The neuronal and non-neuronal substance P, VIP and cholinergic systems in the colon in ulcerative colitis
Maria Jönsson
From the Department of Integrative Medical Biology, Anatomy, and the Department of Surgical and Perioperative Sciences, Surgery.
Umeå 2009
Copyright © Maria Jönsson 2009 ISBN: 978-91-7264-731-2 ISSN: 0346-6612 New series no: 1248 Printed by: Arkitektkopia, Umeå, Sweden
Figure 1: Illustration by the author, modified from Human Anatomy, Mc Graw Hill, Second Edition, 2008. Figure 2: Illustration by Gustav Andersson. Figures 3-8. Photo images by the author.
Abbreviations
ACh acetylcholine AP alkaline phosphatase BSA bovine serum albumin CGRP calcitonin gene-related peptide ChAT choline acetyltransferase CNS central nervous system EIA enzyme immunosorbent assay ELISA enzyme-linked immunosorbent assay FITC fluorescein isothiocyanate GI gastrointestinal Htx hematoxylin IBD inflammatory bowel disease IHC immunohistochemistry IR immunoreactions ISH in situ hybridization -LI -like immunoreactions
M2 muscarinic receptor 2 NK-1R neurokinin-1 receptor PACAP pituitary adenylate cyclase-activating polypeptide PAP peroxidase-antiperoxidase PBS phosphate-buffered saline RT room temperature SP substance P SSC saline sodium citrate STE sodium chloride–tris–EDTA buffer TACR1 tachykinin receptor 1 TRITC tetramethylrhodamine isothiocyanate UC ulcerative colitis VAChT vesicular acetylcholine transporter VIP vasoactive intestinal peptide VPAC1 vasoactive intestinal peptide/pituitary adenylate cyclase activating polypeptide receptor-1
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon Table of Contents Abstract 7 List of publications 8 Introduction 9 Anatomy of the large intestine 9 Histology of the colon 9 Intestinal innervation – General aspects 11 The enteric nervous system 11 Neurotransmitters in the GI tract 12 The cholinergic system 12 The neuronal cholinergic system 12 The non-neuronal cholinergic system 13 Acetylcholine receptors 13 Neuropeptides 14 General aspects 14 Substance P and its receptors 14 VIP and its receptors 15 Interrelationship between VIP/SP and the cholinergic system 15 CGRP 16 Eosinophils 16 Inflammatory bowel diseases (IBD) – general aspects 16 Ulcerative colitis (UC) 17 Background for the studies in this thesis 18 Aims 20 Materials and Methods 21 Patient material 21 Tissue sampling and preparation 22 Blood sampling and preparation 22 Sectioning 22 Morphology staining 23 Staining and counting of eosinophils 23 Immunohistochemistry (IHC) 23 Pre-treatment procedures 23 Immunofluorescence 25 Peroxidase anti-peroxidase staining (PAP) 25 Primary antibodies 25 Control stainings 25 In situ hybridization (ISH) 25 EIA (Enzyme Immunosorbent Assay) 26 Tissue homogenisation 26 EIA procedure 26 In vitro receptor autoradiography 27
5 Maria Jönsson, 2009
Quantitative analysis 27 Correlations VIP binding/VIP IHC/mucosa morphology 28 Semiquantitative analyses 28 Statistics 28 Ethical considerations 28 Results and Discussion 29 Methodological considerations 29 Concerning the patient material 29 Concerning antibodies and tests for specificity 29 Morphology (Papers I-V) 30 Substance P and the NK-1R 31 SP innervation (Paper I) 31 SP levels in mucosa (Paper IV) 31 Local production of SP (Paper III) 31 NK-1R expression (Paper I, III) 33 Eosinophil infiltration in relation to NK-1R expression (Paper I) 33 VIP and VIP receptors 34 VIP innervation (Paper II, III) 34 VIP levels in the mucosa (Paper IV) 34 Local production of VIP (Paper III) 34 VIP receptors 35 VIP binding (Paper II) 35 VPAC1 IHC (Paper III) 35 Neuropeptides in plasma and correlations to other parameters (Paper IV) 36 Neuropeptide levels in plasma 36 Correlations between plasma and mucosa levels and the degree of mucosal derangement 36 The cholinergic system (Paper V) 37 The cholinergic innervation 37 Observations favouring a local production of ACh 38
Muscarinic receptor M2 39 Interpretations concerning the non-neuronal cholinergic system 39 Future treatment possibilities 40 Summary of the main findings 41 Summary of main conclusions 42 Funding 44 Svensk populärvetenskaplig sammanfattning 45 Introduktion 45 Bakgrund till dessa studier 46 Material och metoder 47 Sammanfattning av resultat 47 Tack 49 References 51
6 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon Abstract Ulcerative colitis (UC) is a chronic relapsing inflammatory bowel disease. Neuropeptides, especially vasoactive intestinal peptide (VIP) and substance P (SP), have long been considered to play key roles in UC. Among other effects, these neuropeptides have trophic and growth-modulating as well as wound-healing effects. Furthermore, whilst VIP has anti-inflammatory properties, SP has pro-inflammatory effects. It is generally assumed that the main source of SP and VIP in the intestine is the tissue innervation. It is not known whether or not they are produced in the epithelial layer. The details concerning the expressions of their receptors in UC are also, to a great extent, unclear. Apart from the occurrence of peptidergic systems in the intestine, there are also neuronal as well as non-neuronal cholinergic systems. The pattern concerning the latter is unknown with respect to UC. The studies in this thesis aimed to investigate the expression of SP and VIP and their major receptors (NK-1R and VPAC1) in UC colon, compared to non-UC colon. The main emphasis was devoted to the epithelium. A second aim was to examine for levels of these neuropeptides in blood plasma in UC. Another aim was to examine for the non-neuronal cholinergic system in UC, thus, to investigate whether there is acetylcholine production outside nerves in the UC colon. Methods used in the thesis were immunohistochemistry, in situ hybridization, enzyme immunosorbent assay, and in vitro receptor autoradiography. For the first time, mRNA for VIP and SP has here been found in the colonic epithelium. That was especially noted in UC mucosa showing a rather normal morphology, and in non-UC mucosa. Marked derangement of the mucosa was found to lead to a distinct decrease in VIP binding, and also a decrease in the expression level of VIP receptor VPAC1 in the epithelium. In general, there was an upregulation of the SP receptor NK-1R in the epithelium when the mucosa was deranged. The plasma levels of SP and VIP were higher for UC patients compared to healthy controls. There were marked correlations between the levels of the peptides in plasma, their levels in the mucosa and the degree of mucosal derangement/inflammation. A pronounced nonneuronal cholinergic system was found in both UC and non-UC colon. Certain changes occurred in this system in response to inflammation/derangement in UC. The present study shows unexpectedly that expressions for VIP and SP are not only related to the nerve structures and the inflammatory cells. The downregulation of VPAC1 expression, and the tendencies of upregulation of NK-1R expression levels when there is marked tissue derangement, may be a drawback for the intestinal function. The study also shows that there is a marked release of neuropeptides to the bloodstream in parallel with a marked derangement of the mucosa in UC. The cholinergic effects in the UC colon appear not only to be associated with nerve- related effects, but also effects of acetylcholine produced in local non-neuronal cells. The thesis shows that local productions for not only acetylcholine, but also SP and VIP, occur to a larger extent than previously considered.
7 Maria Jönsson, 2009 List of publications This thesis is based on the following original papers:
I. Substance P and the neurokinin-1 receptor in relation to eosinophilia in ulcerative colitis. Jönsson M, Norrgård Ö, Forsgren S. Peptides. 2005;26:799-814.
II. Decrease in binding for the neuropeptide VIP in response to marked inflammation of the mucosa in ulcerative colitis. Jönsson M, Norrgård Ö, Hansson M, Forsgren S. Ann N Y Acad Sci. 2007;1107:280-289.
III. Presence of mRNA for VIP and Substance P and presence of VPAC1 and NK-1 receptor expressions in the colonic epithelium of man – changed patterns in ulcerative colitis. Jönsson M, Norrgård Ö, Forsgren S. Manuscript
IV. New aspects concerning ulcerative colitis and colonic carcinoma: analysis of levels of neuropeptides, neurotrophins, and TNFalpha/TNF receptor in plasma and mucosa in parallel with histological evaluation of the intestine. Johansson M*, Jönsson M*, Norrgård Ö, Forsgren S. * The first two authors contributed equally to this work. Inflamm Bowel Dis. 2008;14:1331-1340.
V. Presence of a marked nonneuronal cholinergic system in human colon: study of normal colon and colon in ulcerative colitis. Jönsson M, Norrgård Ö, Forsgren S. Inflamm Bowel Dis. 2007 Nov;13:1347-1356.
The original papers are published after permission from the publishers, and in this thesis will be referred to by their Roman numerals.
8 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon Introduction
Anatomy of the large intestine The large intestine, also called the large bowel, has a length of approximately 1.5 meters. The large intestine is the last part of the digestive system and consists of cecum with vermiform appendix, colon, and rectum. Below the rectum is the anal canal. The colon is divided into four different segments, named ascending colon, transverse colon, descending colon and sigmoid colon (see Fig. 1).
Fig 1. The anatomy of the large intestine.
The overall function of the large intestine is the completion of fluid absorption, the manufacturing of certain vitamins, the formation of feces, and the expulsion of feces from the body. Bacteria are very frequent in the feces.
Histology of the colon The colonic wall is divided into different layers: mucosa, submucosa, the muscle layers and the serosa (Fig. 2). The mucosa consists of the epithelial layer and the lamina propria. Beneath the lamina propria there is a smooth muscle layer, the muscularis mucosae, which is a thin muscle layer that consists of longitudinal and circular strands. The mucosa is lined with a simple columnar epithelium, and consists of columnar absorptive cells, goblet cells, and endocrine cells. Paneth cells
9 Maria Jönsson, 2009 infrequently occur. There are also some intraepithelial lymphocytes in the basolateral part of the epithelium. The absorptive cells absorb water and electrolytes. The goblet cells are unicellular mucus glands that secrete mucin to lubricate the lumen. The endocrine cells affect both local cells (paracrine function) and distant cells (endocrine function), and they also secrete products into the lamina propria. Villi are, in contrast to the situation for the small intestine, not formed in the colon. Straight tubules (crypts; glands) extend through the entire thickness of the mucosa. These crypts, called crypts of Lieberkühn, have a length of up to 0.5 mm. Goblet cells are frequent in these crypts, and there are proliferating, in principle undifferentiated cells, at the bottom of the crypts. There is a rapid regeneration of the epithelium, with a replacement every 6 to 7 days (1). The lamina propria contains scattered fibroblasts, immunoactive cells and lymph nodules that extend into the submucosa. Furthermore, there are nerve fibers (cf. below), blood vessels, and lymphatic vessels in the lamina propria. The arteries have their origin in the superior mesenteric (iliocolic, right and middle colic arteries) and inferior mesenteric (left colic artery, sigmoidal arteries and superior rectal artery) arteries. The veins drain into the portal vein.
Fig. 2. The histology and innervation of the large intestine.
10 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
The submucosa is a layer of loose connective tissue that derives its name from its position beneath the mucosa. In the submucosa, the submucous plexus with its nerve branches and frequent blood vessels are located. Scattered immunoactive cells are also found here. The smooth muscle layer consists of the inner circular layer and the outer longitudinal layer. Between these muscle layers a main part of the myenteric plexus is located (Fig. 2). Groups of nerve cells (small ganglia) and large nerve bundles can be seen here. The branches of the plexus are distributed throughout the muscle layers. The outer longitudinal muscle layer is not continuous, but forms muscle fascicles known as taeniae coli. These discontinuities allow segments of the colon to contract independently. There is also a serous coat, which is composed of a thin connective tissue layer covered by mesothelium. It expands into the appendices epiploicae in its free portion. These are extensions that mainly consist of adipose tissue.
Intestinal innervation – General aspects
The enteric nervous system The British physiologist Langley described the autonomic nervous system (ANS) in a classic monography in 1921 (2). In this monography, but in fact, also previously, in 1917 (3), the enteric nervous system (ENS) was described to a certain extent. The ENS belongs to the ANS. The ENS can nevertheless function independently of the central nervous system (CNS). When isolated from the CNS, the ENS can thus mediate reflex activity. The ENS modulates the processes of motility, secretion, microcirculation and reflexes in the gastrointestinal (GI) tract (4) (see Fig. 2). In recent years, the interplay between the ENS and the immune system has also been increasingly appreciated (5). The ENS is a complex and well-organized network of neurons. The ENS consists of 100 millions of neurons, and these are organized into the myenteric and submucous plexuses (6). The myenteric plexus (plexus of Auerbach) provides motor innervation to the muscle layers and some secretomotor innervation to the mucosa. The myenteric ganglia, to a certain extent, innervate adjacent myenteric ganglia and submucous ganglia. The submucous plexus (plexus of Meissner) innervates the muscularis mucosae, intestinal endocrine cells, glandular epithelium and submucosal blood vessels (4). Different submucous ganglia can give branches to each other (7, 8). The neurons of the ENS form varicosities in their terminal parts. Functionally, the neurons in the ENS are motor, sensory or interneurons (9). The motor neurons stimulate or inhibit smooth muscle contraction and gland secretion. The interneurons interconnect neurons of the myenteric and submucous plexuses, hereby interconnecting sensory and motor neurons to each other (10). There is also an extrinsic innervation to the intestine; this
11 Maria Jönsson, 2009 innervation is in certain literature referred to as the “external part” of the ENS. The extrinsic innervation corresponds to preganglionic neurons of the parasympathetic nervous system (vagal nerve and nerves from sacral segments), postganglionic fibers of the sympathetic innervation, and sensory neurons. The first mentioned are destined for the ganglionic accumulations of the myenteric and submucous plexuses. The sympathetic fibers emerge via the celiac plexus and are particularly destined for the blood vessels. There are primary sensory neurons that respond to mechanical, chemical and thermal stimuli. It is a matter of debate to what extent the sensory nerve endings are of an efferent nature and part of the intrinsic ENS. The sensory neurons that innervate the mucosa are described to partly be extrinsic and partly conform to intrinsic afferent neurons (11). In any case, sensory neurons play a protective role through several mechanisms. These include sensations of pain, induction of autonomic reflexes, induction of neuroendocrine responses, and initiation of protective tissue reactions at the site of assault (12). Within the gut, the protective mechanisms triggered by sensory neurons comprise alterations in blood flow, secretion and motility, and modifications of immune function. The neurons in the mucosa are in close contact with two important non- neural surveillance systems: endocrine and immune cells (12).
