacterial Species’, Annual Review of

Phytopathology, Vol. 57 No. 1, pp. 231–251.

Van Larebeke, N., Genetello, C., Schell, J., Schilperoort, R.A., Hermans, A.K., Hernalsteens,

J.P. and Van Montagu, M. (1975), ‘Acquisition of tumour-inducing ability by non-

oncogenic agrobacteria as a result of plasmid transfer’, Nature

Latham, J.R., Wilson, A.K. and Steinbrecher, R.A. (2006), ‘The Mutational Consequences of

Plant Transformation’, Journal of Biomedicine and Biotechnology, Vol. 2006, pp. 1–7.

Li, C. (2008), ‘Neuropeptides’, WormBook, pp. 1–36.

Li, X., Tu, H. and Pan, S.Q. (2018), ‘Agrobacterium Delivers Anchorage Protein VirE3 for

Companion VirE2 to Aggregate at Host Entry Sites for T-DNA Protection’, Cell Reports,

Vol. 25 No. 2, pp. 302-311.e6.

161

Chapter 4: Transgenic Tomato

Li, S., Cong, Y., Liu, Y., Wang, T., Shuai, Q., Chen, N., Gai, J. and Li, Y. (2017), 'Optomisation

of Agrobacterium-mediated Transformation in Soybean', Front Plant Sci

McBride, K.E. and Summerfelt, K.R. (1990), ‘Improved binary vectors for Agrobacterium-

mediated plant transformation’, Plant Molecular Biology,

McCormick, S., Niedermeyer, J., Fry, J., Barnason, A., Horsch, R. and Fraley, R. (1986), ‘Leaf

disc transformation of cultivated tomato (L. esculentum) using Agrobacterium

tumefaciens’, Plant Cell Reports

Nakagawa, T., Ishiguro, S. and Kimura, T. (2009), ‘Gateway vectors for plant

transformation’, Plant Biotechnology, Vol. 26 No. 3, pp. 275–284.

Nester, E.W., Gordon, M.P., Amasino, R.M. and Yanofsky, M.F. (1984), ‘Crown Gall: A

Molecular and Physiological Analysis’, Annual Review of Plant Physiology

Nishimura, A., Aichi, I. and Matsuoka, M. (2006), ‘A protocol for Agrobacterium-mediated

transformation in rice’, Nature Protocols, Vol. 1 No. 6, pp. 2796–2802.

Opperman, C.H., Bird, D.M., Williamson, V.M., Rokhsar, D.S., Burke, M., Cohn, J., Cromer, J.,

et al. (2008), ‘Sequence and genetic map of Meloidogyne hapla: A compact nematode

genome for plant parasitism’, Proceedings of the National Academy of Sciences of the

United States of America,

Park, S.H., Morris, J.L., Park, J.E., Hirschi, K.D. and Smith, R.H. (2003), ‘Efficient and

genotype-independent Agrobacterium - Mediated tomato transformation’, Journal of

Plant Physiology

Pena, L., Perez, R.M., Cervera, M., Juarez, J.A. and Navarro, L. (2004), ‘Early Events in

Agrobacterium-mediated Genetic Transformation of Citrus Explants’, Annals of

Botany, Vol. 94 No. 1, pp. 67–74.

162

Chapter 4: Transgenic Tomato van Roekel, J.S.C., Damm, B., Melchers, L.S. and Hoekema, A. (1993), ‘Factors influencing

transformation frequency of tomato (Lycopersicon esculentum)’, Plant Cell Reports

Sarker, R.H., Islam, K. and Hoque, M.I. (2009), ‘In vitro regeneration and Agrobacterium-

mediated genetic transformation of tomato (Lycopersicon esculentum Mill.)’, Plant

Tissue Culture and Biotechnology

Schäfer, M., Brütting, C., Meza-Canales, I.D., Großkinsky, D.K., Vankova, R., Baldwin, I.T. and

Meldau, S. (2015), ‘The role of cis-zeatin-type cytokinins in plant growth regulation

and mediating responses to environmental interactions’, Journal of Experimental

Botany

Smith, N.A., Singh, S.P., Wang, M.-B., Stoutjesdijk, P.A., Green, A.G. and Waterhouse, P.M.

(2000), ‘Total silencing by intron-spliced hairpin RNAs’, Nature, Vol. 407 No. 6802, pp.

319–320.

Soliman, H.I.A., Abo-El-Hasan, F.M., El-seedy, A.S. and Mabrouk, Y.M. (2017),

‘Agrobacterium-mediated transformation of tomato (Lycopersicon esculentum Mill.)

using a synthetic cry1ab gene for enhanced resistance against Tuta absoluta

(Meyrick)’, Journal of Microbiology, Biotechnology and Food Sciences

Steeves, R.M., Todd, T.C., Essig, J.S. and Trick, H.N. (2006), ‘Transgenic soybeans expressing

siRNAs specific to a major sperm protein gene suppress Heterodera glycines

reproduction’, Functional Plant Biology

Strauss, S.H. and Sax, J.K. (2016), ‘Ending event-based regulation of GMO crops’, Nature

Biotechnology

Subramoni, S., Nathoo, N., Klimov, E. and Yuan, Z.C. (2014), ‘Agrobacterium tumefaciens

responses to plant-derived signaling molecules’, Frontiers in Plant Science

Sun, H.J., Uchii, S., Watanabe, S. and Ezura, H. (2006), ‘A highly efficient transformation

163

Chapter 4: Transgenic Tomato

protocol for Micro-Tom, a model cultivar for tomato functional genomics’, Plant and

Cell Physiology

Tzfira, T., Frankman, L.R., Vaidya, M. and Citovsky, V. (2003), ‘Site-Specific Integration of

Agrobacterium tumefaciens T-DNA via Double-Stranded Intermediates’, Plant

Physiology

Varsha Wesley, S., Helliwell, C.A., Smith, N.A., Wang, M., Rouse, D.T., Liu, Q., Gooding, P.S.,

et al. (2001), ‘Construct design for efficient, effective and high-throughput gene

silencing in plants’, Plant Journal

Warnock, N.D., Wilson, L., Patten, C., Fleming, C.C., Maule, A.G. and Dalzell, J.J. (2017),

‘Nematode neuropeptides as transgenic nematicides.’,PLoS Pathogens, Vol. 13 No. 2,

p. e1006237.

Wesley, S. V, Helliwell, C.A., Smith, N.A., Wang, M.B., Rouse, D.T., Liu, Q., Gooding, P.S., et

al. (2001), ‘Construct design for efficient, effective and high-throughput gene silencing

in plants’, The Plant Journal, Vol. 27 No. 6, pp. 581–590.

Winans, S.C., Mantis, N.J., Chen, C.Y., Chang, C.H. and Dong Cho Han. (1994), ‘Host

recognition by the VirA, VirG two-component regulatory proteins of Agrobacterium

tumefaciens’, Research in Microbiology

Yadav, B.C., Veluthambi, K. and Subramaniam, K. (2006), ‘Host-generated double stranded

RNA induces RNAi in plant-parasitic nematodes and protects the host from infection’,

Molecular and Biochemical Parasitology, Vol. 148 No. 2, pp. 219–222.

Yanofsky, M.F., Porter, S.G., Young, C., Albright, L.M., Gordon, M.P. and Nester, E.W.

(1986), ‘The virD operon of Agrobacterium tumefaciens encodes a site-specific

endonuclease’, Cell

Yasmeen, A., Mirza, B., Inayatullah, S., Safdar, N., Jamil, M., Ali, S. and Choudhry, M.F.