Neurotransmitters in the GI tract Neurotransmitters are substances that transmit signals between neurons and from neurons to cells, and that activate receptors. The neuron is classified as cholinergic if it secretes acetylcholine (ACh) and adrenergic if it secretes noradrenaline (norepinephrine). The classical transmitters of the GI tract are ACh and noradrenaline. However, as early as the 1960s, non-adrenergic, non-cholinergic (NANC) neurons were also found to be involved in the innervation of the GI tract (13) (see (8) for a review). Several neuropeptides, functioning as neuromodulators, and also mediators such as nitric oxide are known to be involved in the NANC innervation.
The cholinergic system
The neuronal cholinergic system The neuronal cholinergic system (parasympathetic system) is classically constructed of preganglionic and postganglionic parts. The cell bodies of the latter are coalesced into large or small ganglia. Concerning the colon, these ganglia correspond to accumulations of neuronal cell bodies within the submucous and myenteric plexuses. The ENS corresponds thus to a large extent to the postganglionic parts of the cholinergic system (cf. above). ACh is synthesized in nerve terminals from choline and acetyl-CoA by choline acetyltransferase (ChAT), and is then translocated to synaptic
12 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon vesicles by the vesicular acetylcholine transporter (VAChT) (14). ACh is then stored in the vesicles until it is released on demand (15). It has long been considered that the neuronal cholinergic system is involved in ulcerative colitis (UC). Already in 1953, studies on dogs suggested that the cholinergic drug mecholyl could cause ulcerative colitis- like symptoms (16). In any case, it has been shown that electrical stimulation of the vagus nerve attenuates the release of pro-inflammatory cytokines (17, 18). A “cholinergic anti-inflammatory pathway” is hereby achieved (17, 19). Parasympathetic stimulation leads to an increase in the secretory activity of the goblet cells and parasympathetic reflexes are mainly responsible for defecation reflexes.
The non-neuronal cholinergic system ACh production occurs in cholinergic neurons, but also in non-neuronal cells, such as cells in the surface epithelium in the skin (20), lymphocytes (21), and vascular endothelial cells (22). ACh has also been found in bacteria, algae, and primitive plants, showing that it has been an important molecule in evolution for about 3 billion years. The non-neuronal ACh is, in contrast to the neuronal ACh, a local signalling molecule. Non-neuronal ACh has growth-related functions, immune- and barrier functions, and functions related to the organization of the cytoskeleton and locomotion (15, 23), and it is also suggested to be involved in the basic cell functions via cellular signalling pathways (15). Of particular interest is the fact that the cholinergic anti-inflammatory pathway (17, 18) also involves the non-neuronal cholinergic system (24). It is not known whether non-neuronal cells have storage capabilities for ACh. It is possible that there is a continuous synthesis, diffusion, release and hydrolysis (15). With regard to the human intestine, it is known that epithelial cells, the endothelium and certain inflammatory cells demonstrate expression of ChAT (25, 26).
Acetylcholine receptors The effects of ACh are mediated by activation of the muscarinic or nicotinic receptors. Five muscarinic G-protein-coupled ACh receptors, M1, M2, M3, M4 and M5, have been identified in mammals (see (27) for a review). The receptors have different functions and properties, although the exact functional roles of all these subtypes have to date not been fully elucidated. Among the functions related to stimulation of muscarinic receptors are effects on cell growth and proliferation (28, 29). The M2 receptor is the major muscarinic receptor subtype expressed by smooth muscle tissues in the GI tract (30), although a smaller population of the M3 receptor is also coexpressed with M2 (30). The muscarinic receptors on smooth muscle do on the whole belong to the M2 and M3 subtypes.
13 Maria Jönsson, 2009
Neuropeptides
General aspects Neuropeptides are small molecules used by neurons for communication. However, they are not only important for neurotransmission, but they also have effects on tissue growth and differentiation, inflammation, immunomodulation and tumour growth. The production of neuropeptides occurs in the cell body of the neurons, and they are then transported to the varicosities and are released after stimulation. Thereafter they interact with their specific receptors. Frequently there is a co-localization of two or several neuropeptides in neurons (see (31) for a review). Neuropeptides can be released from the tissues to the bloodstream. It is known that not only neuronal cells, but also local cells in the tissues, can produce neuropeptides (32, 33). The levels of neuropeptide production in these cells are usually low. Culturing, lesions or other manipulations cause upregulation and/or induction of neuropeptide levels in the cells (32). Tumours that express a neuroendocrine phenotype are known to secrete neuropeptides with paracrine/autocrine growth factor activity (34). Three neuropeptides frequently discussed in inflammatory situations, including those of the intestine, are vasoactive intestinal peptide (VIP), substance P (SP), and calcitonin gene-related peptide (CGRP).
Substance P and its receptors Von Euler and Gaddum discovered SP in 1931 (35). This peptide consists of 11 amino acids, and belongs to the tachykinin family of peptides. SP is classically a peptide produced in sensory neurons, is a pain mediator and is involved in vasoregulation and so-called neurogenic inflammation (36, 37). SP is also involved in immunomodulatory activities and has long been considered to play a key role in IBD (38). SP has pro-inflammatory actions (39). SP has profound effects for intestinal physiology. Thus, it is involved in the regulation of motility and transmural and electrolyte transport as well as in the regulation of blood flow in the intestine (40, 41). SP has excitatory effects in the GI canal, mediating smooth muscle contractions (42). SP also has trophic and growth-modulating functions in various tissues (43, 44) as well as wound-healing effects (45), and is involved in activating the emetic reflex (46). SP is present in enteric efferent neurons but also in sensory innervation. It is synthesized by enteric cholinergic motor neurons, and hence, SP- containing nerve fibers are frequent in the smooth musculature. SP- containing nerve fibers are also present in the submucous plexus, blood vessel walls and lamina propria (47).
14 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Non-neuronal cells can produce SP. That includes keratinocytes (33), and Leydig cells (48). SP is also reported to be produced in human eosinophils (49) and macrophages (50), and has also been detected in T-lymphocytes in the intestine (51). The preferred receptor for SP is the neurokinin-1 receptor (NK-1R) (52, 53), but SP can also bind to NK-2R with low affinity (54). NK-1R is a member of the superfamily of guanin nucleotide binding-coupled receptors, which interact with G-proteins to promote high-affinity binding and signal transduction (54). Binding of SP to the NK-1R mediates rapid endocytosis and internalization of the receptor (55).
VIP and its receptors Vasoactive intestinal peptide (VIP) belongs to the VIP-glucagon peptide family, and was originally isolated from small intestine by Said and Mutt (56). VIP is mainly present in parasympathetic neurons (57, 58). VIP is frequently expressed in the enteric neurons. In contrast to SP, VIP has anti-inflammatory properties (59). It is involved in the regulations of intestinal motility and blood flow (60), and the secretion of electrolytes and water (61). VIP effects on the intestinal smooth muscle are inhibitory. Similar to SP, VIP also has trophic and growth- modulating functions in various tissues (43, 62), and VIP is furthermore reported to have wound-healing effects (45). VIP has a paracrine function between developing neurons and glia (63) and VIP produced by lymphocytes can function in an autocrine/paracrine way in regulating the immune system (64). As well as in neurons, VIP is also reported to be produced by inflammatory cells in the intestine (65, 66). VIP has effects on class II family of G-protein-coupled receptors named VPAC1 and VPAC2 (67). VPAC1 and VPAC2 do not discriminate between VIP and another peptide, pituitary adenylate cyclase-activating polypeptide (PACAP) (68). PACAP binds to the PAC1 receptor, while VIP has a low affinity for the PAC1 receptor. The VIP/PAC receptor reported to dominate in the human colonic mucosa is the VPAC1 receptor (69). The VPAC1 receptor is also called VIP receptor 1 (VIPR1).
Interrelationship between VIP/SP and the cholinergic system It is well known that the neuropeptides VIP and SP are related to the ENS. VIP and SP expressions are thus frequently encountered for the ENS neurons. VIP is actually frequently co-localized with ACh in parasympathetic innervation, why VIP can act as a cholinergic cotransmitter (70). SP cooperates with ACh in the coordination of the peristaltic propulsion (71). Nevertheless, both VIP (72) and SP (73) can have direct effects on the smooth muscle cells of the intestine. M2 is, apart from being present on smooth muscle cells in the intestine, also present on nerve fibers. M2 is thus
15 Maria Jönsson, 2009 expressed together with SP in the myenteric and submucous ganglia and with VAChT and ChAT in cholinergic nerve fibers (74).
CGRP Calcitonin gene-related peptide (CGRP) belongs to the calcitonin family of peptides (75). CGRP is shown to be co-localized with SP in a majority of sensory nerve fibers (76). However, in the intestine, there are also intramural neurons that contain CGRP (77). CGRP is, similar to SP, involved in the regulation of blood flow (78), in the modulation of intestinal motility (79), and in wound healing (45).
Eosinophils Various types of immunoactive cells are found in the intestinal wall. That includes lymphocytes, macrophages, mast cells, and neutrophils (80). It has been suggested that lymphocytes are involved in the disease process in UC. Eosinophils are an additional important cell type that may be involved in the pathogenesis of UC (81). These are white blood cells that contain red granulae in the cellular cytoplasm. Activation of the cells leads to the release of granular proteins (82). Eosinophils play an important role in IBD. They are considered to be pro- inflammatory and pro-motility agents, and to produce effects such as diarrhoea, inflammation, tissue destruction, but, as recently suggested, even repair of injured epithelia (83). An increased release of eosinophil granulae occurs in UC (84). Eosinophils migrate to places of inflammatory or allergic reactions, or parasitic infections. An increase in numbers of eosinophils has been reported in UC (85). The accumulation of eosinophils in the intestinal mucosa in UC is stimulated by different cytokines (86). Elevated levels of chemokines relevant to eosinophil chemotaxis can be detected in serum and feces of patients with active IBD (81). Substances other than cytokines, including neuropeptides, have been shown to attract eosinophils and to stimulate chemotaxis (87-89). SP has thus been shown to have a stimulatory effect on degranulation of eosinophils (90). It has also been shown that eosinophils can produce both SP and VIP in healthy and inflamed human intestine (49).
Inflammatory bowel diseases (IBD) – general aspects Ulcerative colitis (UC) and Crohn’s disease (CD) are the two forms of IBD. UC was first described at the beginning of the 20th century, and Crohn and collaborators (91) described CD in 1932. Nevertheless, symptoms resembling IBD, such as chronic diarrhea, were described even before the time of Christ. Both UC and CD are chronic relapsing diseases, destructive to the GI tract. There is a chronic inflammatory reaction in the gut wall. The triggering
16 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon factors are unknown. Changed immunologic mechanisms are likely to be involved. UC affects the lower GI tract. The disease begins in the rectum and spreads to the colon. CD affects all sections of the GI tract. UC affects only the mucosa, while CD affects all layers of the wall. In about 5% of IBD cases, it is not possible to establish a definite diagnosis of UC or CD (92), due to the fact that some overlapping in the features of the diseases exists. IBD runs in families (93). The risk of having IBD is about 1 in 10-20 if a first-degree relative has the disease. The risk of developing IBD also varies according to countries and ethnic groups. For example, Jewish people have a 5-8 fold increased risk of IBD compared to non-Jews (94).
Ulcerative colitis (UC) Typical symptoms of UC are bloody diarrhoea with mucus, urgent need to go to the toilet, rectal bleeding, abdominal pain, fever, weakness, and weight loss. It is an intermittent disease, and asymptomatic periods can last from months to years. The course of the disease is not predictable. The prevalence of UC is about 3 per 1000 individuals (95). The incidence is the same for men and women (96). UC affects people of all ages, but there is a peak in onset at the age of 20-29 years (97). The disease can also have its onset in childhood (98). The etiology of UC remains elusive. It has been shown that stress presumably not plays a role in the initiation of the disease (99), but that stress is involved in the reactivation of the disease (100). The possibility that an infectious organism such as Helicobacter pylori is involved has been proposed (101), but the result of various human studies concerning this aspect are not consistent. There are indications that breastfeeding is a protecting factor against UC (102). What is known is that there exists an inverse association between smoking and UC. Some studies have reported that smoking has a protective effect against the development of UC (103). Other studies show that patients who have undergone appendectomy for appendicitis have a lowered risk of UC (104). UC treatment consists of corticosteroids, and various immunosuppressive and non-steroid anti-inflammatory drugs. Recently, anti-TNF treatment has also been used. In severe cases, colectomy needs to be considered. The cumulative colectomy rate 10 years after diagnosis is about 10% (105). In some cases, the disease is very severe and requires immediate surgery. If UC is present, there is a risk of developing colorectal cancer. The risk of colorectal cancer begins to rise 8-10 years after diagnosis of UC. Therefore, an endoscopic surveillance program is important (106). Recent studies estimate that the risk of colorectal cancer in UC patients is 2-3 times greater than in the general population (107).
17 Maria Jönsson, 2009
UC affects the mucosa and the inflammation is restricted to the mucosal layer. The mucosal derangement that may occur appears as heavy infiltration of various leukocytes into the lamina propria, architectural irregularity in the crypts, crypt abscesses, and destruction of the epithelium, including a decrease in numbers of goblet cells (108).
Background for the studies in this thesis As can be seen above, the effects of various signal substances are of importance for both the normal and the inflamed colon. This includes the substances released from the neuropeptidergic and cholinergic systems. Nevertheless, there are a large number of aspects that is unclear in this respect. The major aspects that are also the basis for the performance of the studies in the present thesis follow:
• The levels of SPergic and VIPergic innervations in severe UC disease. Variable results concerning the levels of SP- and VIP- innervations have been noted in previous studies on UC. The number of SP-containing nerve fibers has thus been reported to be decreased (109, 110), to be elevated (111, 112), or to be unaltered (113) in UC. An unchanged (113) or decreased (109, 110) level of VIP concentration/VIP innervation has, furthermore, been noted with regard to UC. Thus, from these studies it is unclear whether certain changes in neuronal SP/VIP levels are definitely related to the UC process.
• Is there an occurrence of VIP and SP production in the colonic epithelium? It is well known that SP and VIP are not only confined to the intestinal innervation but they are also produced by inflammatory cells in the intestine (cf. above). This means that the VPAC1 and NK-1 receptors that are present can be affected by peptides from both of these sources. However, is there still another source of SP/VIP? A candidate is the epithelial layer. Here it should be recalled that VIP, to some extent, may function in a paracrine manner with regard to secretion in the rat stomach (114). VIP- and SP-expressing endocrine cells occur in the digestive tract of the turbot (115). SP-containing endocrine cells have also been observed in the intestine of species such as axolotls (116) and rainbow trout (117). Endocrine cells expressing VIP or SP have not been detected in human intestine (118). The same holds true for the other cell types in the intestinal epithelium. It is thus not previously known whether or not there are signs of SP/VIP production in the human colonic epithelium. Instead, it is in the innervation, and to some extent in the inflammatory cells, that both SP and VIP are regularly detected. On the other hand, it
18 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
has been shown that corneal epithelial cells demonstrate SP expression (33) and that both SP and VIP expression has been noted for human nasal epithelium (119). These observations demonstrate that further studies on this aspect of the intestinal epithelium are warranted.