164

Chapter 4: Transgenic Tomato

(2009), ‘In planta transformation of tomato’, Plant Molecular Biology Reporter

Young, C. and Nester, E.W. (1988), ‘Association of the virD2 protein with the 5’ end of T

strands in Agrobacterium tumefaciens.’, Journal of Bacteriology

Zambryski, P., Joos, H., Genetello, C., Leemans, J., Van Montagu, M. and Schell, J. (1983), ‘Ti

plasmid vector for the introduction of DNA into plant cells without alteration of their

normal regeneration capacity’, The EMBO Journal

Zhang, H., Wang, G., Qiao, Y. and Chen, C. (2017), ‘Effects of timentin and other β-lactam

antibiotics on callus induction, shoot regeneration, and rooting in Anthurium

andraeanum Linden ex Andre’, In Vitro Cellular & Developmental Biology - Plant, Vol.

53 No. 3, pp. 219–225.

165

Chapter 5: General Discussion

Chapter 5.

General Discussion

166

Chapter 5: General Discussion

5.1 Thesis Context

The devastating effects of PPNs on crop production can be felt worldwide. Their impact is particularly concerning in regions of Africa where small hold subsistence farming predominates and reliance on successful cropping is critical for both income and food security (Coyne et al., 2018). Estimates for economic losses ascribed to PPNs vary (Abad et al., 2008; Elling, 2013) with broad disease symptoms and a lack of nematode awareness amongst farmers contributing to discrepancies in these evaluations (Jones et al., 2013). Despite varying estimates, it is clear losses due to PPN damage reach billions of dollars annually. Moreover, increasing population projections are a stark reminder that global food security is yet to be obtained and the situation will only worsen without drastic up-scaling of crop production to meet an ever-growing demand (FAO, 2009). The need to increase crop production is in direct competition with our ability to manage plant pests.

Current PPN control strategies fall short for reasons discussed in this thesis introduction and reviewed here (El-Sappah et al., 2019; Ntalli and Caboni, 2012;

Westphal, 2011). Fully utilising biotechnological advances in plant and nematode molecular biology is fundamental for next generation nematicide development that improves upon and looks beyond current control methods.

Nematode neuropeptides represent a group of signal transducers that underpin nematode behaviour. The function of many of these neuropeptides remains to be understood, however advances in gene silencing techniques in nematodes has helped to improve our knowledge of some (Dash et al., 2017).

167

Chapter 5: General Discussion

Indeed, elucidating neuropeptide function and the signalling pathways by which they act will improve our ability to design control systems which act specifically to negatively impact important nematode behaviours. Neuropeptide-like proteins remain to be the least characterised class of neuropeptide. This thesis explores different methodologies available to study nlp/NLP function in PPNs and highlights key issue hampering progress in this area.

5.2. Delivery of dsRNA to PPNs via Soaking

Chapter 3 investigated different experimental protocols available to induce transcript knockdown in economically important nematodes. Despite using soaking methodologies which have been widely successfully in PPN RNAi (Rosso et al., 2005;

Urwin et al., 2002) we did not observe significant target transcript knockdown without the use of electroporation. R. similis was electroporated to induce dsRNA uptake and this led to a modest silencing effect relative to house-keeping genes and compared to controls. Electroporation has long been used in scientific studies to improve delivery of nucleic acid molecules to cells of a range of organisms by inducing a transient permeability (Miller et al., 1988; Neumann et al., 1982). As such, RNAi experiments have successfully utilised this technique to deliver silencing triggers to an organism of interest. Geldhof et al. (2006) targeted 4 genes in the parasitic nematode Haemonchus contortus for gene silencing and demonstrated reduced transcript expression for two of these genes. In this study, electroporation of dsRNA failed to significantly reduce transcript levels of two target genes.

Furthermore, many of the electroporated larvae subsequently died disallowing phenotype assays to be conducted. This demonstrates varying success of

168

Chapter 5: General Discussion electroporation to facilitate RNAi, with different gene targets factoring into this.

One group demonstrated the induction of RNAi induced phenotypes in the sheep gastrointestinal parasite Trichostrongylus colubriformis after electroporation treatment with both long dsRNA and siRNA triggers (Issa et al., 2005). Issa et al. did not however determine transcript knockdown using RT-PCR and so it is difficult to state these results are definitely a result of target gene silencing or an artefact of the experiment itself inducing the observed phenotype. This issue was highlighted by Dalzell et al. (2009) who demonstrated that non-endogenous control dsRNA caused aberrant phenotypes in both M. incognita and G. pallida infective juveniles following soaking (Dalzell et al., 2009).

Another group used electroporation to test the efficiency of RNAi in the pinewood nematode Bursaphelenchus xylophilus and reported an RNAi induced phenotype. Again, using the electroporation method the authors did not assess specific transcript knockdown using RT-PCR (Park et al., 2008). In this thesis electroporation of dsRNA complementary to Rs-nlp-15 only led to slight knockdown. Further optimisation of these method is required. However, reproducibility is an issue with these experiments with many variables playing a role in the outcome (Maule et al., 2011). More understanding of the pathway components and mechanisms across individual species is required for RNAi to reach its full potential in plant nematology gene studies.

A further study was conducted in Chapter 3 to ascertain if distinct populations of M. incognita and M. javanica isolated from Suh-Sharan Africa differed in their ability to mount an RNAi response to exogenous dsRNA using a

169

Chapter 5: General Discussion standardised soaking method (Dash et al., 2017). Although different strains of a nematode species have shown variance in their ability to elicit and RNAi response

(Félix et al., 2011) this work showed no significant transcript knockdown across all isolates tested. As such, I would suggest that RNAi in PPNs is not efficacious enough or reliable enough to facilitate high throughput studies required for efficient gene function studies. The issue of limited genetic tools for gene studies in PPNs is considered by Kranse (Kranse et al., 2020). This group have developed a means to deliver and and express exogenous mRNA throughout the body of H. schachtii juveniles. This represents a promising step towards improved functional genetic tools to aid in understanding PPN biology; a step which will allow research to move away from the current reliance on RNAi for reverse genetics experiments.

5.3. Delivery of Nematode Neuropeptides using Transgenic B. subtilis

NLP-15b confers resistance to tomato seedlings from G. pallida and M. incognita infective juveniles in host invasion assays when the peptide is secreted into an agar slurry mixture containing transgenic B. subtilis (Warnock et al., 2017). B. subtills secrete the mature peptide under the direction of a signal peptide which functions to direct the secretion pathway, and this influences the amount of peptide secreted externally and its correct formation (Tjalsma et al., 2000).

Chapter 2 looks at the effect different signal peptides have on the efficacy of

NLP-15b secretion using the original studies’ host invasion assay. As the amount of peptide secreted could not be quantified the invasion assay was used to determine the signal peptide that resulted in the least number of invading G. pallida J2s. We

170

Chapter 5: General Discussion generated a B. subtilis clone library with each clone containing a unique signal peptide sequence fused to the ORF of the peptide. Each signal peptide clone was tested and compared to the original aprE signal peptide, which served as a control for this study. What we found was the different clones did generate varying levels of resistance to G. pallida in the tomato invasion assay. Three B. subtilis clones, designated 25, 47 and 61, provided the greatest protective effects relative to the control. Having enhanced the resistance of tomato to G. pallida, these B. subtilis unique signal peptide clones a promising starting point for further studies looking towards developing this system as novel nematicide agent. With this platform multi-species resistance could be achieved due to the sequence conservation that’s observed amongst neuropeptides across species. The NLP-15b amino acid sequence is identical in both G. pallida and M. incognita with exogenous application leading to aberrant behaviours in both. Moreover, it has been noted, that these neuropeptides share less sequence homology when compared with other nematodes of a different genus and did not negatively impact certain behaviours when tested with C. elegans and S. carpocapse. This is an important point as it appears this lack of sequence identity amongst other soil borne organisms will likely prevent off-target, non-specific effects, although more tests will be needed to fully explore this.