• VIP/SP levels in blood vs. those in the mucosa. As described above, neuropeptides are released to the blood stream. Certain studies examining this aspect for VIP have been performed concerning UC. However, they have reported inconsistent results (66, 110, 120). There is no information at all for SP in this respect concerning UC. It would be of great interest to find out whether or not the SP/VIP levels in UC differ from those of non-UC patients. It would also be of great interest to know whether there are certain correlations between the SP/VIP levels in blood and those in the mucosa in UC, and the magnitude of mucosa derangement. No correlative study on these aspects has previously been performed. Of interest is whether analyses of neuropeptide levels in blood give a hint of the UC disease.
• The NK-1 and VPAC1 receptors in severe UC disease. As is the case for the levels of SP/VIP innervation, there are uncertain facts concerning the expression levels of the SP/VIP receptors in UC. Concerning the predominating VIP receptor (VPAC1) there is actually no information at all in UC. Concerning NK-1R, there are some reports (121, 122). Nevertheless, there is little information on the levels of expression of this receptor in relation to the degree of mucosal derangement. That includes also a lack of information concerning NK-1 receptor expression in relation to the level of eosinophil infiltration. As both SP and VIP have immunomodulatory and various other effects in the colon, further information on the levels of their receptors in UC is welcome.
• The non-neuronal cholinergic system in UC. There is no information at all concerning the non-neuronal cholinergic system in UC. This is a drawback as ACh is known to have marked autocrine/paracrine effects, including effects on growth and proliferation, angiogenesis, and presumably, wound healing (28, 29, 123). Furthermore, as described above, the cholinergic system can have an anti-inflammatory effect, and there are inter-relationships between ACh effects and effects of SP and VIP. It would be of great interest to know to what extent the cholinergic effects in UC are related to effects via the innervation, and via non-neuronal pathways.
19 Maria Jönsson, 2009 Aims In this thesis, the following aspects for both normal and UC colon were examined for. The aims were:
• To study the distribution and levels of SP and VIP in the colonic wall. How are the SP- and VIP-innervations correlated to the degree of mucosal derangement?
• To study the possible expressions of VIP and SP in the epithelial layer.
• To study the levels of expression of the SP- and VIP-preferred receptors. To what extent are they expressed in the epithelium and how are these receptors correlated to the degree of mucosal damage?
• To study the SP/VIP levels in both blood and mucosa from the same patients, and to correlate these to the degree of mucosal derangement.
• To study the patterns of the non-neuronal cholinergic system.
20 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon Materials and Methods
Patient material For an overview of the patients and the healthy controls used in the thesis, see Table 1.
Paper Methods used Total number Gender Age (years; of patients (Male/Female) mean, range) analyzed
I Htx, PAP, TRITC, 35 (17 UC, 18 UC: 11/6 UC: 38 (21-64) Congo Red non-UC) Non-UC: 10/8 Non-UC: 65 (26-91)
II Htx, PAP, TRITC, 38 (21 UC, 17 UC: 14/7 UC: 39 (21-64) In vitro receptor non-UC) autoradiography Non-UC: 7/10 Non-UC: 64 (41-83)
III Htx, PAP, TRITC, 43 (23 UC, 20 UC: 18/5 UC: 37 (20-62) FITC, In situ non-UC) hybridization Non-UC: 10/10 Non-UC: 68 (45-90)
IV Htx, EIA Mucosa: 39 (20 Mucosa; UC: Mucosa; UC: UC, 19 non- 17/3 37 (20-79) UC) Non-UC: 8/11 Non-UC 70 (54-90)
Plasma; UC: Plasma: 76 (24 19/5 Plasma; UC: UC, 23 non-UC, 37 (20-79) 30 healthy Non-UC: 12/11 controls) Non-UC: 70 Healthy: 13/17 (54-90)
Healthy: 41 (21-62)
V Htx, TRITC, FITC, 43 (23 UC, 20 UC: 18/5 UC: 37 (20-62) In situ non-UC) hybridization Non-UC: 10/10 Non-UC: 68 (45-90)
Table 1. Overview of patients and methods used. In total, intestine of 46 UC- patients and 42 non-UC patients, and plasma of 24 UC, and 23 non-UC patients as well as 30 healthy controls were used in Papers I-V.
All UC and non-UC patients were undergoing surgery at the University Hospital of Umeå. The UC patients were operated on due to severe UC disease. Some of the patients were operated in an acute stage of the disease
21 Maria Jönsson, 2009 and some of the patients were operated in a more chronic stage. All UC patients underwent total colectomies and ileostomies, leaving the rectum. The UC patients were sent home with their ileostomas 1 to 2 weeks postoperatively. The non-UC patients were operated on for their disease, which in most cases (all but three) corresponded to colonic carcinoma, and were not receiving any chemotherapy or irradiation prior to the surgery. The remaining three non-UC patients had volvolus, perforated diverticulitis and diverticulosis. Many of the UC patients, and one non-UC patient, had been treated with corticosteroids. The healthy volunteers donating blood samples (Paper IV) did not suffer from any disease and were not treated with any form of medication.
Tissue sampling and preparation The tissue specimens were taken during operations (cf. above) and were, concerning both UC and non-UC patients, taken from the most aboral part of the sigmoid colon. Concerning the non-UC carcinoma patients, the specimens were taken at least 10 cm from the visible margin of the tumor, and represented macroscopically non-cancerous tissue. The tissue specimens were directly after the surgery transported on ice to the laboratory. Some specimens were immediately dissected, mounted on thin cardboard in OCT embedding medium, frozen in liquid propane chilled with liquid nitrogen, and stored at –80°C. Other specimens were fixed by immersion overnight at 4°C in an ice-cold solution of 4% formaldehyde in 0.1 M phosphate buffer (pH 7.0). Then they were washed in Tyrode´s solution, containing 10% sucrose, at 4°C overnight. The specimens were further dissected, mounted, frozen and stored as described above. The mucosa samples intended for EIA analyses were weighed and then directly frozen in liquid nitrogen and stored at –80°C.
Blood sampling and preparation Blood samples from UC and non-UC patients were collected in the morning, on the day of the surgery (Paper IV). Blood samples from the healthy controls were also taken in the morning. Venous blood samples were collected in EDTA-treated tubes. 1.3 mg EDTA and 50 µL Trasylol were added to each mL of blood. The blood was centrifuged at 4000 rpm for 15 min in 4°. The plasma was collected, transferred to new tubes, and frozen at –80°C.
Sectioning Series of sections were cut using a cryostat. For immunohistochemistry, 7-8 µm sections were cut and for in situ hybridization, 10 µm thickness was used. The sections aimed for immunohistochemical purposes were mounted on
22 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon slides precoated with crome-alun gelatin. For in situ hybridization, Super Frost Plus slides were used.
Morphology staining In order to display the morphology, the sections were stained in Harris hematoxylin (Htx) solution for 2 min. They were then rinsed in distilled water, dipped in 0.1% acetic acid for a few seconds, and then washed in running water for 5 min. The sections were then counterstained with eosin for 1 min, dehydrated in ethanol and mounted in Permount.
Staining and counting of eosinophils In order to detect eosinophils (Paper I), staining for Congo Red was performed. The reliability of the Congo Red method was tested by comparing sections stained with Congo Red with parallel sections stained with mouse monoclonal anti-eosinophil peroxidase antibody (MAB 1087, Chemicon). The parallel Congo Red and antibody stainings showed similar results. The number of eosinophils per area of the lamina propria was counted from sections of randomly chosen UC patients (six patients) and six non-UC patients. 10 areas of 10,000-15,000 µm2 were counted in each section. Furthermore, semiquantitative determinations of eosinophil numbers in the lamina propria was made for all other specimens.
Immunohistochemistry (IHC) Immunohistochemistry (IHC) was used in Papers I, II, III, V. Two different IHC methods were used, immunofluorescence [tetramethylrhodamine isothiocyanate (TRITC) or fluorescein isothiocyanate (FITC)] and peroxidase anti-peroxidase (PAP) staining. Test stainings were made in order to reveal which method that was the most appropriate for each antibody. For certain antibodies, both immunofluorescence and PAP staining were used. During the tests, stainings for other types of tissues were also performed, in order to display reference information. Test stainings were also made in order to clarify if chemically fixed or unfixed tissue was appropriate for each antibody. For details concerning the preferred method (PAP/TRITC/FITC), and the preferred tissue processing (fixed or unfixed), for the antibodies used, see Table 2.
Pre-treatment procedures In some cases, microwave antigen retrieval was applied (Paper I). The sections were placed in 0.01 M citrate buffer, pH 6.0, and boiled in a microwave oven for 3x5 min. The buffer was changed between each 5 min cycle. After the last cycle, the slides were allowed to cool to room temperature, in the buffer, and were then washed 3x5 min in PBS.
23 Maria Jönsson, 2009
Another pre-treatment method frequently used (Papers I, II, III, V) was acid potassium permanganate solution (1 vol. of 2.5% KMnO4 and 1 vol. of
5% H2SO4 in 80 vol. of distilled water, pH 2.0) for 2 min (124). This pre- treatment was found to be very useful in increasing the specific reactions for certain of the antibodies. That included both stainings with PAP and immunofluorescence methods. For details of when this pre-treatment procedure was used, see the respective papers.
Antigen Code Source Type Dilution Tissue Method Papers
SP 8450- Biogenesis Rabbit 1:100, Fixed PAP I, III 0004 1:200
SP Mas 035 Sera-Lab Rat 1:100 Fixed PAP I
SP I675/00 UCB Rabbit 1:100, Fixed TRITC I 2 1:200
NK-1R NB 300- Novus Rabbit 1:100 Unfixed, TRITC I 119 post- fixation
NK-1R S8305 Sigma Rabbit 1:100 Fixed PAP, I, III TRITC
NK-1R Pc 481 Oncogene Rabbit 1:100 Unfixed, TRITC I Fixed
NK-1R Pc 324 Oncogene Rabbit 1:100 Fixed TRITC I
NK-1R AB5060 Chemicon Rabbit 1:100 Unfixed, TRITC I post- fixation
VIP RPN Amersham Rabbit 1:200 Fixed PAP, II 1582 TRITC
VIP H-064 Phoenix Rabbit 1:500, Fixed PAP, II, III 1:200 TRITC
AChR M2 M9858 Sigma Rabbit 1:100 Unfixed TRITC V
ChAT AB144P Chemicon Goat 1:25 Fixed FITC V
VAChT Sc7716 Santa Cruz Goat 1:25 Fixed FITC V
Chromo- PH176 The Binding Sheep 1:100 Fixed FITC V granin A Site
VPAC1 sc- Santa Cruz Goat 1:100 Fixed FITC III 15958
Table 2. Primary antibodies
24 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Immunofluorescence Incubation with primary antibodies was performed for 1h at 37°C or overnight at 4°C. The sections were stained with tetramethylrhodamine isothiocyanate (TRITC) or fluorescein isothiocyanate (FITC) to detect immunoreactions. For some of the antibodies, pre-treatment was performed (see above). For all the details in the immunofluorescence method protocols, see papers I, II, III, V.
Peroxidase anti-peroxidase staining (PAP) The PAP method was used to detect immunoreactions for some of the substances. The sections were incubated with the respective primary antibodies for 1h at 37°C. For the details in the PAP method protocols, see papers I-III.
Primary antibodies For an overview of the antibodies used for the immunohistochemical stainings, see Table 2.
Control stainings Numerous control stainings were performed to clarify if specific immunoreactions were obtained with the antibodies. The commonly used methods were preabsorbtion of the antibody with the corresponding antigen, and replacement of the primary antibody with PBS or normal serum. Parallel stainings on other tissues were also performed. For details of the preabsorbtions, see the respective papers.
In situ hybridization (ISH) In situ hybridization (ISH) was performed in Papers III and V. For details of the probes used, see Table 3. ISH was performed according to an established protocol (125) with a few modifications. All the details in the protocol are described in Papers III and V. In brief, the sections were air-dried at room temperature (RT), fixed in filter- sterilized 4% paraformaldehyde in 0.1M-phosphate buffer (ph 7.4) at RT, and thereafter washed in saline sodium citrate (SSC) for 10 min. The sections were then placed in 0.2 M HCl at RT to inhibit endogenous alkaline phosphatase activity. Then they were placed in a mixture of 195 ml DEPC-
H2O, 2.7 ml triethanolamine, 0.355 ml HCl and 0.5 ml acetic anhydride in RT in order to acetylate the slides. The slides were then rinsed in SSC. The ssDNA probe (see Table 3) was added to 15 µl of hybridization solution in a tube, denaturated for 5 min at 80°C and then put on ice. Each section was then subjected to the probe-containing solution, covered with coverslips, sealed with nail polish, and incubated at 56°C overnight. The slides were
25 Maria Jönsson, 2009 washed in SSC and thereafter in STE-buffer, and then incubated in 100 µl RNase A at 37°C. Then followed washing, first in SSC containing 50% formamide at 56°C, then in SSC and thereafter in buffer. Then followed incubation with normal horse serum in buffer for 1h, whereafter the sections were incubated with the AP-labelled anti-DIG antibody at RT. After that the slides were washed in buffers. Then the enzyme (AP) substrate solution was sterile filtered and added. Incubation was performed at 4° overnight. Placing of the slides in buffer stopped the colour reaction, and the slides were then counterstained in methyl green and mounted in Pertex.
Probe Code Dilution* Sequence Papers
ChAT GD1001 25-50 ng CCATAGCAGCAGAACATCTCCGTGGT V -CS TGTGGGCACCTGGCTAGTGGAGAG
SP GD1001 25-50 ng CGTTTGCCCATTAATCCAAAGAACTGC III -CS TGAGGCTTGGGTCTCCG
VIP GD1088 50 ng ACTGGTGAAAACTCCATCAGCATGCC III -OP TGGC
TACR1 GD1001 10-50 ng TGACCACCTTGCGCTTGGCAGAGACT III (NK-1R) -DS TGCTCGTGGTAGCGGTCAGAGG
Table 3. Probes used for in situ hybridisation. All the probes were Green Star*TM DIG10 Oligonucleotide probes and were ordered from Gene Detect, New Zealand. The corresponding sense DIG-hyperlabelled ssDNA probes were used as negative controls. *Dilution refers to ng in 15 µl of hybridization solution. β-actin (GD5000-OP), at a dilution of 25 ng in 15 µl hybridization solution, was regularly used as a positive control.
EIA (Enzyme Immunosorbent Assay) Both colonic mucosa and blood plasma were analyzed by the EIA method (Paper IV).
Tissue homogenisation The mucosa samples were homogenized in a prepared buffer (for details, see paper IV) in a 1:20 relation. The homogenization procedures were performed on ice. The tubes were thereafter centrifuged at 4°, 13 000 g, for 15 min. The supernatant was then transferred to new tubes and stored at –80°.
EIA procedure The SP, VIP and CGRP concentrations were analyzed using commercially available enzyme immunoassay kits (see Table 4). The minimum detection level for these kits was 0.25 ng/mL. The assays were performed in accordance with the supplier’s instructions. Reference samples were
26 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon included in all plates, in order to obtain comparable results between different plates. Thus, more than one plate for each substance was needed.
Antigen Code Source
SP EK-061-05 Phoenix Pharmaceuticals, CA, USA
VIP EK-064-16 Phoenix Pharmaceuticals, CA, USA
CGRP EK-015-02 Phoenix Pharmaceuticals, CA, USA
Table 4. EIA kits used. All kits were used in Paper IV. Additional EIA/ELISA kits were used (TNFalpha, TNF receptor and NGF/BDNF, cf. Paper IV) but these were beyond the scope of the current thesis.
In vitro receptor autoradiography In vitro receptor autoradiography, a technique that has been frequently used in detecting receptors (126), and which permits morphometric evaluation via counting of silver grains, was used (Paper II). Specimens from five randomly chosen UC patients and five non-UC patients were analyzed. Five areas from mucosa from each section (level) were randomly chosen, photographs being taken from these areas concerning both total binding and non-specific binding. We analyzed three levels from each patient. We analyzed approximately 2.5 mm2 per level. The total areas analyzed were 32.5 mm2 for non-UC patients and 37.5 mm2 for UC patients. Sections were mounted on poly-L-lysine-coated slides and air dried for 2 h at 4°C, and were then pre-incubated for 30 min at 23°C, in one of two solutions. One was a solution of 0.0005% polyethylenamine in 50 mM tris- HCl buffer (pH 7.4) to uncouple endogenously bound VIP. The other was the same solution also containing 1.250 µM VIP (Sigma), 0.1% bacitracin and 1% bovine serum albumin to saturate the VIP binding sites. The sections were then incubated in a humid environment for 60 min at 23°C in 50 mM Tris- HCl containing 0.125nM [125I]VIP (Amersham), 0.1% bacitracin and 1% BSA. By incubating the sections with 0.125 nM [125I]VIP in the presence of 1.250 µM unlabeled VIP, non-specific binding was assessed. Thereafter followed washings, fixation with glutaraldehyde, further washing and covering with LM-1 nuclear emulsion (Amersham), exposure and then development in Kodak D19, fixation in 30% sodium thiosulphate, and staining with Mayer’s hemalum solution. Parallel sections were stained for morphology.
Quantitative analysis The areas used for detection of VIP binding in the mucosa were randomly chosen. Analysis of the autoradiograms was made via a dark-field
27 Maria Jönsson, 2009 microscope (Zeiss Axioskop 2 plus) that was equipped with a CCD camera (Olympus DP70) connected to a computer with image software (Image Pro Plus 5.0). The optical system was adjusted in the way that 1280 x 1024 pixels of the monitor screen corresponded to an analyzed area of 800 x 640 µm of the tissue specimen, i.e. 1.6 x 1.6 pixels per 1.00 µm tissue. The grey-scaled image was converted into a binary image. The silver grains were noticed against a neutral background. The same discrimination level was used in every computation. Thereafter, the specific binding of [125I]VIP was determined.
Correlations VIP binding/VIP IHC/mucosa morphology The degree of VIP binding, categorized in a 5-graded scale, was compared with the morphologic appearance of the mucosa (5-graded scale) and an overall estimation of the level of VIP innervation in the lamina propria.
Semiquantitative analyses Semiquantitative analyses were used (Papers I, II, IV, V) in order to evaluate the degrees of mucosal derangement. When making the evaluation concerning levels of derangement, marked derangement was defined as large affection of crypt morphology, markedly increased lamina propria area on behalf of epithelial area, and pronounced infiltration of inflammatory cells into the lamina propria. The level of immunohistochemical expressions of different substances was also determined semiquantitatively (Papers III, V).
Statistics The results were evaluated using the software SPSS 11.0 for Macintosh. 2- independent sample test according to Mann-Whitney, unpaired student’s t- test, paired samples t-test, independent samples t-test, Pearson correlation analysis was used (cf. the respective Papers). We considered P-values ≤ 0.05 to be significant.
Ethical considerations Informed consent was obtained from all individuals, both patients and healthy controls. The Ethical Committee at Umeå University granted permission for these human studies (dnr 01/332). The experiments were conducted according to the principles expressed in the Declaration of Helsinki.
28 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon Results and Discussion
Methodological considerations
Concerning the patient material It should be stressed that the material of UC patients was from patients operated on due to severe disease, which did not respond to pharmacological treatment. Thus, the material did not conform to biopsies of patients with very mild disease. Via the way the material was obtained, much larger specimens could be taken and analyzed compared to what would have been possible with biopsies. Furthermore, the entire colonic wall could be examined. The patients operated on in a non-acute stage were chronically ill and were also in need of surgery. The great majority of the non-UC patients were suffering from colorectal carcinoma. We did not observe any general differences between non-UC patients operated on for other reasons and the colonic carcinoma patients. The mean age of the non-UC patients was considerably higher compared to the UC patients. Nevertheless, when comparing specimens of the youngest individuals with those of the oldest in the non-UC group, we did not observe any obvious differences in the immunohistochemical pattern of the antibody reactions (data not published).
Concerning antibodies and tests for specificity It is crucial that optimal procedures are used in order to produce the most distinct and specific reactions concerning both IHC and ISH. Thus, evaluations of test stainings using chemically fixed and unfixed tissue specimens, different pre-treatment methods, and different staining protocols were made. Furthermore, the procedures used are based on several years’ experience of these issues in the laboratory. Preabsorbtion was performed with the majority of the antibodies to confirm their specificities in IHC. For ISH, stainings with a sense probe were always performed in parallel. In the antibody test procedures, reference stainings on other tissues were also performed. It was found especially crucial to use different methods and different antibodies in order to clearly depict the NK-1R expression patterns using IHC. Thus, five different NK-1R antisera and varying staining protocols were used. Specific reactions were noted to somewhat varying extents by using the different methodological procedures and the different antisera. This is presumably related to the fact that there are known variations in specificities and affinities between different NK-1R antibodies (127), to the occurrence of tissue and species variations in NK-1R detectability (128, 129), the
29 Maria Jönsson, 2009 occurrence of different NK-1R subtypes (130), and to the fact that the fixation procedures used can affect the extent of NK-1R detectability (131). One should always be cautious concerning the aspects of specificity. E.g. with respect to detection of SP, it should be noted that recently discovered peptides belonging to the tachykinin family demonstrate a high degree of cross-reactivity with anti-SP antibodies. These peptides include members related to hemokinins and endokinins (132, 133). Thus, the question arises as to whether the currently used SP EIA kit not only detects SP-related peptides but also hemokinins and endokinins. The C-terminal structure of SP, hemokinins and endokinin A/B are thus very similar. There is no information from the supplier on this aspect.
Morphology (Papers I-V) Although the material of all UC patients collectively was obtained from colectomy operations, the general morphology displayed variations between different samples. Nevertheless, the mucosa displayed, as expected, significantly more derangement in the UC group compared to the non-UC group (Fig. 3). Some of the UC samples showed only minor derangement. We also noted that there to some extent were variations in morphology between different samples of the same individual.
Fig. 3. Morphology of the mucosa from non-UC (a) and UC patients (b) stained for haematoxylin-eosin. Note the marked infiltration of inflammatory cells and the absence of crypts in (b).
30 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Substance P and the NK-1R
SP innervation (Paper I) Nerve fibers showing SP-like immunoreaction (LI) were found in the lamina propria (Fig. 4). They occurred in varying numbers. Nevertheless, the variability was not related to variability in the extent of mucosal derangement. SP-LI was also observed in nerve fascicles in the submucosa, in nerve fibers in the ganglionic accumulations of the submucous plexus, perivascularly, and in the myenteric plexus, including in the innervation of the smooth muscle layers. SP-LI was also observed in neuronal perikarya of both the submucous and the myenteric plexuses. No obvious differences in general innervation patterns were observed between the UC and non-UC groups. These results on SP innervation patterns in the human colon agree with those previously described for UC and controls (113, 134, 135). Thus, there are to some extent inter-individual variations, which can explain the findings of increased, unaltered or decreased levels of SP-innervation in previous studies (cf. Introduction). This can in turn be related to the continuing inflammatory responses in the UC process. It appears as if a downregulation of the type observed for VIP innervation (cf. below) not occurs for SP- innervation in response to severe UC.
SP levels in mucosa (Paper IV) Using EIA, it was demonstrated that the SP levels in the mucosa were significantly higher in UC patients compared to non-UC patients. The levels were about three times higher in the UC mucosa. Overall, it is thus obvious that there is a general difference between UC mucosa and non-UC mucosa in this aspect. Here it is of importance to realize that the SP levels detected with EIA are not only related to SP-innervation but also to SP produced in local cells such as inflammatory cells and epithelium (see further below).
Local production of SP (Paper III) SP mRNA was found in epithelial cells and lamina propria and submucosal cells. Epithelial SP mRNA was mainly observed in non-UC mucosa and in UC mucosa demonstrating only minor derangement. Immunoreactions for SP were on the other hand not observable in the epithelium, or in the lamina propria/submucosal cells. One explanation may be that the production levels of SP in epithelium are too low to be detected by our immunohistochemical methods. In accordance with such an explanation are the previous findings that there are comparatively low levels of SP gene expression in non-neuronal SP- expressing cells, as compared to neuronal such cells, (136) and that neuropeptide levels in neuropeptide-synthesizing non-neuronal cells are
31 Maria Jönsson, 2009 very low (32). Another possible explanation is that SP is only produced under certain circumstances. There are several regulating steps in the pathway from DNA to protein, and the process can be inhibited before the protein synthesis (137). The mRNA is furthermore needed in a certain amount in order to lead to protein production. Nevertheless, the former interpretation seems more attractive. In any case, as it is described in Introduction, SP expression is nowadays shown for human epithelium in other parts of the body. Inflammatory cells have also been shown to express SP (51, 138).
Fig. 4. SP-LI in nerve fibers in lamina propria of an UC patient.
Fig. 5. NK-1R in lamina propria cells of a non-UC patient.
32 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
NK-1R expression (Paper I, III) NK-1R immunoreactions were detected in nerve fibers of nerve fascicles in the submucosa, and also in the smooth muscle and myenteric and submucous plexuses and in blood vessel walls. NK-1R immunoreactions, as well as to certain extents TACR1 mRNA, were also found in the epithelium of both UC and non-UC patients. The reactions were weak in some of the samples, demonstrating that there are interindividual differences. It was frequently observed that the epithelial NK- 1R reactions were particularly pronounced in areas demonstrating marked mucosal derangement. The level of NK-1R expression has also been noted to be increased in certain other situations, such as during the inflammation seen in the rat intestinal epithelium after exposure to Clostridium difficile toxin A (139). Distinct NK-1R immunoreactions (Fig. 5) and TACR1 mRNA were also detected in cells in lamina propria and submucosa. Lamina propria cells demonstrating NK1-R gene expression were earlier observed in the IBD mucosa (51, 121, 122). These were interpreted as lymphocytes, macrophages and eosinophilic granulocytes (122). As will be discussed below, we have also in our laboratory noted that a subpopulation of the lamina propria cells exhibiting NK-1R are eosinophils (unpublished observations).
Eosinophil infiltration in relation to NK-1R expression (Paper I) It is well known that different types of white blood cells are present in lamina propria during the inflammatory process in UC. As a part of this thesis, the level of infiltration of the eosinophils was evaluated. One main finding was the notion that there were marked interindividual variations in eosinophil numbers in both the UC and the non-UC groups. One explanation for this may be the occurrence of differences in allergic backgrounds. However, in the great majority of the UC samples demonstrating pronounced inflammation and/or morphologic derangement, there was a large number of eosinophils in the mucosa. This suggests that the eosinophils are involved in the disease process in UC. It is previously reported that there is an increased activation and degranulation of eosinophils in UC (84). Lampinen and collaborators have found that eosinophils were more numerous and more active in patients with active UC than in controls, and these findings indicates that these cells are possibly pro-inflammatory and tissue damaging cells (83). The fact that numerous eosinophils in the lamina propria usually occurred in specimens with marked NK-1R expression in the epithelium, may suggest that the NK-1 receptor may play a role in the extravasation of eosinophils. We have also recently observed that NK-1R is present in eosinophils in the human colonic mucosa (unpublished observations). It is therefore possible that NK-1R receptors are involved in this extravasation. In accordance with
33 Maria Jönsson, 2009 this suggestion are the findings that SP is of importance for eosinophil infiltration in the airways (140, 141). It is previously described that NK-1R participates in neutrophil accumulation in inflamed skin (142).
VIP and VIP receptors
VIP innervation (Paper II, III) Nerve fibers demonstrating VIP-like immunoreactivity (-LI) were found in lamina propria, especially in the superficial parts. They were also found in submucosal nerve fascicles, submucosal and myenteric plexuses, and in the smooth muscle. Concerning the mucosa, VIP-LI nerve fibers were most numerous in mucosa demonstrating a rather normal morphology. Comparatively fewer nerve fibers demonstrating VIP-LI were found in parts of the mucosa where the infiltration of inflammatory cells was the most marked. The general observations on the pattern of VIP innervation conform to the previously described pattern for the normal colon and the colon in UC (e.g. (113, 135, 143)). The findings of a decrease in VIP-innervation in relation to marked UC-inflammation do to a certain extent conform to previous studies (109, 110). The observations show that there, in contrast to the situation for SP-innervation, is a down-regulation of VIP innervation when the inflammation is marked.
VIP levels in the mucosa (Paper IV) There were significantly higher levels of VIP in the mucosa in UC patients compared to non-UC patients, in examinations using the EIA method. Thus, in contrast to the fact that VIP innervation appears to be downregulated in response to severe UC, there was not a correlative decrease in VIP levels as seen by EIA. This may be explained by the fact that some of the inflammatory cells are producing VIP, and that we also have observed signs of VIP production within the epithelial layer (see further below).
Local production of VIP (Paper III) mRNA for VIP was found in submucosal and lamina propria cells. VIP immunoreactions were also observed in those cells. This is in accordance with the previous findings that VIP is produced by inflammatory cells in the intestine (65, 66, 144). Epithelial VIP mRNA was found, with the exception of very deranged mucosa. The epithelial reactions were mainly observed in basal crypt epithelium. Very weak VIP immunoreactions were also seen in the basal crypt epithelium. Expression of VIP has not previously been demonstrated in colonic epithelium.