Much research has focused on the establishment of a feeding site and the sedentary stage of PCNs and RKNs. However, this work represents a potential means of controlling these pests at the point of invasion. This is greatly beneficial as

PPNs act as vectors for viruses and other plant pathogens (Brown et al., 1995).

Additionally, the wounding sites of entry generated during the migratory invasion

171

Chapter 5: General Discussion stage, generate points of entry for secondary pathogens such as fungi and bacteria

(Back et al., 2002). Reducing invasion events could confer additional resistance to these secondary pathogens and further reduce the damage and burden placed on the plant. Transgenic B. subtilis have been used in biotechnology for years and so their safety has been thoroughly investigated and have achieved GRAS status

(Elshaghabee et al., 2017). This thesis demonstrates a platform for use as a transgenic delivery mechanism of a neuropeptide with the potential to be scaled up for field deployment. Other unamidated neuropeptides may also be explored with this system with a stacking effect possibly increasing resistance.

5.4. Delivery of Silencing Triggers using VIGS Vectors

Chapter 2 also addresses the issues surrounding the in vitro delivery of dsRNA to non-feeding infective juveniles by using a VIGS platform to induce dsRNA/siRNA uptake via viral vectors modified with our gene of interest. This approach has been documented for studying genes in several plant nematode species (Chi et al., 2016;

Dubreuil et al., 2009; Kandoth et al., 2013). Surprisingly, when Chi et al exposed M. incognita juveniles to dsRNA complementary to the effector gene Mi-vap-2 using a

TRV VIGS platform in Nicotiana benthamiana they observed significant upregulation of this gene. The upregulation of Mi-vap-2 persisted in progeny nematodes and lead to an increase in pathogenicity as determined by the number of galls present compared to control plants. Although this outcome was unexpected in that their gene silencing technique lead to transcript upregulation, they were able to draw conclusions from this work which provides a potential role for Mi-vap-2 in pathogenicity (Chi et al., 2016). Moreover, this study silenced Mi16D10 as had been

172

Chapter 5: General Discussion demonstrated in previous studies using transgenic lines (Huang et al., 2006; Yang et al., 2013) to act as a positive control showing this method can be successfully used to silence target genes. Again, this study highlights the effect a chosen target has when attempting to induce RNAi and the benefits of using a previously silenced gene as a positive control.

The work presented in chapter 3 demonstrates that Mi-nlp-15 was not successfully targeted for silencing relative to controls. We were successful in establishing viral transmission in tomato as demonstrated by photobleaching due to knockdown of PDS, whilst using a topical painting method for viral application as developed within our group (Cox et al., 2019). Further work is required to optimise this platform for studying neuropeptide gene function with additional quality control measures needed as highlighted in chapter 3 of this thesis. Based on the previous studies mentioned using VIGS to study gene function it is clear this technique has the potential for high throughput studies to characterise nematode genes as well as plant genes important for plant-nematode interactions. However, what is needed is careful consideration on the gene target and use of appropriate controls to fully exploit this technique.

5.5. In Planta RNAi

Using transgenic plants to induce RNAi in target organisms and their progeny has been an invaluable tool allowing researchers to study plant pest genes in planta

(Ghag, 2017; Koch et al., 2013; Papolu et al., 2013; Shivakumara et al., 2017).

Chapter 4 begins to develop a method for studying Mi-nlp-15 through in planta

RNAi. Agrobacterium-mediated plant transformation was used to introduce an

173

Chapter 5: General Discussion ihpRNA silencing construct into tomato plants. Continuation of this work will see the production of multiple transgenic lines and controls followed by nematode gene function studies. Using this method to target genes of interest individually or by using multi-gene constructs to create a stacking effect will help to further our understanding of genes involved in plant parasitism. In addition, transgenic plants which negatively impact parasitism behaviours by silencing target genes have great nematicidal potential.