34 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
If we assume that VIP to some extent is produced in the epithelial layer, the peptide can have autocrine/paracrine effects within the layer. This is mainly a fact for normal epithelium and epithelium that is not much deranged. In accordance with an occurrence of autocrine/paracrine VIP effects in the intestinal epithelium are the findings that VIP is involved in the regulation of proliferation of intestinal epithelial cells (145). It is since long considered that VIP has marked trophic and growth-modulating functions (63). Concerning the intestine, VIP is described to have immunomodulatory effects on intestinal epithelial cells via a regulation of IL-8 secretion (146).
VIP receptors The distribution and the magnitude of occurrence of VIP receptors in UC and non-UC mucosa were examined by two different methods. VIP in vitro receptor autoradiography and VPAC1 immunohistochemistry were applied. The background for using autoradiography was that the magnitude of binding sites over large areas could be analyzed for, and the background for using antibodies against VPAC1 is the known fact that this is the VIP/PACAP receptor that is known to predominate for the human intestine, at least concerning the smooth muscle (69).
VIP binding (Paper II) Via in vitro receptor autoradiography, the binding sites for VIP in the colonic mucosa were studied. A significant difference was found between non-UC and UC patients. The non-UC patients displayed more VIP-binding sites in the mucosa compared to UC-patients. As was the case for VIP innervation, VIP binding sites were most clearly observed in the superficial parts of the mucosa. In lamina propria areas demonstrating accumulation of inflammatory cells, there was a very low degree of VIP binding.
VPAC1 IHC (Paper III) Distinct VPAC1 IR was noted for the epithelial layer (Fig. 6). However, there were low levels of VPAC1 IR in UC specimens demonstrating a marked inflammation. VPAC1 IR was also noted for cells of the lamina propria and submucosa, in muscularis mucosae and in blood vessel walls. The observations of a low degree of VPAC1 IR in deranged and inflamed mucosa correspond to the observations seen for deranged mucosa concerning VIP binding sites. The findings suggest collectively that there are limited VIP effects in colonic areas that are highly inflamed by the UC disease. As VIP has both anti-inflammatory (59) and trophic effects (43), this fact may be negative for the colon.
35 Maria Jönsson, 2009
Fig. 6. In (A) VPAC-1-IR in the epithelium of crypts, and in the muscularis mucosae (to the left). In (B) the same area after preabsorbtion of the antibody. Non-UC patient.
Neuropeptides in plasma and correlations to other parameters (Paper IV)
Neuropeptide levels in plasma The plasma levels of VIP and SP, as well as those of CGRP, were studied concerning both UC and non-UC patients (colonic carcinoma patients). Additionally, plasma from healthy controls was studied. For all three neuropeptides, the UC group was showing the highest plasma levels, and healthy controls were displaying the lowest levels (see Paper IV, Table 3). The differences between UC patients and healthy controls were more marked than those between colonic carcinoma patients and healthy controls. The observations show that there is an increased release to the blood of all three neuropeptides analyzed in UC. Concerning the UC-group, the VIP, SP and CGRP levels in plasma were significantly higher in patients treated with corticosteroids and/or non-steroid anti-inflammatory/immunosuppressive drugs, compared to those that were not given any medication. It has not previously been shown that the plasma levels of several neuropeptides collectively are increased in UC. It is previously described that plasma levels of different cytokines are different in UC compared to healthy individuals (147).
Correlations between plasma and mucosa levels and the degree of mucosal derangement Correlative analyses of neuropeptide levels in plasma vs. mucosa from the same individuals gave the opportunity to study possible associations
36 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon between the levels in plasma and those in mucosa, and if there were correlations to the extent of morphologic affection. In plasma, there were correlations (Paper IV, Table 8) between the levels of all three neuropeptides (SP vs. VIP, SP vs. CGRP and VIP vs. CGRP respectively). There were also correlations between VIP and SP in mucosa (Paper IV, Table 7). For VIP, there was furthermore a significant correlation between levels in plasma and mucosa (P <0.05). Concerning SP, the correlation between plasma and mucosa levels was only almost significant (P <0.10). Interestingly, there was a marked correlation between the degree of mucosa derangement and the plasma levels of the three neuropeptides. The levels of all three neuropeptides in the mucosa were higher when there was a marked derangement. The observations show that the levels of the three neuropeptides in both plasma and mucosa to a large extent are related to the extent of colitis involvement. It is apparent that the production levels for all three are increased in parallel with the disease process. Furthermore, that there are marked correlations between VIP and SP for both plasma and mucosa. It is also apparent that high levels of VIP and SP in mucosa parallel high levels in plasma. It is of interest to have markers for UC to examine for in blood- and/or stool samples from patients, both concerning diagnostic issues to discriminate UC from other diseases, and to monitor and predict the disease course. CRP is a valuable marker to detect and follow up disease activity in Crohn’s disease (148). Elevations in CRP are, however, of smaller magnitude in patients with active UC than active Crohn’s disease (149). For UC, anti- neutrophil cytoplasmic antibodies have been found in sera in 60% of the patients (150). In stool, markers for calprotectin have been studied; this marker followed the disease activity in UC patients (151). The observations on three neuropeptides analyzed in Paper IV concerning plasma give a hint for the further use of examining for neuropeptide plasma levels in UC analyses.
The cholinergic system (Paper V)
The cholinergic innervation Immunoreactions for ChAT and VAChT were noted for nerve fibers of the lamina propria, the submucous plexus, and the myenteric plexus, including the smooth muscle innervation. These observations are related to the postganglionic part of the parasympathetic nervous system and thus to the ENS. ChAT immunoreactions have also previously been observed for the submucous and myenteric plexuses of the intestine of man (152-154).
37 Maria Jönsson, 2009
Observations favouring a local production of ACh The non-neuronal cholinergic system was extensively examined for in Paper V. The ACh synthesizing enzyme ChAT, and the ACh transporter VAChT were studied. ChAT IR was found in endocrine cells of the epithelial crypts. There were significantly more immunoreactive endocrine cells found in non- UC patients, compared to UC patients. ChAT IR was also found in lamina propria cells and submucosal cells. Weak ChAT IR was noted for blood vessel walls. Whereas ChAT IR was not detected with certainty in the epithelial layer, ChAT mRNA reactions were observed in the epithelium. That included the situation for goblet cells. ChAT mRNA was also observed in cells in the lamina propria, and also in some blood vessel walls in the submucosa. VAChT IR was observed in the epithelium (Fig. 7). There were significantly higher levels of VAChT IR in the epithelium of non-UC patients compared to UC patients. VAChT IR was also found in cells in the lamina propria. The levels of VAChT in the epithelial layer were significantly correlated to the levels of VAChT in lamina propria (reactive cells and nerve fibers grouped together).
Fig. 7. VAChT IR is present in the epithelium of crypts, and in cells in the lamina propria of a non-UC patient.
38 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Muscarinic receptor M2 Immunoreactions for the ACh receptor M2 were clearly observed in the mucosal epithelium (Fig. 8). There was a tendency of more pronounced M2 IR in UC epithelium compared to non-UC epithelium. M2 IR were also noted for blood vessel walls, nerve fascicles and the smooth muscle layers.
Fig. 8. M2 immunoreactions in the epithelium of crypts of a non-UC patient.
Interpretations concerning the non-neuronal cholinergic system The patterns of the non-neuronal cholinergic system for the human colon in UC are here established. Thus, it is evident that the observations suggest that a local ACh production occurs. Here it should be recalled that although immunoreactions for ChAT previously have been demonstrated for the epithelium and some inflammatory cells in the human intestine (25, 26), the ChAT patterns in UC have never been analyzed before. Furthermore, ChAT ISH and VAChT IHC have not before been applied on the human intestine. Concerning the epithelium it is likely that ACh released from cells of this layer interacts with the epithelial ACh receptors. When discussing this aspect, it should be recalled that muscarinic receptors are not only related to effects on ion transport and secretory activity, but also to effects on cell growth and proliferation (28, 29). Thus, marked cholinergic autocrine/paracrine effects may precede in the colonic epithelial layer. Cells in lamina propria and submucosa are apparently a part of the non- neuronal cholinergic system. Accordingly, lymphocytes have been described to constitute an independent non-neuronal cholinergic system, synthesizing and producing ACh and expressing both muscarinic and nicotinic receptors (155).
39 Maria Jönsson, 2009
Of great interest is the nowadays accepted concept of a cholinergic anti- inflammatory pathway (19). One example showing this is the finding that ACh released in response to activation of the vagal nerve has effects on the local inflammation (156). The concept may involve the non-neuronal cholinergic system (24). This may be of great importance in an inflammatory situation like UC. The importance of the non-neuronal cholinergic system in UC is completely unknown. As inflammatory cells can produce ACh and as this system is markedly present in the colon, the importance of this system in UC should be the scope of future studies.
Future treatment possibilities Information about expressions and magnitudes of VIP/SP and cholinergic systems in UC is not only of academic interest. Information on these aspects may be of relevance when discussing future treatment possibilities for UC. It is suggested that VIP treatment (157, 158), as well as blocking of the NK-1 receptor (71, 139, 159), may be useful in this disease. Experimental studies on animals favor that NK-1R blocking (160, 161) and VIP treatment (157) might be useful in colitis. Experimental studies do also favor that VIP treatment may have effects in other inflammatory situations, such as experimental autoimmune encephalomyelitis (162). However, in certain experimental studies, VIP treatment was found unable to modulate colitis (163). It might be that interference with several mediators, i.e. multitarget therapy, can be an alternative in inflammatory disorders (164). It is thus well known that a large number of interactions occur between neuromodulators and cytokines. Interfering with neuropeptide effects in parallel with the use of other medications is considered as one alternative in inflammatory disorders (165). The fact that VIP treatment down-regulates the production of several inflammatory mediators, including TNFalpha (162) is nevertheless promising. Anti-TNF treatment has been used for several years concerning troublesome Crohn’s disease (166) and has also nowadays been introduced for severe UC. There is good response for some, but not for all patients (167- 169). Also the cholinergic/nicotinergic systems are relevant when discussing treatment possibilities. It is known that UC is a disease that mainly affects non-smokers. Nicotine has its effect on nicotinic acetylcholine receptors, distributed both in neurons but also in nonneuronal cells (170). Trials with transdermal nicotine (patches) showed however that these were not better than placebo in the maintenance of remission of UC (171). There are several studies which suggests that muscarinic receptor antagonists or agonists may be beneficial in different situations, for example
40 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon obesity (172), Alzheimer’s disease (173), schizophrenia (174), overactive bladder (175), and even cancer (176).
In a study of Hirota and collaborators muscarinic receptor M3 knock-out mice were more sensitive in developing colitis compared to wild type mice (177), showing that manipulations of the cholinergic system may be of advantage in treating UC. Most of the UC patients have relapses in their disease. Medications to reduce the likelihood of those relapses may be of advantage also in reducing the long-term complications of the disease. Maybe a combination of several agonists/antagonists interfering with several neuropeptides, cytokines or other neuromodulators are alternatives in treating UC in the future.
Summary of the main findings
• There is mRNA for SP and VIP in the colonic epithelium as seen by in situ hybridization.
• The level of VIP innervation but not the level of SP innervation is decreased in mucosa areas showing marked inflammation.
• There are marked reactions for the VPAC1 receptor in the colonic epithelium, the reactions being particularly pronounced in normal and little affected mucosa.
• The levels of VIP receptors in the mucosa, as seen by in vitro receptor autoradiography, are decreased in areas of the UC mucosa that show marked inflammation/derangement.
• There is an association between marked derangement of the mucosa, pronounced infiltration of eosinophils in lamina propria, and a marked NK-1R expression in the epithelial layer. Thus, epithelial NK-1R immunoreactions are often the most marked where the mucosa shows a pronounced morphologic derangement. There were usually numerous eosinophils in the underlying mucosa in these areas.
• In accordance with previous observations, there is presence of VIP immunoreaction, VIP mRNA, VPAC1 immunoreaction, SP mRNA and NK-1R immunoreaction in cells in lamina propria and submucosa.
• There are elevated levels of SP, VIP and CGRP in both plasma and mucosa in UC patients. There are marked correlations between the levels of the three peptides with regard to both plasma and mucosa. There are
41 Maria Jönsson, 2009
also, to a certain extent, correlations between the levels of SP and VIP in mucosa vs. plasma.
• The levels of the neuropeptides in plasma and mucosa are correlated to the degree of mucosal derangement.
• Reaction patterns observed for ChAT and VAChT suggest that there is a marked local production of ACh in the colon. Thus, there is a non- neuronal cholinergic system. Some changes in this system occur in UC.
• Marked muscarinic M2 immunoreactions occur in several tissue compartments. There was a tendency towards higher M2 immunoreactions in the epithelium of UC patients than in non-UC patients.
Summary of main conclusions
• It seems as if there is not only a VIP- and SP-supply to the intestine via the innervation and inflammatory cells, but presumably also via the epithelium. Nevertheless, further studies are needed to clearly show the existence of productions of the peptides in the epithelium.
• The colon is supplied with not only a neuronal but also a non-neuronal cholinergic system. This fact has not previously been considered for IBD. The non-neuronal cholinergic system may be highly involved in the processes that occur in the colon. The existence of a cholinergic anti- inflammatory pathway speaks in favor of such a suggestion.
• The epithelium is shown to be markedly influenced by SP, VIP, as well as ACh. A marked presence of receptors for all these was noted. Autocrine/paracrine SP, VIP, and ACh effects are likely to occur.
• The findings suggest that there is a downregulation of both VIP innervation and VIP receptors in mucosal areas that are greatly inflamed and deranged.
• In contrast to the situation for VIP, SP innervation appears not to be reduced when there is marked inflammation, and the levels of SP receptor (NK-1R) are, instead, often pronounced in such cases.
• The changes seen regarding VIP and SP receptors in relation to inflammation/derangement may be a drawback for intestinal function.
42 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
• It may be that the NK-1R is involved in the extravasation of eosinophils in the colonic mucosa.
• New information on the existence of correlations between neuropeptide levels in mucosa and plasma and the mucosal affection has been obtained via correlative studies on all three parameters for the individual patients. More mucosal affection leads to more neuropeptide production in the mucosa and higher levels of these in the blood.
• In conclusion, regarding the importance of both the SP/VIP systems and the cholinergic system in the colon, both neuronal and non-neuronal components should be taken into consideration.
43 Maria Jönsson, 2009 Funding
• The Faculty of Medicine, Umeå University
• The County Council of Västerbotten
• Lions Cancer Research Foundation
• The foundation “Nio meter liv”
• Dagmar Ferbs minnesfond
• Arnerska forskningsfonden
• JC Kempes Minnes Stipendiefond
• Wallenbergs stiftelse för resestipendium vid Umeå Universitet
• Anna Cederbergs stiftelse
44 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon Svensk populärvetenskaplig sammanfattning
Introduktion Ulcerös colit (UC) är en kronisk inflammatorisk tarmsjukdom som går i skov. Den drabbar slemhinnan i tjocktarmen. Under ett skov får patienten blodiga slemmiga diarréer, feber och magsmärtor. Skoven kan komma tätt eller med flera års intervaller. Sjukdomens förlopp går inte att förutsäga. Sjukdomen behandlas med kortison och olika antiinflammatoriska mediciner. En del av patienterna blir inte hjälpta av den medicinska behandlingen och måste få tjocktarmen bortopererad. För vissa görs detta på därför att de aldrig blir riktigt besvärsfria. För andra görs det under akuta skov som faktiskt kan bli livshotande. Andelen UC-patienter som genomgår operation varierar mellan olika studier men har beskrivits vara ungefär 10 % efter 10 års sjukdom. UC drabbar människor i alla åldrar, men vanligaste åldern för insjuknande är 20-29 år. Sjukdomen drabbar även barn. Med sjukdomen följer också en ökad risk för cancer i tjocktarm och ändtarm. Risken har beskrivits vara 2-3 gånger högre jämfört med den för friska. Tjocktarmsväggen är uppbyggd av en slemhinna (mukosa) som har ett lager celler längst ut (epitel). Mukosan består av inbuktningar (kryptor) och en del som kallas lamina propria där det bland annat finns immunceller och nervtrådar. Under mukosan finns submukosan. I submukosan finns blodkärl och en omkopplingsstation för nerver som kallas submukösa plexat. Under submukosan finns två muskellager, och mellan dessa muskellager finns en annan omkopplingsstation för nerver som kallas myenteriska plexat (för bilder över tarmens uppbyggnad, se Fig 1 sid 9 samt Fig 2 sid 10). Neurotransmittorer är substanser som överför signaler mellan olika nerver, och mellan nerver och celler. Den neurotransmittor som studerats i den här avhandlingen är acetylkolin. Acetylkolin tillverkas i nervändar med hjälp av ett enzym som heter ChAT. Det transporteras sedan till sin lagringsplats (vesiklar) med hjälp av transportören VAChT. Man har numera även funnit att acetylkolin kan produceras i celler som inte är nervceller. Detta kallas för det icke-neuronala kolinerga systemet. Acetylkolin påverkar receptorer, och i denna avhandling fokuseras på den så kallade muskarinerga receptorn M2. Acetylkolin har bland annat effekter på immunsystem och tillväxtprocesser. Vidare har neuropeptiderna substans P (SP), VIP och CGRP studerats. Neuropeptider är inblandade i vävnadstillväxt, inflammation, tumörtillväxt mm. SP är bland annat inblandad vid upplevelse av smärta, vid reglering av blodflöde, vid sårläkning, och vid aktivering av kräkreflexen. VIP är bland annat inblandad vid reglering av blodflöde, tarmrörelser, och sårläkning. Viktiga skillnader funktionellt dem emellan är att VIP är en anti-
45 Maria Jönsson, 2009 inflammatorisk substans och SP en pro-inflammatorisk substans, och vidare verkar de olika på motoriken i tarmen. Eosinofiler är en typ av vita blodkroppar som mycket väl kan vara inblandade vid utvecklingen av UC. Aktivering av dessa celler gör att de tömmer ut granula som förstör vävnaden, skapar inflammation, och i tarmen kan detta leda till bland annat diarré. Det har också nyligen föreslagits att eosinofiler även ska kunna reparera skadat epitel.
Bakgrund till dessa studier Effekterna av signalsubstanserna acetylkolin, SP och VIP är viktiga för både frisk och inflammerad tarm. Men det är många faktorer som är oklara (för referenser, se Introduction). Det gäller:
• Nivåerna av SP och VIP i nerver vid svår UC-sjukdom. Det finns stora variationer i resultaten från studier som tidigare gjorts. Utifrån dessa tidigare studier är det oklart om förändringar i SP- och VIP- innervering hör ihop med sjukdomsprocessen vid UC.
• Ifall det finns produktion av VIP och SP i epitelet i tarmen? Det är välkänt att SP och VIP inte enbart produceras i nerver utan också av inflammationsceller. Men man vet inte om SP och VIP också produceras i epitelet i tarmen. Man vet däremot att de produceras i epitel på några andra platser i kroppen.
• Nivåerna av SP och VIP i blod jämfört med nivåerna av dessa i mukosa. Neuropeptider frisläpps från vävnader till blodet. Det är okänt om det finns någon koppling mellan nivåerna av dessa i blod och nivåerna i tarmens mukosa. Det som är intressant är om man kan mäta dessa substanser i blodet och på så sätt få någon vägledning om hur sjukdomen ser ut i tarmen.
• Receptorerna för SP och VIP vid svår UC-sjukdom. Det finns oklarheter i nivåerna av receptorerna (bindningsställena) för SP och VIP vid UC. Man vet heller inte om nivåerna av receptor har någon koppling till hur skadad tarmen är vid UC.
• Det icke-neuronala kolinerga systemet vid UC. Det finns inga tidigare studier gjorda angående det icke-neuronala kolinerga systemet vid UC. Det kolinerga systemet kan ha en anti-inflammatorisk effekt, och acetylkolin har effekter på tillväxt, blodkärlsbildning, och troligen sårläkning. Därför är det intressant att studera detta vid UC.
46 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Material och metoder I den här studien har material studerats från UC-patienter som varit så sjuka att de varit tvungna att få sin tarm bortopererad. Som kontroller har tarm från patienter som opererat bort tjocktarmen av andra skäl, oftast på grund av tjocktarmscancer använts. Då har en till synes frisk tarmbit minst 10 cm från tumören undersökts. Även blodprov har tagits från både UC- patienter och kontrollerna. Det har även tagits blodprov från helt friska försökspersoner. Tarmbitarna har snittats i 0,007 mm tunna snitt och har sedan färgats in med olika metoder (immunhistokemi, in situ hybridisering och autoradiografi). En del av tarmbitarna har dessutom lösts upp i vätska och analyserats med den biokemiska metoden EIA. Även blodet har analyserats med den metoden. Projektet är godkänt av etisk kommitté. Alla patienter har informerats och de har gett sitt samtycke till att vara med i studien.
Sammanfattning av resultat
• Det finns i princip ett samband mellan graden av tarmskada, antalet eosinofiler i mukosan, samt graden av SP-receptor i epitelet. Där skadan är stor finns oftast en stor mängd SP-receptor i epitelet och många eosinofiler i den underliggande mukosan. Det kan vara till nackdel för mukosan eftersom SP är en pro-inflammatorisk substans. Fynden talar också för att SP kan vara inblandad i rekryteringen av eosinofiler till den inflammerade mukosan.
• Det finns vissa tecken på en produktion av VIP och SP i epitelet i tarmen. Uttryck för dessa ses nämligen på så kallad mRNA-nivå. Alltså kan det vara så att VIP och SP inte bara tillförs tarmen via nerver och inflammationsceller vilket man tidigare trott.
• Det finns ett färre antal receptorer för VIP i tarm som är mycket skadad, jämfört med lindrigt skadad och normal tarm. Det är en nackdel eftersom VIP har anti-inflammatoriska egenskaper.
• Nivåerna av neuropeptiderna SP, VIP och CGRP är högre i både blod och tarm hos UC-patienter jämfört med kontroller. Det finns ett samband mellan skadad mukosa, och nivåerna av neuropeptiderna i både tarm och blod. Mer skada på mukosan leder till högre nivåer av neuropeptiderna i mukosan och i blodet. Parallell analys av alls dessa tre neuropeptider i blodprov kan alltså ge en fingervisning om graden av inflammation/skada av mukosan.
47 Maria Jönsson, 2009
• Bevis visas för att en lokal produktion av acetylkolin sker i celler i tarmen. Det har förut inte visats för UC tarm. Det finns alltså inte bara ett neuronalt kolinergt system i tarmen utan också ett icke-neuronalt sådant system. Det sker en del förändringar i detta vid UC.
• Ett huvudbudskap är att fynden talar för att det, mer än vad man förut trott, sker en lokal produktion av SP, VIP och acetylkolin i mukosan i tarmen. Detta kan ha en viktig betydelse vid UC.
48 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon Tack Den här doktorsavhandlingen utgår huvudsakligen från avdelningen för Anatomi och har genomförts i samarbete med avdelningen för Kirurgi. Jag vill tacka alla som på olika sätt varit till hjälp under dessa år.
Sture Forsgren, min huvudhandledare. Jag tror inte att det är särskilt många doktorander som fått uppleva en sådan engagerad handledare. Din dörr har alltid stått öppen och du har aldrig funnits mer än ett telefonsamtal bort. Lämnar jag ett manuskript för synpunkter innan jag går hem på eftermiddagen så ligger det på min stol följande morgon, med kommentarer. Tack Sture, för ditt engagemang!
Örjan Norrgård, min bihandledare. Utan dig hade jag inte haft något tarmmaterial att forska på. Tack också för att du har delat med dig av värdefulla kunskaper om den kliniska delen.
Alla patienter som donerat tarm och blod till forskningen. Även de friska kontrollpersoner som lät oss få lite blod. Tack också till Karin Forsgren för hjälpen med blodtappningen.
Alla på avdelningen för Anatomi. Särskilt för alla trevliga fredagsfikastunder.
Ulla Hedlund, för att du alltid delar med dig av tips och tricks, protokoll, och framförallt din erfarenhet, samt att du alltid funnits för uppmuntrande peppning. Lena Jonsson, som fanns som hjälp under mitt första år på lab.
Sekreterarna Anna-Lena Tallander och Anita Dreyer-Perkiömäki för administrativ hjälp. Anna-Lena, ingen kan göra lika innovativa tipspromenader som du kan.
Tomas Carlsson, för att du gjorde ett skräddarsytt program åt mig så att jag kunde räkna ytor och celler. Göran Dahlgren, för att du hjälpte mig de gånger min Mac inte ville bete sig som en PC.
Magnus Hansson för medförfattarskap.
Mina kollegor som jag har delat rum med under dessa år. Ola, vi tyckte inte alltid lika men vi har lärt oss mycket genom olikheterna. Gustav, att räkna celler räknas tydligen inte som tics. Tack för fina illustrationer, även om alla inte gick att publicera… Patrik, Dennis, Johan, Alex, Hanna, Berit, Elisabeth, Solveig… jag har väl inte glömt någon nu?
49 Maria Jönsson, 2009
Malin Johansson, min kollega, rumskamrat, förlossningskamrat och framförallt vän. Tack för alla skratt, särskilt på hotell Zara i Neapel.
Både forskande och icke-forskande vänner, som berikar livet.
Mamma och pappa, för att ni alltid trott på mig och alltid ställt upp, vad det än är. Elin, min härliga syster.
Peter, min sambo, som alltid kan få mig att se saker ur en ny vinkel. För att du förstår, och för att vi är vi.
Mina älskade barn, Hugo och Adam. Min inspiration. För att ni inte är förstående inför forskningen, så att jag går hem i tid varje dag. Ni är bäst i hela världen!