The use of transgenic crops for consumption continues to spark debate with issues surrounding biosafety, loss of biodiversity and selection of resistant strains being raised as cause for concern (Maghari and Ardekani, 2011). Nevertheless, in 26 countries GM crops were planted on 190 million hectares in 2017 (ISAA, 2017). The focus of this thesis was the development of dsRNA expressing plants to induce RNAi in a non-host, plant dwelling organism. Using this approach, some of the biosafety concerns surrounding the effect of protein molecules on non-target organisms can be alleviated as dsRNA targets a specific gene in a sequence dependent manner.

Proof of concept studies have been carried out using this approach with broad resistance being conferred to transgenic plants (Huang et al., 2006). Further work, as explained in Chapter 4, is needed to improve our transformation protocol and then to asses our transgenic plants and what effect they have on invading nematodes. Successful use of transgenic crops to alleviate the ongoing burden inflicted by plant parasitic nematodes will help in the goal to intensify crop production and feed an ever-growing population.

174

Chapter 5: General Discussion

5.6. References

Abad, P., Gouzy, J., Aury, J.-M., Castagnone-Sereno, P., Danchin, E.G.J., Deleury, E., Perfus-

Barbeoch, L., et al. (2008), ‘Genome sequence of the metazoan plant-parasitic

nematode Meloidogyne incognita’, Nature Biotechnology, Vol. 26 No. 8, pp. 909–915.

Back, M.A., Haydock, P.P.J. and Jenkinson, P. (2002), ‘Disease complexes involving plant

parasitic nematodes and soilborne pathogens’, Plant Pathology

Brown, D.J., Robertson, W.M. and Trudgill, D.L. (1995), ‘Transmission of viruses by plant

nematodes’, Annual Review of Phytopathology

Chi, Y., Wang, X., Le, X., Ju, Y., Guan, T. and Li, H. (2016), ‘Exposure to double-stranded RNA

mediated by tobacco rattle virus leads to transcription up-regulation of effector gene

Mi-vap from Meloidogyne incognita and promotion of pathogenicity in progeny’,

International Journal for Parasitology

Cox, D.E., Dyer, S., Weir, R., Cheseto, X., Sturrock, M., Coyne, D., Torto, B., et al. (2019),

‘ABC transporter genes ABC-C6 and ABC-G33 alter plant-microbe-parasite interactions

in the rhizosphere’, Scientific Reports, Vol. 9 No. 1, p. 19899.

Coyne, D.L., Cortada, L., Dalzell, J.J., Claudius-Cole, A.O., Haukeland, S., Luambano, N. and

Talwana, H. (2018), ‘Plant-parasitic nematodes and food security in Sub-Saharan

Africa’, Annual Review of Phytopathology

Dalzell, J.J., McMaster, S., Johnston, M.J., Kerr, R., Fleming, C.C. and Maule, A.G. (2009),

‘Non-nematode-derived double-stranded RNAs induce profound phenotypic changes

in Meloidogyne incognita and Globodera pallida infective juveniles’, International

Journal for Parasitology

Dash, M., Dutta, T.K., Phani, V., Papolu, P.K., Shivakumara, T.N. and Rao, U. (2017), ‘RNAi-

mediated disruption of neuropeptide genes, nlp-3 and nlp-12 , cause multiple

175

Chapter 5: General Discussion

behavioral defects in Meloidogyne incognita’, Biochemical and Biophysical Research

Communications, Vol. 490 No. 3, pp. 933–940.

Dubreuil, G., Magliano, M., Dubrana, M.P., Lozano, J., Lecomte, P., Favery, B., Abad, P., et

al. (2009), ‘Tobacco rattle virus mediates gene silencing in a plant parasitic root-knot

nematode’, Journal of Experimental Botany, Vol. 60 No. 14, pp. 4041–4050.

El-Sappah, A.H., M. M., I., H. El-awady, H., Yan, S., Qi, S., Liu, J., Cheng, G., et al. (2019),

‘Tomato Natural Resistance Genes in Controlling the Root-Knot Nematode’, Genes,

Vol. 10 No. 11, p. 925.

Elling, A.A. (2013), ‘Major Emerging Problems with Minor Meloidogyne Species’,

Phytopathology®, Vol. 103 No. 11, pp. 1092–1102.

Elshaghabee, F.M.F., Rokana, N., Gulhane, R.D., Sharma, C. and Panwar, H. (2017), ‘Bacillus

As Potential Probiotics: Status, Concerns, and Future Perspectives’, Frontiers in

Microbiology, Vol. 8.

FAO. (2009), ‘News Article: 2050: A third more mouths to feed’, Food and Agriculture

Organization of the United Nations.

Félix, M.-A., Ashe, A., Piffaretti, J., Wu, G., Nuez, I., Bélicard, T., Jiang, Y., et al. (2011),

‘Natural and Experimental Infection of Caenorhabditis Nematodes by Novel Viruses

Related to Nodaviruses’, edited by Hodgkin, J.PLoS Biology, Vol. 9 No. 1, p. e1000586.

Geldhof, P., Murray, L., Couthier, A., Gilleard, J.S., McLauchlan, G., Knox, D.P. and Britton, C.

(2006), ‘Testing the efficacy of RNA interference in Haemonchus contortus’,

International Journal for Parasitology

Ghag, S.B. (2017), ‘Host induced gene silencing, an emerging science to engineer crop

resistance against harmful plant pathogens’, Physiological and Molecular Plant

Pathology, Vol. 100, pp. 242–254.

176

Chapter 5: General Discussion

Huang, G., Allen, R., Davis, E.L., Baum, T.J. and Hussey, R.S. (2006), ‘Engineering broad root-

knot resistance in transgenic plants by RNAi silencing of a conserved and essential

root-knot nematode parasitism gene’, Proceedings of the National Academy of

Sciences of the United States of America

ISAA. (2017), ‘Global Status of Commercialized Biotech/GM Crops in 2017: Biotech Crop

Adoption Surges as Economic Benefits Accumulate in 22 years’, Isaaa

Issa, Z., Grant, W.N., Stasiuk, S. and Shoemaker, C.B. (2005), ‘Development of methods for

RNA interference in the sheep gastrointestinal parasite, Trichostrongylus

colubriformis’, International Journal for Parasitology, Vol. 35 No. 9, pp. 935–940.

Jones, J.T., Haegeman, A., Danchin, E.G.J., Gaur, H.S., Helder, J., Jones, M.G.K., Kikuchi, T.,

et al. (2013), ‘Top 10 plant-parasitic nematodes in molecular plant pathology’,

Molecular Plant Pathology, Vol. 14 No. 9, pp. 946–961.

Kandoth, P.K., Heinz, R., Yeckel, G., Gross, N.W., Juvale, P.S., Hill, J., Whitham, S.A., et al.

(2013), ‘A virus-induced gene silencing method to study soybean cyst nematode

parasitism in Glycine max’, BMC Research Notes, Vol. 6 No. 1, p. 255.

Koch, A., Kumar, N., Weber, L., Keller, H., Imani, J. and Kogel, K.H. (2013), ‘Host-induced

gene silencing of cytochrome P450 lanosterol C14α-demethylase-encoding genes

confers strong resistance to Fusarium species’, Proceedings of the National Academy

of Sciences of the United States of America

Kranse O, Beasley H, Adams S, Pires da Silva A, Bell C, Lilley C, Urwin PE, Bird D, Miska EA,

Smant G, Gheysen G, Jones J, Viney M, Abad P, Maier TR, Baum TKJ, Siddique S,

Williamson V, Akay A, Eves-van den Akker S. (2020) 'Towards genetic modification of

plant-parasitic nematodes: delivery of macromolecules to adults and expression of

exogenous mRNA in second stage juveniles', bioRxiv

177

Chapter 5: General Discussion

Maghari, B.M. and Ardekani, A.M. (2011), ‘Genetically modified foods and social concerns.’,

Avicenna Journal of Medical Biotechnology, Vol. 3 No. 3, pp. 109–17.