50 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon References
1. Gartner L, Hiatt J. Color textbook of Histology. 1997:332-336
2. Langley J. The autonomic nervous system. London: Heffner. 1921
3. Trendelenburg P. Physiologishe und pharmakologische Versuche über die Dünndarmperistaltik. Arch exp Path Pharmak. 1917;81:55-129
4. Altaf MA, Sood MR. The nervous system and gastrointestinal function. Dev Disabil Res Rev. 2008;14:87-95
5. Ben-Horin S, Chowers Y. Neuroimmunology of the gut: physiology, pathology, and pharmacology. Curr Opin Pharmacol. 2008;8:490-495
6. Furness JB, Costa M. Types of nerves in the enteric nervous system. Neuroscience. 1980;5:1-20
7. Ekblad E, Winther C, Ekman R, et al. Projections of peptide-containing neurons in rat small intestine. Neuroscience. 1987;20:169-188
8. Furness JB. Types of neurons in the enteric nervous system. J Auton Nerv Syst. 2000;81:87-96
9. Ekblad E, Bauer AJ. Role of vasoactive intestinal peptide and inflammatory mediators in enteric neuronal plasticity. Neurogastroenterol Motil. 2004;16 Suppl 1:123-128
10. Goyal RK, Hirano I. The enteric nervous system. N Engl J Med. 1996;334:1106-1115
11. Furness JB, Kunze WA, Bertrand PP, et al. Intrinsic primary afferent neurons of the intestine. Prog Neurobiol. 1998;54:1-18
12. Holzer P. Role of visceral afferent neurons in mucosal inflammation and defense. Curr Opin Pharmacol. 2007;7:563-569
13. Burnstock G, Campbell G, Bennett M, et al. Innervation of the Guinea-Pig Taenia Coli: Are There Intrinsic Inhibitory Nerves Which Are Distinct from Sympathetic Nerves? Int J Neuropharmacol. 1964;3:163-166
14. Eiden LE. The cholinergic gene locus. J Neurochem. 1998;70:2227-2240
15. Wessler I, Kilbinger H, Bittinger F, et al. The non-neuronal cholinergic system in humans: expression, function and pathophysiology. Life Sci. 2003;72:2055-2061
16. Nickel WF, Jr., Gordon GM, Andrus WD. Studies on several cholinergic drugs as possible etiologic agents in ulcerative colitis. Gastroenterology. 1953;24:556-559
17. Czura CJ, Tracey KJ. Autonomic neural regulation of immunity. J Intern Med. 2005;257:156-166
18. de Jonge WJ, van der Zanden EP, The FO, et al. Stimulation of the vagus nerve attenuates macrophage activation by activating the Jak2-STAT3 signaling pathway. Nat Immunol. 2005;6:844-851
19. Tracey KJ. The inflammatory reflex. Nature. 2002;420:853-859
51 Maria Jönsson, 2009
20. Wessler I, Reinheimer T, Kilbinger H, et al. Increased acetylcholine levels in skin biopsies of patients with atopic dermatitis. Life Sci. 2003;72:2169-2172
21. Kawashima K, Fujii T. Extraneuronal cholinergic system in lymphocytes. Pharmacol Ther. 2000;86:29-48
22. Kirkpatrick CJ, Bittinger F, Unger RE, et al. The non-neuronal cholinergic system in the endothelium: evidence and possible pathobiological significance. Jpn J Pharmacol. 2001;85:24-28
23. Wessler I, Kirkpatrick CJ, Racke K. Non-neuronal acetylcholine, a locally acting molecule, widely distributed in biological systems: expression and function in humans. Pharmacol Ther. 1998;77:59-79
24. Kawashima K, Fujii T. The lymphocytic cholinergic system and its contribution to the regulation of immune activity. Life Sci. 2003;74:675-696
25. Ratcliffe EM, deSa DJ, Dixon MF, et al. Choline acetyltransferase (ChAT) immunoreactivity in paraffin sections of normal and diseased intestines. J Histochem Cytochem. 1998;46:1223-1231
26. Klapproth H, Reinheimer T, Metzen J, et al. Non-neuronal acetylcholine, a signalling molecule synthezised by surface cells of rat and man. Naunyn Schmiedebergs Arch Pharmacol. 1997;355:515-523
27. Eglen RM. Muscarinic receptor subtypes in neuronal and non-neuronal cholinergic function. Auton Autacoid Pharmacol. 2006;26:219-233
28. Mayerhofer A, Fritz S. Ovarian acetylcholine and muscarinic receptors: hints of a novel intrinsic ovarian regulatory system. Microsc Res Tech. 2002;59:503-508
29. Metzen J, Bittinger F, Kirkpatrick CJ, et al. Proliferative effect of acetylcholine on rat trachea epithelial cells is mediated by nicotinic receptors and muscarinic receptors of the M1-subtype. Life Sci. 2003;72:2075-2080
30. Iino S, Nojyo Y. Muscarinic M(2) acetylcholine receptor distribution in the guinea-pig gastrointestinal tract. Neuroscience. 2006;138:549-559
31. Hokfelt T, Broberger C, Xu ZQ, et al. Neuropeptides--an overview. Neuropharmacology. 2000;39:1337-1356
32. Ubink R, Calza L, Hokfelt T. 'Neuro'-peptides in glia: focus on NPY and galanin. Trends Neurosci. 2003;26:604-609
33. Watanabe M, Nakayasu K, Iwatsu M, et al. Endogenous substance P in corneal epithelial cells and keratocytes. Jpn J Ophthalmol. 2002;46:616-620
34. Petit T, Davidson KK, Lawrence RA, et al. Neuropeptide receptor status in human tumor cell lines. Anticancer Drugs. 2001;12:133-136
35. von Euler U, Gaddum J. An unidentified depressor substance in certain tissue extracts. J Physiol (London). 1931;72:74-87
36. Foreman JC. Peptides and neurogenic inflammation. Br Med Bull. 1987;43:386-400
52 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
37. Gamse R, Posch M, Saria A, et al. Several mediators appear to interact in neurogenic inflammation. Acta Physiol Hung. 1987;69:343-354
38. Gross KJ, Pothoulakis C. Role of neuropeptides in inflammatory bowel disease. Inflamm Bowel Dis. 2007;13:918-932
39. Collins SM. The immunomodulation of enteric neuromuscular function: implications for motility and inflammatory disorders. Gastroenterology. 1996;111:1683-1699
40. Holzer P, Holzer-Petsche U. Tachykinins in the gut. Part II. Roles in neural excitation, secretion and inflammation. Pharmacol Ther. 1997;73:219-263
41. Riegler M, Castagliuolo I, So PT, et al. Effects of substance P on human colonic mucosa in vitro. Am J Physiol. 1999;276:G1473-1483
42. Bartho L, Holzer P. Search for a physiological role of substance P in gastrointestinal motility. Neuroscience. 1985;16:1-32
43. Goll R, Poulsen JH, Schmidt P, et al. Peptide-evoked release of amylase from isolated acini of the rat parotid gland. Regul Pept. 1994;51:237-254
44. Fan TP, Hu DE, Guard S, et al. Stimulation of angiogenesis by substance P and interleukin-1 in the rat and its inhibition by NK1 or interleukin-1 receptor antagonists. Br J Pharmacol. 1993;110:43-49
45. Luger TA, Lotti T. Neuropeptides: role in inflammatory skin diseases. J Eur Acad Dermatol Venereol. 1998;10:207-211
46. Herrstedt J. New perspectives in antiemetic treatment. Support Care Cancer. 1996;4:416-419
47. Brodin E, Sjolund K, Hakanson R, et al. Substance P-containing nerve fibers are numerous in human but not in feline intestinal mucosa. Gastroenterology. 1983;85:557- 564
48. Chiwakata C, Brackmann B, Hunt N, et al. Tachykinin (substance-P) gene expression in Leydig cells of the human and mouse testis. Endocrinology. 1991;128:2441-2448
49. Metwali A, Blum AM, Ferraris L, et al. Eosinophils within the healthy or inflamed human intestine produce substance P and vasoactive intestinal peptide. J Neuroimmunol. 1994;52:69-78
50. Pascual DW, Bost KL. Substance P production by P388D1 macrophages: a possible autocrine function for this neuropeptide. Immunology. 1990;71:52-56
51. Qian BF, Zhou GQ, Hammarstrom ML, et al. Both substance P and its receptor are expressed in mouse intestinal T lymphocytes. Neuroendocrinology. 2001;73:358-368
52. Nakanishi S. Mammalian tachykinin receptors. Annu Rev Neurosci. 1991;14:123-136
53. Regoli D, Nantel F. Pharmacology of neurokinin receptors. Biopolymers. 1991;31:777- 783
54. Hershey AD, Krause JE. Molecular characterization of a functional cDNA encoding the rat substance P receptor. Science. 1990;247:958-962
53 Maria Jönsson, 2009
55. O'Connor TM, O'Connell J, O'Brien DI, et al. The role of substance P in inflammatory disease. J Cell Physiol. 2004;201:167-180
56. Said SI, Mutt V. Polypeptide with broad biological activity: isolation from small intestine. Science. 1970;169:1217-1218
57. Lundberg JM, Anggard A, Fahrenkrug J, et al. Vasoactive intestinal polypeptide in cholinergic neurons of exocrine glands: functional significance of coexisting transmitters for vasodilation and secretion. Proc Natl Acad Sci U S A. 1980;77:1651-1655
58. Domeij S, Dahlqvist A, Forsgren S. Studies on colocalization of neuropeptide Y, vasoactive intestinal polypeptide, catecholamine-synthesizing enzymes and acetylcholinesterase in the larynx of the rat. Cell Tissue Res. 1991;263:495-505
59. Kim WK, Kan Y, Ganea D, et al. Vasoactive intestinal peptide and pituitary adenylyl cyclase-activating polypeptide inhibit tumor necrosis factor-alpha production in injured spinal cord and in activated microglia via a cAMP-dependent pathway. J Neurosci. 2000;20:3622-3630
60. Grider JR, Jin JG. Vasoactive intestinal peptide release and L-citrulline production from isolated ganglia of the myenteric plexus: evidence for regulation of vasoactive intestinal peptide release by nitric oxide. Neuroscience. 1993;54:521-526
61. Polak JM, Bloom SR. The neuroendocrine design of the gut. Clin Endocrinol Metab. 1979;8:313-330
62. Gressens P, Hill JM, Gozes I, et al. Growth factor function of vasoactive intestinal peptide in whole cultured mouse embryos. Nature. 1993;362:155-158
63. Gozes I, Brenneman DE. Neuropeptides as growth and differentiation factors in general and VIP in particular. J Mol Neurosci. 1993;4:1-9
64. Pozo D, Delgado M. The many faces of VIP in neuroimmunology: a cytokine rather a neuropeptide? FASEB J. 2004;18:1325-1334
65. Delgado M. VIP: a very important peptide in T helper differentiation. Trends Immunol. 2003;24:221-224
66. Todorovic V, Janic B, Koko V, et al. Colonic vasoactive intestinal polypeptide (VIP) in ulcerative colitis--a radioimmunoassay and immunohistochemical study. Hepatogastroenterology. 1996;43:483-488
67. Harmar AJ, Arimura A, Gozes I, et al. International Union of Pharmacology. XVIII. Nomenclature of receptors for vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide. Pharmacol Rev. 1998;50:265-270
68. Laburthe M, Couvineau A, Tan V. Class II G protein-coupled receptors for VIP and PACAP: structure, models of activation and pharmacology. Peptides. 2007;28:1631-1639
69. Schulz S, Rocken C, Mawrin C, et al. Immunocytochemical identification of VPAC1, VPAC2, and PAC1 receptors in normal and neoplastic human tissues with subtype- specific antibodies. Clin Cancer Res. 2004;10:8235-8242
54 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
70. Willard AL. A vasoactive intestinal peptide-like cotransmitter at cholinergic synapses between rat myenteric neurons in cell culture. J Neurosci. 1990;10:1025-1034
71. Holzer P. Tachykinins as targets of gastroenterological pharmacotherapy. Drug News Perspect. 1998;11:394-401
72. Yamamoto H, Kuwahara A, Fujimura M, et al. Motor activity of vascularly perfused rat duodenum. 2. Effects of VIP, PACAP27 and PACAP38. Neurogastroenterol Motil. 1999;11:235-241
73. Harrington AM, Hutson JM, Southwell BR. Immunohistochemical localization of substance P NK1 receptor in guinea pig distal colon. Neurogastroenterol Motil. 2005;17:727-737
74. Harrington AM, Hutson JM, Southwell BR. Immunohistochemical localisation of pre- synaptic muscarinic receptor subtype-2 (M2r) in the enteric nervous system of guinea- pig ileum. Cell Tissue Res. 2008;332:37-48
75. Juaneda C, Dumont Y, Quirion R. The molecular pharmacology of CGRP and related peptide receptor subtypes. Trends Pharmacol Sci. 2000;21:432-438
76. Gibbins IL, Furness JB, Costa M, et al. Co-localization of calcitonin gene-related peptide-like immunoreactivity with substance P in cutaneous, vascular and visceral sensory neurons of guinea pigs. Neurosci Lett. 1985;57:125-130
77. Ekblad E, Håkanson R, Sundler F. Microanatomy and chemical coding of peptide- containing neurons in the digestive tract. . In: Daniel E, ed. Neuropeptide function in the gastrointestinal tract: CRC Press, Boca Raton, Florida; 1991:131-179
78. Holzer P. Local effector functions of capsaicin-sensitive sensory nerve endings: involvement of tachykinins, calcitonin gene-related peptide and other neuropeptides. Neuroscience. 1988;24:739-768
79. Holzer P, Bartho L, Matusak O, et al. Calcitonin gene-related peptide action on intestinal circular muscle. Am J Physiol. 1989;256:G546-552
80. Al-Haddad S, Riddell RH. The role of eosinophils in inflammatory bowel disease. Gut. 2005;54:1674-1675
81. Wedemeyer J, Vosskuhl K. Role of gastrointestinal eosinophils in inflammatory bowel disease and intestinal tumours. Best Pract Res Clin Gastroenterol. 2008;22:537-549
82. Weller PF. The immunobiology of eosinophils. N Engl J Med. 1991;324:1110-1118
83. Lampinen M, Ronnblom A, Amin K, et al. Eosinophil granulocytes are activated during the remission phase of ulcerative colitis. Gut. 2005;54:1714-1720
84. Raab Y, Fredens K, Gerdin B, et al. Eosinophil activation in ulcerative colitis: studies on mucosal release and localization of eosinophil granule constituents. Dig Dis Sci. 1998;43:1061-1070
85. Bischoff SC, Wedemeyer J, Herrmann A, et al. Quantitative assessment of intestinal eosinophils and mast cells in inflammatory bowel disease. Histopathology. 1996;28:1-13
55 Maria Jönsson, 2009
86. Lampinen M, Carlson M, Hakansson LD, et al. Cytokine-regulated accumulation of eosinophils in inflammatory disease. Allergy. 2004;59:793-805
87. Wiedermann FJ, Kahler CM, Reinisch N, et al. Induction of normal human eosinophil migration in vitro by substance P. Acta Haematol. 1993;89:213-215
88. Numao T, Agrawal DK. Neuropeptides modulate human eosinophil chemotaxis. J Immunol. 1992;149:3309-3315
89. Dunzendorfer S, Meierhofer C, Wiedermann CJ. Signaling in neuropeptide-induced migration of human eosinophils. J Leukoc Biol. 1998;64:828-834
90. Kroegel C, Giembycz MA, Barnes PJ. Characterization of eosinophil cell activation by peptides. Differential effects of substance P, melittin, and FMET-Leu-Phe. J Immunol. 1990;145:2581-2587
91. Crohn B, L G, GD O. Regional ileitis. A pathological and clinical entity. JAMA. 1932;99:1323-1329
92. Odze R. Diagnostic problems and advances in inflammatory bowel disease. Mod Pathol. 2003;16:347-358
93. Russell RK, Satsangi J. IBD: a family affair. Best Pract Res Clin Gastroenterol. 2004;18:525-539
94. Roth MP, Petersen GM, McElree C, et al. Geographic origins of Jewish patients with inflammatory bowel disease. Gastroenterology. 1989;97:900-904
95. Ehlin AG, Montgomery SM, Ekbom A, et al. Prevalence of gastrointestinal diseases in two British national birth cohorts. Gut. 2003;52:1117-1121
96. Bernstein CN, Blanchard JF, Rawsthorne P, et al. Epidemiology of Crohn's disease and ulcerative colitis in a central Canadian province: a population-based study. Am J Epidemiol. 1999;149:916-924
97. Molinie F, Gower-Rousseau C, Yzet T, et al. Opposite evolution in incidence of Crohn's disease and ulcerative colitis in Northern France (1988-1999). Gut. 2004;53:843-848