Maule, A.G., McVeigh, P., Dalzell, J.J., Atkinson, L., Mousley, A. and Marks, N.J. (2011), ‘An

eye on RNAi in nematode parasites’, Trends in Parasitology.

Miller, J.F., Dower, W.J. and Tompkins, L.S. (1988), ‘High-voltage electroporation of

bacteria: Genetic transformation of Campylobacter jejuni with plasmid DNA’,

Proceedings of the National Academy of Sciences of the United States of America

Neumann, E., Schaefer-Ridder, M., Wang, Y. and Hofschneider, P.H. (1982), ‘Gene transfer

into mouse lyoma cells by electroporation in high electric fields.’, The EMBO Journal,

available at:https://doi.org/10.1002/j.1460-2075.1982.tb01257.x.

Ntalli, N.G. and Caboni, P. (2012), ‘Botanical nematicides: A review’, Journal of Agricultural

and Food Chemistry

Papolu, P.K., Gantasala, N.P., Kamaraju, D., Banakar, P., Sreevathsa, R. and Rao, U. (2013),

‘Utility of Host Delivered RNAi of Two FMRF Amide Like Peptides, flp-14 and flp-18, for

the Management of Root Knot Nematode, Meloidogyne incognita’, edited by Davis,

K.R.PLoS ONE, Vol. 8 No. 11, p. e80603.

Park, J.-E., Lee, K.Y., Lee, S.-J., Oh, W.-S., Jeong, P.-Y., Woo, T., Kim, C.-B., et al. (2008), ‘The

efficiency of RNA interference in Bursaphelenchus xylophilus.’, Molecules and Cells,

Vol. 26 No. 1, pp. 81–6.

Rosso, M.N., Dubrana, M.P., Cimbolini, N., Jaubert, S. and Abad, P. (2005), ‘Application of

RNA interference to root-knot nematode genes encoding esophageal gland proteins’,

Molecular Plant-Microbe Interactions

Shivakumara, T.N., Chaudhary, S., Kamaraju, D., Dutta, T.K., Papolu, P.K., Banakar, P.,

Sreevathsa, R., et al. (2017), ‘Host-Induced Silencing of Two Pharyngeal Gland Genes

178

Chapter 5: General Discussion

Conferred Transcriptional Alteration of Cell Wall-Modifying Enzymes of Meloidogyne

incognita vis-à-vis Perturbed Nematode Infectivity in Eggplant’, Frontiers in Plant

Science, Vol. 08

Tjalsma, H., Bolhuis, A., Jongbloed, J.D.H., Bron, S. and van Dijl, J.M. (2000), ‘Signal Peptide-

Dependent Protein Transport in Bacillus subtilis: a Genome-Based Survey of the

Secretome’, Microbiology and Molecular Biology Reviews, Vol. 64 No. 3, pp. 515–547.

Urwin, P.E., Lilley, C.J. and Atkinson, H.J. (2002), ‘Ingestion of Double-Stranded RNA by

Preparasitic Juvenile Cyst Nematodes Leads to RNA Interference’, Molecular Plant-

Microbe Interactions, Vol. 15 No. 8, pp. 747–752.

Warnock, N.D., Wilson, L., Patten, C., Fleming, C.C., Maule, A.G. and Dalzell, J.J. (2017),

‘Nematode neuropeptides as transgenic nematicides.’, edited by Mackey, D.PLoS

Pathogens, Vol. 13 No. 2, p. e1006237.

Westphal, A. (2011), ‘Sustainable approaches to the management of plant-parasitic

nematodes and disease complexes.’, Journal of Nematology, Vol. 43 No. 2, pp. 122–5.

Yang, Y., Jittayasothorn, Y., Chronis, D., Wang, X., Cousins, P. and Zhong, G.Y. (2013),

‘Molecular Characteristics and Efficacy of 16D10 siRNAs in Inhibiting Root-Knot

Nematode Infection in Transgenic Grape Hairy Roots’, PLoS ONE

179