98. Heyman MB, Kirschner BS, Gold BD, et al. Children with early-onset inflammatory bowel disease (IBD): analysis of a pediatric IBD consortium registry. J Pediatr. 2005;146:35-40
99. Li J, Norgard B, Precht DH, et al. Psychological stress and inflammatory bowel disease: a follow-up study in parents who lost a child in Denmark. Am J Gastroenterol. 2004;99:1129-1133
100. Hollander D. Inflammatory bowel diseases and brain-gut axis. J Physiol Pharmacol. 2003;54 Suppl 4:183-190
101. Bohr UR, Glasbrenner B, Primus A, et al. Identification of enterohepatic Helicobacter species in patients suffering from inflammatory bowel disease. J Clin Microbiol. 2004;42:2766-2768
56 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
102. Klement E, Cohen RV, Boxman J, et al. Breastfeeding and risk of inflammatory bowel disease: a systematic review with meta-analysis. Am J Clin Nutr. 2004;80:1342-1352
103. Calkins BM. A meta-analysis of the role of smoking in inflammatory bowel disease. Dig Dis Sci. 1989;34:1841-1854
104. Andersson RE, Olaison G, Tysk C, et al. Appendectomy and protection against ulcerative colitis. N Engl J Med. 2001;344:808-814
105. Solberg C, Lygren I, Jahnsen J, et al. Clinical course during the first 10 years of ulcerative colitis: results from a population-based inception cohort (IBSEN Study). Scand J Gastroenterol. 2008;19:1-10
106. Lindberg J. Ulcerative colitis. Colorectal cancer risk and surveillance in an unselected population. . Umeå University Medical Dissertations. 2007
107. Bernstein CN, Blanchard JF, Kliewer E, et al. Cancer risk in patients with inflammatory bowel disease: a population-based study. Cancer. 2001;91:854-862
108. Le Berre N, Heresbach D, Kerbaol M, et al. Histological discrimination of idiopathic inflammatory bowel disease from other types of colitis. J Clin Pathol. 1995;48:749-753
109. Kimura M, Masuda T, Hiwatashi N, et al. Changes in neuropeptide-containing nerves in human colonic mucosa with inflammatory bowel disease. Pathol Int. 1994;44:624-634
110. Renzi D, Mantellini P, Calabro A, et al. Substance P and vasoactive intestinal polypeptide but not calcitonin gene-related peptide concentrations are reduced in patients with moderate and severe ulcerative colitis. Ital J Gastroenterol Hepatol. 1998;30:62-70
111. Keranen U, Kiviluoto T, Jarvinen H, et al. Changes in substance P-immunoreactive innervation of human colon associated with ulcerative colitis. Dig Dis Sci. 1995;40:2250- 2258
112. Mazumdar S, Das KM. Immunocytochemical localization of vasoactive intestinal peptide and substance P in the colon from normal subjects and patients with inflammatory bowel disease. Am J Gastroenterol. 1992;87:176-181
113. Lee CM, Kumar RK, Lubowski DZ, et al. Neuropeptides and nerve growth in inflammatory bowel diseases: a quantitative immunohistochemical study. Dig Dis Sci. 2002;47:495-502
114. Rudholm T, Wallin B, Theodorsson E, et al. Release of regulatory gut peptides somatostatin, neurotensin and vasoactive intestinal peptide by acid and hyperosmolal solutions in the intestine in conscious rats. Regul Pept. 2009;152:8-12
115. Reinecke M, Muller C, Segner H. An immunohistochemical analysis of the ontogeny, distribution and coexistence of 12 regulatory peptides and serotonin in endocrine cells and nerve fibers of the digestive tract of the turbot, Scophthalmus maximus (Teleostei). Anat Embryol (Berl). 1997;195:87-101
116. Maake C, Kloas W, Szendefi M, et al. Neurohormonal peptides, serotonin, and nitric oxide synthase in the enteric nervous system and endocrine cells of the gastrointestinal
57 Maria Jönsson, 2009
tract of neotenic and thyroid hormone-treated axolotls (Ambystoma mexicanum). Cell Tissue Res. 1999;297:91-101
117. Holmgren S, Vaillant C, Dimaline R. VIP-, substance P-, gastrin/CCK-, bombesin-, somatostatin- and glucagon-like immunoreactivities in the gut of the rainbow trout, Salmo gairdneri. Cell Tissue Res. 1982;223:141-153
118. Lolova IS, Davidoff MS, Itzev DE. Histological and immunocytochemical data on the differentiation of intestinal endocrine cells in human fetus. Acta Physiol Pharmacol Bulg. 1998;23:61-71
119. Chalastras T, Nicolopoulou-Stamati P, Patsouris E, et al. Expression of substance P, vasoactive intestinal peptide and heat shock protein 70 in nasal mucosal smears of patients with allergic rhinitis: investigation using a liquid-based method. J Laryngol Otol. 2008;122:700-706
120. Duffy LC, Zielezny MA, Riepenhoff-Talty M, et al. Vasoactive intestinal peptide as a laboratory supplement to clinical activity index in inflammatory bowel disease. Dig Dis Sci. 1989;34:1528-1535
121. Goode T, O'Connell J, Anton P, et al. Neurokinin-1 receptor expression in inflammatory bowel disease: molecular quantitation and localisation. Gut. 2000;47:387-396
122. Renzi D, Pellegrini B, Tonelli F, et al. Substance P (neurokinin-1) and neurokinin A (neurokinin-2) receptor gene and protein expression in the healthy and inflamed human intestine. Am J Pathol. 2000;157:1511-1522
123. Jacobi J, Jang JJ, Sundram U, et al. Nicotine accelerates angiogenesis and wound healing in genetically diabetic mice. Am J Pathol. 2002;161:97-104
124. Hansson M, Forsgren S. Immunoreactive atrial and brain natriuretic peptides are co- localized in Purkinje fibres but not in the innervation of the bovine heart conduction system. Histochem J. 1995;27:222-230
125. Panoskaltsis-Mortari A, Bucy RP. In situ hybridization with digoxigenin-labeled RNA probes: facts and artifacts. Biotechniques. 1995;18:300-307
126. Reubi JC, Waser B, Schmassmann A, et al. Receptor autoradiographic evaluation of cholecystokinin, neurotensin, somatostatin and vasoactive intestinal peptide receptors in gastro-intestinal adenocarcinoma samples: where are they really located? Int J Cancer. 1999;81:376-386
127. Grubor B, Ramirez-Romero R, Gallup JM, et al. Distribution of substance P receptor (neurokinin-1 receptor) in normal ovine lung and during the progression of bronchopneumonia in sheep. J Histochem Cytochem. 2004;52:123-130
128. Kido MA, Yamaza T, Goto T, et al. Immunocytochemical localization of substance P neurokinin-1 receptors in rat gingival tissue. Cell Tissue Res. 1999;297:213-222
129. Bandari PS, Qian J, Yehia G, et al. Differences in the expression of neurokinin receptor in neural and bone marrow mesenchymal cells: implications for neuronal expansion from bone marrow cells. Neuropeptides. 2002;36:13-21
58 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
130. Baker SJ, Morris JL, Gibbins IL. Cloning of a C-terminally truncated NK-1 receptor from guinea-pig nervous system. Brain Res Mol Brain Res. 2003;111:136-147
131. Yip L, Kwok YN, Buchan AM. Cellular localization and distribution of neurokinin-1 receptors in the rat stomach. Auton Neurosci. 2003;104:95-108
132. Kurtz MM, Wang R, Clements MK, et al. Identification, localization and receptor characterization of novel mammalian substance P-like peptides. Gene. 2002;296:205- 212
133. Page NM, Bell NJ, Gardiner SM, et al. Characterization of the endokinins: human tachykinins with cardiovascular activity. Proc Natl Acad Sci U S A. 2003;100:6245-6250
134. Forsgren S, Hockerfelt U, Norrgard O, et al. Pronounced substance P innervation in irradiation-induced enteropathy--a study on human colon. Regul Pept. 2000;88:1-13
135. Keranen U, Jarvinen H, Karkkainen P, et al. Substance P--an underlying factor for pouchitis? Prospective study of substance P- and vasoactive intestinal polypeptide- immunoreactive innervation and mast cells. Dig Dis Sci. 1996;41:1665-1671
136. Lai JP, Douglas SD, Ho WZ. Mimic-based RT-PCR quantitation of substance P mRNA in human mononuclear phagocytes and lymphocytes. Methods Mol Biol. 2002;193:129-147
137. Alberts B, Bray D, Lewis J, et al. In: al. BAe, ed. Molecular biology of the cell: Garland Publishing; 1994:403
138. Ho WZ, Lai JP, Zhu XH, et al. Human monocytes and macrophages express substance P and neurokinin-1 receptor. J Immunol. 1997;159:5654-5660
139. Pothoulakis C, Castagliuolo I, Leeman SE, et al. Substance P receptor expression in intestinal epithelium in clostridium difficile toxin A enteritis in rats. Am J Physiol. 1998;275:G68-75
140. Baluk P, Bertrand C, Geppetti P, et al. NK1 receptors mediate leukocyte adhesion in neurogenic inflammation in the rat trachea. Am J Physiol. 1995;268:L263-269
141. Teramoto S, Tanaka H, Kaneko S, et al. Neurokinin-1 and neurokinin-2 antagonism inhibits long-term acid fog-induced airway hyperresponsiveness. Chest. 2003;123:524- 529
142. Cao T, Pinter E, Al-Rashed S, et al. Neurokinin-1 receptor agonists are involved in mediating neutrophil accumulation in the inflamed, but not normal, cutaneous microvasculature: an in vivo study using neurokinin-1 receptor knockout mice. J Immunol. 2000;164:5424-5429
143. Hockerfelt U, Henriksson R, Franzen L, et al. Irradiation induces marked immunohistochemical expression of vasoactive intestinal peptide in colonic mucosa of man. Dig Dis Sci. 1999;44:393-401
144. Belai A, Boulos PB, Robson T, et al. Neurochemical coding in the small intestine of patients with Crohn's disease. Gut. 1997;40:767-774
145. Simopoulos C, Gaffen JD, Bennett A. Effects of gastrointestinal hormones on the growth of human intestinal epithelial cells in vitro. Gut. 1989;30:600-604
59 Maria Jönsson, 2009
146. Toumi F, Neunlist M, Denis MG, et al. Vasoactive intestinal peptide induces IL-8 production in human colonic epithelial cells via MAP kinase-dependent and PKA- independent pathways. Biochem Biophys Res Commun. 2004;317:187-191
147. Goral V, Celenk T, Kaplan A, et al. Plasma cytokine levels in ulcerative colitis. Hepatogastroenterology. 2007;54:1130-1133
148. Vermeire S, Van Assche G, Rutgeerts P. C-reactive protein as a marker for inflammatory bowel disease. Inflamm Bowel Dis. 2004;10:661-665
149. Fagan EA, Dyck RF, Maton PN, et al. Serum levels of C-reactive protein in Crohn's disease and ulcerative colitis. Eur J Clin Invest. 1982;12:351-359
150. Duerr RH, Targan SR, Landers CJ, et al. Anti-neutrophil cytoplasmic antibodies in ulcerative colitis. Comparison with other colitides/diarrheal illnesses. Gastroenterology. 1991;100:1590-1596
151. Roseth AG, Aadland E, Jahnsen J, et al. Assessment of disease activity in ulcerative colitis by faecal calprotectin, a novel granulocyte marker protein. Digestion. 1997;58:176-180
152. Schneider J, Jehle EC, Starlinger MJ, et al. Neurotransmitter coding of enteric neurones in the submucous plexus is changed in non-inflamed rectum of patients with Crohn's disease. Neurogastroenterol Motil. 2001;13:255-264
153. Porter AJ, Wattchow DA, Brookes SJ, et al. The neurochemical coding and projections of circular muscle motor neurons in the human colon. Gastroenterology. 1997;113:1916- 1923
154. Neunlist M, Aubert P, Toquet C, et al. Changes in chemical coding of myenteric neurones in ulcerative colitis. Gut. 2003;52:84-90
155. Fujii T, Takada-Takatori Y, Kawashima K. Basic and clinical aspects of non-neuronal acetylcholine: expression of an independent, non-neuronal cholinergic system in lymphocytes and its clinical significance in immunotherapy. J Pharmacol Sci. 2008;106:186-192
156. Borovikova LV, Ivanova S, Zhang M, et al. Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Nature. 2000;405:458-462
157. Abad C, Martinez C, Juarranz MG, et al. Therapeutic effects of vasoactive intestinal peptide in the trinitrobenzene sulfonic acid mice model of Crohn's disease. Gastroenterology. 2003;124:961-971
158. Gonzalez-Rey E, Delgado M. Therapeutic treatment of experimental colitis with regulatory dendritic cells generated with vasoactive intestinal peptide. Gastroenterology. 2006;131:1799-1811
159. Rijnierse A, van Zijl KM, Koster AS, et al. Beneficial effect of tachykinin NK1 receptor antagonism in the development of hapten-induced colitis in mice. Eur J Pharmacol. 2006;548:150-157
60 Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
160. Di Sebastiano P, Grossi L, Di Mola FF, et al. SR140333, a substance P receptor antagonist, influences morphological and motor changes in rat experimental colitis. Dig Dis Sci. 1999;44:439-444
161. Pothoulakis C, Castagliuolo I, LaMont JT, et al. CP-96,345, a substance P antagonist, inhibits rat intestinal responses to Clostridium difficile toxin A but not cholera toxin. Proc Natl Acad Sci U S A. 1994;91:947-951
162. Gonzalez-Rey E, Fernandez-Martin A, Chorny A, et al. Therapeutic effect of vasoactive intestinal peptide on experimental autoimmune encephalomyelitis: down-regulation of inflammatory and autoimmune responses. Am J Pathol. 2006;168:1179-1188
163. Newman R, Cuan N, Hampartzoumian T, et al. Vasoactive intestinal peptide impairs leucocyte migration but fails to modify experimental murine colitis. Clin Exp Immunol. 2005;139:411-420
164. Gomariz RP, Juarranz Y, Abad C, et al. VIP-PACAP system in immunity: new insights for multitarget therapy. Ann N Y Acad Sci. 2006;1070:51-74
165. Keeble JE, Brain SD. A role for substance P in arthritis? Neurosci Lett. 2004;361:176- 179
166. Sands BE. Why do anti-tumor necrosis factor antibodies work in Crohn's disease? Rev Gastroenterol Disord. 2004;4 Suppl 3:S10-17
167. Rutgeerts P, Sandborn WJ, Feagan BG, et al. Infliximab for induction and maintenance therapy for ulcerative colitis. N Engl J Med. 2005;353:2462-2476
168. Kohn A, Prantera C, Pera A, et al. Infliximab in the treatment of severe ulcerative colitis: a follow-up study. Eur Rev Med Pharmacol Sci. 2004;8:235-237
169. Jarnerot G, Hertervig E, Friis-Liby I, et al. Infliximab as rescue therapy in severe to moderately severe ulcerative colitis: a randomized, placebo-controlled study. Gastroenterology. 2005;128:1805-1811
170. Gahring LC, Rogers SW. Neuronal nicotinic acetylcholine receptor expression and function on nonneuronal cells. AAPS J. 2005;7:E885-894
171. Thomas GA, Rhodes J, Mani V, et al. Transdermal nicotine as maintenance therapy for ulcerative colitis. N Engl J Med. 1995;332:988-992
172. Maresca A, Supuran CT. Muscarinic acetylcholine receptors as therapeutic targets for obesity. Expert Opin Ther Targets. 2008;12:1167-1175
173. Fisher A. Cholinergic treatments with emphasis on m1 muscarinic agonists as potential disease-modifying agents for Alzheimer's disease. Neurotherapeutics. 2008;5:433-442
174. Scarr E, Dean B. Muscarinic receptors: do they have a role in the pathology and treatment of schizophrenia? J Neurochem. 2008;107:1188-1195
175. Hegde SS. Muscarinic receptors in the bladder: from basic research to therapeutics. Br J Pharmacol. 2006;147 Suppl 2:S80-87
61 Maria Jönsson, 2009
176. Paleari L, Grozio A, Cesario A, et al. The cholinergic system and cancer. Semin Cancer Biol. 2008;18:211-217
177. Hirota CL, McKay DM. M3 muscarinic receptor-deficient mice retain bethanechol- mediated intestinal ion transport and are more sensitive to colitis. Can J Physiol Pharmacol. 2006;84:1153-1161
62